STRUCTURAL FEATURES AFFECTING THE CLEAVAGE RATE AND
MAGNESIUM OPTIMUM IN THE NEUROSPORA VS RIBOZYME
Alan Hing-Lun Poon
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Molecular and Medical Genetics
University of Toronto
O Copyright by Alan Hing-Lun Poon (2001) nie author has granteci a non- L'auteur a accordé une licence non exclusive licence aliowing the exclusive permettant ii la Natiod Library of Canada to BibliotMque nationale du Canada de reproduce, Io-, distnie or sefl reproduire, prêter, distnûuer ou copies of this thesis in microform, vendre des copies 6 cette thèse sous paper or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur format Clectronique.
The author retains ownersbip of the L'auteur conserve la propriété du copyright in this thesis. Neikthe droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. ABSTRACT
Structural Fwhves Affécting the Cleavage Rate and Magnesium Optimum in the Neurospom VS Ribozyme
Alan Hing-Lun Poon Master of Science, 2001 Department of Molecular and Medical Genetics, University of Toronto
Varkud Satellite (VS) RNA catalyzes a magnesium-dependent, site-specific, self- cleavage reaction. It has been previousl y detemined that a base-paired region, called helix la, adjacent to the site of self-cleavage, is a structural element that limits the rate of self-cleavage. Mutants with a disrupted helix Ia not only display an increase in cleavage rate, but also are active at much lower concentrations of magnesium. By measuring the cleavage kinetics of a series of linker-insertion mutants with or without a disrupted helix
Ia, 1 have been able to identify separate structural causes for the slow cleavage rate and high magnesium optimum of the wild-type RNA. The slow cleavage rate is due to a steric constraint imposed by the natural RNA sequence. The high magnesium optimum reflects the instability of an alternative secondary structure that must fom near the cleavage site dunng folding into the active conformation of the RNA. ACKNOWLEDGMENTS
1 extend my deepest thanks to Dr. Richard Collins for his advice, support and encouragement, and for making the last couple of years a great and memorable learning experience. In addition, 1 would like to thank my supervisory cornmittee members, Dr.
Alan Cochrane and Dr. Barbara Funnell, as they have been very helpful in guiding and supporting me thmughout my project. 1 am also grateful to the members of the Collins lab, both past and present: Angela Andersen, Shawna Hiley, Jonathon Maguire, Joan
Olive, Vanita Sood, Elisabeth Tillier and Ricardo Zarnel.
Finally, 1 am deeply thankful to my wonderful parents, Ching-Po and Tai-Kwan, my sister Grace and brother Kevin, for their never-ending love, support and encouragement.
iii TABLE OF CONTENTS
TABLE OF CONTENTS...... iv
LIST OF FIGURES...... , .. . . vi
INTRODUCTION ...... ,... 1
1. Role of Metal Ions in RNA Folding and Stability 3
II. Role of Metal Ions in RNA Catalysis 7
m.Neurospora VS Ribozyme 12
IV. Research Rationale 14
MATERIALS AND METHODS ...... 17
1. DNA Cloning 17
II. Synthesis of RNA by ln Vitro Transcription For CIeavage Reactions 20
III. Measurement of Self-Cleavage Rate Constants 2 1
IV. Measurement of k,, and [M~'+]ln 23
VI. Chernical Modification Structure Probing DEPC modification DMS modification
Flexible Single Stranded Linker Insertion Into GI1 - Longth Does Matter 26
Linker Insertion Mutants Have High Magnesiwn Optima Sirnilar 28 to that of GI 1
Disrupting HelLr la Lowers Magnesiurn Optimum 29 Mutationally Pre-Shijfing Helix Ib Lowen Magnesium Optimum 30
Chernical Modification Structure Probing of ANI6-Pre 32
DISCUSSSON ...... 35
1. Linker insertion Increases Cleavage Rate 35
II. Dismption of Helix Ia Lowers Magnesium Optimum 4 t
III. Re-Shifting Helix b Lowers Magnesium Optimum 44
REFERENCES...... , ...... 64 LIST OF FIGüRJ3S
Figure 1. Chemistry of Small Ribozyme Cleavage
Figure 2. Secondary Structure Mode! of G11 in the Absence and Presence of Magnesium
Figure 3. G1 I and H3
Figure 4. Secondary Structure Mode1 of Linker insertion Mutants
Figure 5. Linker Insertion Mutants and Their Effect on Self-Cleavage
Figure 6. Summary of Linker Insertion Mutants (25 mM M$+)
Figure 7. Cleavage is Independent of Ribozyme Concentration
Fipre 8. Increasing Linker Length Causes an Increase In Cleavage Rate With Little Effect on Magnesiurn Optimum
Figure 9. Secondary Structure Model of AN 16-H3
Figure 10. Dismption of Helix Ia bersthe Magnesiurn Optimum With Little Effect on the Maximal Cleavage Rate
Figure 1 1. Secondary Structure Model of Mutants With Constitutively Shifted Helix Ib (MCS)
Figure 12. Mutationally Pre-Shifting Helix Ib Lowers the Magnesium Optimum With Little Effect on the Maximal Cleavage Rate
Figure 13. DEPC and DMS Structure Probing of AN 16
Figure 14. Summary of k,, and mgt+]In
Fipre 15. Alternative Representation of the Secondary Structure of O1 1
Figure 16. Model of Putative Coaxial Stacking of Helix Ia on Helix Il INTRODUCTION --- For the longest tirne, proteins were thought of as the only molecules capable of
efficiently catalyzing chernical reactions. Then in the 1980's, the revolutionary discovery
of catalytic RNAs in the laboratories of Sidney Altman and Thomas R. Cech changed this
scientific view (Guemer-Takada et al., 1983; Kruger et al., 1982). These findings
indicated that, in addition to carrying genetic information, RNA molecules were also
capable of catalyzing phosphodiester bond cleavage in the absence of proteins. These
findings made previous proposals of an "RNA world", with RNA king the ancestral
molecule that gave rise to both DNA and proteins, more plausible (Gesteland and Atkins,
1993). Since the initiai discovery of catalytic RNAs, better known as ribozymes, a
number of naturally occumng ribozyme motifs have been discovered In addition, in vitro
evolution methods (Lorsch and Szostak, 1994; Tsang and Joyce, 1996) have been very
successhil in generating new ribozymes. Artificial ribozymes, which now exceed the
number of known natural ribozymes, have significantly extended the number of chemical
reactions thought previously to be only performed by proteins. These chemical reactions
include nucleophilic attack at phosphoryl, carbonyl and alkyl halide centers, as well as
metdation and isomenzation react ions (reviewed by Jaeger 1997).
Seven nanually occumng catalytic RNAs have ken identified to date and they have
been divided into two groups according to size: large and small. Group 1 and II introns
and ribonuclease P (RNase P) are grouped together as the "large ribozymes" because they
are several hundred nucleotides in length and more stnicturally complex than the small
ribozymes. Secondly, al1 three ribozymes cleave RNA to generate 5' phosphate and 3'
hydroxyl termini (reviewed by Cech 1993). The hammerhead, hepatitis delta virus (HDV), hairpin and Neurospom Varkud satellite (VS) ribozyme comprise the "small - -- ribozymes". These RNAs are between 50-150 nucleotides and are found in viral, virusoid,
or satellite RNA genomes where they process the products of rolling circle replication
into genome-length strands (Branch and Robertson, 1984). The general mechanism of
these ribozymes is a 2' oxygen nucleophile attacking the adjacent phosphate in the RNA
backbone, resulting in cleavage products with 2'.3'-cyclic phosphate and 5' hydroxyl
termini (Figure 1 ; Symons, 1992).
Just like the protein-folding problem, scientists have ken searching for rules to
predict the threedimensional structures of RNA from their primary sequences. By
cornparison, RNA folding is much simpler since only four nucleotides, each made of a
base, a ribose, and a phosphate, are used as building blocks of the structure. Nevertheless,
little is known about the relationship between structure and function. Although secondary
structures have ken elucidated for many of the known ribozymes, less is known about
the interactions goveming tertiary structure. Ribozymes have therefore proven to be
powerfbl tools in studying RNA structure-function relationships and RNA folding since
functionally important changes in structure can often be detected by changes in cataiytic
properties. As a result. much effort has ken focused towards elucidating elements of
RNA structure that exist in ribozymes as well as in how these structural elements
contribute to the catalytic function of the ribozyme.
in general, an RNA molecule can be thought of as possessing a hierarchical
structure in which the pnmary sequence determines the secondas, structure, which. in
mm, determines its tertiary folding, whose formation alters the secondary structure only
marginally (Conn and Draper, 1998). The pnmary structure of each ribonucleic acid is - characterized by the sequence of its four nucleosides: adenosine (A), guanosine (G),
cytidine (C) and uridine (U). The folding of the RNA chain, depending on its
sumundings, produces its secondary and tertiary structure. Short range base pairing
establishes the secondary structure of RNA while long range interactions detemine
elements of tertiary structure. There are four basic secondary stmcture elements in RNA
and include helices, loops. bulges and junctions (Tinoco and Bustamante, 1999). While
the helices are A-fom Watson-Crick duplexes, the loops, bulges and junctions are all
non-Watson-Crick regions terminated by one or more helices. Because the energies
involved in formation of the secondary structure are larger than those involved in tertiary
interactions, secondary structural elements cm exist and be stable by themselves (Tinoco
and Bustamante, 1999). On the other hand, tertiary structure elements involve interactions
arnong the secondary structure elements and stabilize the three-dimensional folding of the
RNA. They include triple strands, pseudoknots, kissing hairpins, bulge-loop complexes
and hairpin lwp-intemal loop complexes (Nowakowski and Tinoco, 1997).
1. Role of Metal Ions in RNA Folding and Stability
The central issue in the RNA folding problem is the "Levinthal Paradox". How does
a linear polyanionic chah of nucleotides fold in minutes or less despite the astronornical
length of time needed to search al1 potentiaily accessible conformational states? Unlike
protein folding where hydrophobic residues drive folding by burying themselves into the
core of the protein to hide from the aqueous environment (Creighton, 1993), RNA does
not have hydrophobic building blocks. On the contrary, RNA molecules are very polar.
One of the keys in driving RNA folding lies in metal ions reducing the electronic repulsion between closely packed negatively charged phosphates (Draper and Misra,
1998). Both monovalent and divalent ions can effectively stabilize RNA. However, the
unique role of divalent ions, especially magnesium ions, has always been particularly
evident. For example, divalent ions, as opposed to monovalent metal ions, affect the
tertiary folding much more than the secondary structure (Pan et al., 1993). Early studies
have shown that M~~'strongly stabilize native tertiary structure of tRNA even in the
presence of a large excess of monovalent ions (Cole et al., 1972). Therefore, an ongoing challenge has been to understand how divalent cations stabilize RNA.
In aqueous solutions, metal ions form coordination complexes with water or solutes.
The coordination number and coordination geometry depend on characteristics of both the metal ion and the ligands (Pan et al., 1993). Most aqueous divalent ions, such as magnesium, are hexacoordinated and surrounded with a shell of water molecules arranged at the apices of an octahedron. Conceptually, magnesium can interact with RNA in several distinct ways that are classified according to the strength of their interaction with the RNA. These include diffusely bound and site bound.
In diffuse binding, both monovalent and divalent salts can interact with the strong anionic field around the sugar-phosphaie backbone via Long range, non-specific
Coulombic interactions through solvent (Anderson and Record, 1995). This results in a high local concentration of cations (e.g. Na' or M~*+)accumulating around nucleic acids, forming a "delocalized" counterion atmosphere. Since the relatively weak interaction is through long range forces and not directly with individual nucleotides, the hydration shells surrounding the ion and the RNA remain intact. This counterion atmosphere is very important in neutralizing the repulsive charges of the phosphate backbone and allows the -- formation of stems and loops that make up the RNA secondary structure (Draper and Misra, 1998).
In site binding, metal ions are trapped near the surface of the RNA due to strong
local attractive foms (Misra and Draper. 1998). Depending on the hydration state, these
localized ions can be classified in two different ways. The first type is referred to as outer-
sphere coordination where there is disruption of al1 but the innermost hydration layer so
that the ion and a nearby RNA ligand share solvent shells. These ions are "trappe#' in the
strong electrostatic field surrounding nucleic acids that can be viewed as pockets of
negative charge created by the irregular shape of the molecular surface. In the second
type, an ion strongly interacts with the RNA directly by contacting a set of RNA ligands
with no intervening water molecules. This is referred to as inner-sphere coordination and
either one or more water molecules are removed from the hydration shell in the process of
binding. The very large cost of dehydration must be offset by both electrostatic and
nonelectrostatic interactions between the ion and the RNA.
The process by which secondary structure elements corne together to fonn tertiary
structure is still unclear. However, in well characterized systems such as the Teiruhymena
group 1 intron, studies show that site bound ions play a very important role in formation
and stabilization of RNA tertiary structure. Five magnesium ions were observed
crystallographically to bind in the PZabc subdomain where the two helical halves of the
P4-P6 molecule interact (Cate et al., 1997). These sites are clustered in a three helix
junction whose backbone is largely buried by the domain's tertiary structure. Since
single-atom changes in any one of the four experimentally accessible cation binding sites
abolished folding of both the junction and the entire P4-P6 domain, it has been coined a "metal ion core". These five magnesium ions bind to phosphate groups and bases that span 26 nucleotides and use a combination of inner-sphere and outer-sphere coordination to bind to RNA. Cate et al. have actually proposed that an ion core may be equivalent for
RNA folding to the hydrophobic core for protein folding (Cate et ai., 1997).
Although divaient metal ions are thought to play the leading role in stabilizing tertiary structure with monovalent metal ions king delocalized, this is not always the case. It has been shown that the hammerhead. hairpin and VS ribozyme cm fold into a functiondly active structure that displays respectable cleavage rates in the presence of only monovalent metal ions (Murray et al., 1998a). Secondly, in the crystal structure of the P4-P6domain of the Tetmhymena group 1 intron, a potassium ion was found bound to the functional groups immediately under both the J616a and J6a/6b platfoms (Basu et al.,
1998). A third potassium ion was also noted at a different position below the L5c platform. The ions associated with J6/6a and J6a/6b platforms each make fïve direct meial coordinations to the RNA: a phosphate oxygen and a 2' hydroxyl from the backbone between the two A's, the N7 and 06 positions of the wobble G and the 04 from a U immediately 3' to the G. These potassium ion binding sites are not only important for the folding of the P4-P6 domain, but also for the activity of the Azoarcirs group I intron (Basu et al., 1998). This is the first time that a particular function has been attributed to a monovalent cation.
In sumrnary, both monovalent and divalent metal ions stabilize RNA through delocalized, long range electrostatic interactions that help fom the secondary structure.
Site bound divalent rnetals play a major role in stabilizing RNA tertiary st~~cturethough monovalent metal binding sites with both structural and functional relevance do exist. II. Role of Metal Ions in RNA Catalysis
The notion that RNA could cataîyze chah cleavage was initially quite surprising since it lacks the diversity of functional groups characteristic of protein enzymes. In the case of protein ribonucleases such as RNase A, RNA hydrolysis occurs via acid-base catalysis in which one histidine imidazole group, acting as a general base, abstracts a proton from the 2' hydroxyl nucleophile while a second histidine, acting as a general acid, donates a proton to the 5' hydroxyl leaving group. The penta-coordinated phosphate of the transition state is thought to be stabilized by the positive charge of a nearby lysine side chain. In contrast, the pK. values of the free RNA nucleotides are outside the range considered useful for general acid-base catalysis at physiological pH (Narlikar and
Herschlag, 1997). In addition, no RNA groups are positively charged at neutral pH to stabilize the negative charge of the penta-coordinated phosphate of the transition state.
So how do ribozymes accomplish significant rate enhancements with cleavage king a factor of 10'- 1o6 greater than that of background hydrolysis (Hertel et al., 1997)?
One possibility is that the local environment perturbs the pl&, of nucleotides so they are brought into the range at which they could function in generd base catalysis. Catalytic mechanisms in which the local environment allows exocyclic amine functional groups to act as general bases have previously been proposed for two RNAs: the HDV ribozyme
(Pemtta et al., 1999) and an in vitro selected leadzyme (Legault and Pardi, 1997).
Another possibility is that divalent metal ions, particularly M~~+,play several roles in cataîysis. A metal ion coordinated to a hydroxide rnight activate a hydroxyl or water nucleophile by deprotonation, or a divalent ion might directiy coordinate the nucleophilic more - - oxygen, making the oxygen susceptible to deprotonation by hydroxide ions. Metal
ions also might stabilize the transition state by direct inner-sphere coordination to the
pentavalent scissile phosphate group and might stabilize the leaving group by protonating
or directly coordinating the leaving oxygen atom. Finally, metal ions might also stabilize
the transition state structure by donating positive charge (Doherty and Doudna, 2000).
It is known that metal ions are essentiai for folding and catalysis of ribozymes, but
their precise roles are still king questioned. It is difficult to distinguish between metal
ions that are involved in RNA folding and those that are involved in RNA catalysis.
Therefore, extensive research has gone into elucidating the role of metal ions in RNA
catalysis. I will surnmarize some of the findings on the mechanism of cleavage in the
Tetrahymena thennophila group 1 intron, hammerhead ribozyme and hairpin ribozyme.
Despite the large size and sophisticated higher-order structure of the group 1
Tetrahymena ribozyme, a lot is known about the mechanism of catalysis due to extensive
efforts over the past decade. The introduction of a sulfur atom to replace an oxygen atom
that has the potential to interact with a catalpically important metal ion has provided
considerable information about the sites at which functiond metal ions bind. One
interpretation of a reduction in cleavage rate in the presence of M~~+(the thio effect) and
the subsequent recovery in cleavage rate in the presence of ~n?+(the manganese rescue
effect) is the direct coordination of the oxygen atom in question with a metal ion. This
phenornenon cm be explained by the hard-soft acid base rule where a 'hard-acid', such as
~g*',prefers to bind to a 'hard-base' oxygen atom rather than a 'soft-base' sulfur atom.
In contrast, 'soft-acids', such as cd2+and ~n*+,prefer to bind to a 'soft-base' sulfur
atom. Therefore, in combination with metai-ion rescue experiments (Weinstein et al., 1997; Yoshida et al., 2000) and an innovative general fingerprinting technique by
Herschlag and CO-workers(Shan et al., 1999). a minimum of three metal-binding sites are believed to participate in catalysis. Tetrahymena ribozyme is now generally accepted as a metalloenzyme that operates via a double-metal-ion mechanism of catalysis. One metal acts as a general base that enhances the deprotonation of the 3' hydroxyl of the guanosine nucleophile and another metal acts as a general acid and stabilizes the leaving 3'-bridging oxygen of U(-1) in the transition state. The third metal is postulated to activate the nucleophile by interacting directly with the 2' hydroxyl of the guanosine cofactor.
Of the small nucleol ytic ribozymes, the rnost intensively studied is the hammerhead ribozyme. As a result, there are many lines of evidence that indicate at least one metal ion participating directly in the cleavage reaction. For example, the logarithm of the cleavage rate of the hammerhead ribozyme increases linearly with pHT with a slope near unity, suggesting that a single proton transfer is involved in the rate-limiting step (Dahm et al.,
1993). However, there has been an ongoing debate as to whether the catalytic reaction requires one or two metal ions and also their precise role. From flash-frozen unmodified hammerhead crystals, a metal ion was observed bound to the pro-Rp oxygen of the scissile phosphate and no metal ion was found near the leaving group in any subsequent structure (Scott et al., L996). This is consistent with coordination of M~~+to the pro-Rp phosphate oxygen seen in phosphorothioate rescue studies with ~n'+(Dahm and
Uhlenbeck, 1991; Scott and Uhlenbeck, 1999; Slim and Gait, 1991). Based on this crystal structure, Scott and CO-workersproposed that one M~~'ion aione could perform dl the necessary catalytic hinctions at the active site: one NIg*+ ion could be coordinated to the non-bridging phosphate oxygens (the pro-Rp phosphate oxygen), as well as to the 2' hydroxyl oxygen. Also, an outer-sphere water molecule on this M~*+ion could be in a position to donate a proton to the 5' oxygen of the leaving group. On the other hand, evidence for the two-metal-ion mechanisrn was obtained by Lott (Lott et al., 1998). was titrated into a hammerhead cleavage reaction in the presence of 8 mM M~*+ions. A bel1 shaped curve was obtained and interpreted in terms of two binding events: the fint was interpreted to be the replacement of the Mg2' ion bound at the 5' oxygen atom and the second to be the direct coordination of the La3+ ion at the 2' oxygen atom. With this al1 said, most recently it has been proposed that the majority of the catalytic interactions of the hammerhead ribozyme do not involve metal ions at al1 (Curtis and Bartel, 2001;
O'Rear et al., 2001). The hammerhead has been shown to be active in a wide rage of monovalent ions with the cleavage properties observed in monovalent cations very similar to those in divalent cations. The pH dependence of the reaction is similar in 10 mM M~~+.4 M Li+ and 4 M Na* (Curtis and Bartel, 2001). Since monovalent ions have little effect on the acidity of water molecules to which they are bound, this is not consistent with the hypothesis that a metal ion acts as a base in the catalytic reaction
(Curtis and Bartel, 2001). bstead, it is believed that the primary role of divalent metal ions in hammerhead ribozyme catalysis is to help the ribozyme fold into its active conformation.
There are several lines of evidence that suggest that divalent cations may not play a central role in catalysis for the hairpin ribozyme. Firstly, it wûs shown that the cleavage reaction in the presence of Mg2+ions was virtually pH-independent (Nesbitt et al., 1997).
Secondly. thme groups have independently confimed a lack of metal ion coordination in the rate-limiting step of the cleavage process using phosphorothioate substitution experiments. Both mixed (Hampel and Cowan, 1997) or resolved (Nesbitt et al., 1997;
Young et al., 1997) non-bridging sulfbr substitutions of the scissile phosphate led to changes in the cleavage rate that were much smaller compared to corresponding effects in the hammerhead ribozyme. Thirdly, the catalytic reaction proceeds efficiently in cobalt hexammine [CO(NH~)~]~*,an ion similar in size and geometry to a fully hydrated magnesium ion (Hampel and Cowan, 1997; Nesbitt et ai., 1997; Young et al.. 1997).
However, unlike magnesium, cobalt hexammine cannot form inner sphere coordinations with RNA functional groups since the amrnine ligands are substitutionaily inert (Cowan,
1993). This eliminates the possibility that metal bound hydroxide acts as a general base for removal of the proton from the 2' hydroxyl group. Fourthly, molar concentrations of monovalent rnetal ions and even ammonium ions also support hairpin ribozyme activity
(Murray et al., 1998a). This is evidence that non-specific, electrostatic interactions stabilize the functional stmcture but that catalytic chemistry requires no direct, specific cation interactions. Lastly, the recent crystal structure of the hairpin ribozyme-inhibitor complex shows that the active site consists entirely of RNA (Rupert and Ferre, 2001).
Neither multiwavelength anomaious dispersion (MAD) nor model-phased electron density maps show features that could correspond to tightly baund metal ions in the vicinity of the scissile bond. Rupert et al. (2001) do however suggest certain active site residues that might be catalyzing the ligation reaction. G8 and A38 could be functioning as a general acid and a general base analogous to His 12 and His 1 19 respectively in RNase
A.
In summary, at least three metal binding sites are believed to catalyze the
Tetruhymena group I ribozyme cleavage reaction while there is still no cornplete -- agreement on the number of ions and their manner of involvement in the harnmerhead ribozyme. On the other hand, the hairpin ribozyme can perform site specific RNA
cleavage in the absence of inner sphere metal ion coordination.
m.Neurospora VS Ribozyme
VS RNA is a satellite RNA found in the mitochondria of the Varkud 1-c strain and
other natural isolates of Neurospora as an 881 nucleotide single stranded circular
molecule (Saville and Collins, 1990). In vitro, VS RNA has been shown to catalyze site
specific self-cleavage and self-ligation reactions (Saville and Collins, 1991). In vivo,
these reactions are hypothesized to be part of the replication system of this "selfish"
catalytic RNA. Of the 881 nucleotides, the minimal contiguous region required for self-
cleavage is 154 nucleotides and corresponds to one nucleotide upstrearn and 153
nucleotides downstream from the cleavage site (Guo et al., 1993).
The most extensively characterized region of VS RNA is contained within a RNA
molecule narned G1 1-Pre (Figure 2). This RNA contains nucleotides 61 7 to 783 of the
complete VS sequence with cleavage producing a 13 nucleotide upstream product (P) and
a 163 nucleotide downstream product @) (Guo et al., 1993). Like other smdi ribozymes,
VS performs the same type of RNA cleavage, leaving products with 2',3'-cyclic phosphate
and 5'-OH termini (Saville and Collins, 1990). However, the VS ribozyme has little in
common with other small ribozymes as both the sequence and secondary structure are
quite different. In addition, there is little, if any, pH effect on the cleavage rate between
pH 5.5 and 8.9 (Collins and Olive, 1993; Guo and Collins, 1995). This suggests that a rate-limiting step precedes the cleavage step and rate of chemistry has not been reached yet.
The secondas, structure of Gll-Pm was elucidated using chernical structure probing and mutational analysis (Beattie et al., 1995). It consists of six helical elements numbered I through VI (Figure 2). Using deletion analysis, it was also discovered that five out of the six helices could be shortened without loss of activity with the catalytic core located within a region of no more than 121 nucleotides (Rastogi and Collins, 1998).
Through damage selection and mutational data, helix Ia was identified as a structural element that inhibits the self-cleavage reaction (Beattie and Collins, 1997; Rastogi and
Collins, 1998). RNAs that lack a stable helix Ia cleave at least 10-fold faster than G11-
Pre.
As with other self-cleaving ribozymes (group 1 and 11 introns. hammerhead, hairpin and HDV), the VS ribozyme can be separated into two domains to study the intennolecular reaction (Guo and Collins, 1995). A tmns-cleavage system was engineered by separating the cisîleaving RNA molecule between helical regions 1 and II to generate a substrate consisting of helix 1, and a ribozyme consisting of the remainder of the RNA, helices Ki through VI. Unique among the small ribozymes, recognition of the subsuate
RNA by the VS ribozyme is through tertiary interactions since the substrate stem-loop has no long regions available for Watson-Crick base-paring with the ribozyme. Using this trans-system, a KM of -0.13 mM and a keî< of -0.7 min" have ken determined (Guo and
Collins, 1995).
Two important tertiary interactions have been identified in the VS ribozyme. The first is a long range three base-pair pseudoknot between G630, U631 and C632 of lwp 1 -- and C699, A698 and (3697 of lwp V, respectively (Figure 2; Rastogi, Beattie et al. 1996).
This pseudoknot has ken shown to be required for the self-cleavage reaction to proceed.
The second is a secondary structure remangement of stem lwp I on tertiary structure
formation (Figure 2; Andersen and Collins 2000). In the absence of divalent metal ions,
the structure of helix Ib is such that G623 base pairs with C636, G624 with C635 and
G625 with C634. However, in the presence of divalent metal ions, helix Ib is reananged
such that C634 is bulged oui of the helix and C635, C636 and C637 shift up one base pair
relative to the 5' side of the helix.
IV. Research Rationale
RNA molecules can form complex secondary and tertiary structures that are
intimately linked with their functions in vivo. With the determination of several crystd
structures of various RNA fragments and RNA-ligand complexes, the recurrence of
certain motifs suggests that complex functional RNA molecules may be composed of a
relatively small number of RNA "building blocks" (Nowakowski and Tinoco, 1997). One
optimistic view is once this "language" of structurai motifs is understood, the secondary
and, more significantly, the tertiary structures of RNAs could be predicted from the
primary sequence alone. As a result, much effort has been focused towards elucidating
elements of RNA structure that exist in ribozymes as well as in how these structural
elements contribute to the catalytic hnction of the ribozyme. With this said, a driving
force in our lab has always been the establishment of structure-function relationships in
the VS ribozyme. One structural feature in the VS ribozyme that has been of great interest is helix la.
Several pieces of data in our lab have implicated this helix as an inhibitory sttucniral
element that lirnits the cis-cleavage reaction in wild-type Gl 1. For example, a chernical
damage selection (modification interference) assay that identifies functionally important
nucleotides and structural elements had found a cluster of bases whose modification
significantly enhanced cleavage (Beattie and Collins, 1997). These bases were clustered
on the 3'-side of helix Ia and in the adjacent region of helix II. Secondly, a mutant by the
name of H3 that had only 3 nucleotides upstrearn of the cleavage site and does not form
helix Ia had cleavage kinetics that were quite different than that of G11. When assayed
for cleavage activity, H3 cleaved several-fold faster than G 1 1 (Rastogi and Collins.
1998). in addition, the concentration of magnesium needed to elicit maximal cleavage
activity in H3 was much lower than required for G11 (Rastogi and Collins, 1998). At the
time, base pairing of helix Ia was hypothesized to be interfering with the folding of the
RNA into the active conformation and therefore responsible for the slow cleavage kinetics of 01 1. This idea was supported by mutation experiments in which the bottom two base pairs or the closing base pair of helix la were disrupted and then restored by compensatory changes. Cleavage rate was increased compared to Gl 1 by the disruption whereas compensatory mutations that restored the base pairs had cleavage rates similar to
G 1 1 (Rastogi and Collins, 1998).
Another interpretation of the increased cleavage rate exhibited by H3 is that the disruption of helix Ia creates a long, flexible, single stranded linker between stem-loop I and the rest of the ribozyme (Figure 3b). My project involved testing the latter hypothesis to examine why disruption of helix Ia causes both an increase in cleavage rate and u
lowered magnesium requirement for maximal activity. MATERIALS AND METHODS
1. DNA CIoning
DNA-fragments for the cloning of G 1 1-36, ANX28, AN 16-H3,AN 16-MCS,G 1 1 -
MCS, H3-MCS and ANl6-H3-MCS mutants were obtained by amplification of specific
DNA sequences by using polymerase chain reaction (PCR) with Taq polymerase and synthetic oligonucleotides essentially as performed by Beattie (1997). Primers AP-1,
Gl I-ANX and 6340-Gl1 contain the desired mutations, as well as upstrearn vector nucleotides and a HindIII site for cloning; primers H3-tail and 634G-H3 contain an additional T7 promoter consensus sequence for transcription.
Table 1: VS Clones Used in this Study
RNA Rimer Correspands Rimer Squence DNA Template Mddt to VS (mutaîions ancapitolized anà underlintd) & PCR Nucleoddw . Awaiing Temp G11Snt AP- 1 617-660 S'gaaagcttgcgaagggcgtcgtcgccccgagcg @CAcagtaagcagggaactc 3' W L ANX28 G1 1-ANX 6I 7-660 S'gaaagcttgcgaagggcgtcgtcgccccgagcg
ACTCTAGagtaagcagggaactc 3' AN16-H3 6 1 8-629 5 'gggaagc ttt aatacgactcac tat agdgaaggg AN 1 cgtc 3' 40°C G t 1-MCS
ANI 6- MCS - - H3-MCS 6 18-653 S'gggaagctttaatacgactcac tatagdgaaggg H3 cgtcgtcg;bcccgap;cgg 3' 48°C ANl6-H3- 6 18-643 sarne as above AN16
10 ng of template DNA (refer to above table) was added to the PCR reaction and amplified with each of the above primers containing the mutations. PCR reaction mixtures (100 pL) contained 50 mM KCl, 10 rnM Tris-HCl pH 8.0,O.1 96 Triton X- 100, 1.5 rnM MgC12, 20 pM primer, 2 pli4 forward sequencing primer, 25 mM each dNTP and
0.5 U of Taq polymerase. The DNA was amplified with 30 PCR cycles consisting of a denaturing step of 94OC for 1 min, an annealing step for 2 min (refer to table for temperature) and an extension step at 72'C for 3 min.
Following the DNA amplification, PCR products were treated with proteinase K to remove the Toq polymerase. Proteinase K reaction mixtures (100 pL) contained the PCR products, 10 rnM Tris-HCI pH 8.0, 5 rnM EDTA, 0.5% SDS and 8 pg of proteinase K.
After 30 min of incubation, the mixtures were extracted once with pheno1:chloroform: isoamyl alcohol (phenolICIA), once with chloroform:isoamyl alcohol
(CM) and ethanol precipitated. The RNA was resuspended in 20 pL water.
After treatment with proteinase K. 8 pL of PCR products were incubated in 100 pL total volume with EcoM and HindIIi in Pharmacia One-Phor-Ml buffer for 2 hours at
37°C. The mixtures were then extracted once with phenoVCIA, once with CM,ethanol precipitated and resuspended in 5 pL water.
Fragments were cloned either into the plasmid pUCl9 (AN16-H3, H3-MCS and
AN 16-H3-MCS fragments) or plasmid pTZl9R (al1 remaining fragments) that have been cleaved to expose the respective HindIii and EcoRI restriction sites as performed by
Beattie (1997). Ligation mixtures (10 pL) contained 0.4 pg of plasmid vector DNA, 3 pL of insert DNA, 25 mM Tris-HCI pH 7.6, 10 mM MgCl*, 1 mM ATP, 1 mM DTT and were incubated for 10 min at 65°C before 1 U of T4 DNA ligase was added. Ligation reaction mixtures were incubated for 2 hours at room temperature and then diluted to a final volume of 50 @. 1 pL of the diluted ligation mixture was used to transfomi
Escherichia coli strain DHSaF' using protocols described by BRL Life Technologies. --.. - Positive clones were identified on the basis of bludwhite selection and plasrnid DNA was
pnpared by alkali lysis. The Sanger sequencing method confirmed identity of positive
clones.
ANX28 was designed with 3 unique restriction enzyme sites with compatible
overhangs in the linker sequence:
5'. ..gtCACCTAGGAACAACGCTAGCAACTCTAGap.. .3'. The restriction sites are
underlined and from left to right are AvrII, NheI and XbaI; upper and lowercase represent
inserted linker and VS nucleotides respectively. Depending on the combination of
restriction enzymes used, linken of different lengths can be made after religation.
Unfortunately, after perforrning diagnostic digests on ANX28 DNA, it was discovered
that a second XbaI site existed at the very 3' end of the RNA molecule. Since a BamHI
restriction site exists just 5' to this second XbaI site, ANX28 DNA was digested in 100
pL total volume with BamHI in NEB Buffer #2 and BSA for 2 hours at 37OC to rernove
this second XbaI site. The mixture was then extracted once with phenolICIA, once with
CIA, ethanol precipitated and resuspended in water. This RNA molecule will be referred
to as ANX28-BarnHi.
AX7 and AN16 were cloned by digesting ANX28-BmHI DNA in 100 pL total
volume with AvrII and either XbaI (for AX7) or NheI (for AN 16) in NEB Buffer #2 and
BSA for 2 hours at 37OC. The mixtures were extracted once with phenoVCIA, once with
CIA, ethanol precipitated and resuspended in water. Ligation reaction mixtures (10 pL)
contained 0.4 pg of the digested DNA, 25 rnM Tris-HCI pH 7.6, 10 mM MgC12, 1 rnM
ATP and 1 mM Dm.Rotocols for ligation incubation and transformation were the sarne as above. Positive clones were identified using diagnostic digests and verified by Sanger sequencing method.
AXl 1 was obtained by digesting ANX28-BamHI DNA in 100 pL total volume with
AvrIi and XbaI in NEB Buffer #2 and BSA for 2 hours at 37OC. The overhangs were then filled in with the Klenow fragment of DNA polymerase 1 in the presence of dNTPTs.
These mixtures (50 pL) contained 1 pg digested DNA, 1 rnM each dNTP, NEB Buffer ##2 and 1 U DNA polymerase 1. After 30 min at 37"C, mixtures were extracted once with phenoVCiA, once with CIA, ethanol precipitated and resuspended in water. Ligation and transformation protocols were same as above and positives clones were again verified using Sanger sequencing method.
a. Synthesis of RNA by In Vitro Transcription For Cleavage Reactions
Radioactive precursor RNAs were synthesized using Gl I (Guo et al., 1993), H3
(Guo et al., 1993), Gll-MCS, H3-MCS or linker insertion plasrnids (or mutant derivatives) that were linearized at the SspI site at VS nucleotide 783 as performed by
Collins and Olive (1993). In vitro transcription reaction mixtures (100 pL) contained 40 mM Tris-HCI pH 8.0, 125 mM NaCl, 2 mM spermidine, 4 mM DTT, I mM each NTP,
50 pCi of [a-32~]-~~~(10 mCilrnL, 3000 CVmmol; Amenharn), 200 units of RNAguard
(Phannacia), 250 units of T7 RNA polymerase (BRL)and 2.5 mM MgCl*. To inhibit self-cleavage during transcription of RNAs, an antisense oligodeoxynucleotide complementary to VS nucleotides 648-662 (on the 5' side of stem II and IIî) was included at a concentration of 0.5 ph4 to prevent the ribozyme from folding into its native structure. Mixtures were incubated at 37°C for 1.5 hours. After ethanol precipitation, the RNA was dissolved in RNA loading dye (80% v/v formamide, 50 mM EDTA,0.5X TBE,
0.05% each of xylene cyan01 and bromophenol blue) and purified by electrophoresis through a 4% polyacrylamidel8.3 M urea gel (for H3 and H3 like mutants, a 6% polyacrylamide/8.3 M urea gel was used). Full length precursor RNA was located by UV shadowing, excised and crushed and eluted for 60 min at 6S°C in water. Eluted RNA was
Filtered through a 0N0.2 pm Acrodisc (Gelman Sciences) membrane to remove polyacrylarnide, precipitated twice with ethanol and dissolved in water. The RNA concentration was determined by UV absorbance at 260 nm.
III. Measurement of Self-Cleavage Rate Constants
In al1 time courses, 10 nM RNA, except where inaicated in Figure 7, was preincubated at 37OC for 5 min in cleavage buffer (40 mM Tris-HCl pH 8.0 and 50 mM
KCl). Reactions were initiated by the addition of MgCI2, which was also preheated to
37OC for 5 min, to a final concentration as described in individurl figures. Aliquots of 4 pL were removed afier times specified in the figures and mixed with lOuL of RNA loading dye. RNAs were separated by electrophoresis on a 4% polyacrylamidel8.3 M urea sequencing gel. h order to 'hiple load" r 4% polyacrylamidef8.3 M urea sequencing gel, the first set of sarnples were electrophoresed for 40 min before loading the second set of samples; after another 40 min, the third set of samples were loaded; lastly, the third set of sarnples were electrophoresed for 60 min to separate precursor from downstrearn cleavage proâuct.
After gels were scanned using a PhosphorIrnager and quantified using
ImageQuan0.3 (Molecular Dynamics), the fraction of RNA cleaved was plotted versus L fitted to either a monophasic or biphasic equation. the monophasic fit had - time and If an
r2 5 0.95, then a biphasic fit was used. The monophasic equation was:
f = f, - ae'-"'
where f, is the total fraction of RNA cleaved when time is a. and a is the fraction of
RNA cleaving at rate constant k in min". For biphasic reactions, the double exponential
equation was:
f =f,. -ale (-kt0 -
where f,, is the total fraction of RNA cleaved when time is -, a, is the fraction of RNA
cleaving at rate constant kl in min" and a2 is the fraction of RNA cleaving at rate constant
k2 in min-'. These parameters were estimated by nonlinear regression andysis using
SigmaPlot 5.0 software.
AXl 1, AN 16, ANXZS, AN lbH3, AN 16-MCS and AN16-H3-MCS displayed
biphasic cleavage kinetics and were fit to a biphasic equation with an r2 2 0.99. Unless
otherwise stated, the rate of the faster cleaving phase is shown in figures and used in the
calculation of km, and lin.
Note that throughout my thesis, 1 will refer to the rate constant as just simply rate.
Secondly, this rate is an apparent rate coiistant as it is unclear what contribution the
reverse ligation reaction has on the arnount of cleavage generated. IV. Measurement of k, and [blg2+]in
Al1 plots of rate versus magnesium concentration were fit to a sigrnoidal curve. This particular equation was used because al1 plots fit with an r2 of 0.95 or better. The equation was:
where k,, is the maximal rate under saturating magnesium in min-', is the concentration of magnesium at which half-maximal rate was observed and y is the rate constant in min" of a reaction done at x rnM of magnesium. These parameters were estimated by nonlinear regression analysis using SigmaPlot 5.0 software.
V. 3'-End-Labeling of RNAs
In vitro transcription was performed as described above except that no [d'pl-GTP was included. Gel-purified RNAs were 3'-end-labeled with 5 pg of RNA and 50 pCi 5'-
[''P]-~c~in a 20 pL reaction mixture which included 0.1 M ATP, 50 mM HEPES pH
7.5, 3.3 rnM Dm, 20 mM MgCI2, 0.2 pg BSA, 10% DMSO,40 units of RNAguard and
60 units of T4 RNA ligase (BRL).The reaction mixture was incubated for 2 hours at 4OC.
Precursor RNAs were gel purified once more by gel electrophoresis as described above.
VI. Chemical Modification Structure Robing
Chemical modification reactions with diethyl pyrocarbonate (DEPC)or dimethyl sulfate OMS) were performed essentially as described by Kr01 and Carbon (1989) and later adapted by Beattie (1997). Modifications were perfomed under either denaturing conditions at 9S°C (in 200 mM HEPES pH 8.011 mM EDTA) or non-denaturing conditions at 37OC (in 200 mM HEPES pH 8.0150 mM KCl) in the presence or absence of various concentrations of CO(NH~)~C~~(see individual figure for metal ion concentrations). The HEPES buffer was adjusted to pH 8.0 ai 2S°C with NaOH. For the chemical modifications, approximately 0.2 pg of RNA was pre-incubated for 5 min at
37'C in the appropriate buffer with a final volume of 200 pL (for non-denaturing reactions) and 300 pL (for denaturing reactions) before the addition of modifying reagent
(see below).
DEPC Modification
For DEPC reactions, 10 pL (non-denatured reactions) or 5 p.L (denaturing reactions) of DEPC was added to RNA and buffer for 15 min or 7 min, respectively. The reaction mixtures were stopped on ice, followed by the addition of 3 pg of yeast carrier tRNA and the RNA was precipitated with 1110" volume of 3 M sodium acetate pH 5.2 and 3 volumes of ethanol. The chemically modified RNA was resuspended in 20 pL of 1.O M aniiinelacetate buffer pH 4.5 and incubated for 15 min at 60°C in the dark. Reactions were terminated by placing them on ice and then evaporated to dryness. The products were resuspended in RNA loading dye (80% vlv formamide, 50 rnM EDTA, 0.5X TBE,
0.05% each of xylene cyan01 and bromophenol blue) and separated by gel electrophoresis.
Short gel runs were performed at 65 W on 12% gels pre-nin for 1.5 hours with 1 M
NaOAc in the bottom buffer to generate a salt gradient. Long runs were performed on 8% gels run at 65 W in the absence of a salt gradient. DMS Modification
For DMS reactions, 0.5 pL of DMS was added to RNA and buffer and was incubated for 15 min (non-denatured reactions). The reactions were stopped on dry icelethanol. followed by the addition of 5 pg yeast carrier tRNA and the RNA was precipitated on drylice ethanol with 1110~volume of 3 M sodium acetate pH 5.2 and 3 volumes of ethanol. The precipitated pellet was resuspended in 10 pL of icesold 50%
(v:v) hydrazine:liO% (v:v) water and was incubated on ice for 5 min. The RNA was then precipitated with 100 pLof 30mM NaOAc and 300 pL ethanol on dry ice/ethanol. The pellet was rinsed with 70% ethanol and then treated with aniline as described for the
DEPC modification reactions. The RNA was subsequently resuspended in RNA loading dye and separated by gel electrophoresis as described for DEPC modification.
A CRI ladder was made by first evaporating to dryness approximately 0.2 pg of
RNA with 10 pg of yeast carrier tRNA. The pellet was then resuspended in 10 pL of ice- cold 1 mL hydrazine with 0.2 pg NaCl and incubated on ice for 15 min. Following the hydrazine reaction, the RNA was precipitated with 100 pL 300 mM NaOAc and 300 pL ethanol on dry icelethanol. The pellet was nnsed with 70% ethanol and then treated with aniline as described above. RESULTS
Flexible single stranded linker insertion into GI I - Length Does Matter
Stem-lwp 1 of G 11 may be subdivided into helices la qdIb which are separated by an interna1 loop that contains the site of cleavage (Figure 2). The H3 RNA molecule is identical in sequence to G11 with the only difference king that the 13 nucleotides upstream of the cleavage site in Gl 1 have been replaced with GGG in H3, which disrupts the base pairs present in helix Ia of GI 1 (Figure 3). The original characterization of H3 was peifomed in the presence of 2 rnM spermidine (Rastogi, 1998). It was shown in G11 that stimulation by spermidine and KCI are not additive presumably because both act as structural counterions to facilitate folding of the RNA (Collins and Olive. 1993).
Therefore, in order to detennine the effect of only KCI and magnesium on the self- cleavage reaction, 1 examined the cleavage kinetics of both G 1 1 and H3 in the absence of spermidine. Activity of H3 was detectable at a much lower concentration of magnesium than required for 011 (Figure 3, compare the cleavage rate of H3 at 1 rnM M~'+versus
GI I at 5 mM M~~').In addition, H3 required a lower magnesium concentration for its maximal rate (henceforth referred to as magnesium optimum) and cleaved approximately
6-fold faster than did Gl 1 at optimal magnesium concentrations (Figure 3, compare H3 at
17 rnM M~"versus 011 at 75 mM ~~~f).These results for H3 were consistent with those originally characterized in the presence of spermidine and confïrmed that KCI and magnesium (without spermidine) were sufficient for cleavage activity.
To test the hypothesis that H3 displays an increase in cleavage rate due to the 3'- side of helix Ia acting as a single stranded linker, 3 nucleotides were inserted between helix la and 11 in G 11 to create 011-3nt (Figure 4). My hypothesis predicted that G11-3nt would behave similarly to 01 1 since helix Ia was still present. Under standard cleavage conditions of 40 rnM Tris-HCl pH 8.0,50 mM KCI and 25 mM MgCl?, Gl l-3nt cleaved with a rate similar to that of Gl 1 (compare Figure Sa & b). To rule out the possibility that a 3 nucleotide insertion was not long enough to cause the cleavage kinetics seen in H3, an even longer linker was inserted (Figure 4). This linker was designed with two criteria.
First, its length could be easily changed, which was achieved by introducing unique restriction enzyme sites into the 28 nucleotide linker (see Materials and Methods).
Second, the linker would stay single stranded and flexible when the rest of the RNA folds into its secondary structure. By using Mike Zuker's mfold program (Mathews et al., 1999;
Zuker et al., 1999)' 1 designed a linker that was predicted to stay mainly single stranded.
The inserted linker was probably not as single stranded as predicted by mfold.
AX 1 1, AN 16 and ANX28 cleavage under standard conditions did not fit well to a monophasic, single exponential analysis but instead to a biphasic, double exponential one
(Figure 5d-0. For example, 76% of AN16 existed in a faster cleaving conformation that cleaved at 5.01 min-' and another 15% that cleaved at 0.21 min-'.This suggests that more than one conformation may have existed when the RNA was folded. These results are not surprishg since the longer Wrshave a higher chance of base pairing with thernselves or with other parts of the ribozyme (such as the 5' vector sequence). It is conceivable that the faster cleaving phase consisted of molecules with an extended linker while the slower cleaving phase consisted of molecules with misfolded linkers that may be interferhg with the cleavage reaction.
Due to the fact that AXl 1, AN16 and ANX28 did not fit well to a single exponential analysis, 1 wanted to verifj that the cleavage reaction was still an u- - intramolecular one. Instead of perfonning full time courses at different RNA
concentrations to obtain rates, one time point at different RNA concentrations was taken
for each of the RNA molecules (Figure 7). The fraction cleaved at 5, 10, 50 and 500 nM
RNA was approximately the same for each RNA molecule and varied less than 35% for
AX 11, 30% for AN 16 and 20% for ANX28. Since the time point chosen was close to
where 50% of the substrate was cleaved, this reflects mostly the rate for the faster
cleaving phase and suggests that the initial cleavage rates were very similar even at
different RNA concentrations. Thus, cleavage rate was independent of ribozyme
concentration and consistent with intramolecular cis-cleavage.
Overall, even if we consider only the monophasic fits for AX 1 1, AN 16 and ANX28,
it is clear that under standard cleavage conditions of 25 mM MgCl?, the cleavage rate
increased as the linker length increased, (Figure 5, 6). The minimum number of inserted
nucleotides required to increase the cleavage rate was between 4 and 7 nucleotides,
suggesting that a steric constraint imposed by the natunl RNA sequence is removed once
a minimum length of linker is achieved.
Lùiker insertion mutants have high magnesiwn optima similur tu thut of Gf 1
RNA molecules, such as H3, that lack or disrupt helix Ia exhibit both an increased
cleavage rate and lower magnesium optimum compared to ones that have helix Ia. if a
linker completely mimics the disruption of base pairs in helix Ia, linker insertion mutants
should be active in much lower concentrations of magnesium than those required by Gl 1.
Therefore, time courses at different magnesium concentrations were perfomed to obtain
rates, which were fit using SigmaPlot to a sigrnoidal curve (see Materials and Methods). Since AXI 1, AN16 and ANX28 displayed biphasic cleavage kinetics, rates for the faster - - cleaving phase were used in the nonlinear regression analysis.
The maximal cleavage rate when magnesium is saturating (k,,) can be easily
compared between RNA molecules in Figure 8a. Consistent with results seen at 25 mM
MgC12, the km increased as the linker length increased. However, once a certain length
of linker had ken reached, the k-s were approximately the sarne and varied less than
20% (compare the k-s of AXl 1. AN16 and ANX28). The fast cleavage rate of 7-8 min-'
suggests that a new rate-limiting step had been reached. It is possible that linker insertion
mutants cleave at chemistry with a direct involvement of hydroxide ion in cleavage.
To compare the magnesium optimum between RNA molecules, the concentration of
magnesium required for half maximal cleavage rate ([M~~+]~/~)was used. Rates from
Figure 8a were expressed as a fraction of the maximal cleavage rate and normalized as
shown in Figure 8b. The [M~*+],,zfor each linker insertion mutant was approximately the
same and also not significantly different from Gl 1. The difference in [M~~+]~Ebetween
any of these RNAs was less than two fold with the only exception king 14x11. % had a
high [~~~+li~of 4 1.7 mM. Nevertheless, linker insertion mutants and G 1 1 required
approximately 5- 10 times more magnesium to achieve maximal cleavage rate than H3.
Disrupting helk la lowers magnesium optimum
Since linker insertion mutants did not show a lowered magnesium optimum as
hypothesized, AN 16 was chosen as a parent molecule in which to make further mutations.
I chose AN1 6 because a 16 nucleotide linker insertion was long enough to overcome the
rate-limiting step present in Gl i and elicit an increase in cleavage rate. In addition, the probability of the linker misfolding in this context was low since ANX28 (a 28 nucleotide
insertion) displayed a cleavage rate that was also several fold faster than that of GI 1.
Helix Ia in AN16 was disrupted to create AN16-H3 (Figure 9) with the expectation that it
would require lower magnesium concentrations for maximal cleavage rate relative to G 1 1
and to linker insertion mutants that have a helix Ia.
Rates of cleavage for AN16-H3 were determined at different magnesium
concentrations. Since AN16-H3 displayed biphasic cleavage kinetics, rates for the faster
cleaving phase were used in the nonlinear regression analysis. As predicted, AN16-H3
required less magnesium to reach its maximal cleavage rate cornpared to AN16. Its
[M~~+]~~was almost identical to that of H3 (Figure lob). The km of AN16-H3 was
higher, but only by approximately 1.7-fold than that of AN16 (Figure IOa). This increase
in cleavage rate may be explained by the lengthening of the existing linker by 4
nucleotides when helix la is disrupted.
In conclusion, disrupting helix Ia was able to lower the magnesium optimum with
small affects on the cleavage rate. In essence, 1 have been able to identify separate structural causes for the slow cleavage rate and high magnesium optimum of Gl 1. Both
H3 and AN16-H3 showed an increase in cleavage rate and lowered magnesium optimum due to the combined effects of a linker and disrupted helix Ta.
Mutationally pre-shifiing helk Ib lowers magnesium optimum
Recently, it has been shown that secondary structure rearrangement of helix Ib in the presence of magnesium is essential for the cleavage reaction to take place (Andersen and Collins, 2000). 1 hypothesized that H3 and RNA molecufes that disrupt helix la are -- able to undergo this conformational change more readily since helix Ia, a rigid structure
that might be inhibiting this rearrangement, has ken nmoved. With this in mind, 1 tested
whether secondary structure rearrangement rnight be responsible for the high magnesium
optimum seen in 01 1 and linker insertion mutants that contain helix Ia. Through
chemical modification structure probing, it has ken shown that a C634G mutation causes
secondary structure rearrangement of helix Ib even in the absence of divalent metal
cations (Andersen and Collins, 2000). 1 therefore mutationally shifted helix Ib
constitutively in G 1 1 and AN 16 to create G I 1-MCS and AN 16-MCS, respectively
(Figure 1lb & d). I expected these new mutants to have a low magnesium optimum but a
kW very similar to their non-shifted counterparts.
Self-cleavage time courses at different magnesium concentrations were performed
on G 1 1-MCS and AN 16-MCS and rates were detemined. Since AN 1 6-MCSdisplayed
biphasic cleavage kinetics, rates for the faster cleaving phase were used in the nonlinear
regression analysis. As predicted, mutationally pre-shifting helix Ib in G 1 1 and AN 16 had
a small affect on km, with less than a two-fold increase (Figure 121 & c). On the other
hand, the magnesium requirement for maximal cleavage rate of G 1 1 -MCS and AN 16-
MCS was lowered several fold with a [~~~qinlower than thiit of H3 and AN l6-H3,
respectively (Figure 12b & d). Therefore, mutationally pre-shifting helix b alone with a
stable helix Ia present lowered the magnesium optimum.
To further investigate and confinn whether disrupting helix Ia and mutationally
shifting helix Ib are one and the same phenornenon, double mutants in 01 1 and AN16
were made that contained both a disrupted helix Ia and mutationaily pre-shifted helix Ib
(H3-MCS and AN16-H3-MCS, respectively). If the lowered magnesium optimum observed in each mutant represented a unique and distinct effect, 1 anticipated observing a EL-
significantly lower magnesium optimum in the double mutant than in either single
mutant. On the other hand, if both mutations caused the sarne single phenomenon, 1
expected to see no further decrease in magnesium optimum in the double mutant
compared to the single mutants. Both double mutants ANl6-H3-MCS and H3-MCS
exhibited a [M~'+]I~that was slightly (less than 1.5-fold) lower than either of their
respective single mutants (AN 16-MCS and G1 1-MCS; Figure 12b & d). Therefore, it was
difficult to conclude whether disruption of helix Ia and pre-shifting helix Ib are the same
or different phenomenon.
Chernical Modification Structure Probing of ANI6-Pre
The only evidence that AN16 has a single stranded linker is through Mike Zuker's
mfold program (Mathews et al., 1999; Zuker et al., 1999). To verify that the 16 nucleotide
linker was indeed single stranded, chemical modification structure probing using diethyl
pyracarbonate (DEPC)and dirnethyl sulphate (DMS)were performed on AN 16 precursor
RNA (AN16-Pre). DEPC modifies the N7 position of adenosine nucleotides unless the
base is either stacked in a helix, involved in tertiary interactions or involved with a direct
metal coordination (Krol and Carbon, 1989). DMS modifies the N3 position of cytosine
nucleotides unless this position is involved in a hydrogen bond, such as in Watson-Crick
base pairing (Krol and Carbon, 1989). Therefore, there are a total of 1 1 such adenines and
cytosines within the 16 nucleotide linker to monitor whether the linker stays single
stranded when the rest of the RNA fol& into its secondary structure. A major problem with experiments that probe the structure of the fully folded precursor in the presence of magnesium is that cleavage occurs, leading to a mixed population of cleaved and uncleaved RNAs. An alternative solution is to use cobalt hexammine, a structural analog of fully-hexahydrated magnesium. Recent work has shown that Gl1 does not cleave when cobalt hexammine is the sole polyvalent cation.
Although there are subtle differences in chemical reactivity that are displayed by certain nucleotides in cobalt hexammine relative magnesium, both metal ions induce similar tertiary structure in Gl ID (Maguire, 1999). Through mixed-metal kinetic experiments in the presence of both cobalt hexammine and magnesium, it has been shown that the RNA does fold into a hinctionally relevant structure that self-cleaves (Maguire, 1999). This showed that the differences in chemical reactivity of certain nucleotides are not reflective of structure that is detrimental to catalytic function. With this in mind, 1 perfonned DEPC and DMS modification over a range of cobalt hexarnmine concentrations to study AN 16-
Pre. if the linker was single stranded, I would expect to see reactivity for each of the adenines and cytosines in the linker at al1 cobalt hexarnmine concentrations.
Figure 13b shows the results of DEPC modification. A qualitative examination of the adenosines in the linker revealed that they are accessible to DEPC modification at dl concentrations of cobalt hexammine. in contrast, for exarnple, A667 in helix IV, A661 in helix iIi and A648 in helix 11 were fully protected from modification at ImM cobalt hexamrnine. This suggests that while the rest of the RNA molecule was folded comectly, the linker adenosines are not involved in any secondary structure.
To fiirther confirm that the linker was single stranded, Figure 13c shows the results of DMS modification. C672 in helix IV, C663 in helix III and C651 in helix II, for .-a - - example, were fully protected at 10 rnM of cobalt hexammine, suggesting that the RNA
was folded comctly. However, qualitative examination indicated that only 4 of the 6
cytosines in the linker are reactive even at the highest concentration of cobalt hexammine.
W and LA are protected from DMS modification from O to 10 rnM cobalt hexammine.
Combined, the above data suggests that the 16 nucleotide linker was mainly single
stranded. However, the S'-end of the linker was probably base paired with some non-
essential part of the ribozyme. in essence. this will shorten the overall length of the
inserted linker by 5 nucleotides, though it does not seem to have a great effect on the
overall cleavage rate since AN16 still cleaved several fold faster than G1 1. DISCUSSION
Through cleavage time courses, 1 have discovered that a single stranded, flexible linker inserted between helices la and II in Gl I causes an increase in cleavage raie
(Figure 14a, compare bar i with v) and that rate increases with linker length. 1 have shown that the magnesium requirements of the linker insertion mutants for maximal cleavage rate are similar to that of G11, but high compared to RNA molecules, such as H3, that lack a helix la (Figure 14b, compare bars i & v with ii). 1 have also discovered that disrupting helix la lowers the magnesium optimum with minimal effect on cleavage rate
(Figure 14a & b, compare bars v & vi). Lastly, 1 have demonstrated that mutationally pre- shifting helix Ib alone is enough to lower the magnesium optimum and again, there is minimal effect on the cleavage rate (Figure 14a & b, compare bars iii with i & vii with v).
In essence, 1 have identified separate structural causes for the slow cleavage rate and high magnesium optimum of the wild type RNA and furthered Our understanding of structure- function relationships in the VS ribozyme.
1. Linker Insertion hcreases Cleavage Rate
1 have explored the effect of inserthg a single stranded linker in G11 between helices Ia and II. This was accomplished by performing cleavage time courses on mutants of Gll with different length linkers. Cleavage time course data show that, while a 3 nucleotide linker insertion has a negligible effect on the cleavage rate, a 28 nucleotide insertion increases cleavage rate more than 50-fold compared to G1I (Figure 8). This increase in cleavage rate suggests that a slow step that was limiting the observed cleavage rate of G 11 is overcome or circumvented in linker insertion mutants. A possible rate-limiting step in Gl 1 cleavage might be the docking of the cleavage site loop with the active site. In the hairpin ribozyme, the essential nucleotides required for cleavage activity reside on distantly located intemal loops A and B. In order for the two loops to interact, a sharp bend brings the two domains into close proximity (Komatsu et al., 1995). In the wild-type (-)sTRSV-derived hairpin ribozyme, there is an 'A' residue between the A and B domains that seems to function as a flexible hinge to fold the two domains together (Anderson et al., 1994; Berzal-Herranz et al., 1993). However, the phosphate backbone of a single 'A' at the hinge of the wild-type hairpin ribozyme does not seem to be flexible enough to allow efficient interaction between the loops A and B
(Shin et al., 1996). Experiments that added flexibility at the hinge by inserting a linker resulted in increased cleavage rate (Feldstein and Bruening, 1993; Komatsu et al., 1995;
Shin et al., 1996).
Through phosphorothioate interference-rescue experiments in the presence of manganese ions, the A730 loop is hypothesized to be a candidate region for the active site of the VS ribozyme (Sood et al., 1998). Recent fluorescence resonance energy transfer
(FRET) data shows helix ïü and VI are aimost coaxial with helix II subtending an acute angle to helix VI (Lafontaine et al.. 201). The space between helices U and M is believed to accommodate helix 1 with the cleavage site juxtaposed to the A730 loop. In addition to cleavage site docking, another possible rate-limiting step that cm be envisaged in Gl1 is the formation of the pseudoknot that is known to be essentirl for cleavage activity (Rastogi et al., 1996). The pseudoknot has ken implicated in shifting of helix Ib (Andersen and Collins, PNAS, in press) and binding of helix 1 to the ribozyme in tram (Zamel and Collins, unpublished data). Analogous to the hairpin ribozyme, if the A730 loop is the active site in the VS ribozyme, then the cleavage loop and the active site are distantly located and the RNA rnust fold in such a way that allows for interaction of the two loops plus formation of pseudoknot. In order to more accurately depict the relative orientation of helices, an alternative representation of the secondary structure has been developed that accommodates the relative orientation of helices 1 and V which fom the pseudoknot and helices II and VI which can be cross-linked by exposure to ultraviolet light (Figure 15; D.
De Abreu et al., unpublished results). From this alternative model, it is apparent that helix
VI may be near helix II and/or 1 and that helix 1 may be at a sharp angle with helix II in order to interact with helix V. With this in mind, the single stranded UA nucleotides in
G1l between helix Ta and II could be acting as a hinge/joint to provide flexibility for proper orientation of helix 1 relative the ribozyme. However, similar to the hairpin ribozyme, a two nucleotide UA hinge/joint may not provide enough flexibility for efficient folding of the RNA. An increase in cleavage rate with linker insertions at this hinge area is consistent with added flexibility overcoming steric constraint in Gl1 by allowing for either: (1) more efficient interaction between the cleavage loop and active site or, (2) more ease in formation of the pseudoknot or, (3) a combination of the two.
Linker insertion mutants, with the exception of GI 1-3nt, have faster cleavage rates than
H3 probably because the longer linker overcomes this steric constraint more readily.
Through chernical modification structure probing, 1 have demonstrated that the 16 nucleotide linker is mainly single stranded with only the S'-end probably base paired with some non-essential part of the ribozyme (Figure 13). Due to the proximity of the 5' vector sequence to the 5'-end of the inserted linker, it is reasonable to predict that the CCU of the linker sequence rnay base pair with the GGG of the vector sequence. It is also conceivable that a linker insertion much longer than 28 nucleotides might actually cause a decrease in the cleavage rate as the linker has a higher chance of misfolding with essential parts of the ribozyme.
It was surpnsing that 011-3nt did not show an increase in cleavage rate relative to
GI 1. If H3 elicits an increase in cleavage rate due to the 3'-side of the now-disrupted helix Ia acting as a linker, then 1 would have thought that a 3 nucleotide insertion in Gl 1 be sufficient to do the sarne. In H3, disniption of helix Ia inadvertently creates a linker that is only one nucleotide longer than G 1 I -3nt (compare H3 in Figure 3b venus G 1 1-3nt in Figure 4b). However, the km of H3 is 5-fold faster than G1 1-3nt. This could mean that the one additional nucleotide in H3 provides just enough flexibility to overcome steric constraint still present in G 1 1-3nt.
Another plausible explanation is that helix Ia, missing in H3, coaxially stacks ont0 helix il and limits the cleavage rate of GI I-3nt. For example, in the hairpin ribozyme, two alternative conformations exist (Esteban et al., 1998). One conformer is catdytically inactive due to an extended conformation where helices 2 and 3 are coaxially stacked and interaction between loops A and B is prevented Conuersely, the active conformer has a sharp bend that allows loops A and B to interact. Secondly, helical regions PI and P2 of the Tetrahymena group 1 intron have been proposed not to stack coaxially in the active structure (Peyman, 1994). It is therefore reasonable to propose that a similar stacking interaction in VS ribozyme might be lirniting the cleavage reaction.
Two pieces of data support the idea that helix 1coaxially stacks ont0 helix lI in the
VS ribozyme. Through darnage selection (modification interference) experiments, a -- - cluster of bases was found to significantly enhance cleavage upon modification (Beattie
and Collins, 1997). These stmng enhancements were clustered on the 3'-side of helix Ia
and the adjacent region of helix 11 (nucleotides A639 to A649 and U775). The observed
clustering of enhancements at several positions in adjacent helices suggested the
possibility of helix la stacking ont0 helix ïI. The second piece of evidence cornes from a
point mutation in helix 11 of GI 1 where U775 was changed to an A. This mutation
cleaved at least 5-foold faster than wild-type GI I and was predicted to disrupt the stacking
interaction by disrupting a base pair in helix II (Rastogi, 1998).
The formation of a coaxially stacked helix 1 on II structure would simply require
extending helix U by one (for G L 1) or two base pain (for G 1 1-3nt; Figure 16). This
would presumably be inactive as it might prevent conformational changes involving helix
I that are required to attain the active structure of the ribozyme or proper orientation of
helix 1 relative the rest of the ribozyme. If this were tme, then an unstacking step would
be expected to take place prior to cleavage and thus limit the cis-cleaving reaction in
GI 1-3nt and Gl 1. On the other hand, H3 and long linker insertion mutants may have
circumvented this rate-limiting step. In the case of H3, there is no helix Ia available for
sracking with helix Il. As for linker insertion mutants, while coaxial stacking of RNA
helices is energetically favorable (Walter et al., 1994), long single stranded regions
between helices will bulge out and destabilize the stacking interaction. This in turn will
allow the RNA to fold into the active structure more easily, hence a faster cleavage rate.
A third possibility that can explain the increase in cleavage rate seen in linker
insertion mutants is that the cleavagenigation equilibrium has ken shifted. The majority
of VS RNA in vivo is actually found as circular monomers (Saville and Collins, 1990), suggesting that although the ribozyme is capable of mediating cleavage and ligation reactions, thc cleavagelligation equilibrium in native VS RNA favours ligation. A structure that has been proposed to attenuate the self-cleavage reaction by affecting the cleavagenigation equilibrium is helix la (Rastogi, 1998). Therefore, one possible reason why Gl 1 cleavage may appear to be slow compared to H3 is that some fraction of the upstrearn cleavage product religates, rather than dissociates, after cleavage due to helix Ia holding ont0 the upstream cleavage product. if this were tme, RNA molecules such as H3 that lack a helix Ia would display faster observed cleavage rates presumably because the fraction that religates is small compared to G11. Then why do linker insertion mutants display a faster cleavage rate compared to GlI since helix Ia is still intact? In the harnmerhead and hairpin ribozyme, tertiary structure stability has ken shown to shift the equilibrium towards favouring ligation (Fedor, 1999; Hertel et al., 1994; Stage-
Zimmermann and Uhlenbeck, 1998). Therefore, one simple interpretation is that a flexible linker in Gl1 has disrupted or destabilized a subtle teniary interaction that is more important for ligation than cleavage, thus shifting the cleavage/ligation equilibrium towards cleavage. As a consequence, there will be an overall increase in observed cleauage rate for iinker mutants. It has been shown that littie ligatior; occurs when a short linker between helices 2 and 3 impedes interdomain docking in the hairpin ribozyme
(Feldstein and Bruening, 1993). Whether or not a similar situation happens in the VS linker insertion mutants is, however, unclear.
In summary, 1 have found that a linker inserted into the VS ribozyme increases cleavage rate. A few plausible theories help to explain this phenomenon and include the linker having a role in: (1) overcoming steric constraints present in the native RNA, (2) destabilizing the stacking interaction of helix Ia on II and (3) shifting the cleavagefligation equilibnum to favour cleavage. In most likelihood, it is some combination of these effects that cause an increase in cleavage rate seen in linker insertion mutants.
U. Disruption of Helix Ia Lowers Magnesium Optimum
Through cleavage time courses at different rnagnesium concentrations, 1 have detemined the magnesium optimum of RNA molecules with and without a helix la in the presence and absence of a linker. While an inserted linker increases cleavage rate with minimal effect on magnesium optimum, data also show that disruption of helix Ia lowers the magnesium optimum with minimal effect on cleavage rate. Disrupted helix Ia RNA molecules require approximately 5-fold less magnesium to achieve maximal cleavage rates compared to RNA molecules with helix Ia (Figure 10). A question that anses is:
Why does disrupting helix Ia lower the rnagnesium optimum?
A simple interpretation of a lowered magnesium optimum is that RNAs that are missing helix Ia have a greater affinity for a critical magnesium ion. In the hammerhead ribozyme, replacement of helix II with a Loop sequence increased the magnesium optimum due to a 20-fold reduction in the apparent magnesium binding affinity
(Sakamoto et al., 1997). Whether or not the opposite is possible, that is disruption of a helix increasing magnesium binding affinity and lowering the magnesium optimum, is not known.
A more likely explanation for a lowered magnesium optimum is that helix Ia interferes with folding of the RNA. In the presence of helix la, Gl1 and linker insertion - mutants may favour an inactive conformation that can only be converted to the active conformation by high concentrations of magnesium. One such inactive conformation in
VS RNA might be the coaxial stacking of helix I on Il. RNAs that lack a helix la
presumably will not fonn a coaxial 1 on II structure and the equilibrium will favour
formation of the active conformation even at lower concentrations of magnesium. On the
other hand, although a linker may destabilize the stacking of helix Ia on iI in linker
insertion mutants. high concentrations of magnesium might still be required for the
unstacking step to take place, even though unstacking might occur more readily. This
would be consistent with the high magnesium optimum still present in linker insertion
mutants compared to RNA molecules that lack helix [a.
The ability of high magnesium concentrations to compensate for mutations shows
the importance of magnesium in the stability of structures. Several observations
demonstrate that detrimental mutations can be rescued by high magnesium concentrations
by re-stabilizing the native folding motif (Laggerbauer et al., 1994; Murphy and Cech,
1994). Therefon, another interpretation of a high magnesium optimum in G1I and linker
insertion mutants is that it reflects the instability of an alternative secondary structure that
must fonn near the cleavage siie of the active conformation before cleavage tdces place.
Recent work hm shown chat a conformational change does indeed occur near the
cleavage site of the VS ribozyme (Andersen and Collins, 2000). In the presence of
magnesium, a secondary structure remangement of helix Ib creates an asymmetric
cleavage loop with the bulging out of C634 (Figure 2). A conformational change at the
cleavage site prior to cleavage has also been proposed in other ribozyme systems
including the hammerhead ribozyme and leaûzyme. X-ray crystal structures of the hammerhead ribozyme (Pley et al., 1994; Scott et al., 1995) and the NMR solution structure of the leaàzyme (Hwgstraten et al., 1998), show the cleavage site to be incompatible with the required positioning of the 2'-hydroxyl group, the phosphorus and the 5'-oxygen for an in-line SN2 attack. These structures represent the ground state conformation and in order for an in-line attack to occur, a conformational change is required prior to cleavage. A more recent X-ray structural study of the hammerhead ribozyme, using a slowly cleavable substrate, has actually trapped a structure with the active site more closely resernbling an in-line conformation (Murray et al., 1998b). A remangement of secondary structure in VS RNA could place the required atoms for an in-line attack prior cleavage.
So why would a RNA molecule with a disrupted helix la have a more stable active conformation near its cleavage site than a RNA molecule with a helix la? The answer might lie in the intemal loop of helix 1. NMR spectroscopy has recently determined the solution structure of the intemal loop and helix la (Michiels, 2000) and it has revealed that the cleavage loop has more structure than depicted in the traditional secondary structure. The two nucleotides, G620 and A62 1, flanking the cleavage site are involved in two sheared G.A base pairs with A639 and G638, respectiuely and stûck on helix la.
Adjacent to the tandem G.A base pairs, A622 and C637, form a non-canonical wobble A-
C base pair. This NMR data is consistent with chernical modification structure probing data performed by various members in our lab on Gll-Pre (Beattie, 1997; Maguire,
1999). In contrast, RNA molecules that lack a helix Ia have a more relaxed structure around the cleavage site. Stmcturing probing data have shown that A622 and A639 in
G1 ID have an increased accessibility to DEPC modification whereas in Gl1 precunor, -- they are protected from modification (Rastogi, 1998). In addition, the tandem G.A base
pairs cm no longer stack on helix Ia which rnight destabilize the base pairs altogether.
The lack of flexibility around the cleavage loop in RNA molecules that have a helix Ta
(i.e. G11 and presumably linker insertion mutants) might be inhibiting the necessary
conformational change around the cleavage site. Or, the non-reananged helix 1 structure
could be more stable relative the rearranged helix 1 structure. Either way, high
concentrations of magnesium, therefore a high magwsium optimum, may be required to
either cause the conformational change and/or stabilize the reananged secondary structure
around the cleavage loop.
Divalent metal ions, especially magnesium ions, have been thought to play a leading
role in folding and catalysis of ribozymes. However, with the observation that a trans-
acting VS ribozyme was catalytically proficient in 4 M sodium, lithium or ammonium
ions (Murray et al., 1998a), the role of divalent metal ions has become questionable.
Analogous to the hammerhead ribozyme, the primary role of divalent metal ions might
only help to fold the ribozyme into its active conformation. The activity observed with
monovalent metd ions has forced us to consider the possibility that the catalytic reaction
might proceed by mechanisms not considered until now, such as the involvement of a
shifted pK, nucleobase functional group.
m. Pre-shifting Helix Ib Lowers Magnesium Optimum
In order to test whether secondary structure rearrangement was responsible for the
high magnesium optimum seen in Gl 1 and linker insertion mutants that contain helix Ia,
mutants with a constitutively shifted helix Ib were created. To evaluate the magnesium optimum of these mutants, cleavage time courses at different concentrations of magnesium were determined and plotted. Data show that pre-shifting helix Ib in the presence or absence of an inserted linker lowers magnesium optimum approximately 10- fold compared to their non-shifted counterparts (Figure 12c & d).
Due to the structure present in the cleavage loop of G 1 1, it has been hypothesized that the slow cleavage rate is due to secondary structure rearrangement king a rate- lirniting step (Maguire, 1999). However, constitutively pre-shifted helix ib mutants have maximal cleavage rates that are very similar to their non-shifted counterparts in the presence or absence of a linker, respectively (Figure 12a & b). This data strongly suggests that secondary structure rearrangement of helix Ib is not a rate-limiting step in Gl1 and linker insertion mutants.
Although secondary structure rearrangement does not seem to be a rate-limiting step. it does seem to be the underlying reason for the high magnesium optimum seen in
Gl1 and linker insertion mutants. This secondary structure remangement involves the breaking and fonning of at least five base pairs and has to overcome a rather large energy barrier. A plausible theory that can explain the high magnesium optimum is if large arnounts of magnesium are required to drive the stable, non-rearranged helix I into the rearranged conformation. In RNA molecules that lack helix Ia, the flexibility around the cleavage loop might allow for this secondary structure rearrangement to occur more readily, hence a lower magnesium optimum relative to RNA molecules that have a helix
Ia. However, since magnesium is required to cause this rearrangement, the magnesium optimum will still be higher than for pre-shifted mutants. Once in the rearranged conformation, it would be stabilized by native tertiary contacts. Actually, in the shifted conformation, the bottom base pair of helix (G623:C637) and the flanking base on L- Ib
each strand (A622 and G638) exactly match a motif that has been observed to bind a
divalent cation in crystal structures of two harnmerhead ribozymes and the "GAAA
duplex" (Baeyens et al., 1996; PIey et al., 1994; Scott et al., 1995). This potential metal
binding site could play a role in stabilizing the shifted conformation.
If the high magnesium optimum seen in G11 and linker insertion mutants was due
to secondary structure rearrangement of helix Ib, and RNA molecules ihat lack helix Ia
have a relatively lower magnesium optimum due to reanangement being easier, then a
simple prediction about the double mutant with both a disrupted Ia and pre-shifted Ib
helices could be made. A double mutant would have a magnesium optimum very similar
to that of a single mutant with only a pre-shifted helix Ib. However, since both the double
mutants (H3-MCSand AN16-H3-MCS) have magnesium optima that are slightly lower
than their respective single mutants (G 1 1-MCS and ANl6-MCS), interpretation of these
results becomes more difficult. One interpretation is that the model described above is
incorrect and disruption of helix Ia and pre-shifting of helix Ib achieve lowered
magnesium optima for different, independent reasons. However, if this were the case, an
even lower magnesium optimum than the one observed might have been expected for the
double mutant since the combined effects would be additive. Although, it is also possible
that a minimum concentration of magnesium is required to stabilize the RNA structure
and this prevents the magnesium optimum from going infinitely low. Altematively, the
model is correct and dismption of helix la or pre-shifting helix Ib achieves the sarne ends.
However, for example, disruption of helix Ia introduces flexibility into the rearranged
cleavage lwp that is also favourable. This in mm will cause an even lower magnesiurn to the mutant with a A-- .- - optimum in the double mutant compand single only pre-shifted
helix Ib. Figure 1: Chemistry of Smd Ribozyme Cleavage
The cleavage reaction begins with the attack of the 2' oxygen atom on the phosphorus, with the departure of the 5' oxygen atom in an SN2 mechanism. The products are a 2',3'-cyclic phosphate with inversion of configuration at the phosphorus and a 5' hydroxyl.
Figure 2: Secondary Structure Model of Cl1 In The Absence and Resence of Magnesium
The alternative conformations of helix Ib in the absence or presence of M~"are indicated in the boxes. In the presence of M~", rearrangernent of the secondary structure of helix Ib causes nucleotides, shown in coloured boxes, to shift in register and C634, indicated in italics, to become unpaired. The double-headed arrow indicates a pseudoknot interaction between the circled bases in loops 1 and V (Rastogi et al., 1996). The site of self-cleavage is shown by an arrow. VS nucleotides and non-VS nucleotides are indicated in upper and lower case, respectively. Helices are denoted by Roman numerals as in Beattie et al. (1995) and bases are numbered as in Saville & Collins (1990). c-0,. i -- Ib a-. "1 a-m ,
O A 1 I: A U0.G i O-C i C-O j Ir u-Q U-OUAI I OC Ü--QU O A C QOUAUUOQCO iTll~~htc 111. : :; l 1,. U i i li1;!li A CAC ouu~uorcu~r QAC UAAOAO . Y 770 tao II Vl '* Figure 3: Cl1 and H3
The secondary structure mode1 of Gll (a) and H3 (b). The difference between H3 and Gl1 is that the nucleotides upstream of the cleavage site, indicated by an arrow, have ken replaced with GgG in H3 which disrupts the base pain present in helix Ia of Gl 1. Nucleotides that were part of the 3'-side of helix Ia are boxed in H3. Helices are denoted by Roman numerals; VS nucleotides and non-VS nucleotides are indicated in upper and lower case, respectively. Time courses of G11 (c) and H3 (d) at different magnesium concentrations (40 mM Tris-HCl pH 8.0, 50 mM KCl). Time courses were fit using SigmaPlot 5.0 to a monophasic equation (see Materials and Methods) where k is the rate constant in min". G-C C-G Ib G-c G-- C O-C G-C G-C C C G L: G 620.0 A C-6 la a-c U-d
Tirne (min) Time (min)
[Mg] (mM) k (min") [Mg](mM) k (min*') Figure 4: Secondary Structure Mode1 of Linker Insertion Mutants
(a) Single stranded flexible linker, indicated by a red bar, inserted into G11 between helices Ia and II. (b) The linker sequence is given for each RNA. C O U U O-C C-- O Ib o-c O -- C O-C C-O - C-O 111 a0 0 A A-- u A C-O Uoac-O U-A.720 la a60 730 740 w U- O LlNKER A AC-O AA a ~~o~~@oC~--OUABUAAOCOQQAOCUOUOACOOUAUUQOCO l il! IIIj/ : IIU III: l[i 1 A ~auucO cccoA*c~co A c AC ~Uu~ridic30~ QAC a 3' UAAOAO . 770 m 740
Coostruct Linker . - Name Inacrtim (nt) Linkr muence G11-3nt 3 CAC _ AX7 7 CACCUAG AXIl , 11 , CACCUAGCUAG ANI6 16 CACCUAGCAACUCUAG IAMUs 1 28 1 CACCUAGGAACAACGCUAGCAACUCUAG 1 Figure 5: Linker Insertion Mutants and Their Effeet on Self-Cleavage
Time courses of self-cleavage of Gll (a) and linker insertion mutants (b)- (f). "~-internall~labeled RNA was incubated in standard cleavage buffer (40 rnM Tris-HCI pH 8.0, 50 mM KCI) and cleavage was initiated by addition of MgClz to a finai concentration of 25 mM. The upper band in each gel is the precursor, P. and the lower band is the downstrearn cleavage product, D. Time courses were fit using SiepaPiot 5.0 to either a monophasic curve ( f = f, - ae'-"' , where f,, is the total fraction of
RNA cleaved when time is 0 and a is the fraction of RNA cleaving at rate constant k in min"), or to both a monophasic curve and biphasic curve (f =f, -aie -a,e'-k2r', where f,, is the total fraction of RNA cleaved when time is 00, a, is the fraction of RNA cleaving at rate constant kl in min-' and a2 is the fraction of RNA cleaving at rate constant k2 in min"). Note ihat the scaie of the x-axis is different for different RNAs. 0,o .I O 50 100 150 2 Time [min)
.+o.of-. -.-. - -. I 0.0 m 0102030405060 2 4 6 8 10 12 14 16 Time (min) Time (min)
-+"C"----i.
Mono: k = 3.82 a = 0.83 - - Morio: k = 4.51 a = 0.85 k, = 0.27 a, = 0.1 2 - { = 5. 4 = 0.79 F
--- -. - O 2 4 6 8 10 12 14 16 O 2 4 6 8 10 12 14 16 Time (min) rime (min] Figure 6: Summary of Linker insertion Mutants (25 mM M~~+)
Time course under standard cistleavage conditions (25 mM MgC12, 40 mM Tris-HCI pH 8.0 and 50 m.KCI) of G11 and linker insertion mutants. For AX 1 1, AN 16 and ANX28, the biphasic fits and rate of the fast-cleaving phase are shown. Data are from Figure 5. 2 3 Time [min)
Conshuct k (min")
A Gll 0.07 O G11-3nt 0.07 0 AX7 0143 A AXII 2.46 AN16 5.01
6 ANX28 5.68 Figure 7: Cleavage 1s Independent of Ribozyme Concentration
One point cleavage assay for linker insertion mutants AXll, AN16 and ANX28. Cleavage was initiated under standard cis-cleavage conditions (25 mM MgCI2, 40 mM Tris-HCI pH 8.0 and 50 mM KCI), varying only the concentration of RNA. Reactions were terminated by addition of 2.5 volumes of loading dye containing formamide and EDTA at times indicated. 12 sec. 12 sec. 20 sec. Figure 8: Increasing Linker Length Causes an Increase In Cleavage Rate With Little Effect on Magnesium Optimum
(a) Plots of rates at different MgCl? concentrations for G11 and linker insertion mutants. (b) Same plot as (a), however the rates have been normalized so that they are a fraction of the maximal rate. Plots were fit to a sigrnoidal curve using SigrnaPlot 5.0: y = km / [1+ (x / [M~"]~~)~], where kW is the maximal rate under saturating magnesium in min" and [~~~7i~is the concentration of magnesium at which half-maximal rate was obsewed in rnM. (min")
0.15 & 0.02
0.13 & 0.01
0.96 &= 0.06 7.3 * 0.8 6.8 I 0.3
8.4 I 0.2
' III II I 1 0.0- ' "1' "' 1 1 I 1 O 20 40 60 80 100 Figure 9: Secondary Structure Model of AN16-H3
A linker insertion mutant with a disrupted helix la where a single stranded 16 nucleotide flexible linker, indicated in red, is inserted into H3. G-C
G -- C G-C C 0 A G' C G 0 U CACCUAGCAACUCUAG,A -- 16 nt. Unker Insertion 1111 1111 VI Figure 10: Disruption of Helix Ia Lowers the Magnesium Optimum With Little Effect on the Maximal Cleavage Rate
(a) Plots of rates at different MgC12 concentrations for G 1 1, AN 16, H3 and ANl6-H3. (b) Sarne as (a), except that the rates have been normalized so that they are a fraction of the maximal rate. Maximal rate (kW) and half- maximal magnesium concentration [M~?']12 were determined as in Figure 8.
Figure 11: Secondary Structure Mode1 of Mutants With Constitutively Shifted Helix Ib (MCS)
(a) Gl1 helix Ib conformation in the presence of M~'+.C634 becomes unpaired and coloured nucleotides shift in register to form an asyrnmetric cleavage loop. Refer to Figure 2 for the unshifted conformation. Constmcts with different helix 1 are shown in boxes (b)-(e). These constructs have C634 mutational 1y changed to G634. Coloured nucleotides shift in re ister and an asymmetric cleavage loop foms even in the absence of Mgf+ (Mutant Constitutively Shifted - MCS). (b) G 1 1 with a MCS helix Ib (c) H3 with a MCS helix Ib (d) 16nt linker mutant with a MCS helix Ib (e) 16nt linker mutant with both a disnipted helix Ia and MCS helix Ib. The sequence of the 16nt linker (red bar) is: CACCUAGCAACUCUAG. I C 0 1 CUGAAAUUG UCOU AOCAGUUG ! U U / A
1' 1 I la a-c I I U-O I i I i u-QU ; Figure 12: Mutationally Pre-Shifting Helix Ib Lowers the Magnesium Optimum With Little Effect on the Maximal Cleavage Rate
Plots of rates at different MgC12 concentrations for: (a) G 1 1, H3, G 1 1- MCS and H3-MCS and (b) AN1 6, AN 16-H3, AN 16-MCS and AN 16-H3- MCS. (c) and (d) are the same as (a) and (b), respectively, except that the rates have been nomalized so that they are a fraction of the maximal rate. Maximal rate (km) and half-maximal magnesium concentration [M$T in were determined as in Figure 8.
Figure 13: DEPC and DMS Structure Probing of AN16
(a) The secondary structure mode1 of AN16 with the linker nucleotides shown explicitly and numbered from Li to L16. (b) 3'-end-labeled AN 16- Pre modified with DEPC under denaturing conditions (den) and under conditions containing 0 to 1 mM CO(NH~)~C~~Sites of modification were detected by cleavage with aniline and subjected to denaturing electrophoresis on a 8% gel run for 5 houn. (c) 3'-end-labeled AN16-Pre modified with DMS under conditions containing O to 10 rnM CO(NH~)~C~~.Sites of cytosine modification by DMS were detected by hydrazine treatment followed by strand cleavage with aniline. Background U resides is a result of the hydrazine treatment. A control lane was included containing the input RNA (input). To demarcate the position of cytosines, a CN ladder was also included. RNA fragments were visualized via denaturing electrophoresis on an 8% gel run for 4.75 hours. - - III CACCUAGCAACUCUA 1111 11113 Li 2 3 4 5 6 7 8 O 10 11 12 13 14 15 18 0 II VI 3' Figure 14: Summary of k, and ~~1~
Cornparison of: (a) k,, and (b) [M~~']in. (i) G 1 I (ii) H3 (iii) G 1 1-MCS (iv) H3-MCS(v) AN 16 (vi) AN 16-H3 (vii) AN 16-MCS (viii) AN 16-H3- MCS. The presence or absence of a disrupted helix Ia or pre-shifted helix Ib are represented by + and -, respectively. Note that in both graphs, the y- mis is logariihmic. (min") Figure 15: Alternative Representation of the Secondary Structure of Cl1
An alternative secondary structure mode1 of G 1 1 that orients the helices in a way that accommodates a long-range pseudoknot between loop 1 and V (Rastogi et al., 1996) and a UV-induced crosslink between helices II and VI (shown with a double-headed arrow; D. De Abreu et al., unpublished results). The single stranded nucleotides between helix Ia and II are indicated explicitly; the putative active site is indicated by a shaded circle; the cleavage site is indicated by an arrowhead.
Figure 16: Model of Putative Coaxial Stacking of Helix la on Helix II
Putative inactive conformation of the VS ribozyme. in which helix la and Il are coaxially stacked, is illustrated for: (a) G11 and (b) G 1 1 -3nt. The inserted 3 nucleotide linker for GI 1-3nt is illustrated in red and the cleavage site is indicated by an arrowhead. A U~~~~~ * 630G CGAG~~~U~GUAAGC GGGA* LP 11111 IlII I IIIIII III uGCGGGAAGCGUU AGCGUUCG* CCCGA Ib A* c G 775 11 620 la g A
A A * A 630*G U~~~~~ CGAG~~~~~c GUAAGC GGGA* P llllt IIIIII t IIIIII III L uGCGGGAAGCGUu AGAG CGUUCG CCCGA c A Ib 7% II Qo Ia g U Andersen, A. A., and Collins. R. A. (2000). Reamuigement of a stable RNA secondary structure during VS ribozyme catalysis, Mol Cell5.469-78.
Anderson, C. F., and Record, M. T. (1995). Salt-nucleic acid interactions, Annu Rev Phys Chem 46,657-700,
Anderson, P., Monforte, J., Tritz, R., Nesbitt, S., Hearst, J., and Harnpel, A. (1994). Mutagenesis of the hairpin ribozyme, Nucleic Acids Research 22, 1096- 100.
Baeyens, K. J., De Bondi, H. L., Pardi, A., and Holbrook, S. R. (1996). A curved RNA helix incorporating an intemal loop with G.A and A.A non-Watson-Crick base pairing, Proceedings of the National Academy of Sciences of the United States of America 93, 1285 1-5.
Basu, S., Rambo, R. P., Strauss-Soukup, J., Cate, J. H., Ferre-D'Amare, A. R., Stmbel, S. A., and Doudna, J. A. (1998). A specific monovalent metal ion integral to the AA platform of the RNA tetraloop receptor [see comments], Nature Structural Biology 5,986-92,
Beattie, T. L. (1997) Chemicd modification structure probing and interference assays for structural and funciionai studies of the Neurospora VS ribozyme, Ph.D, University of Toronto, Toronto.
Beattie, T. L., and Collins, R. A. (1997). Identification of Functional Domains in the Self- cleaving Neurospora VS Ribozyme Using Damage Selection, Journal of Molecular Biology 267,830-840.
Beattie, T. L., Olive, J. E., and Collins, R. A. (1995). A secondary-structure mode1 for the self-cleaving region of Neurospora VS RNA, Proceedings of the National Academy of Sciences of the United States of America 92,4686-90.
Berzal-Herranz, A., Joseph, S., Chowrira, B. M., Butcher, S. E., and Burke, J. M. (1993). Essential nucleotide sequences and secondary structure elemenis of the hairpin ribozyme. EMBO J 12,2567-73.
Branch, A. D., and Robertson, H. D. (1984). A replication cycle for viroids and other small infectious RNA's, Science 223,450-5.
Cate, J. H., Hanna, R. L., and Doudna, J. A. (1997). A magnesium ion core at the heart of a ribozyme domain [see comments], Nature Structural Biology 4,553-8. Cech, T. R. (1993). Structure and mechanism of the large catalytic RNAs: group 1 and group Il introns and ribonuclease P. In The RNA World, R. F. Gesteland, and J. F. Atkins, eds. (Plainview, N.Y., Cold Spring Harbor Laboratory Press), pp. 239-269.
Cole, P. E., Yang, S. K., and Crothers, D. M. (1972). Conformational changes of transfer ribonucleic acid. Equilibriurn phase diagrams, Biochemistry 11,4358-68.
Collins, R. A., and Olive, J. E. (1993). Reaction conditions and kinetics of self-cleavage of a ribozyme derived from Neurospora VS RNA, Biochemistry 32,2795-9.
Conn. G. L., and Draper, D. E. (1998). RNA structure, Current Opinion in Structural Biology 8,278-85.
Cowan, J. A. (1993). Metallobiochemistry of RNA. Co(NH3)6(3+) as a probe for Mg2+(aq) binding sites, J Inorg Biochem 49, 17 1-5.
Creighton, T. E. (1993). Proteins: Structures and Molecular Properties, 2nd edn (New York, W.H. Freeman and Company).
Cunis, E. A., and Bartel, D. P. (201). The Hammerhead Cleavage Reaction in Monovalent Cations, RNA 7,546-52.
Dahm, S. C., Derrick, W. B., and Uhlenbeck, O. C. (1993). Evidence for the role of solvated metal hydroxide in the harnmerhead cleavage mechanism, Biochernistry 32, 13040-5.
Dahm, S. C., and Uhlenbeck, O. C. (1991). Role of divalent metal ions in the hammerhead RNA cleavage reaction, Biochemistry 30,9464-9.
Doheny, E. A., and Doudna, J. (2000). Ribozyme Structures and Mechanisms, Annual Review of Biochemistry 69,597-6 15.
Draper, D. E., and Misra, V. K. (1998). RNA shows its metai [news] [comment],Nature Structural Biology 5,927-30.
Esteban, J. A., Walter, N. G., Kotzorek, G., Heckman, J, E., and Burke, J. M. (1998). Structural bais for heterogeneous kinetics: reengineering the hairpin ribozyme, Proceedings of the National Academy of Sciences of the United States of America 95,609 1-6.
Fedor, M. J. (1999). Tertiary structure stabilization promotes hairpin ribozyme ligation, Biochernistry 38, 1 1040-50. Felàstein, P. A., and Bmening, G. (1993). Catalytically active geometry in the reversible circularizaiion of 'minimonomer' RNAs derived fmm the complementary strand of tobacco ringspot virus satellite RNA,Nucleic Acids Research 2 1, 199 1-8.
Gesteland, R., and Atkins, J. F. (1993). The RNA World (Plainview, N.Y.,Cold Spnng Harbor Laboratory Press).
Guemer-Takada, C., Gardiner, K., Marsh, T., Pace, N., and Altman, S. (1983). The RNA moiety of ribonuclease P is the cataiytic subunit of the enzyme. Ce11 35,849-57.
Guo, H. C., and Collins, R. A. (1995). Efficient transtleavage of a stem-loop RNA substrate by a ribozyme denved from neurospora VS RNA, EMBO J 14,368-76.
Guo, H. C., De Abreu, D. M., Tillier, E. R., Saville, B. J., Olive, J. E., and Collins, R. A. (1993). Nucleotide sequence requirements for self-cleavage of Neurospora VS RNA, Journal of Molecular Biology 232,351-61.
Hampel, A.. and Cowan, J. A. (1997). A unique mechanism for RNA catalysis: the role of metal cofactors in hairpin ribozyme cleavage, Chemistry & Biology 4,5 13-5 17.
Hertel, K. J., Herxhlag, D., and Uhlenbeck, O. C. (1994). A kinetic and thermodynamic framework for the hammerhead ribozyme reaction, Biochemistry 33,3374-85.
Hertel, K. I., Peracchi, A., Uhlenbeck, O. C., and Herschlag, D. (1997). Use of intrinsic binding energy for catalysis by an RNA enzyme, Proceedings of the National Academy of Sciences of the United States of Amenca 94,8497-8502.
Hoogstraten, C. G., Legault, P., and Pardi, A. (1998). NMR solution structure of the lead- dependent ribozyme: evidence for dynarnics in RNA catalysis, Journal of Molecular Biology 284,337-50.
Jaeger, L. (1997). The New World of ribozymes, Current Opinion in Structural Biology 7, 324-35.
Kornatsu, Y., Kanzaki, 1.. Koizumi, M., and Ohtsuka, E. (1995). Modification of primary structures of hairpin ribozymes for probing active conformations, Journal of Molecular Biology 252,296-304.
Krol. A., and Carbon, P. (1989). A pide for probing native smdl nuclear RNA and ribonucleoprotein structures, Methods in Enzymology 180,2 12-27.
Kruger, K., Grabowski, P. J., Zaug, A. J., Sands, J., Gottschling, D. E., and Cech, T. R. (1982). Self-splicing RNA: autoexcision and autocyclization of the nbosomal RNA intervening sequence of Tetrahymena, Cell31, 147-57. Lafontaine, D. A., Norman, D. G., and Lilley, D. M. (2001). Structure, folding and activity of the VS ribozyme: importance of the 2-3-6 helical junction, EMBO J 20, 1415-24.
Laggerbauer, B., Murphy, F. L., and Cech. T. R. (1994). Two major tertiary folding transitions of the Tetrahymena catalytic RNA, EMBO J 13,2669-76.
Legault, P., and Pardi, A. (1997). Unusual dynamics and pK(a) shift at the active site of a lead-dependent ribozyme, Journal of the Amencan Chernical Society 119, 6621- 6628.
Lorsch, J. R., and Szostak, J. W. (1994). In vitro evolution of new ribozymes with polynucleotide kinase activity, Nature 371,3 1-6.
Lott, W. B., Pontius, B. W., and von Hippel, P. H. (1998). A two-metal ion mechanism operates in the hammerhead ribozyme-mediated cleavage of an RNA substrate. Proceedings of the National Academy of Sciences of the United States of America 95,542-7.
Maguire, J. L. (1999) The Development and Use of Cobalt Hexammine as a Tool to study the Teniary Structure of the Neurospora VS Ribozyme., M. Sc., University of Toronto, Toronto.
Mathews. D. H., Sabina, J., Zuker, M., and Turner. D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure, Journal of Molecular Biology 288,9 1 1-40.
Michiels, P. J. A., Schouten, C.H.J., Hilbers, C.W.,Heus, B.A. (2000). Structure of the ribozyme substrate hairpin of Neurospora VS RNA: A close look ai the cleavage site., RNA 6, 182 1- 1832.
Misra, V. K., and Draper, D. E. (1998). On the role of magnesium ions in RNA stability, Biopolymers 48, 1 13-35.
Murphy, F. L., and Cech, T. R. (1994). GAAA tetraloop and conserved bulge stabilize tertiary structure of a group 1 intron domain, Journal of Molccular Biology 236, 49- 63.
Murray, J. B., Seyhan, A. A., Walter, N. G., Burke, J. M., and Scott, W. G. (1998a). The hammerhead, hairpin and VS ribozymes are catalytically proficient in monovalent cations alone, Chemistry & Biology 5,587-95.
Murray, J. B., Terwey, D. P., Maloney, L., Karpeisky, A., Usman, N., Beigelman, L., and Scott, W. G. (1W8b). The structural basis of hammerhead ribozyme self-cleavage, Cell92,665-73. Narlikar, G. J., and Herschlag, D. (1997). Mechanistic aspects of enzymatic catalysis: Lessons from cornparison of RNA and protein enzymes, Annual Review of Biochernistry 66, 19-59.
Nesbitt, S., Hegg, L. A., and Fedor, M. J. (1997). An unusual pH-independent and rnetal- ion-independent mechanism for hairpin ribozyme catalysis, Chemistry & Biology 4, 6 19-30.
Nowakowski, J., and Tinoco, I., Jr. (1997). RNA Structure and Stability, Seminars in Virology 8, 153- 165.
O'Rear, J. L., Wang, S., Feig, A. L., Beigelman, L., Uhlenbeck, O. C., and Herschlag. D. (200 1). Cornparison of the Harnmerhead Cleavage Reactions Stimulated by Monovalent and Divalent Cations, RNA 7,5374.
Pan, T., Long, D. M., and Uhlenbeck, O. C. (1993). Divalent Metal Ions in RNA Fotding and Catalysis. In The RNA World, R. F. Gesteland, and J. F. Atkins, eds. (Plainview, N.Y.,Cold Spring Harbor Laboratory Press), pp. 271 -302.
Perrotta, A. T., Shih, L, and Been, M. D. (1999). Imidazole rescue of a cytosine mutation in a self-cleaving ribozyme [see comments], Science 286, 123-6.
Peyman, A. (1994). P2 Functions as a Spacer in the Tetrahymena ribozyme, Nucleic Acids Res 22, 1383-88.
Pley, H. W., Flaherty, K. M., and McKay, D. B. (1994). Three-dimensional structure of a hammerhead ribozyme, Nature 372,68-74.
Rastogi, T. (1998) Identification of Functional Domains and Tertiary Interactions in the Neurospora VS Ribozyme, Ph D., University of Toronto, Toronto.
Rastogi, T.. Beatîie, T. L, Olive, J. E, and Coiiins, R. A. (1996). A long-range pseudoknot is required for activity of the Neurospora VS ribozyme, EMBO J 15, 2820-5.
Rastogi, T., and Collins, R. A. (1998). Smaller, faster ribozymes reveal the catalytic core of Neurospora VS RNA, Journal of Molecular Biology 277,2 15-24.
Rupert, P. B., and Ferre, D. A. A. R. (2001). Crystal Structure of a Hairpin Ribozyme- Inhibitor Complex with Implications for Catalysis, Nature 410,780-6.
Sakamoto, T., Kim, M. H., Kurihara, Y., Sasaki, N., Noguchi, T., Katahira, M., and Uesugi, S. (1997). Roperties of a hammerhead ribozyme with deletion of stem II, I Biochem (Tokyo) 121,288-294. Saville, B. J., and Collins, R. A. (1990). A site-specific self-cleavage reaction perfomed by a novel RNA in Neurospora mitochondria, Ceil 41,685-96.
Saville, B. J., and Collins, R. A. (1 99 1). RNA-mediated ligation of self-cleavage products of a Neurospora mitochondrial plasmid transcnpt, Proceedings of the National Academy of Sciences of the United States of America 88,8826-30.
Scott, E. C., and Uhlenbeck, O. C. (1999). A re-investigation of the thio effect at the hammerhead cleavage site, Nucleic Acids Research 27,479-84.
Scott, W. G., Finch, J. T., and Klug, A. (1995). The crystal structure of an dl-RNA hammerhead ribozyme: a proposed mechanism for RNA catalytic cleavage, Cell 81, 991-1002,
Scott, W. G., Murray, J. B., Arnold, J. R. P., Stoddard. B. L., and Klug, A. (1996). Capturing the structure of a catalytic RNA intermediate: the hammerhead ribozyme, Science 274,2065-9.
Shan, S., Yoshida, A., Sun. S., Piccirilli, J. A., and Herschlag, D. (1999). Three metal ions at the active site of the Tetrahymena group 1 ribozyme, Proceedings of the National Academy of Sciences of the United States of America 96, 12299-304.
Shin, C., Choi, J. N., Song, S. I., Song, J. T., Ahn, J. H., Lee, J. S., and Choi, Y. D. (1996). The loop B domain is physicaily separable from the loop A domain in the hairpin ribozyme, Nucleic Acids Research 24,2685-9.
Slim, G., and Gait, M. 1. (1991). Configurationally defined phosphorothioatetontaining oligoribonucleotides in the study of the mechanism of cleavage of hammerhead ribozymes, Nucleic Acids Research 19, 1 183-8.
Sood, V. D., Beattie, T. L., and Collins, R. A. (1998). Identification of phosphate groups involved in metai binding and tertiary interactions in the core of the Neurospora VS ribozyme, Journal of Molecular Biology 282,74 1-50.
Stage-Zimmermann, T. K., and Uhlenbeck, O. C. (1998). Circular substrates of the harnmerhead ribozyme shift the interna1 equilibrium hirther toward cleavage, Biochemistry 37,9386-93.
Symons, R. H. (1992). Small catalytic RNAs, Annual Review of Biochemistry 61, 641- 71.
Tinoco, I,Jr., and Bustamante, C. (1999). How RNA folds, Journal of Molecular Biology 293,27 1-8 1. Tsang, J., and Joyce, G. F. (1996). In vitro evolution of randomized ribozymes, Methods in Enzymology 267,4 10-26.
Walter, A. E., Turner, D. H., Kim, J., Lyttle, M. H., Muller, P., Mathews, D. H., and Zuker, M. (1994). Coaxial stacking of helixes enhances binding of oligoribonucleotides and improves predictions of RNA folding, Pmceedings of the National Academy of Sciences of the United States of America 91,92 1 8-22.
Weinstein, L. B., Jones, B. C. N. M., Cosstick, R., and Cech, T. R. (1997). A second catalytic metal ion in a group 1 ribozyme, Nature 388, 805-808.
Yoshida, A., Shan, S., Herschlag, D., and PicciRlli, J. A. (2000). The role of the cieavage site 2'-hydroxyl in the Tetrahyrnena group 1 ribozyme reaction, Chemistry & Biology 7,85-96.
Young, K. J., Gill, F., and Grasby, J. A. (1997). Metal ions play a passive role in the hairpin ribozyme catalysed reaction, Nucleic Acids Research 25,3760-6.
Zuker, M., Mathews, D. H., and Turner, D. H. (1999). Algorithms and Therrnodynamics for RNA Secondary Structure Prediction: A Practical Guide. In RNA Biochemistry and Biotechnology, J. B. B. F. C. Clark, ed. (Kluwer Acadernic Publishers).