DOCSLIB.ORG

Genetic Signature and Treatment of Pediatric High‑Grade Glioma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Signature and Treatment of Pediatric High‑Grade Glioma MOLECULAR AND CLINICAL ONCOLOGY 14: 70, 2021 Genetic signature and treatment of pediatric high‑grade glioma MILENA GUIDI1, LAURA GIUNTI2, ANNA MARIA BUCCOLIERO3, CHIARA CAPORALINI3, MARIA LUIGIA CENSULLO1, LUISA GALLI4, LORENZO GENITORI5 and IACOPO SARDI1 1Neuro‑Oncology Unit, Department of Pediatric Oncology, 2Medical Genetics Unit, 3Pathology Unit, Meyer Children's University Hospital; 4Department of Health Sciences, University of Florence, 5Neurosurgery Unit, Meyer Children's University Hospital, I‑50139 Florence, Italy Received January 7, 2020; Accepted November 13, 2020 DOI: 10.3892/mco.2021.2232 Abstract. Pediatric high‑grade glioma (HGG) is a type the H3F3A K27M mutation had a worse prognosis compared of malignancy that carries a poor prognosis. The genetic with wild‑type patients (P=0.0045). Moreover, 3/5 patients analysis of HGGs has previously identified useful mutations, with the BRAF V600E mutation had HGGs that were derived the targeting of which has improved prognosis. Thus, further from a previous low‑grade glioma (LGG; P=0.001). In conclu‑ research into the more common mutations, such as H3 histone sion, these results suggested that histone H3 mutations may variants (HIST1H3B and H3F3A) and BRAF V600E, may help predict the outcome in patients with HGG. In addition, be useful in identifying tumors with different prognoses, as the BRAF V600E mutation was found to be associated with the mutations are considered to drive two distinct oncogenic an increased risk of anaplastic progression. The novel data programs. The present study performed a retrospective anal‑ of the present study may help better define the clinical and ysis of pediatric HGGs. In total, 42 cases of HGG, including radiological characteristics of glioma. 32 cases (76.1%) of anaplastic astrocytoma and 10 cases (23.8%) of glioblastoma multiforme (GBM), were assessed. Introduction The median age of the patients was 7 years (range, 0‑32 years). Mutations on histone H3, in particular the K27M and G34R Anaplastic astrocytoma (AA) and glioblastoma (GBM) repre‑ mutations in the distinct variants HIST1H3B and H3F3A, sent ~20% of all central nervous system (CNS) tumors. These in addition to the presence of the BRAF V600E mutation, two brain tumor subtypes respond poorly to therapy and they were analyzed in 24 patients. The H3F3A K27M mutation are the most biologically aggressive malignancies and the prin‑ was identified in 7 patients (29.1%), while the HIST1H3B cipal cause of cancer‑related mortality and morbidity during K27M mutation was only observed in 1 patient with GBM. In childhood (1). Although the outcome of pediatric high‑grade addition, 5 patients harbored a BRAF V600E mutation (21%), gliomas (HGGs) is marginally superior to that of their adult while the H3F3A G34R mutation was not recorded in any of counterparts, it remains poor, despite aggressive treatment (2). the patients. The overall survival of the wild‑type patients The two main prognostic factors are the primary loca‑ at 20 months was 68% [confidence interval (CI): 38‑85%] tion and resectability. Currently, up to 85% of patients with compared with 28% (CI: 0.4‑60%) in patients with the H3F3A hemispheric GBM succumb to the disease within 2 years of K27M mutation. These results suggested that patients with diagnosis (3). The genetic alterations involved in the patho‑ genesis of pediatric HGGs, particularly the role of somatic driver mutations (K27M) in the histone H3 genes (H3F3 and H1ST1H3B), were previously investigated. Another mutation in H3F3A, G34R/V, has also been described, and appears to Correspondence to: Dr Iacopo Sardi, Neuro‑Oncology Unit, be more frequent among young adults (4). Department of Pediatric Oncology, Meyer Children's University The histone methyltransferases are responsible for the Hospital, 24 Viale Gaetano Pieraccini, I‑50139 Florence, Italy methylation of histone H3 at Lys27 and the K27M mutation E‑mail: [email protected] replaces lysine with methionine, while the G34V/R mutation in amino acid 34 initiates the replacement of glycine with Abbreviations: AA, anaplastic astrocytoma; CNS, central nervous system; DIPG, diffuse intrinsic pontine glioma; GBM, glioblastoma either valine or arginine (5). Histone proteins undergo modifi‑ multiforme; HDCT, high‑dose chemotherapy; HGG, high‑grade glioma; cations, such as acetylation, methylation and phosphorylation, LGG, low‑grade glioma; OS, overall survival; PFS, progression‑free which are mediated by writers (methyltransferases), erasers survival; SDCT, standard‑dose chemotherapy (demethylases) and readers (which recognize specific histone modifications). These mechanisms on histone tails are impor‑ Key words: glioblastoma, high‑grade glioma, histone 3, midline tant in facilitating gene transcription (6). It is well‑established glioma, oncology, pediatric, H3F3A K27M, BRAF V600E that the misregulation of histone lysine methylation is impli‑ cated in the occurrence and development of numerous types of cancer (4); however, the role of the K27M mutation in the development of glioma remains unclear. 2 GUIDI et al: MUTATIONS IN PEDIATRIC HIGH‑GRADE GLIOMAS Considering the clinical implications, H3.3K27M muta‑ Table I. Clinical characteristics of the patients. tions have been found to be associated with poor prognosis of pediatric HGGs, which appear to have diffuse growth Characteristics No. (%) patterns and a midline localization. This group is classified as diffuse midline glioma, H3K27M‑mutant, and includes Age, years previously defined entities, such as diffuse intrinsic pontine Median (range) 7 (0‑32) glioma (DIPG) (7). <3 10 Furthermore, the two main histone H3 variants have been >3 32 associated with distinct biological characteristics, thereby Sex driving different oncogenic programs. Tumors with mutated Female 20 (47.6) H1ST1H3B were found to be less aggressive and more respon‑ Male 22 (52.4) sive to radiotherapy and standard treatment. Histone H3F3A Tumor histology and HIST1H3B K27M mutations in HGGs help define the Anaplastic astrocytoma 32 (76.1) two subgroups of HGG, which exhibit different prognoses and Glioblastoma multiforme 10 (23.8) phenotypes (8). Mutations in patients aged >3 years (n=24) The BRAF V600E mutation is commonly present in xanthoastrocytomas and gangliogliomas, but it has also been H3F3A K27M 7 (29.1) described in diffuse astrocytoma and low‑grade glioma (LGG). H1ST1H3B K27M 1 (4.1) It was previously demonstrated that the presence of mutations H3F3A G34R 0 has diagnostic, prognostic and therapeutic potential. In fact, BRAF V600 E 5 (20.8) BRAF mutations may help differentiate benign from aggres‑ IDH 0 sive cancers; tumors with a BRAF V600E mutation were P53 0 strongly associated with an increased risk of progression and development of a secondary cancer with anaplastic evolution. Moreover, BRAF mutations were suggested as possible targets for the improved adjuvant treatment of residual or recurrent forward, GTCTCTGCAGGCAAGCTTTT and reverse, tumors (9); no patients with double‑mutant tumors (H3 and CAACTCGGTCGACTTTTGGT. BRAF) were identified. For the molecular analysis of the genes, the coding In the present study, the presence of mutations and their portions and the respective flanking regions were amplified by associations with clinical characteristics were compared in PCR. Once the systems were purified by capillary electropho‑ pediatric HGGs, with the aim to define the prognostic role of resis (CE), software analysis was performed. these mutations by comparing the genetic and clinical data with those reported in the existing literature. Statistical analysis. A Student's t‑test was used to compare the levels between the mutated and wild‑type tumors. The log‑rank Materials and methods (Mantel‑Cox) test was used to determine the association between the mutations and overall survival (OS). The patient Patient studies. A total of 42 patients with HGGs recruited outcome (OS) was analyzed using the following clinicopatholog‑ between January 2003 and January 2016 at the Meyer Children's ical and treatment‑related variables: Age, sex, tumor size, stage at University Hospital (Florence, Italy) were considered to be presentation, histological subtype and response to chemotherapy. eligible for inclusion in the present study. Histological diag‑ Survival was measured from the time of diagnosis to the date nosis and tumor grading were performed based on the 2016 of death or the date of the last follow‑up. Survival curves were World Health Organization criteria (10). The diagnoses were drawn using the Kaplan‑Meier product limit method. P<0.05 was confirmed following review by the CNS national panel of considered to indicate a statistically significant difference. pathologists. The study protocol was approved by the institu‑ tional ethics board and informed consent was obtained from Results the parents or legal guardians of all the patients. Patients and treatment. A total of 42 patients were enrolled in Genetic analysis. The majority of the analyses were performed the present study and their main clinicopathological character‑ following DNA extraction from fresh‑frozen tissues using istics are summarized in Table I. The median age at the time a specific protocol (Qiagen GmbH). The sequence analysis of diagnosis was 7 years (range, 0‑32 years), while 10 patients of the coding region of the gene was prepared using the were aged <3 years. All subjects were treated with chemo‑ BigDye Terminator v1.1 Cycle Sequencing kit (Applied therapy and/or radiotherapy according to the clinical studies of Biosystems;
Load more

Recommended publications
  • The Landscape of Somatic Mutations in Epigenetic Regulators Across 1,000 Paediatric Cancer Genomes
    ARTICLE Received 24 Sep 2013 | Accepted 12 Mar 2014 | Published 8 Apr 2014 DOI: 10.1038/ncomms4630 The landscape of somatic mutations in epigenetic regulators across 1,000 paediatric cancer genomes Robert Huether1,*, Li Dong2,*, Xiang Chen1, Gang Wu1, Matthew Parker1, Lei Wei1, Jing Ma2, Michael N. Edmonson1, Erin K. Hedlund1, Michael C. Rusch1, Sheila A. Shurtleff2, Heather L. Mulder3, Kristy Boggs3, Bhavin Vadordaria3, Jinjun Cheng2, Donald Yergeau3, Guangchun Song2, Jared Becksfort1, Gordon Lemmon1, Catherine Weber2, Zhongling Cai2, Jinjun Dang2, Michael Walsh4, Amanda L. Gedman2, Zachary Faber2, John Easton3, Tanja Gruber2,4, Richard W. Kriwacki5, Janet F. Partridge6, Li Ding7,8,9, Richard K. Wilson7,8,9, Elaine R. Mardis7,8,9, Charles G. Mullighan2, Richard J. Gilbertson10, Suzanne J. Baker10, Gerard Zambetti6, David W. Ellison2, Jinghui Zhang1 & James R. Downing2 Studies of paediatric cancers have shown a high frequency of mutation across epigenetic regulators. Here we sequence 633 genes, encoding the majority of known epigenetic regulatory proteins, in over 1,000 paediatric tumours to define the landscape of somatic mutations in epigenetic regulators in paediatric cancer. Our results demonstrate a marked variation in the frequency of gene mutations across 21 different paediatric cancer subtypes, with the highest frequency of mutations detected in high-grade gliomas, T-lineage acute lymphoblastic leukaemia and medulloblastoma, and a paucity of mutations in low-grade glioma and retinoblastoma. The most frequently mutated genes are H3F3A, PHF6, ATRX, KDM6A, SMARCA4, ASXL2, CREBBP, EZH2, MLL2, USP7, ASXL1, NSD2, SETD2, SMC1A and ZMYM3. We identify novel loss-of-function mutations in the ubiquitin-specific processing protease 7 (USP7) in paediatric leukaemia, which result in decreased deubiquitination activity.
    [Show full text]
  • M2139: Molecular Analysis for Gliomas
    Molecular Analysis for Gliomas Policy Number: AHS – M2139 – Molecular Analysis Prior Policy Name and Number, as applicable: for Gliomas • AHS – M2139 – Analysis of MGMT Promoter Methylation for Malignant Gliomas Initial Presentation Date: 06/16/2021 Revision Date: N/A I. Policy Description Glioma refers to tumors resulting from metaplastic transformation of glial tissue of the nervous system. Tumors have historically been classified by the retained histologic features of the three types of glial cells: astrocytes, oligodendrocytes, and ependymal cells. Tumors of each type can vary widely in aggressiveness, response to treatment, and prognosis (Louis, Schiff, & Batchelor, 2020). Molecular genetic features were added to histopathologic appearance in the current WHO classification to yield more biologically homogeneous and narrowly defined diagnostic entities for greater diagnostic accuracy, improved patient management, more accurate determinations of prognosis, and better treatment response (Louis et al., 2016). II. Related Policies Policy Number Policy Title AHS-M2109 Molecular Panel Testing of Cancers for Diagnosis, Prognosis, and Identification of Targeted Therapy III. Indications and/or Limitations of Coverage Application of coverage criteria is dependent upon an individual’s benefit coverage at the time of the request 1. MGMT promoter methylation testing IS MEDICALLY NECESSARY for prognosis of malignant gliomas. 2. IDH1 and IDH2 testing IS MEDICALLY NECESSARY for prognosis of malignant gliomas. M2139 Molecular Analysis for Gliomas Page 1 of 15 3. Testing for the co-deletion of 1p and 19q by either fluorescence in situ hybridization (FISH) or polymerase chain reaction (PCR) for the characterization of gliomas and/or to guide treatment decisions IS MEDICALLY NECESSARY. 4. ATRX mutation testing via EITHER immunohistochemistry OR gene sequencing IS MEDICALLY NECESSARY for the prognosis of malignant gliomas.
    [Show full text]
  • Somatic Histone H3 Alterations in Pediatric Diffuse Intrinsic Pontine
    BRIEF COMMUNICATIONS (c.83A>T) in H3F3A resulting in a substitution to methionine at lysine 27 Somatic histone H3 alterations in (p.Lys27Met) in the histone H3.3 protein (Supplementary Fig. 1). In the tumor from a fifth affected individual, an analogous adenine-to- pediatric diffuse intrinsic pontine thymine transversion (c.83A>T) encoding a p.Lys27Met alteration was gliomas and non-brainstem identified in the closely related HIST1H3B gene, which codes for the histone H3.1 isoform. glioblastomas To determine the frequency of mutations in the histone H3 gene family, we performed targeted sequencing of the exons encoding Lys27 in all 16 1,8 2,8 3,8 Gang Wu , Alberto Broniscer , Troy A McEachron , genes that code for histone H3 isoforms in a validation cohort comprising 4 3 5 5 Charles Lu , Barbara S Paugh , Jared Becksfort , Chunxu Qu , 43 DIPGs as well as 36 non-BS-PGs (see Supplementary Methods and 4 1 1 3 Li Ding , Robert Huether , Matthew Parker , Junyuan Zhang , Supplementary Tables 1 and 2). Including the original seven individuals 2 3 6 Amar Gajjar , Michael A Dyer , Charles G Mullighan , with DIPG analyzed by WGS, we found recurrent adenine-to-thymine 3 4 4 Richard J Gilbertson , Elaine R Mardis , Richard K Wilson , transversions encoding p.Lys27Met alterations in H3F3A or HIST1H3B in 6 6 1 James R Downing , David W Ellison , Jinghui Zhang & 78% of DIPGs and 22% of non-BS-PGs (Fig. 1 and Table 1). In addition, 3 Suzanne J Baker for the St. Jude Children’s Research Hospital– a new guanine-to-adenine transition resulting in a p.Gly34Arg alteration 7 Washington University Pediatric Cancer Genome Project in H3F3A was identified in 5 of 36 (14%) non-BS-PGs but not in any of the 50 DIPGs analyzed.
    [Show full text]
  • Product Data Sheet
    For research purposes only, not for human use Product Data Sheet Anti-Histone H3 (MonoMethyl K36) Antibody Catalog # Source Reactivity Applications CPA9358 Rabbit H, M, R WB, IH Description Rabbit polyclonal to Histone H3 (MonoMethyl K36) Immunogen KLH-conjugated synthetic peptide encompassing a sequence of human Histone H3. The exact sequence is proprietary. Purification The antibody was purified by affinity chromatography. Specificity Recognizes endogenous levels of Histone H3 (MonoMethyl K36) protein. Clonality Polyclonal Form Liquid in 0.42% Potassium phosphate, 0.87% Sodium chloride, pH 7.3, 30% glycerol, and 0.01% sodium azide. Dilution WB (1/200 - 1/500), IH (1/200 - 1/500) Gene Symbol HIST1H3A; HIST1H3B; HIST1H3C; HIST1H3D; HIST1H3E; HIST1H3F; HIST1H3G; HIST1H3H; HIST1H3I; HIST1H3J; HIST2H3A; HIST2H3C; HIST2H3D; H3F3A; H3F3B Alternative Names HIST1H3A; H3FA; HIST1H3B; H3FL; HIST1H3C; H3FC; HIST1H3D; H3FB; HIST1H3E; H3FD; HIST1H3F; H3FI; HIST1H3G; H3FH; HIST1H3H; H3FK; HIST1H3I; H3FF; HIST1H3J; H3FJ; Histone H3.1; Histone H3/a; Histone H3/b; Histone H3/c; Histone H3/d; Histone H3/f; Histone H3/ Entrez Gene 8350, 8351, 8352, 8353, 8354, 8355, 8356, 8357, 8358, 8968 (Human); 319152, 15077, 15078 (Mouse); 291159, 100361558 (Rat) SwissProt P68431, Q71DI3, P84243 (Human); P68433, P84228, P84244 (Mouse); Q6LED0, P84245 (Rat) Storage/Stability Shipped at 4°C. Upon delivery aliquot and store at -20°C for one year. Avoid freeze/thaw cycles. Application key: E- ELISA, WB- Western blot, IH- Immunohistochemistry, IF- Immunofluorescence, FC-
    [Show full text]
  • Clinical and Genomic Characteristics of Adult Diffuse Midline Glioma
    pISSN 1598-2998, eISSN 2005-9256 https://doi.org/10.4143/crt.2020.694 Cancer Res Treat. 2021;53(2):389-398 Original Article Clinical and Genomic Characteristics of Adult Diffuse Midline Glioma Changhee Park1, Tae Min Kim1,2, Jeong Mo Bae3, Hongseok Yun4, Jin Wook Kim5, Seung Hong Choi6, Soon-Tae Lee7, Joo Ho Lee8, Sung-Hye Park3, Chul-Kee Park5 1Department of Internal Medicine, Seoul National University Hospital, Seoul, 2Cancer Research Institute, Seoul National University, Seoul, 3Department of Pathology, Seoul National University Hospital, Seoul, 4Biomedical Research Institute, Seoul National University Hospital, Seoul, Departments of 5Neurosurgery, 6Radiology, 7Neurology, and 8Radiation Oncology, Seoul National University Hospital, Seoul, Korea Purpose The treatment outcomes and genomic profiles of diffuse midline glioma (DMG) in adult patients are rarely characterized. We performed a retrospective study to evaluate the clinicogenomic profiles of adult patients with brain DMG. Materials and Methods Patients aged ≥ 18 years diagnosed with brain DMG at Seoul National University Hospital were included. The clinicopathological parameters, treatment outcomes, survival, and genomic profiles using 82-gene targeted next-generation sequenc- ing (NGS) were analyzed. The 6-month progression-free survival (PFS6) after radiotherapy and overall survival (OS) were evaluated. Results Thirty-three patients with H3-mutant brain DMG were identified. The median OS from diagnosis was 21.8 months (95% confi- dence interval [CI], 13.2 to not available [NA]) and involvement of the ponto-medullary area tended to have poor OS (median OS, 20.4 months [95% CI, 9.3 to NA] vs. 43.6 months [95% CI, 18.2 to NA]; p=0.07).
    [Show full text]
  • Histone H3.1 (Human) Cell-Based ELISA Kit
    Histone H3.1 (Human) Cell-Based ELISA Kit Catalog # : KA2761 規格 : [ 1 Kit ] List All Specification Application Image Product Histone H3.1 (Human) Cell-Based ELISA Kit is an indirect enzyme-linked Qualitative Description: immunoassay for qualitative determination of Histone H3 expression in cultured cells. Reactivity: Human, Mouse, Rat Storage Store the kit at 4°C. Instruction: Protocol: Protocol Download Suitable Attached Cell, Loosely Attached Cell, Suspension Cell Sample: Label: HRP-conjugated Detection Colorimetric Method: Regulation For research use only (RUO) Status: Datasheet: Download Applications Qualitative HIST1H3A HIST1H3D HIST1H3C HIST1H3E HIST1H3I HIST1H3G HIST1H3J HIST1H3H HIST1H3B HIST1H3F Gene Information Entrez GeneID: 8350 Protein P68431 Accession#: Gene Name: HIST1H3A Gene Alias: H3/A,H3FA Gene histone cluster 1, H3a Description: Omim ID: 602810 Gene Ontology: Hyperlink Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a Page 1 of 6 2021/6/18 nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq Other H3 histone family, member A,histone 1, H3a Designations: Gene Information Entrez GeneID: 8351 Protein P68431 Accession#: Gene Name: HIST1H3D Gene Alias: H3/b,H3FB Gene histone cluster 1, H3d Description: Omim ID: 602811 Gene Ontology: Hyperlink Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes.
    [Show full text]
  • Identification of Prognostic Markers in Diffuse Midline Gliomas H3K27M
    Brain Pathology ISSN 1015-6305 RESEARCH ARTICLE Identification of prognostic markers in diffuse midline gliomas H3K27M-mutant Charlotte Dufour1 ; Romain Perbet1,2; Pierre Leblond3; Romain Vasseur2 ; Laurence Stechly4; Adeline Pierache5; Nicolas Reyns6; Gustavo Touzet6; Emilie Le Rhun7,8,9; Matthieu Vinchon10; Claude-Alain Maurage1,2; Fabienne Escande4; Florence Renaud1,2 1 Institute of Pathology, Centre de Biologie Pathologie, Lille University Hospital, Lille, F-59000, France. 2 Univ Lille, Inserm, UMR 1172 – JPARC – Centre de Recherche Jean-Pierre AUBERT Neurosciences et Cancer, Lille, F-59000, France. 3 Department of Paediatric Oncology, Centre Oscar Lambret, Lille, F-59000, France. 4 Department of Biochemistry and Molecular Biology, Centre de Biologie Pathologie, Lille University Hospital, Lille, F-59000, France. 5 Department of Biostatistics and Data Management, Lille University Hospital, Lille, F-59000, France. 6 Department of Stereotactic Neurosurgery, Lille University Hospital, Lille, F-59000, France. 7 Univ Lille, Inserm, U-1192, Lille, F-59000, France. 8 Department of Neuro-Oncology and Neurosurgery, Lille University Hospital, Lille, F-59000, France. 9 Department of Neurology, Breast Cancer, Centre Oscar Lambret, Lille, F-59000, France. 10 Department of Paediatric Neurosurgery, Lille University Hospital, Lille, F-59000, France. Keywords Abstract chomosomal profile, diffuse midline gliomas, H3K27M-mutant, molecular Pediatric diffuse midline gliomas are devastating diseases. Among them, diffuse alterations, prognostic markers, translational midline gliomas H3K27M-mutant are associated with worse prognosis. However, study. recent studies have highlighted significant differences in clinical behavior and bio- logical alterations within this specific subgroup. In this context, simple markers are Abbreviations needed to refine the prognosis of diffuse midline gliomas H3K27M-mutant and aCGH, comparative genomic hybridization guide the clinical management of patients.
    [Show full text]
  • Histone H3F3A and HIST1H3B K27M Mutations Define Two Subgroups of Diffuse Intrinsic Pontine Gliomas with Different Prognosis and Phenotypes
    Acta Neuropathol (2015) 130:815–827 DOI 10.1007/s00401-015-1478-0 ORIGINAL PAPER Histone H3F3A and HIST1H3B K27M mutations define two subgroups of diffuse intrinsic pontine gliomas with different prognosis and phenotypes David Castel1,2 · Cathy Philippe1 · Raphaël Calmon3 · Ludivine Le Dret1 · Nathalène Truffaux1 · Nathalie Boddaert3 · Mélanie Pagès7 · Kathryn R. Taylor4 · Patrick Saulnier5 · Ludovic Lacroix5 · Alan Mackay4 · Chris Jones4 · Christian Sainte‑Rose6 · Thomas Blauwblomme6 · Felipe Andreiuolo7 · Stephanie Puget6 · Jacques Grill1,2 · Pascale Varlet7 · Marie‑Anne Debily1,8 Received: 24 June 2015 / Revised: 8 September 2015 / Accepted: 10 September 2015 / Published online: 23 September 2015 © The Author(s) 2015. This article is published with open access at Springerlink.com Abstract Diffuse intrinsic pontine glioma (DIPG) is the a systematic stereotactic biopsy and were included in most severe paediatric solid tumour, with no significant this observational retrospective study. Histone H3 genes therapeutic progress made in the past 50 years. Recent mutations were assessed by immunochemistry and direct studies suggest that diffuse midline glioma, H3-K27M sequencing, whilst global gene expression profiling and mutant, may comprise more than one biological entity. chromosomal imbalances were determined by microar- The aim of the study was to determine the clinical and bio- rays. A full description of the MRI findings at diagnosis logical variables that most impact their prognosis. Ninety- and at relapse was integrated with the molecular profiling one patients with classically defined DIPG underwent data and clinical outcome. All DIPG but one were found to harbour either a somatic H3-K27M mutation and/or loss of H3K27 trimethylation. We also discovered a novel K27M This work was presented at the International Symposium mutation in HIST2H3C, and a lysine-to-isoleucine substitu- of Pediatric Neuro-Oncology meeting held in June 2014 in tion (K27I) in H3F3A, also creating a loss of trimethyla- Singapore.
    [Show full text]
  • HIRA Orchestrates a Dynamic Chromatin Landscape in Senescence and Is Required for Suppression of Neoplasia
    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press HIRA orchestrates a dynamic chromatin landscape in senescence and is required for suppression of neoplasia Taranjit Singh Rai,1,2,3 John J. Cole,1,2,5 David M. Nelson,1,2,5 Dina Dikovskaya,1,2 William J. Faller,1 Maria Grazia Vizioli,1,2 Rachael N. Hewitt,1,2 Orchi Anannya,1 Tony McBryan,1,2 Indrani Manoharan,1,2 John van Tuyn,1,2 Nicholas Morrice,1 Nikolay A. Pchelintsev,1,2 Andre Ivanov,1,2,4 Claire Brock,1,2 Mark E. Drotar,1,2 Colin Nixon,1 William Clark,1 Owen J. Sansom,1 Kurt I. Anderson,1 Ayala King,1 Karen Blyth,1 and Peter D. Adams1,2 1Beatson Institute for Cancer Research, Bearsden, Glasgow G61 1BD, United Kingdom; 2Institute of Cancer Sciences, College of Medical, Veterinary, and Life Sciences, University of Glasgow, Glasgow G61 1BD, United Kingdom; 3Institute of Biomedical and Environmental Health Research, University of West of Scotland, Paisley PA1 2BE, United Kingdom Cellular senescence is a stable proliferation arrest that suppresses tumorigenesis. Cellular senescence and associated tumor suppression depend on control of chromatin. Histone chaperone HIRA deposits variant histone H3.3 and histone H4 into chromatin in a DNA replication-independent manner. Appropriately for a DNA replication-independent chaperone, HIRA is involved in control of chromatin in nonproliferating senescent cells, although its role is poorly defined. Here, we show that nonproliferating senescent cells express and incorporate histone H3.3 and other canonical core histones into a dynamic chromatin landscape.
    [Show full text]
  • Diffuse Midline Gliomas, H3 K27M-Mutant
    Castel et al. Acta Neuropathologica Communications (2018) 6:117 https://doi.org/10.1186/s40478-018-0614-1 RESEARCH Open Access Transcriptomic and epigenetic profiling of ‘diffuse midline gliomas, H3 K27M-mutant’ discriminate two subgroups based on the type of histone H3 mutated and not supratentorial or infratentorial location David Castel1,2*, Cathy Philippe1,12, Thomas Kergrohen1,2, Martin Sill3,4, Jane Merlevede1, Emilie Barret1, Stéphanie Puget5, Christian Sainte-Rose5, Christof M. Kramm6, Chris Jones7, Pascale Varlet8, Stefan M. Pfister3,4,9, Jacques Grill1,2, David T. W. Jones3,10 and Marie-Anne Debily1,11,13* Abstract Diffuse midline glioma (DMG), H3 K27M-mutant, is a new entity in the updated WHO classification grouping together diffuse intrinsic pontine gliomas and infiltrating glial neoplasms of the midline harboring the same canonical mutation at the Lysine 27 of the histones H3 tail. Two hundred and fifteen patients younger than 18 years old with centrally-reviewed pediatric high-grade gliomas (pHGG) were included in this study. Comprehensive transcriptomic (n = 140) and methylation (n = 80) profiling was performed depending on the material available, in order to assess the biological uniqueness of this new entity compared to other midline and hemispheric pHGG. Tumor classification based on gene expression (GE) data highlighted the similarity of K27M DMG independently of their location along the midline. T-distributed Stochastic Neighbor Embedding (tSNE) analysis of methylation profiling confirms the discrimination of DMG from other well defined supratentorial tumor subgroups. Patients with diffuse intrinsic pontine gliomas (DIPG) and thalamic DMG exhibited a similarly poor prognosis (11.1 and 10.8 months median overall survival, respectively).
    [Show full text]
  • NIH Public Access Author Manuscript Acta Neuropathol
    NIH Public Access Author Manuscript Acta Neuropathol. Author manuscript; available in PMC 2015 June 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Acta Neuropathol. 2014 June ; 127(6): 881–895. doi:10.1007/s00401-013-1218-2. Comparative Multidimensional Molecular Analyses of Pediatric Diffuse Intrinsic Pontine Glioma Reveals Distinct Molecular Subtypes Amanda M. Saratsis1,2, Madhuri Kambhampati2, Kendall Snyder2, Sridevi Yadavilli2, Joe Devaney2,3, Brennan Harmon2, Jordan Hall2, Eric H. Raabe4,5, Ping An4,6, Melanie Weingart4, Brian R. Rood7, Suresh Magge8, Tobey J. MacDonald9, Roger J. Packer10,11, and Javad Nazarian2,3 1Department of Neurosurgery, Georgetown University Hospital, Washington DC, 20007, USA 2Center for Genetic Medicine, Children's National Medical Center, Washington DC, 20010, USA 3Department of Integrative Systems Biology, George Washington University School of Medicine and Health Sciences, Washington, DC, 20052, USA 4Division of Neuro-Pathology, Johns Hopkins University School of Medicine, Baltimore MD 21287, USA 5Division of Pediatric Oncology, Johns Hopkins University School of Medicine, Baltimore MD 21287, USA 6Neurobiology Department, College of Basic Medical Sciences, China Medical University, 110001, China 7Division of Oncology, Center for Cancer and Immunology Research, Children’s National Medical Center, Washington DC, 20010, USA 8Division of Neurosurgery, Children’s National Medical Center, Washington DC, 20010, USA 9Department of Pediatrics, Emory University School of Medicine, Atlanta, GA, 30322, USA 10Division of Neurology, Center for Neuroscience Research, Children’s National Medical Center, Washington DC, 20010, USA 11Brain Tumor Institute, Center for Neuroscience and Behavioral Medicine, Children’s National Medical Center, Washington DC, USA Abstract Diffuse Intrinsic Pontine Glioma (DIPG) is a highly morbid form of pediatric brainstem glioma.
    [Show full text]
  • Molecular Diagnosis of Diffuse Gliomas Through Sequencing Of
    Published OnlineFirst April 3, 2018; DOI: 10.1158/1078-0432.CCR-17-3800 Personalized Medicine and Imaging Clinical Cancer Research Molecular Diagnosis of Diffuse Gliomas through Sequencing of Cell-Free Circulating Tumor DNA from Cerebrospinal Fluid Francisco Martínez-Ricarte1,2,3, Regina Mayor1, Elena Martínez-Saez 2, Carlota Rubio-Perez 4, Estela Pineda5, Esteban Cordero2, Marta Cicuendez 2, Maria A. Poca2,3, Nuria Lopez-Bigas 4, Santiago Ramon y Cajal2,6, María Vieito1, Joan Carles1, Josep Tabernero1,6, Ana Vivancos1, Soledad Gallego2, Francesc Graus5, Juan Sahuquillo2,3, and Joan Seoane1,3,6,7 Abstract Background: Diffuse gliomas are the most common pri- patients and performed a histopathologic characterization of mary tumor of the brain and include different subtypes with the tumors. diverse prognosis. The genomic characterization of diffuse Results: Analysis of the mutational status of the IDH1, IDH2, gliomas facilitates their molecular diagnosis. The anatomical TP53, TERT, ATRX, H3F3A, and HIST1H3B genes allowed localization of diffuse gliomas complicates access to tumor the classification of 79% of the 648 diffuse gliomas analyzed, specimens for diagnosis, in some cases incurring high-risk into IDH-wild-type glioblastoma, IDH-mutant glioblastoma/ surgical procedures and stereotactic biopsies. Recently, diffuse astrocytoma and oligodendroglioma, each subtype exhi- cell-free circulating tumor DNA (ctDNA) has been identified biting diverse median overall survival (1.1, 6.7, and 11.2 years, in the cerebrospinal fluid (CSF) of patients with brain respectively). We developed a sequencing platform to simulta- malignancies. neously and rapidly genotype these seven genes in CSF ctDNA Patients and Methods: We performed an analysis of IDH1, allowing the subclassification of diffuse gliomas.
    [Show full text]