Biol. Pharm. Bull. 27(5) 661—669 (2004) 661

May 2004 Biol. Pharm. Bull. 27(5) 661—669 (2004) 661

Polymerase Chain Reaction–Restriction Fragment Length Polymorphism (PCR-RFLP) and Ampliﬁcation Refractory Mutation System (ARMS) Analyses of Medicinally Used Rheum Species and Their Application for Identiﬁcation of Rhei Rhizoma

a,b a b ,a Dong-Ye YANG, Hirotoshi FUSHIMI, Shao-Qing CAI, and Katsuko KOMATSU* a Research Center for Ethnomedicines, Institute of Natural Medicine, Toyama Medical and Pharmaceutical University; 2630 Sugitani, Toyama 930–0194, Japan: and b Department of Natural Medicines, School of Pharmaceutical Sciences, Peking University; Beijing 100083, China. Received December 24, 2003; accepted January 16, 2004

Previously, we have determined marker nucleotides on the chloroplast matK gene to identify Rheum palmatum, R. tanguticum and R. officinale used as Rhei Rhizoma officially. In the present study, we further developed a convenient and efficient identification method on the basis of marker nucleotides with Amplification Refractory Mutation System analysis. On the basis of the nucleotide substitutions at positions 367 and 937 among the three species on the matK gene, at each position two kinds of reverse primers with complementary 3-terminal nucleotides were designed. Upon PCR amplification using three sets of primers and template DNA from each species, one or two fragments (202 bp or/and 770 bp) were detected. As the resultant three fragment profiles were species-specific, the procedure enabled us to classify the botanic origins of 22 drug samples of Rhei Rhizoma. Key words Rheum; matK gene; amplification refractory mutation system (ARMS) analysis; polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) analysis; Rhei Rhizoma; identification

Rhei Rhizoma (“Dahuang” in Chinese) has been used for revealed that the key nucleotides for identifying section the treatment of constipation and various syndromes caused Palmata, including official species, existed at positions 587, by the obstruction of blood circulation, such as dysmenor- 707, and 838, and the marker nucleotides for identifying rhea, etc. in traditional Chinese medicine.1,2) Its pharmaco- three official species such as R. palmatum, R. tanguticum and logical effects have been known to be variable according to R. officinale were at 367 and 937, while those for distinguish- its botanic origin and the composition of its chemical con- ing the three intraspecies groups of R. palmatum were at 619, stituents.3,4) In the Japanese Pharmacopoeia,5) Rhei Rhizoma 769, 883, and 1061. In the present paper, based on the above is prescribed as Rheum palmatum, R. tanguticum, R. offici- marker nucleotides, polymerase chain reaction–restriction nale, and R. coreanum of section Palmata, family Polygo- fragment length polymorphism (PCR-RFLP)14,15) and ampli- naceae,6) while the first three species are prescribed as fication refractory mutation system (ARMS)14—16) analyses Dahuang in the Chinese Pharmacopoeia.1) However, due to were designed in order to develop a convenient and efficient the morphologic similarity of the aerial parts and frequent identification method for Rhei Rhizoma. On the matK gene occurrence of intermediate forms, the taxonomy of this sequence, we found restriction enzyme sites detecting three genus and the correct identification of Rheum species and marker nucleotides, one at position 587 which is useful for Rhei Rhizoma are very difficult. Recently, DNA-based poly- identifying section Palmata, and another two at positions 769 morphic assay was found to provide valuable information and 1061 for distinguishing the three groups of R. palmatum necessary to resolve such taxonomic problems.7—9) The (Fig. 1). For these two purposes, PCR-RFLP analysis was chloroplast matK gene sequence has been widely employed carried out. On the other hand, for the purpose of identifica- as a powerful tool in examining inter- and intragenus phy- tion of R. palmatum, R. tanguticum and R. officinale, ARMS logeny due to its high substitution rate.10—12) In our previous analysis using three sets of designed primers17,18) was per- paper,13) molecular analysis of the matK gene sequences of formed. After PCR-RFLP and ARMS methods were estab- 56 plant specimens of nine Rheum species, especially of 47 lished using plant specimens of eight Rheum species, their specimens of the above three species used as the official application for the identification of Rhei Rhizoma was inves- Dahuang in China (Table 1), was performed to clarify their tigated. phylogenetic relationship and to determine the identification markers of the three species. Although the matK gene se- MATERIALS AND METHODS quence of genus Curcuma of family Zingiberaceae was quite conservative intragenus,8) and that of genus Panax of family Materials Forty-seven plant specimens of R. palmatum, Araliaceae was stable intraspecies,9) those of the three Rheum R. tanguticum and R. officinale, and eight specimens of R. species were variable not only interspecies but also in- rhaponticum, R. franzenbachii, R. undulatum, R. przewalskyi traspecies (Table 2). However, the phylogenetic tree con- and R. kialense were used in this study (Table 1). Twenty-two structed using the unweighted pair group method with arith- drug samples of Rhei Rhizoma (Dahuang) were purchased metic mean (UPGMA method) showed that the specimens of from Chinese markets near the fields of Rheum species, and R. tanguticum and those of R. officinale belonged to their from Uchida Wakanyaku Co., Ltd. (Tokyo, Japan) and Tochi- own subclades, respectively, while those of R. palmatum be- moto Tenkaido Co., Ltd. (Osaka, Japan) (Table 3). Both plant longed to the three subclades related to their production specimens and drug samples are deposited in the Museum of areas. The result of sequence comparison of the matK gene Materia Medica, Institute of Natural Medicine, Toyama Med- ∗ To whom correspondence should be addressed. e-mail: [email protected] © 2004 Pharmaceutical Society of Japan 662 Vol. 27, No. 5

Table 1. Plant Specimens Used in This Study

Date of GenBank Species Locality of voucher Voucher no. Statement Code no. Cladea) collection accession no.

Section Palmata A. LOS. Rheum palmatum L. Qinghai Prov., Banma (班瑪) Co. 2000.7.20 K. Komatsu et al. QS127-2, cult. Pq1, 2 RPI AB115669 China QS129 Dongqinghan (東傾溝) 2000.7.21 K. Komatsu et al. QS171-5 cult. Pq3 RPI AB115670 Sichuan Prov., Heping (和坪), 2000.8.7 K. Komatsu et al. QS351 cult. Ps4 RPII AB115672 China Shimian (石棉) Co. Heping, Shimian Co. 2000.8.7 K. Komatsu et al. QS352-6 cult. Ps5 RPI AB115671 Caoke (草科), Shimian Co. 2000.8.8 K. Komatsu et al. QS354-1 cult. Ps6 RPIII AB115676 Caoke, Shimian Co. 2000.8.8 K. Komatsu et al. QS354-2 cult. Ps7 RPIII AB115677 Zheduo (折多山), 2000.8.8 K. Komatsu et al. wild Ps8, 9, 10 RPIII AB115678 Kangding (康定) Co. QS365-2, -4, -7 Geka (葛 ), Daofu (道孚) Co. 2000.8.9 K. Komatsu et al. QS405 cult. Ps11 RPI AB115670 Geka, Daofu Co. 2000.8.12 K. Komatsu et al. QS479 cult. Ps12 RPIII AB115679 Tagong (塔公), Kangding Co. 2000.8.12 K. Komatsu et al. QS480 cult. Ps13 RPIII AB115680 Xinduqiao (新都橋), 2000.8.12 K. Komatsu et al. QS481-1 cult. Ps14 RPIII AB115680 Kangding Co. Xinlong (新龍) Co. 2001.4.28 H. Cao QS0738 wild Ps15 RPI AB115671 Yulong (玉隆), Dege (徳格) Co. 2000.8.11 K. Komatsu et al. QS416-1, -4 wild Ps16, 17 RPI AB115670 Shiqu (石渠) Co. 2000.8.14 Y. Sahashi QS2 cult. Ps18 RPIII AB115680 Yunnan Prov., Heqing (鶴慶), Dali (大理) Co. 1999.7.30 K. Komatsu et al. Y229, Y231, cult. Py19, 20, 21, 22 RPIII AB115681 China Y232, Y233 Heqing, Dali Co. 1999.7.30 K. Komatsu et al. Y230 cult. Py23 RPII AB115673 Heqing, Dali Co. 1999.7.30 X. Wang Y1 cult. Py24 RPII AB115673 Gansu Prov., Li (礼) Co. 2001.7.30 D.Y. Yang G01 cult. Pg25 RPII AB115673 China Gezigou (格子溝), Li (礼) Co. 2001.7.30 D.Y. Yang G02-1 cult. Pg26 RPII AB115673 Shuanshui (銓水), Li Co. 2001.7.31 D.Y. Yang G04-1 cult. Pg27 RPIII AB115677 Shuanshui, Li Co. 2001.7.31 D.Y. Yang G04-6 cult. Pg28 RPIII AB115677 Nanyang (南陽), 2001.7.31 D.Y. Yang G05-1 cult. Pg29 RPII AB115673 Tanchang (宕昌) Co. Nanyang, Tanchang Co. 2001.7.31 D.Y. Yang G05-2 cult. Pg30 RPIII AB115677 Chengjiao (城郊), Min (岷) Co. 2001.8.2 D.Y. Yang G06, G07 cult. Pg31, 32 RPII AB115673 Chengjiao, Min Co. 2001.8.2 D.Y. Yang G08-1 cult. Pg33 RPIII AB115677 Hanban (愍班), 2001.8.4 D.Y. Yang G09 cult. Pg34 RPII AB115674 Zhouqu (舟曲) Co. Baidian (白点山), Zhouqu Co. 2001.8.4 D.Y. Yang G10-1, -2, -6 wild Pg35, 36, 37 RPII AB115675 R. tanguticum Qinghai Prov., Qunjia (群加), 2000.7.17 K. Komatsu et al. QS1 cult. T1 RT AB115682 MAXIM. ex BALF. China Huangzhong (湟中) Co. Mashidang (麻什当), 2000.7.24 K. Komatsu et al. QS201-1 wild T2 RT AB115682 Huangnan (黄南) Co. Reshui (熱水), 2000.8.2 K. Komatsu et al. QS307-1, -2 wild T3, 4 RT AB115683 Dulan (都蘭) Co. R. ofﬁcinale BAILLON Sichuan Prov., Fengtong (蜂桶), 2000.8.19 K. Komatsu et al. QS500-3, cult. O1, 2, 3 ROC AB115684 China Wanyuan (万源) Co. QS501-1, -3 Piwo (皮窩), Wanyuan Co. 2000.8.20 K. Komatsu et al. QS510 cult. O4 ROC AB115685 Piwo, Wanyuan Co. 2000.8.20 K. Komatsu et al. QS514-2, -3 wild O5, 6 ROC AB115686 Section Rhapontica A. LOS. R. rhaponticum L. Qinghai Prov., Dulan (都蘭) Co. 2000.8.1 K. Komatsu et al. QS306 cult. R RR AB115688 China R. franzenbachii Hebei Prov., Anguo (安国) 2002.9.16 K. Komatsu 1 cult. F RR AB115689 MU¨ NT. China R. undulatum L. Ulaanbaatar, Hairthaan 2001.7.23 K. Komatsu et al. M24 wild U1 RR AB115690 Mongolia Ovorhangay, Gandyn Had 2001.7.29 K. Komatsu et al. M148 wild U2 RR AB115690 Mongolia Bayanhongor, Suuj Teeg Uul 2001.7.30 K. Komatsu et al. M194 wild U3 RR AB115691 Mongolia Section Spiciformia A. LOS. R. przewalskyi Qinghai Prov., Xidatan (西大灘), 2000.7.29 K. Komatsu et al. QS277-1 wild S1 RS AB115693 A. LOS. China Geermu (格尓木) Qinghai Prov., Reshui (熱水), 2000.8.2 K. Komatsu et al. QS308-2 wild S2 RS AB115694 China Dulan (都蘭) Co. Section Acuminata C. Y R. kialense FRANCH. Sichuan Prov., Yulong (玉隆), 2000.8.11 K. Komatsu et al. QS417-6 wild K RK AB115692 China Dege (徳格) Co.

a) Each clade was determined on the basis of phylogenetic analysis of the matK gene sequence. b) TMPU, Medicinal Plant Garden, Toyama Medical and Pharmaceutical University, Japan. ical and Pharmaceutical University (TMPW). method described in our previous paper.15) Total DNA Preparation Total DNA was extracted from PCR-RFLP Analysis PCR ampliﬁcation of the partial 50—100 mg of dried or fresh leaves of the plant specimens matK gene was performed using 10—100 ng of total DNA as using the DNeasyTM Plant Mini Kit (QIAGEN, Germany), a template in 50 ml of reaction mixture, consisting of 10 mM and from 100—1000 mg of drug samples using the CTAB Tris–HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 1.5 mM May 2004 663

Table 2. Comparison of the Partial matK Gene Sequence among 55 Specimens of Eight Rheum Species and 16 Rhei Rhizoma

Nucleotide position

11111111 Species Code no. 112222333344445555666666777777788888889999999999900001122 Cladea) 451267016614552388111179012346902355891135555556834671145 128240275773182157256966715939138829372870123451429122467

Rheum palmatum Pq1, 2; D1 T G T T GGG C G C A T G T C GGAAAAAGCCACGCTCTGCAACGCCC ––––––TGCCCGTCCC RPI Pq3; Ps11, 16, 17 ****************************A******C*****––––––********** RPI Ps5, 15; D21 ***********A****************A******C*****––––––********** RPI Ps4; D18, 19 * A *********A*********C******AG*****C*****––––––******G***RPII Py23, 24; Pg25, 26, 29, ***********A***A*****C******AG*****C*****––––––*********TRPII 31, 32; D5—7, 10 Pg34; D8 ***********A*********C******AG*****C*****––––––**********RPII Pg35, 36, 37 ***********A*********C******AG*****C**AT*––––––**********RPII Ps6 *******T***A*********C******AG*****CA****––––––****T*****RPIII Ps7; Pg27, 28, 30, 33; D9 ***********A*********C******AG*****CA****––––––****T*****RPIII Ps8, 9, 10; D3 ****A******A*********C******AG*****CAT***––––––****T*****RPIII Ps12 ***********A****************AG*****CA****––––––****T*****RPIII Ps13, 14, 18 ***********A*********C******AG*****CAT***––––––****T*****RPIII Py19—22 ***********A*********C******A******CA****––––––****T*****RPIII R. tanguticum T1, 2; D2, 13, 22 *********T*A****************AG*A***C****T––––––*******T** RT T3, 4; D14 *********TCA****************AG*****C****T––––––*******T** RT R. ofﬁcinale O1, 2, 3 ***********A********T*******AG*****C****T––––––**********ROC O4; D4 ***********A****************AG*****C****T––––––*******T**ROC O5, 6 ***********A********T*******AG**T**C****T––––––**********ROC R. rhaponticum R ***********AA***TG***C**G***AG***A*C*****––––––********** RR R. franzenbachii F ***********AA***TG***C**G***AGT**A*C*****––––––********** RR R. undulatum U1, 2 ***********AA***TG***C**G***AGT**A*C*****––––––********T* RR U3 ***********AA***TG***C*TG***AGT**A*C*****––––––********** RR R. przewalskyi S1 **AG**T*A**A**T**G***C**GGG*AGT**AGC*****CAAGAA* * * T ****** RS S2 **AG**T*A**A**T**G***C**GGG*AGT**AGC*****CAAGAA* T * T ****** RS R. kialense K A*AG*T**A**A*C***GTG*CA*G**AAGT**A*CA****CAAGAAC * TT * T * * * * RK

Hyphens (–) denote alignment gaps. Asterisks (∗) indicate sequence identity with R. palmatum from Banma County, Qinghai Prov., China (Pq1). Nucleotide positions indicate the aligned position, starting from the 5 end of the matK gene. a) Each clade was determined on the basis of phylogenetic analysis of the matK gene sequence.

Fig. 1. Positions of Marker Nucleotides, PCR Primers for PCR-RFLP and ARMS Analyses, and Restriction Enzyme Sites on matK Gene Marker nucleotides used in this study are indicated by numerals in italics above the diagram; nucleotide substitutions with shadows at positions 587, 769 and 1061 were applied to PCR-RFLP analysis, and those at positions 367 and 937 to ARMS analysis. PCR primers for PCR-RFLP analysis are indicated by broad half-arrows, and those for ARMS analysis by dotted broad half-arrows, mapped below the diagram. The lengths of the resulting PCR products are shown at the bottom. For PCR-RFLP analysis, PCR products of 1129 bp (or 1135 bp) obtained from PCR or semi-nested PCR methods were used. The PCR product of 1265 bp was used as a template in semi-nested PCR for drug samples. The PCR products of regions 1 and 2 were used for PCR-RFLP analysis of one drug sample (D21). Important restriction enzyme sites of BglII, NsiI and DraI used for identifying section Palmata and the distinction of three group of R. palmatum are indicated by sharp arrows. 664 Vol. 27, No. 5

Table 3. Rhei Rhizoma Used in This Study and Their Botanic Origins

Date of TMPW Code Botanic Herbal drug name Market Production area collection no.b) no. origin (group)

Dahuang (大黄)a) Banma (班瑪) County, Banma County, Qinghai 2000, 7 20061 D1 Rheum palmatum (I) Qinghai (青海), China Dahuanga) Tongren (同仁) County, Qinghai, China Huangnan (黄南) County, 2000, 7 20065 D2 R. tanguticum Qinghai Dahuang Tongren County, Qinghai, China Huangnan County, Qinghai 2000, 7 20066 D11 R. tanguticum Dahuang Dulan (都蘭) County, Qinghai, China Dulan County, Qinghai 2000, 8 20107 D12 R. tanguticum Dahuang Dulan County, Qinghai, China Dulan County, Qinghai 2000, 8 20108 D13 R. tanguticum Dahuang Dulan County, Qinghai, China Dulan County, Qinghai 2000, 8 20109 D14 R. tanguticum Dahuang Ganzi (甘孜) County, Sichuan (四川), China Ganzi County, Sichuan 2000, 8 20218 D15 R. palmatum (I) Dahuanga) Kangding (康定) County, Sichuan, China Jiulong (九龍) County, 2000, 8 20216 D3 R. palmatum (III) Sichuan Yin-huang (陰黄) Yaan (雅安) County, Sichuan, China Litang (理塘) County, 2001, 2 20574 D16 R. palmatum (III) Sichuan Yin-kang-huang Yaan County, Sichuan, China Shimian (石棉) County, 2001, 2 20573 D17 R. palmatum (III) (陰康黄) Sichuan Dahuang Wanyuan (万源) County, Sichuan, China Wanyuan County, Sichuan 2000, 8 20266 D18 R. palmatum (II) Dahuanga) Wanyuan County, Sichuan, China Wanyuan County, Sichuan 2000, 8 20267 D4 R. ofﬁcinale Mati-dahuang Wanyuan County, Sichuan, China Wanyuan County, Sichuan 1987, 10 07422 D19 R. palmatum (II) (馬蹄大黄) Dahuanga) Zhongdian (中甸) County, Zhongdian County, Yunnan 1999, 7 19535 D5 R. palmatum (II) Yunnan (雲南), China Ba-cheng-ji (八成吉)a) Li (礼) County, Gansu (甘粛), China Li County, Gansu 2001, 7 20926 D6 R. palmatum (II) Tong-huo (統貨)a) Li County, Gansu, China Li County, Gansu 2001, 7 20928 D7 R. palmatum (II) Dahuanga) Min (岷) County, Gansu, China Diebu (迭部) County, Gansu 2001, 8 20931 D8 R. palmatum (II) Dahuang Zhouqu (舟曲) County, Gansu, China Zhouqu County, Gansu 2001, 8 20932 D20 R. palmatum (III) Dahuanga) Uchida Wakanyaku Co., Ltd., Tokyo, Japan Shimian County, Sichuan 2000, 4 19928 D9 R. palmatum (III) Liu-cheng-ji (六成吉)a) Uchida Wakanyaku Co., Ltd., Tokyo, Japan Li County, Gansu 2000, 3 19927 D10 R. palmatum (II) Ya-huang (雅黄) Tochimoto Tenkaido Co., Ltd., Osaka, Japan Sichuan 2000, 5 19948 D21 R. palmatum (I) Bao-huang (包黄) Tochimoto Tenkaido Co., Ltd., Osaka, Japan Qinghai 2000, 5 19949 D22 R. tanguticum

a) The botanic origins of D1—D10 have been identiﬁed by sequence analysis in our previous paper. b) The specimen reference number of the Museum of Materia Medica, Institute of Natural Medicine, Toyama Medical and Pharmaceutical University (TMPW).

Table 4. Sequences of PCR Primers for PCR-RFLP and ARMS Analyses

Application Length Primer Sequence (5 to 3) (bp) PCR Semi-nested PCR (drug D21) ARMS (plants) PCR (Drugs) (Regions 1, 2)

matKAF CTA TAT CCA CTT ATC TTT CAG GAG T 25 Step 1-F matK191F TAG TTA TTC GAA TGT ATC AAC AG 23 F Step 2-F F Region 1-F matK367CR GAT CGT AAA TTT TGA TAT TTT TTG AG 26 R1 matK367TR GAT CGT AAA TTT TGA TAT TTT TTG AA 26 R1 matK646F TCC TAC GTG TGT GAA TGC G 19 Region 2-F trnK1544R GGA TAA CCC CAG AAT GCT TAG 21 Region 1-R matK937CR ATA TAG ATT CTT TGC AAC CAG AG 23 R2 matK937TR GAT ATA GAT TCT TTG CAA CCA GAA 24 R2 matK8R AAA GTT CTA GCA CAA GAA AGT CGA 24 R R Region 2-R

F, forward primer; R, reverse primer. R1 and 1 indicate two kinds of reverse primers designed on the basis of nucleotide difference at position 367, whereas R2 and 2 are on the basis of nucleotide difference at position 937. Nucleotides with underlines indicate destabilizing mismatches.

MgCl2, 0.2 mM of each dNTP, 0.25 m M of each primer, and method was applied: the first PCR product amplified with a 1.5 U of Taq Polymerase (Promega, U.S.A.). The sequences pair of primers, matKAF and matK8R, under the above cy- of a pair of primers flanking the partial matK gene, cling condition was purified with a QIAquick PCR Purifica- matK191F and matK8R, are shown in Table 4. PCR amplifi- tion Kit (Qiagen, Germany), and, using this product as a tem- cation was carried out in a Thermal Controller PTC 100 (MJ plate, the second PCR amplification was performed using a Research, Inc., U.S.A.) with the following cycling condition: pair of primers, matK191F and matK8R (Table 4, Fig. 1). hot start at 94 °C for 1 min, followed by 40 cycles of 94 °C The resulting PCR products from all materials were digested for 1 min, 50 °C for 1 min, and 72 °C for 2 min, and a final with 5 units of restriction enzyme, BglII (BioLabs, Inc., extension at 72 °C for 30 min. The 1/10 volume of the result- U.S.A.) at 37 °C for 1.5 h. Moreover, the PCR products from ing PCR product was detected by 1.0% agarose gel elec- the materials derived from R. palmatum were digested with 5 trophoresis and visualized by ethidium bromide staining units of restriction enzyme NsiI or DraI (BioLabs, Inc., under UV. In the case of drug samples, a semi-nested PCR U.S.A.). The fragments obtained were detected by 2.0% May 2004 665 agarose gel electrophoresis and visualized by ethidium bro- 50 s and 58.5 °C for 50 s, respectively, and the extension time mide staining under UV. In the case of one drug sample was also changed to 1 min and 50 s. The 5 ml of resulting (Table 3: D21), as a PCR product of the partial matK gene product was analyzed by 2.0% agarose gel electrophoresis. was not obtained, two regions (1 and 2) were amplified sepa- rately using matK191F and trnK1544R, and matK646F and RESULTS matK8R, respectively, together with the total DNA as a template (Fig. 1). The cycling condition was the same as men- Determination of Rheum Species Officially Used as tioned above except for the annealing temperature being ad- Rhei Rhizoma The PCR products of six Rheum species justed to 53 °C. The PCR product of region 1 was digested amplified with a pair of primers, matK191F and matK8R, with restriction enzyme BglII, whereas that of region 2 was were of 1129 bp in length, except for those of R. przewalskyi digested with restriction enzymes NsiI or DraI. and R. kialense of 1135 bp. The restriction enzyme BglII, ARMS Analysis On the basis of the nucleotide substitu- which recognizes the sequence of 5AGATCT3, was found tions at positions 367 and 937 among the three official to give diagnostic fragments among the eight species. The species on the matK gene, at each position two kinds matK gene of five species, excluding the three official of reverse primers, matK367CR and matK367TR, and species, had a BglII restriction site at the nucleotide position matK937CR and matK937TR with complementary 3-termi- 586—591 (Fig. 2A). The PCR products of these five species nal nucleotide were designed (Table 4, Fig. 1). To enhance digested with BglII showed three fragments of 100, 296 and the specificity, a destabilizing mismatch was incorporated at 733 or 739 bp, while in the three official species the products the 3rd nucleotide from the 3 terminus in each reverse showed two fragments of 100 and 1029 bp in electrophore- 17,18) primer. Three sets of primers (Fig. 3: A, B and C) were togram (Fig. 2B1). prepared, each of which consisted of 2 kinds of reverse Identification of Three Rheum Species Upon PCR am- primers, matK367CR or matK367TR, and matK937CR or plification using three sets of primers (A, B and C), each matK937TR, and one forward primer, matK191F. For each consisting of 2 kinds of reverse primers, matK367CR or primer set, the PCR amplification was performed using total matK367TR and matK937TR or matK937CR, and one for- DNAs from all materials as a template in 25 ml of reaction ward primer, matK191F, and template DNA from each mixture composed of 10 mM Tris–HCl (pH 9.0), 50 mM KCl, species, one or two fragments of 202 bp and/or 770 bp in

0.1% Triton X-100, 1.5 mM MgCl2, 0.2 mM of each dNTP, length or no fragments were observed in the electrophore- 0.25 m M of forward primer, 0.125 m M of each reverse primer togram. When the primer set A was used, one fragment of and 1.5 U Taq Polymerase (Promega, U.S.A.). The optimal 202 bp was observed in R. palmatum, one fragment of 770 bp cycling condition for primer set A was established as fol- in R. tanguticum, and both fragments in R. officinale (Fig. lows: hot start at 94 °C for 1 min, followed by 40 cycles at 3A1). When the primer set B was used, two fragments of 202 94 °C for 1 min, 52 °C for 1 min, 72 °C for 2 min, and a final and 770 bp were observed in R. palmatum, one fragment of extension at 72 °C for 15 min. For primer sets B and C, the 202 bp in R. officinale, and no fragments in R. tanguticum annealing temperature and time were changed to 59 °C for (Fig. 3A2). When primer set C was used, two fragments were

Fig. 2. PCR-RFLP Analysis Using the Restriction Enzyme BglII on Partial matK Gene (A) BglII restriction sites in three official Rheum species and five other species; nucleotides with shadows indicate the defined identification marker at position 587. (B) agarose gel electrophoretograms of PCR products digested with BglII; 1, eight Rheum species; 2, drug samples of Rhei Rhizoma; code numbers of drug samples are shown. Lane M, 1 kb DNA ladder; M, pBR 322DNA-MspI digestion. 666 Vol. 27, No. 5

Fig. 3. ARMS Analysis Using Three Sets of Primers on Partial matK Gene PCR amplification with primer sets A, B and C was carried out using the DNA of each material as a template. (A) three official Rheum species; (B) drug samples of Rhei Rhi- zoma derived from official species; code numbers of drug samples are shown. 1, 2 and 3, fragment patterns when primer sets A, B and C were used, respectively. Control, blank without DNA templates; Lane M, 1 kb DNA ladder.

observed in R. tanguticum, one fragment of 770 bp in R. of- NsiI showed one fragment (Fig. 4B2: D17, D20 and D9), ficinale, and no fragments in R. palmatum (Fig. 3A3). By ob- whereas those of the other 9 samples showed two fragments, serving three kinds of fragment profiles, the three official which suggested that the former was originated from group species were authenticated. III and the latter from groups I or II of R. palmatum, respec- Distinction of the Three Groups of Rheum palmatum tively. The digestion of the PCR products of the latter sam- The restriction enzymes NsiI and DraI, which recognize the ples with DraI resulted in the formation of three fragments in sequence of 5ATGCAT3 and that of 5TTTAAA3, respec- 2 samples from Banma County, Qinghai Province and Ganzi tively, were found to give diagnostic fragments among the County, Sichuan Province (Fig. 4D2: D1 and D15), and two three groups of R. palmatum (I, II, III). The matK gene of fragments in 7 samples from mostly Gansu and Yunnan groups I and II had a NsiI restriction site at the nucleotide Provinces, suggesting that the former was originated from position 1058—1063; moreover, that of group I had a DraI group I and the latter from group II of R. palmatum, respec- restriction site at the position 768—773 (Fig. 4A, C). The tively. PCR products of groups I and II digested with NsiI showed Identification of One Drug Sample (D21) Upon PCR two fragments of 263 and 866 bp, whereas that of group III amplification of regions 1 and 2 of the partial matK gene showed one fragment of 1129 bp (Fig. 4B1). On the other (Fig. 1), the PCR products of 612 and 674 bp were obtained, hand, the digestion of the PCR products with DraI resulted in respectively. The PCR product of region 1 digested with the formation of three fragments of 247, 333 and 549 bp in BglII showed two fragments of 100 and 512 bp, which was group I, and two fragments of 247 and 882 bp in group II the same as in the three official Rheum species (Fig. 5A). The

(Fig. 4D1). result of ARMS analysis suggested that this sample was de- Identification of Rhei Rhizoma Twenty-two drug sam- rived from R. palmatum (Fig. 3B). Then, the PCR product of ples (Table 3) were analyzed by using the above PCR-RFLP region 2 was digested with NsiI or DraI. Two fragments of and ARMS methods. Their PCR products, amplified with a 263 and 411 bp and those of 125 and 549 bp were observed pair of primers, matK191F and matK8R, in a semi-nested in the digestion with NsiI and DraI, respectively, which were PCR method, were of 1129 bp in length except for one sam- the same as in group I of R. palmatum (Fig. 5B, C). ple (D21) with no product. The digestion of the PCR products with the restriction enzyme BglII resulted in the forma- DISCUSSION tion of two fragments of 100 and 1029 bp (Fig. 2B2), suggesting that the 21 samples were derived from official Rheum Previously,13) we investigated the phylogenetic relationship species of section Palmata. In the ARMS method using three of the Rheum species, especially of R. palmatum, R. sets of primers, six drug samples from Qinghai Province tanguticum and R. officinale of section Palmata, used as Rhei showed the same fragment patterns as those of R. tanguticum Rhizoma officially on the basis of their matK gene se- (Fig. 3B: D11, D14 and D22), one sample from Wanyuan quences. The phylogenetic tree suggested that R. tanguticum County, Sichuan Province, as those of R. officinale (D4), and and R. officinale were monophyletic, but R. palmatum was the remnants, as those of R. palmatum, respectively. As for mainly composed of 3 groups (I, II, III) which were related the last 14 samples, their PCR products were digested with to the production area. In general, specimens from the south- the restriction enzyme NsiI or DraI. The PCR products of 5 east part of Qinghai Province and northwestern part of drug samples, mostly from Sichuan Province, digested with Sichuan Province belonged to group I, those from Gansu May 2004 667

Fig. 4. PCR-RFLP Analysis Using the Restriction Enzyme NsiI or DraI on Partial matK Gene (A) NsiI restriction site in three groups of Rheum palmatum; nucleotides with shadows indicate the defined identification marker at position 1061. (B) agarose gel electrophoretograms of PCR products digested with NsiI; 1, three groups of R. palmatum; 2, drug samples of Rhei Rhizoma; code numbers of drug samples are shown. (C) DraI restriction sites in two groups of R. palmatum; nucleotides with shadows indicate the identification marker at position 769. (D) agarose gel electrophoretograms of PCR products digested with DraI; 1, two groups of R. palmatum; 2, drug samples of Rhei Rhizoma. Lane M, 1 kb DNA ladder; M, pBR 322DNA-MspI digestion.

Province to group II, and those from the central to southern was developed using three sets of primers, each having two part of Sichuan Province to group III, respectively. By se- kinds of species-specific reverse primers designed on the quence comparison, we also have determined marker nu- basis of nucleotide differences at positions 367 and 937. The cleotides to identify section Palmata, to identify the above plant specimens were analyzed using the PCR-RFLP and three official species, and to distinguish the three intraspecies ARMS methods to give the expected products in an elec- groups of R. palmatum. In the present study, on the basis of trophoretogram. For the plant specimen identified as group I five marker nucleotides at positions 367, 587, 769, 937 and of R. palmatum, two fragments were observed in the diges- 1061, PCR-RFLP and ARMS analyses were designed. PCR- tion of the PCR product with BglII; both 202 and 770 bp RFLP methods using restriction enzymes BglII, and NsiI or fragments were detected in the ARMS method using primer DraI were developed for identifying section Palmata and for set B; and two and three fragments were observed in the di- identifying the three groups of R. palmatum, respectively. For gestion of the PCR product with NsiI and DraI, respectively. the identification of three official species, ARMS method These methods were also applied to drug samples of Rhei 668 Vol. 27, No. 5

Fig. 5. PCR-RFLP Analysis of One Drug Sample (D21) Using the Restriction Enzyme BglII, NsiI or DraI on Partial matK Gene (A) PCR products of region 1 (612 bp), amplified using DNAs from eight Rheum species (three official and five unofficial species) and one drug sample as a template, were digested with BglII. (B) and (C) PCR products of region 2 (674 bp) were amplified using DNAs from three groups of R. palmatum, and one drug sample as template, were digested with NsiI (B) or DraI (C). 1, restriction sites of BglII, NsiI or DraI; 2, agarose gel electrophoretograms of the PCR products digested with three restriction enzymes; nucleotides with shadows indicate the defined identification markers at position 587 (A), 1061 (B) or 769 (C). Lane M, 1 kb DNA ladder; M, pBR 322DNA-MspI digestion.

Rhizoma. The ARMS method was found to be valuable in from Sichuan Province (Table 2: Ps4). On the other hand, one identifying the species of the drug samples. However, the drug sample named “Ya-huang” (D21), which is available in PCR-RFLP method failed at first in most samples, since PCR the Japanese market, was found to be derived from group I of products of the partial matK gene were not detected. When a R. palmatum, not as expected from group III.13) Although the semi-nested PCR method was performed using these PCR Ya-huang samples imported from China have been known to products as a template, the expected products were obtained be produced in Jiulong and Shimian Counties, the central except for one sample (D21). As for this sample, upon PCR part of Sichuan Province,5,20) their production areas have amplification of dividing two regions of the partial matK been moved recently to the northwestern part. In fact, the gene, PCR products of 612 and 674 bp were obtained, respec- partial matK gene sequence was found to be identical to that tively. It was understood that a semi-nested PCR method was of wild plants from Xinlong County, in the northwestern part required to obtain PCR products from drug samples, and a of Sichuan Province (Table 2: Ps15). region shorter than 700 bp was suitable for amplification. In the present study, the PCR-RFLP and ARMS methods After obtaining the PCR products, using the PCR-RFLP were established as convenient tools for identifying Rhei method, the groups of R. palmatum were identified. Rhizoma derived from Rheum species. After obtaining 2 Adding to the 10 drug samples investigated in our previ- kinds of PCR products from dividing two regions of partial ous paper, we investigated 12 more samples to identify their matK gene, the combination of PCR-RFLP and ARMS are botanic origins by using PCR-RFLP and ARMS methods. thought to be useful for identifying drug samples. Also, the Thereafter, six out of the 12 samples were selected to deter- matK gene sequences of drug samples are expected to be- mine the partial matK gene sequences to validate the accu- come useful indices for quality control of Rhei Rhizoma, and racy of the identification, then sequencing results were found for predicting their production areas. to be completely consistent with those demonstrated in our After the origins of Rhei Rhizoma were unambiguously present method. All 22 samples were found to be derived authenticated by molecular analysis, evaluation of their qual- from official Rheum species. Their botanic origins almost ity based on chemical components will be reported in the corresponded with those deduced from information about forthcoming article. their production areas, as previously described. However, two drug samples (D18 and D19) from Wanyuan County, Acknowledgments We are grateful to all who kindly Sichuan Province were found to be derived from group II of provided help during our field investigations and collections. R. palmatum, not as expected from R. officinale.19) Although We thank Prof. Hui Cao of the National Engineering Re- most Rhei Rhizoma derived from group II of R. palmatum is search Center for Modernization of Traditional Chinese produced in Gansu Province, these samples were thought to Medicine, China, and Uchida Wakanyaku Co., Ltd. and be produced in Sichuan Province, since the partial matK Tochimoto Tenkaido Co., Ltd. for providing plant specimens gene sequence was identical to that of the plant specimen and drug samples. This work was supported by a Grant-in- May 2004 669

Aid for Scientiﬁc Research (B), No.11695086 in 1999— 8) Cao H., Sasaki Y., Fushimi H., Komatsu K., Biol. Pharm. Bull., 24, 2001 and No.14406030 in 2002—2003 from the Japan Soci- 1389—1394 (2001). 9) Zhu S., Fushimi H., Cai S. Q., Komatsu K., Planta Med., 69, 647— ety for the Promotion of Science, and by the 21st Century 653 (2003). COE Program from the Ministry of Education, Culture, 10) Johnson L. A., Soltis D. E., Syst. Bot., 19, 143—156 (1994). Sports, Science and Technology, Japan. 11) Plunkett G. M., Soltis D. E., Soltis P. S., Syst. Bot., 21, 477—495 (1996). REFERENCES 12) Padgett D. J., Les D. H., Crow G. E., Am. J. Bot., 86, 1316—1324 (1999). 13) Yang D. Y., Fushimi H., Cai S. Q., Komatsu K., Biol. Pharm. Bull., 27, 1) Chinese Pharmacopoeia Commission (English edition), “Pharma- 375—383 (2004). copoeia of The People’s Republic of China,” Vol. 1, Chemical Industry 14) Sekiya T., Fujinaga S., “Protein, Nucleic Acid and Enzyme,” Vol. 41, Press, Beijing, 1997, pp. 149—150. 1996, pp. 546—548, 564—567. 2) Namba T. (ed.), “The Encyclopedia of Wakan-Yaku (Traditional Sino- 15) Fushimi H, Komatsu K., Isobe M., Namba T., Biol. Pharm. Bull., 20, Japanese Medicines) with Color Pictures,” Vol. I, Hoikusha Publish- 765—769 (1997). ing, Osaka, 1993, pp. 16—20. 16) Sasaki Y., Fushimi H., Cao H., Cai S. Q., Komatsu K., Biol. Pharm. 3) Miyamoto H., Ikeda Y., Takeda O., Kubo M., Higuchi M., Sasaki H., Bull., 25, 1593—1599 (2002). Okada M., Nat. Med., 55, 159—164 (2001). 17) Mcpherson M. J., Hames B. D., Taylor G. R., “PCR 2 (A Practical Ap- 4) Harima S., Matsuda H., Kubo M., Biol. Pharm. Bull., 17, 1522—1525 proach),” Oxford University Press, New York, 1995, pp. 224—227. (1994). 18) Newton C. R., Graham A., Heptinstall L. E., Powell S. J., Summers C., 5) Society of Japanese Pharmacopoeia (ed.), “The Japanese Pharma- Kalsheker N., Smith J. C., Markham A. F., Nucleic Acids Res., 17, copoeia (Japanese edition),” 14th ed., Hirokawa Publishing, Tokyo, 2503—2516 (1989). 2001, pp. D687—D698. 19) Lou Z. C., Wang X., Mikage M., Namba T., Shoyakugaku Zasshi, 42, 6) Li A. R., “Flora Reipublicae Popularis Sinicae,” Tomus 25, Science 291—301 (1988). Press, Beijing, 1998, pp. 167—209. 20) Department of Pharmacognosy, Nanjing College of Pharmacy (ed.), 7) Mizukami H., Okabe Y., Kohda H., Hiraoka N., Biol. Pharm. Bull., 23, “Materia Medica,” People’s Publishing House, Beijing, 1960, p. 388. 589—594 (2000).