Modulation of Insulin Signalling and Calcium Homeostasis By

MODULATION OF INSULIN SIGNALLING AND CALCIUM HOMEOSTASIS BY

ENDOSOMES IN PANCREATIC BETA-CELLS

Tobias Albrecht

B.Sc., University of Applied Sciences Zittau/Görlitz, 2009

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES

(Cell and Developmental Biology)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

April, 2015

Disrupted pancreatic β-cell function is a key event in the pathogenesis of diabetes mellitus, a metabolic disorder resulting in elevated blood sugar levels. β-cells are responsible for the secretion of insulin, which promotes the uptake of blood glucose into peripheral tissue.

Additionally, autocrine insulin signalling contributes to the maintenance of properly functioning

β-cells. Upon insulin binding, the insulin receptor tyrosine kinase is activated and recruits insulin receptor substrates to its intracellular domain. These substrates can activate two major signalling branches, the Akt branch and the Ras/Erk branch. Both signalling branches are suggested to be involved in the maintenance of β-cell function and survival. Interestingly, results from experiments in adipose-like cell lines demonstrate, that endocytic vesicles can act as signalling hubs potentially directing insulin receptor signals between the Erk and Akt branches. Endosomes have also been suggested as organelles that are capable of buffering the rapid influx of calcium into β-cells following glucose stimulation thus avoiding calcium-induced β-cell death. These findings highlight endosomes as important organelles involved in the maintenance of β-cell function. This thesis examines the role of endosomes in autocrine insulin signalling and their involvement in calcium homeostasis. To observe the impact of endocytosis on autocrine insulin signalling, a novel fluorescent protein-labeled insulin receptor construct was developed and validated, revealing that tyrosine-phosphorylated caveolin-1 (Cav1) participates in insulin receptor internalization in β- cells. Remarkably, this process was found to bias insulin signalling towards the Erk branch in vitro and in vivo. As a functional consequence, reduction of Cav1 activity inhibited Erk signalling and was associated with increased β-cell apoptosis and decreased β-cell mass in mice lacking Cav1.

The role of endosomes in β-cell calcium buffering was elucidated by creating a genetically encoded calcium sensor specifically localized to the lumen of endosomes and estimating calcium ii

levels in defined endosome sub-populations. Indeed, endosomes accumulate calcium during glucose stimulation. Together, this work highlights endosomes as hubs for autocrine insulin signalling and contributors to the calcium homeostasis in the glucose response of β-cells.

iii

Preface

This thesis was written by T Albrecht and revised by JD Johnson, GE Lim, S Skovsø, SX Bamji,

B Rodrigues, F Jean, M Numata and CE Rochelau.

The studies shown in Chapter 2 and Chapter 3 were designed and conceived by T Albrecht, JD

Johnson, GE Lim and IR Nabi. Studies shown in Chapter 4 were designed and conceived by T

Albrecht, JD Johnson, Y Zhao and RE Campbell. All experiments in this thesis were performed by T Albrecht unless otherwise noted. Immunofluorescence staining in Figure 2.1 A was performed by M Piske. Life-cell TIRF imaging to acquire data shown in Figure 3.2 G was performed by H Cen. Immunofluorescence staining of pancreatic sections shown in Figure 3.4

A,B,C and Figure 3.5 was performed by M Piske and SN Li. Raw experimental data were analyzed by T Albrecht. Data in Chapter 2 and Chapter 3 were interpreted by T Albrecht, GE Lim, JD

Johnson and IR Nabi. Data in Chapter 4 were interpreted by T Albrecht, JD Johnson, Y Zhao and

RE Campbell.

A version of Chapter 1.8 was previously published in the following book:

JD Johnson, MJ Bround, T Albrecht (2014) Colloquium series on building blocks of the cell –

Ca2+-dependent signal transduction. Morgan & Claypool Life Sciences ISBN: 9781615046645

A version of Chapter 4 has been published in the following article: T Albrecht*, Y Zhao*, TH

Nguyen, RE Campbell, JD Johnson (2015) Fluorescent biosensors illuminate calcium levels within

defined beta-cell endosome subpopulations. Cell Calcium Apr;57(4):263-74. doi:

10.1016/j.ceca.2015.01.008 *denotes shared contribution

The research presented in this thesis was ethically approved under protocol number A11-0390

(“Cellular mechanisms of diabetes and diabetic complications”) issued by the University of British

Columbia Animal Care Committee. iv

Table of contents

Abstract ...... ii

Preface ...... iv

Table of contents ...... v

List of tables...... xi

List of figures ...... xii

List of abbreviations ...... xiv

Acknowledgements ...... xvi

Chapter 1: Introduction ...... 1

1.1 Diabetes mellitus ...... 1

1.1.1 Rare forms of diabetes ...... 1

1.1.2 Type 1 diabetes ...... 3

1.1.2.1 Causes of type 1 diabetes ...... 3

1.1.2.2 Treatment for type 1 diabetes ...... 5

1.1.3 Type 2 diabetes ...... 6

1.1.3.1 Causes of type 2 diabetes ...... 6

1.1.3.2 Treatments for type 2 diabetes ...... 10

1.2 The insulin receptor ...... 13

1.2.1 Insulin ...... 14

1.2.2 Insulin receptor structure and function ...... 15

1.3 Insulin receptor signalling ...... 17

1.3.1 The Akt signalling branch ...... 19 v

1.3.2 The Ras/Erk signalling branch ...... 19

1.3.3 Autocrine insulin signalling in the pancreatic β-cell ...... 21

1.3.3.1 Autocrine insulin effects on insulin synthesis ...... 22

1.3.3.2 Autocrine insulin effects on insulin secretion ...... 23

1.3.3.3 Autocrine insulin effects on β-cell proliferation ...... 25

1.3.3.4 Autocrine insulin effects on β-cell survival ...... 26

1.3.3.5 Interplay between insulin and IGF1 signalling in β-cells ...... 27

1.3.3.6 Lessons from the BIRKO mice ...... 28

1.4 Insulin resistance ...... 29

1.4.1 Insulin resistance caused by genetic defects ...... 29

1.4.2 Insulin resistance caused by lipotoxicity ...... 30

1.4.3 Insulin resistance caused by tissue inflammation ...... 30

1.4.4 Insulin resistance caused by ER stress ...... 31

1.4.5 Insulin resistance in β-cells ...... 31

1.5 Endocytosis ...... 32

1.5.1 Endocytic pathways ...... 32

1.5.1.1 Clathrin-mediated endocytosis ...... 33

1.5.1.2 Caveolin-mediated endocytosis ...... 34

1.5.1.3 Other endocytic pathways ...... 35

1.5.2 The role of endocytosis in insulin receptor signalling ...... 36

1.6 Intracellular calcium signalling ...... 37

1.6.1 Mechanisms of calcium signalling in the plasma membrane ...... 38

1.6.2 Mechanisms of calcium signalling in the endoplasmic reticulum ...... 39 vi

1.6.3 Mechanisms of calcium signalling in the Golgi network ...... 41

1.6.4 Mechanisms of calcium signalling in the nucleus ...... 41

1.6.5 Mechanisms of calcium signalling in mitochondria ...... 42

1.6.6 Mechanisms of calcium signalling in endolysosomes ...... 43

1.6.6.1 Transient receptor potential channels ...... 44

1.6.6.2 Two pore channels ...... 46

1.6.6.3 ATP gated ionotropic receptors ...... 48

1.6.6.4 Ryanodine receptors ...... 49

1.7 Calcium signalling in the pancreatic β-cell ...... 49

1.8 Measuring calcium in live cells ...... 52

1.9 Goals and objectives ...... 54

Chapter 2: Insulin receptor trafficking in β-cells ...... 56

2.1 Rationale ...... 56

2.2 Results ...... 57

2.2.1 Subcellular localization of endogenous insulin receptors ...... 57

2.2.2 Development of functional fluorescent insulin receptor fusion proteins ...... 58

2.2.3 Localization of insulin receptors in β-cell endolysosomal compartments...... 61

2.2.4 Insulin receptor dynamics in Cav1 positive membrane domains ...... 66

2.3 Discussion ...... 67

2.4 Materials and methods ...... 69

2.4.1 Cell culture and islet isolation...... 69

2.4.2 Cell fractionation ...... 69

2.4.3 Treatments of cell cultures ...... 69 vii

2.4.4 Plasmids and molecular cloning ...... 70

2.4.5 Transfection ...... 73

2.4.6 Immunofluorescence ...... 73

2.4.7 Imaging ...... 73

2.4.8 Image Analysis ...... 74

2.4.9 Immunoblot ...... 74

2.4.10 Statistics ...... 75

Chapter 3: The role of Caveolin-1 in insulin receptor trafficking and signalling ...... 76

3.1 Rationale ...... 76

3.2 Results ...... 76

3.2.1 Binding kinetics of Cav1 and insulin receptors ...... 76

3.2.2 The effects Cav1 phosphorylation on insulin receptor internalization ...... 77

3.2.3 The effects of Cav1 phosphorylation on insulin signalling in vitro...... 80

3.2.4 The effects of Cav1 deficiency in vivo...... 81

3.3 Discussion ...... 84

3.4 Materials and methods ...... 85

3.4.1 Immunoprecipitation ...... 85

3.4.2 Plasmids, cell culture, transfection, immunoblots, imaging and image analysis ...... 86

3.4.3 Generation of MIN6 cell lines ...... 86

3.4.4 Pancreatic tissue immunostaining ...... 87

3.4.5 Mice ...... 87

3.4.6 Statistics ...... 87

Chapter 4: Endosomal Ca2+ handling in β-cells ...... 88 viii

4.1 Rationale ...... 88

4.2 Results ...... 90

4.2.1 Development of an endosomal targeted calcium sensor ...... 90

4.2.2 Validation of the Ca2+ sensing capabilities of TiVAMP-GEM-GECO1 in situ ...... 91

4.2.3 Luminal Ca2+ during endosomal maturation ...... 93

4.2.4 Development of biosensors for quantitative Ca2+ and pH measurements...... 95

4.2.5 Endosomal Ca2+ fluxes in the glucose response of β-cells...... 97

4.3 Discussion ...... 99

4.4 Material and methods ...... 102

4.4.1 Cloning, plasmids and transfection ...... 102

4.4.2 Microscopy and image analysis ...... 103

4.4.3 Statistics ...... 104

Chapter 5: Conclusion ...... 105

5.1 Summary and impact ...... 105

5.2 Caveats and limitations ...... 108

5.3 Future directions ...... 110

References ...... 112

Appendix ...... 135

Appendix A Plasmid maps and sequences ...... 135

A.1 pcDNA-3.1-(-)-InsRA-TagRFP ...... 135

A.2 pcDNA-3.1-(-)-InsRB-TagRFP ...... 136

A.3 pcDNA-3.1-(-)-InsRA-TagBFP ...... 137

A.4 pcDNA-3.1-(-)-InsRB-TagBFP ...... 138 ix

A.5 pcDNA-3.1-(-)-TiVAMP-GEM-GECO1 ...... 139

A.6 pcDNA-3.1-(-)-TiVAMP-mKeima ...... 140

List of tables

Table 2.1: Primer sequences ...... 72

Table 4.1: Primer sequences ...... 102

List of figures

Figure 1.1: Secondary structure of the human insulin receptor...... 17

Figure 1.2: Insulin receptor signalling pathways...... 21

Figure 1.3: Endocytic entry portals to the cell...... 36

Figure 2.1: Endogenous localization of insulin receptors...... 57

Figure 2.2: Design and validation of functional fluorescent protein-tagged insulin receptors. .... 60

Figure 2.3: Insulin receptors do not associate with markers of clathrin-dependent endocytosis. 62

Figure 2.4: β-cell insulin receptors are transported to lysosomes in Cav1 and Flot-1 positive vesicles...... 65

Figure 2.5: Cav1 accumulates in insulin receptor positive membrane compartments prior internalization...... 67

Figure 3.1: Cav1 binds to insulin receptors in an insulin dependent manner...... 77

Figure 3.2: Cav1 phosphorylation modulates insulin receptor domain size and internalization. . 79

Figure 3.3: Cav1 phosphorylation enhances insulin-stimulated Erk, but not Akt, signalling in vitro...... 81

Figure 3.4: Cav1 loss decreases Insr internalization and reduces Erk signalling in vivo...... 83

Figure 3.5: Cav1 loss leads to a reduced β-cell mass and increased islet cell apoptosis...... 84

Figure 4.1: TiVAMP-GEM-GECO1 is a luminal Ca2+ biosensor localized to early and late endosomes...... 91

Figure 4.2: TiVAMP-GEM-GECO1 senses changes in endosomal Ca2+...... 93

Figure 4.3: Ca2+ enrichment of endosomes during maturation...... 95

Figure 4.4: A biosensor pair for quantitative Ca2+ and pH measurements in living cells...... 97

Figure 4.5: Early endosomes enrich Ca2+ in glucose-stimulated β-cells...... 99 xii

Figure 5.1: Working model of insulin receptor trafficking and signalling in β-cells...... 106

xiii

List of abbreviations

ATP Adenosine triphosphate

Ca2+ Calcium

Cav1 Caveolin-1

EEA1 Early endosomal antigen 1

EGF Epidermal growth factor

ER Endoplasmic reticulum

Flot-1 Flotillin-1

FnIII fibronectin type III domain

Foxo Forkhead Box O

FRET Fluorescent resonance energy transfer

GDP Guanosine diphosphate

GEF guanine exchange factor

GLUT4 Glucose transporter type 4

GTP Guanosine triphosphate

GWAS Genome wide association study

HIV Human immunodeficiency virus

IGF1R Insulin like growth factor 1 receptor

INSR Insulin receptor

IPF-1 Insulin promoter factor-1

IRS Insulin receptor substrate

MAPK Mitogen-activated protein kinase or Erk

MCU Mitochondrial Ca2+ uniporter xiv

MEK Mitogen-activated protein kinase kinase

MODY Maturity onset diabetes of the young

mTORC1 mammalian target of rapamycin complex 1

NAADP Nicotinic acid adenine dinucleotide phosphate

NF-κB Nuclear factor κ-light-chain-enhancer of activated B cells

PI3K Phosphatidylinositol-4,5-bisphosphate 3-kinase

PIP3 Phosphatidylinositol (3,4,5)-trisphosphate

PTB Phosphotyrosine binding (domain)

SERCA Sarco-endoplasmic reticulum Ca2+-ATPase

SH2 Src-homology 2 (domain)

SNARE Soluble N-ethylmaleimide-sensitive factor attachment protein receptors

SNP Single nucleotide polymorphism

TNFα Tumor necrosis factor α

TPC Two-pore channel

Acknowledgements

The work I present in this thesis would not have been possible without the support, encouragement and help of my supervisors, colleagues, friends and family. Thanks a million for your guidance and company throughout the years. This work is your credit as well. I want to thank my supervisor Dr. James D. Johnson for giving me the opportunity to conduct my research in his lab. Thank you very much Jim for letting me develop as a person and as a scientist in such a dynamic environment. I appreciated your guidance when I needed it and at the same time the freedom you gave me to pursue my own ideas. Many thanks go to my supervisory committee Drs SX Bamji, B Rodrigues and IR Nabi for their constant support and helpful discussions that led to a successful outcome of my projects. Special thanks go to all past and present members of the Johnson lab. Thank you for your help, discussions and for being such great colleagues. I want to thank Betty and Farnaz for their help in the lab day in and day out. Gareth, thank you very much for your valuable input on my projects and for your efforts to make me a better biochemist. I learned a lot from you.

It feels like yesterday when I started my adventure with the move to Vancouver. Since day one I received a tremendous support from my family which I will always be grateful for. I want to thank my mother, Jörg, Chris and my grandparents for always making me believe I could finish what I started.

Allison, thank you so much for all your support. Your love and optimism gave me strength when times were hard. Even though I have been very busy most of the times with either grad studies or training and there was never enough time for us, you never complained and supported me in any way possible. I will always be grateful for that.

Finally, I want to thank the Karl-Heinz Frenzen Stiftung and the Hans Sauer Stiftung for their faith in my projects and their financial support during my graduate studies.

xvi

Chapter 1: Introduction

1.1 Diabetes mellitus

Diabetes mellitus is a metabolic disease affecting more than 340 million people worldwide1.

Diabetes is defined by the chronic elevation of the blood glucose (hyperglycemia). In particular, a fasting plasma glucose level of greater than 7 mmol/l, a glycated hemoglobin (A1C) value of greater than 6.5% or a 2 hr plasma glucose concentration in a 75g oral glucose tolerance test of greater than 11.1 mmol/l define the clinical parameters for the diagnosis of diabetes2. While there

are a variety of treatment options, diabetes is still incurable. Diabetes incidence in Canada has doubled in the past decade3. This illustrates that diabetes is expanding at an epidemic rate – every

hour, 20 patients in Canada are newly diagnosed. The consequences of chronic hyperglycemia are

costly; the cumulative 5-year health care costs for one Canadian diabetes patient are about CDN

$27,000 – excluding drug costs4. The complications resulting from diabetes are serious threats for

the health of the individuals. Diabetes significantly increases the risk of heart disease and stroke

with 50% of diabetes patients dying of cardiovascular disease5. Diabetes is furthermore one of the

leading causes for kidney failure6. The impaired blood circulation in diabetic patients can lead to

infections and eventual amputation of limbs7. Diabetes mellitus can be divided into multiple types

classified by the cause of the disease8.

1.1.1 Rare forms of diabetes

Approximately 1% of all diabetes mellitus cases are caused by single-gene defects8.

Mutations in the insulin receptor gene lead to severe insulin resistance, growth retardation and a very short life expectancy (Leprechaunism, Rabson-Mendenhall syndrome)9,10. Leprechaunism,

also known as Donohue syndrome, is an autosomal recessive genetic disorder affecting the insulin 1

receptor gene. Initially described by Kadowaki et al. in 1988, Leprechaunism is caused by one or

more mutations in the insulin receptor gene11. In this first case report, a substitution of glutamic

acid for lysine at amino acid 460 by a missense mutation in the alpha subunit and a premature stop

codon at amino acid 671 resulted in the deletion of the transmembrane and tyrosine kinase domain

of the insulin receptor11. Recently a more thorough analysis of a larger group of patients suffering

Leprechaunism unveiled a number of other possible alterations in the insulin receptor gene

including frame shifts or deletion of entire gene fragments12. In Leprechaunism, most of the single

amino acid mutations are localized in the alpha subunit of the receptor and therefore likely

negatively affect the binding and signalling of insulin causing severe insulin resistance in the

patient12. This study concluded, that most of the mutations located within the first eleven exons of

the insulin receptor gene result in Leprechaunism while the Rabson-Mendenhall syndrome is

caused by mutations in the β-subunit of the receptor affecting the function of the tyrosine kinase12.

Together, the Rabson-Mendenhall syndrome appears less severe and treatment with IGF-1, metformin or leptin improved insulin sensitivity while individuals with Leprechaunism usually die within the first two years of life13.

Maturity-onset diabetes of the young (MODY) is a form of diabetes caused by heterozygous mutations directly affecting β-cell function. In this condition individuals display hyperglycemia, which develops during childhood or young adulthood14. To date, there are 11 identified types of

MODY, which are classified by the affected gene15-17. For example, mutations were observed in the genes encoding the glucose metabolizing enzyme glucokinase (MODY2) or the insulin expression regulator IPF-1 (insulin promoter factor-1 or Pdx1, MODY4) negatively effecting β- cell function8,18. In MODY4 not only β-cell function is negatively affected but also β-cell survival

is suggested to be impaired because studies have shown that mice with reduced Pdx1 expression 2

display increased β-cell apoptosis19. Less than 1% of all MODY cases are caused by mutations in the insulin gene (MODY10) causing hypoglycemia due to non-functional insulin16.

Another form of diabetes is gestational diabetes and describes any degree of glucose

intolerance in pregnant individuals20. Depending on ethnicity, approximately 7% of all pregnancies

are affected8. Individuals often display mild insulin resistance and hyperinsulinemia due to the

compensating pancreatic β-cells21. Another form of compensation for the increased demand of

insulin is an increased β-cell proliferation and elevated insulin synthesis in pregnancy22.

Gestational diabetes mellitus is often reversible and rarely affects the newborn severely given an appropriate blood glucose level management by adapted diet and/or insulin treatments during pregnancy23.

Diabetes mellitus can also be caused by diseases of the exocrine pancreas such as

pancreatitis, or surgical pancreatectomy after trauma or metastatic diseases24,25. However, by far

the most common forms of diabetes mellitus are type 1 diabetes (5% -10% of patients) and type 2

diabetes (90% - 95%). They will be discussed in more detail in the following sections.

1.1.2 Type 1 diabetes

1.1.2.1 Causes of type 1 diabetes

Type 1 diabetes, previously known as insulin-dependent or juvenile diabetes describes the

auto-immune destruction of pancreatic β-cells resulting in an insufficient amount of circulating

insulin to control the body’s blood glucose levels26. The precise causes for type 1 diabetes remain

unclear26. However, genetic and environmental factors are suggested to play a significant role in

the development of the disease. The expansion of auto-reactive CD4+ T-helper and CD8+ T-cells

as well as auto-antibody producing B lymphocytes leads to a targeted destruction of pancreatic β- 3

cells27-29. In this process, T-cells recognize epitopes of insulin, glutamic acid decarboxylase 65 and

islet tyrosine phosphatase 2 – both of which are expressed in β-cells30. In a regulated immune

response, T-cells are inactivated by increased apoptosis of the target cell type31. However, it is

thought that in type 1 diabetes conditions this inactivation fails and T-cells stay chronically

activated leading to an expansion and enrichment of autoreactive T-cells against β-cells30.

Type 1 diabetes does not show a definite mode of inheritance but single nucleotide

polymorphisms associated with the development of type 1 diabetes were identified in genome wide

association studies (GWAS)32. To date variations in 41 different genes have been associated with

a predisposed risk for the development of type 1 diabetes33. The strongest candidate for genetic

predisposition towards type 1 diabetes is the genetic region on Chromosome 6p21 associated with

the major histocompatibility complex HLA-DQB1 also referred to as IDDM134. Variation in the alleles of the HLA loci can attribute to approximately 40% of familial aggregation of type 1 diabetes35,36. Interestingly, polymorphisms near the insulin gene, that increase local insulin

production, are the second highest risk factor for the development of type 1 diabetes32. It suggests

that insulin itself could be responsible for the specific recruitment of immune cells to β-cells. This

highlights the importance of studies directed towards the interaction between insulin and its

receptor in β-cells, which can help to understand the molecular mechanism behind the specific

destruction of β-cells by immune cells.

Besides genetic factors a number of environmental factors are thought to contribute to the development of type 1 diabetes26. The “hygiene hypothesis” postulates that an increase in type 1

diabetes incidents is observed in populations of industrialized countries where people experience

a reduced exposure to parasites37. This hypothesis is supported by experimental data gained from

a type 1 diabetes mouse model. In these mice the incidence of type 1 diabetes is dramatically 4

reduced when the animals were exposed to microbial stimuli38. From these data, it is suggested

that the interaction between intestinal microbes and the innate immune system is essential for a protective effect against type 1 diabetes38,39. Furthermore, recent studies suggest a direct effect of

the diet on the development of type 1 diabetes suggesting that certain diet components (e.g. fatty

acids, preservatives) can influence the development of auto immunity40-42. There is also evidence

suggesting that virus infections can be associated with the development of type 1 diabetes43.

Viruses of the Coxsackie family are strong candidates for being involved in outbreak of type 1 diabetes in individuals44,45. The exact mode of action of these viruses remains to be elucidated but it is suggested that these viruses directly infect β-cells causing the release of auto-antigens which in turn trigger the immune response of the body to destroy the inflamed tissue45. Together, the

cause for type 1 diabetes remains a mystery but can be associated with both genetic and

environmental factors.

1.1.2.2 Treatment for type 1 diabetes

The treatment for type 1 diabetes currently requires the lifelong administration of insulin.

Consequently, insulin therapy by pen or pump mediated injection is currently the most common

form for the treatment of type 1 diabetes46. To date, pump-supported insulin therapies show a significantly better management of blood glucose levels in individuals compared to pen injections,

which are often associated with sudden hypoglycemic or hyperglycemic spikes46. Since both

treatment strategies come along with complications, such as infections of injection sites or

inconvenient handling especially for children, new treatment strategies emerged in the past decade.

Islet transplantation is a powerful treatment option for people with severe type 1 diabetes

symptoms. This therapy dramatically improves glycemic control compared to injections47,48. 5

However, high demand for islet donors is a major limiting factor for this treatment strategy.

Consequently, research has been directed towards the engineering of functional β-cells from stem

cells, theoretically providing an unlimited amount of β-cells for transplantation49. To date, fully

functional β-cells have not been successfully engineered from stem cells50. However, significant

progress has been made demonstrating that in vitro differentiated stem cells can reverse diabetes

in model organisms despite lacking some key β-cell features51-53. Currently, type 1 diabetes can be

managed with conventional insulin therapy and there are promising treatments on the horizon.

1.1.3 Type 2 diabetes

Type 2 diabetes, previously termed adult onset or non-insulin dependent diabetes, is the most

common form of diabetes mellitus, representing 90-95% of cases8. Individuals suffering from type

2 diabetes have insulin resistance in peripheral tissues and at more progressed stages of the disease

also a deficiency of circulating insulin resulting in dysfunctional regulation of blood glucose

levels8.

1.1.3.1 Causes of type 2 diabetes

The causes of type 2 diabetes are diverse. The development of type 2 diabetes is mostly

associated with a low physical activity and high calorie diet lifestyle but evidence emerges that

genetic factors can also play a role in the development of type 2 diabetes54-56. Just like type 1

diabetes, type 2 diabetes can be caused by genetic predisposition to the disease. Genome wide

association studies (GWAS) unveiled genetic factors which can lead to type 2 diabetes55,56. Type

2 diabetes has a concordance of 70% in monozygotic twins, suggesting that type 2 diabetes is not exclusively dependent on environmental factors57,58. More than 65 genetic variants have been 6

associated with a predisposition to type 2 diabetes which can increase the risk for the development

of the disease by 10-30%59. This research has led to the abilities to diagnose previously

undiagnosed type 2 diabetes in individuals via a risk score, which is calculated based on their

genetic code60,61. Importantly, these studies also connected the development of insulin resistance

in type 2 diabetes to dysfunctions in β-cells such as defects in insulin secretion62. Indeed, GWAS

point to the β-cell as a major site for the predisposition to type 2 diabetes since most genes

identified are linked to β-cell function62. For example, a polymorphism in the cyclin-dependent

kinase 5 regulatory subunit-associated protein 1-like 1 gene was associated in multiple studies with

a predisposition to the development of type 2 diabetes63. The specific function of this gene is

unknown however patients with this polymorphism in this gene display defects in insulin secretion

suggesting an important role for cyclin-dependent kinase 5 regulatory subunit-associated protein

1-like1 in β-cell function64. Other examples of polymorphisms associated with the development of

type 2 diabetes are the hematopoietically-expressed homeobox protein (HHEX) and the cyclin-

dependent kinase inhibitors 2 A and B (CDKI2). Genetic variations in these genes negatively affect

the insulin secretion of β-cells in response to glucose64,65. Together these results highlight the

importance of research directed to the understanding of β-cell biology to find novel treatment

strategies against type 2 diabetes.

Besides genetic factors, environmental factors can play a role in the development of type 2

diabetes. It has been speculated that environmental factors such as sleep deprivation, toxins in

plastic products (e.g. bisphenol A), or artificial sweeteners can lead to the development of glucose intolerance and eventually type 2 diabetes66-68. However, the leading cause for the development of

type 2 diabetes is obesity.

Obesity, defined by a body-mass index greater than 30 kg/m2 can be a consequence of a

particular lifestyle or genetic predisposition. It contributes to approximately 55% of type 2 diabetes

cases69-71. Weight gain can be promoted by an unhealthy diet. For example, the consumption of

sugar sweetened beverages was correlated to the increased incidences of type 2 diabetes in the

United States72. Consequently, the development of type 2 diabetes is often related to chronic

obesity. A consequence of obesity is the constant exposure of nutrients to the tissue. This leads to the accumulation of toxic metabolic by-products73. Some of these by-products are cytokines which

are secreted by the expanding adipose tissue. Cytokines such as the tumor necrosis factor α (TNFα)

and the nuclear factor κ-light-chain-enhancer of activated B cells (NF-κb) can have a pro-

inflammatory effect which can ultimately lead to insulin resistance74,75(Chapter 1.4). Initially, β-

cells respond to insulin resistance by the increased synthesis and secretion of insulin and by the expansion of β-cell mass. However, if this increased demand of insulin becomes chronic, β-cell failure and ultimately type 2 diabetes can be a result. Since individuals can become obese and mildly insulin resistant but do not necessarily develop diabetes, it is the broad consensus that clinically diagnosed type 2 diabetes is a result of β-cell failure73. The loss of functional β-cells can

either be promoted by the loss of β-cell mass due to increased apoptosis or reduced proliferation

rates or by the failure of key β-cell functions as a consequence of metabolic overload or cell

stress73. The effect of metabolic overload on β-cells was demonstrated in a number of ways.

Experiments with isolated rodent islets showed, that the constant exposure of β-cells to

hyperglycemia increases insulin secretion but reduces their response capabilities to stimulatory

glucose leading to an unregulated secretion of insulin76. Interestingly, an increased amount of free

fatty acids by themselves, as found in obese individuals, does not affect the glucose stimulated

insulin secretion of β-cells unless they are exposed to hypoglycemic conditions (greater than 8 mM 8

glucose) at the same time77. These data show that it is likely a combination of chronically elevated glucose and free fatty acid levels which leads to defects in β-cell function rather than the effect of a single component by itself. This effect is often summarized and termed to as glucolipotoxicity73.

Another important mechanism contributing to the failure and, ultimately, death of β-cells is increased endoplasmic reticulum stress. The presence of excess nutrients requires increased insulin synthesis in β-cells in order to control blood sugar levels appropriately. If this condition becomes chronic, the endoplasmic reticulum’s protein folding capacity in β-cells can be exceeded leading to the activation of the unfolded protein response and endoplasmic reticulum stress73. In regular conditions, protein kinase RNA like endoplasmic reticulum associated kinase (PERK) controls protein synthesis by the inhibition of the eukaryotic translation initiation factor-2a (eIF2a).

Interestingly, mice lacking PERK are severely diabetic and display increased β-cell death due to an uncontrolled translation of protein - a condition similar to the metabolic overload of cells in conditions of obesity78. Additionally, mice with reduced eIF2a gene dosage display reduced islet insulin content and become diabetic on a high fat diet79. Together these findings highlight, that

metabolic overload can lead to endoplasmic reticulum stress in β-cells which can cause β-cell death

and diabetes73.

The peptide family of amyloids has also been associated with β-cell dysfunction in type 2

diabetes73. Increased insulin synthesis can lead to the increased production of the amyloid amylin,

which is secreted by the β-cell along with insulin in a ratio of approximately 1:10080. Upon hypersecretion, amylin can accumulate in amyloid fibrils in β-cells as detected in islet sections of type 2 diabetes patients81. A rodent model illustrated that human amylin overexpression in mice

led to increased β-cell apoptosis resulting in a decreased β-cell mass, which led to glucose

intolerance82. This progression resembles the course of type 2 diabetes in humans highlighting a potential involvement of amyloids in the development of the disease73.

In addition to genetic predisposition or environmental factors, type 2 diabetes can be induced by a number of medical conditions83. For example anti-hypertensive drugs, such as β-blockers are

known to increase the risk for the development of type 2 diabetes84. There is also evidence that a

kidney transplantation predisposes a recipient for type 2 diabetes83. In this context it is believed that for example the immune-suppressive drugs, including cyclosporine, are the cause for the development of type 2 diabetes in transplantation patients85. It was reported that β-cells of patients treated with cyclosporine display cytoplasmic swelling and a reduction of insulin granules

negatively affecting β-cell function86. A significant percentage (7-9%) of human

immunodeficiency virus (HIV) infected patients develop type 2 diabetes as a consequence of the

HIV therapy, which involves the administration of protease inhibitor drugs87. In summary, the

causes for type 2 diabetes are diverse and the disease can be caused by environmental, genetic or

medical conditions and unlike type 1 diabetes, type 2 diabetes is reversible at early stages of

progression.

1.1.3.2 Treatments for type 2 diabetes

Since obesity is the leading cause for type 2 diabetes, lifestyle changes have the largest effect

on preventing the development of type 2 diabetes or can even reverse an early onset of the

disease88,89. These changes involve the reduction of weight by a more controlled diet, which

includes a reduced intake of fat and an increased intake of fibre. Additionally, more physical

activity is suggested for the patients to achieve weight loss88. In general, these lifestyle changes

are more effective in the treatment or prevention of type 2 diabetes than other currently available

treatments such as metformin88.

Metformin is a widely used anti-diabetic drug, which can prevent type 2 diabetes in patients

at high risk88,90. By inhibiting gluconeogenesis in the liver, metformin contributes to a decrease in

blood glucose levels independent of the insulin sensitivity of the patient91. Metformin is also

correlated with a decreased risk for cancer in type 2 diabetes patients additionally benefiting the

individuals receiving this treatment92. Metformin is a low cost, first-line choice for the treatment

of type 2 diabetes, but sulfonylureas are suggested as an additional or alternative therapy93.

Sulfonylureas are ligands for sulfonylurea receptors, which are the regulatory subunits of

ATP sensitive potassium channels93. The binding of sulfonylureas to their receptors leads to a

closure of the potassium channels and to a subsequent depolarization of the plasma membrane in

β-cells. This depolarization causes the opening of voltage gated calcium channels. The subsequent

influx of calcium causes the release of insulin into the blood stream. Sulfonylureas act as insulin

secretion stimulants (secretagogues) and are capable of decreasing the HbA1c values of diabetic

patients by 1-2%93. Another group of sulfonylurea receptor analogs are glinides, which are used

as alternatives in patients with sulfonylurea allergies or predisposition for fasting hypoglycemia93.

However, their short duration of action makes them a less desirable therapy option93.

Another class of type 2 diabetes drugs target and activate peroxisome proliferator activating

receptor gamma. These so called thiazolidinediones are another frequently used class of type 2

diabetes drugs. The activation of peroxisome proliferator activating receptor gamma causes a

reduction in the secretion of free fatty acids and NF-κb by adipose tissue93. In general

thiazolidinediones counteract tissue inflammation and increase insulin sensitivity93.

Insulin secretion can be stimulated by incretins94. Incretins are a group of hormones

synthesized and secreted by enteroendocrine cells of the gastrointestinal tract94. Glucagon-like

peptide-1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP) are well characterized

incretins but due to their short half-life and the possible rapid inactivation through cleavage by

dipeptidyl peptidase-4 (DPP4) a direct injection of recombinant hormones to stimulate insulin

secretion in type 2 diabetic patients is not feasible94. Consequently, a class of drugs acting as either

GLP-1/GIP1 receptor agonists or DPP4 inhibitors emerged as a treatment option for type 2

diabetes94.

Recently, sodium-glucose transporter type 2 inhibitors have been introduced as a novel class of drugs for the treatment of type 2 diabetes93. Sodium-glucose transporter type 2 are responsible

for the uptake of glucose into the kidney up to a blood glucose concentration of 180 mg/dl. If blood

glucose exceeds this concentration glucose is excreted into the urine causing glycosuria. By

inhibiting sodium-glucose transporters type 2, the threshold for the development of glycosuria is

lowered thus leading to a decrease in blood glucose levels. This therapy can effectively decrease

A1C levels by approximately 1 % and is characterized by the term “turning symptoms into

therapy”93.

Lastly, the treatment of advanced type 2 diabetes often requires insulin administration due

to a progressive loss in β-cell function95. Historically, insulin administration was one of the last

options in the treatment of type 2 diabetes after treatments with conventional drugs failed.

Currently, it is suggested to start insulin administration earlier to counteract β-cell exhaustion

caused by excessive insulin secretion due to the development of insulin resistance96. In this

preventative therapy option, a single or basal injection of insulin is administered daily to ensure a steady control of blood sugar levels. The current development of the pharmaceutical industry is 12

directed towards the improvement of these long acting insulins. The goal is to provide a stable

blood sugar control throughout the day despite a single injection96. If the administration of basal

insulin is not sufficient to control the blood sugar the injection of fast-acting insulin is

recommended. These fast-acting insulins are taken before meals to correct for the increased

demand of insulin during the digestion of nutrients. The downside of fast-acting insulin is that it

is often difficult for the patient to predict which amount of insulin is required for a specific meal.

Current development of fast-acting insulins is therefore directed toward a better predictability of

the action, a faster onset and a shorter period of action to avoid hypo- or hyperglycemia after

injection96. Together, insulin can be used as a therapy for onset or progressed type 2 diabetes

however, the administration of this metabolic hormone can often cause weight gain and therefore

counter-acts the suggested weight loss for type 2 diabetes patients97.

1.2 The insulin receptor

The insulin receptor (INSR) belongs to the family of receptor tyrosine kinases and is

responsible for executing the function of insulin in target tissues98. Including the insulin receptor,

58 receptor tyrosine kinase proteins have been identified in humans99. Multiple growth factors

such as the epidermal growth factor or the vascular endothelial growth factor signal through their

respective receptor tyrosine kinases to affect cell growth, migration, proliferation, metabolism and

development99,100. All receptor tyrosine kinases have a similar structure which consist of the extracellular N-terminal region responsible for ligand or hormone binding, a transmembrane

domain and an intracellular C-terminal region which harbours the tyrosine kinase domain, which

is phosphorylated upon ligand binding and induces the respective signalling pathway100. The insulin receptor is expressed among vertebrates and is also present in lower organisms such as 13

Drosophila melanogaster or as the orthologue Daf-2 in Caenorhabditis elegans101. In humans, insulin receptor expression can be detected in all body tissues102. It is highly expressed in kidney,

liver, adipose tissue and skeletal muscle. Significant levels of expression are also detected in the brain and pancreas suggesting a global and fundamental role of insulin in the human body. Similar expression profiles are observed in mice, which are often used as a model system for research directed toward insulin signalling and the underlying mechanisms102.

In peripheral tissues, such as skeletal muscle and adipose tissue, the binding of insulin to the

insulin receptor initiates the translocation of the glucose transporter type 4 (GLUT4) to the plasma

membrane of the cells which enables the uptake of glucose and contributes to the decrease in blood

sugar levels enabling the metabolism of glucose, which is the primary function of insulin103. In

tissues with absent or low expression of GLUT4, such as β-cells, insulin signalling is thought to

primarily influence cell function, proliferation and growth (Chapter 1.3.3). Together, the

ubiquitous expression of the insulin receptor among organisms highlights an essential role for this

protein.

1.2.1 Insulin

The primary ligand for the insulin receptor is insulin. The Nobel Prize in Physiology or

Medicine was awarded in 1923 to FJ Benting and JJR Macleod for the discovery of insulin. Soon

after the discovery the hormone became the first choice treatment for diabetes mellitus101. Due to its early discovery and fundamental importance in treating diabetes, insulin was the first fully sequenced protein and the first protein to be made by synthesis101. Insulin is transcribed as a

prepro-peptide from the INS gene in humans Ins1 and Ins2 genes in mice104. Pro-insulin is formed

by the cleavage of a 24 residue signal peptide upon the entry of the single chain peptide into the 14

rough endoplasmic reticulum. In this cellular organelle, three disulfide bonds are established

contributing to the establishment of the conformation. The subsequent transport of the folded

proinsulin into the Golgi network is followed by a prohormone convertase 1 and 2 mediated

cleavage105. In this process, a central fragment, termed c-peptide, is cleaved from the single chain

leaving two insulin peptide chains (A and B), which are connected by 2 disulfide bonds. This

mature insulin is then packaged into secretory vesicles of the β-cell and released upon glucose

stimulation105. Insulin is stored as a hexamer, which is stabilized by a zinc ion101. Upon release,

the hexamer dissociates in the blood stream and insulin monomers can bind to insulin receptors

present on plasma membranes of cells thereby executing insulin’s physiological effects. The

structure and function of the insulin receptor will be discussed in further detail in the following

sections.

1.2.2 Insulin receptor structure and function

The INSR is transcribed from the INSR gene in two different splice variants. Isoform A is

characterized by the absence of exon 11 (12 amino acids) compared to isoform B (Figure 1.1)106.

Following translation, proteolytic cleavage separates the prepro insulin receptor protein into α and

β chain. Subsequently a disulfide bridge links the two chains and the final functional INSR protein is formed by dimerization with another α-β chain pair107,108. In this process homo- or heterodimers

can be formed between A and B insulin receptor isoforms108. It has also been demonstrated that

hybrid dimers between INSR and insulin like growth factor 1 receptor (IGF1R) can be formed108.

The cysteine rich region (residues 158-310) at the N terminal end of the INSR is flanked by

the first and second leucine rich repeat domain (residues 1-157; L2 residues 311-470)109. These domains are followed by three fibronectin type III domains (FnIII 0-2, residues 471-906) in which 15

FnIII1 is harbouring an insert domain109. The insert domain is terminated by the α-CT segment

(residues 704-719). Insulin binds with a strong affinity to this segment a process in which the insulin receptor undergoes a conformational change110. The transmembrane domain (residues 930-

952) links the extracellular domains with the intracellular juxtamembrane domain (residues 953-

1001), the subsequent tyrosine kinase domain (residues 1002-1259) and the carboxy-terminal tail

(residues 1260-1382, Figure 1.1)111. The intracellular tyrosine kinase domain is responsible for mediating insulin’s signal by the transphosphorylation of tyrosine residues within the tyrosine kinase domain upon the binding of insulin to the α-CT unit at the extracellular part of the receptor101. It is important to note, that to date no function has been described for the INSR residues

906-929 and it is thought that this region acts as a linker between the FnIII-2 and transmembrane domain98.

Figure 1.1: Secondary structure of the human insulin receptor. (A) Schematic of the insulin receptor (drawn to scale). The left half of the schematic shows the 22 exons and their boundaries. The right half outlines the predicted functional domains with their boundaries. L1 and L2, (leucine-rich repeats); CR, Cys-rich domain; Fn0, Fn1, Fn2, fibronectin type III domains; Ins, insert in Fn1; TM, transmembrane domain; JM, juxtamembrane domain; TK, tyrosine-kinase domain; CT, carboxy-terminal tail. Orange arrowheads indicate N-glycosylation sites. Green arrowheads indicate ligand-binding site candidates. (B) 3D structure of the insulin receptor. Black arrows indicate potential target sites for the insertion of fluorescent protein tags. The modules are courtesy of Sir Tom L. Blundell. The figure was adapted with permission from reference98.

1.3 Insulin receptor signalling

The binding of insulin induces a conformational change to the INSR leading to the activation of the tyrosine kinase activity in the β subunit112. The conformational change causes the transphosphorylation of the receptor tyrosine kinase a key process for the recruitment of INSR

substrates113. Six insulin receptor substrates (IRS1 through IRS6) have been characterized as

important scaffolding proteins mediating insulin signalling113. The phosphotyrosine binding and

the pleckstrin homology domains are responsible for the docking of insulin receptor substrates to the phosphorylated insulin receptor113. The docking of insulin receptor substrates to the insulin

receptor leads to a phosphorylation of IRS, which subsequently binds proteins containing a Src-

homology 2 domain. Although insulin receptor substrate family members share binding domains, their individual functions are very diverse. IRS1 is thought to be a mediator of body growth and insulin signalling in muscle whereas IRS2 has been shown to be essential for β-cell survival and insulin signalling in the liver114,115. Interestingly, the IRS3 gene is present in humans but it has

been reported that no protein is expressed63. However, in rodents IRS3 promotes, together with

IRS1, the differentiation of fat cells116. IRS4 knockout mice display glucose intolerance,

suggesting that IRS4 is an important signalling component inducing the translocation of GLUT4

to the plasma membrane promoting glucose uptake into the target tissue117. To date, the relevance

of IRS5 and IRS6 in insulin signalling is unclear. A recent study shows that both substrates are

only mildly stimulated by insulin and the interaction with the insulin receptor is weak compared

to other insulin receptor substrates118.

Phosphorylated IRS proteins are essential for inducing the metabolic actions of insulin by

the recruitment and activation of the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)113.

This process generates the second messenger phosphatidylinositol (3,4,5)-trisphosphate (PIP3), which is responsible for the recruitment of Akt to the plasma membrane (Figure 1.2). These signalling events will be described in more detail below.

1.3.1 The Akt signalling branch

Akt, also known as protein kinase B, is expressed in 3 isoforms in mammals. The global

knockout of Akt1 or Akt3 does not lead to an alteration of insulin sensitivity113. On the contrary,

a global deletion of Akt2 (Akt), which is the most abundant form in insulin sensitive tissues and

mediates insulin’s action on the metabolism, leads to the development of insulin resistance and

diabetes113,119. Akt is responsible for mediating a wide variety of cellular signalling events. For

example, by activating mammalian target of rapamycin complex 1 (mTORC1), the Akt signalling

pathway is responsible for regulating a number of genes controlling cellular anabolic processes

such as growth and protein synthesis120. Another important family of signalling proteins activated

by Akt is Forkhead Box O (Foxo). Foxo proteins are responsible for the inhibition of the cell cycle,

the resistance of cells to oxidative stress and the induction of apoptosis121. However, through the

phosphorylation and inhibition of Bax, Bad or Caspase-9 Akt signalling can also act anti-

apoptotic113. Furthermore Akt signalling is essential for glycogen synthesis by activating glycogen

kinase through the inactivation of glycogen synthase kinase 3 by phosphorylation through Akt122.

Insulin signalling can also inhibit lipolysis via the phosphorylation of phosphodiesterase 3B by

Akt, which decreases cyclic AMP levels in adipocytes123.

1.3.2 The Ras/Erk signalling branch

Another essential signalling branch that is activated by insulin is the Ras/Erk pathway

(Figure 1.2). Adaptor molecules containing SH2 domains such as Grb2 or Shc can be recruited

directly to the phosphorylated insulin receptor or bind to IRS proteins113. Grb2 can bind the

guanine exchange factor (GEF) son-of-sevenless. This enzyme catalyzes the switch of membrane

bound, inactive, guanosine diphosphate (GDP)-bound Ras to an active, Guanosine triphosphate 19

(GTP)-bound Ras113. Ras interacts with the Raf kinase, which in turn stimulates mitogen-activated

protein kinase kinases (MEK) 1 and MEK2. MEK1/2 activate the mitogen-activated protein

kinases (MAPK) extracellular signal-regulated kinase 1 and 2 (Erk1 and Erk2) by

phosphorylation113. Erk1 is dual phosphorylated and activated at threonine residue Thr202 and

tyrosine residue Tyr204, while Erk2 is phosphorylated at threonine residue Thr183 and tyrosine

residue Tyr185. Erk signalling plays a direct role in cell differentiation and proliferation by

regulating gene expression113. Interestingly, Erk1 and Erk2 seem to execute similar functions since

the loss of Erk1 in whole body knockout mice is almost completely compensated by Erk2

activity124. However, Erk1 deficient mice display defects in T-cell maturation suggesting a specific

role for Erk1 signalling in immune cell proliferation124. The effects of insulin mediated Erk

signalling on gene expression can be mediated through the activation the transcription factor

Elk1125,126. It has been demonstrated in pituitary cells, that insulin stimulated Elk1 signalling

promotes prolactin expression127. Importantly, Erk1 signalling is required for adipogenesis and is therefore responsible for the expansion of fat mass, a process that often precedes insulin resistance and type 2 diabetes128. Indeed, a recent study suggests that defects in Erk signalling are likely

responsible for the development of insulin resistance in adipose tissue129.

Figure 1.2: Insulin receptor signalling pathways. The schematic represents a simplified version of the major insulin receptor signalling pathways. Insulin signalling can be divided into the PI3K/Akt and Ras/Erk signalling branches. The schematic was adapted and modified with permission from reference 130.

1.3.3 Autocrine insulin signalling in the pancreatic β-cell

The insulin receptor is highly expressed in β-cells131,132. β-cells have been suggested as an insulin target for the first time in an early study from 1941; the administration of insulin was shown to decrease the insulin content of the pancreas suggesting the autocrine action of insulin133. This early pioneering work was the start of research directed toward the effects of insulin on β-cells.

Since then many models describing the autocrine effects of insulin have been introduced and will be discussed in further detail in the following sections.

1.3.3.1 Autocrine insulin effects on insulin synthesis

The pioneering study by Best et al. which suggested a negative effect of insulin on it’s own

biosynthesis has been revised. Many studies now demonstrate that insulin has a positive effect on

insulin gene transcription in the β-cell134. A popular model system to study the effects of insulin

signalling is a mouse strain with the β-cell specific knock-out of the insulin receptor, often referred to as the BIRKO mouse131. In this model the rat insulin promoter drives the expression of Cre recombinase, which excises exon 4 of the insulin receptor gene resulting in a frame shift and a non-functional receptor131. BIRKO mice were reported to be glucose intolerant through a lack of

first phase insulin secretion and develop diabetes131. With age, BIRKO mice display reduced

insulin content in islets supporting the concept that insulin mediates it’s own biosynthesis131.

Another study proposed that insulin up-regulates the transcription of its own gene by signalling via the insulin receptor A isoform134. In this process insulin signalling occurs from

receptors localized at the plasma membrane which activate insulin receptor substrates, PI3 kinase

and Akt135. The model suggests that Pdx1 acts as a transcription factor specifically activated by

insulin receptor signalling. It was demonstrated that insulin stimulation caused an increased binding of Pdx1 to the insulin promoter region in β-cells136,137. This model is supported by a study

that found a transient increase in insulin content in human islets treated with physiological doses

of insulin138. The emphasis in this study was on using an insulin concentration that led to increased

insulin gene transcription. Importantly, circulating insulin levels in the body are usually within the

picomolar range139. However, many studies use high nanomolar range concentrations to stimulate insulin signalling. Given that the IGF1 receptor has an affinity for insulin, especially at high concentrations, it is critical to apply ‘physiological doses’ of insulin to ensure signalling through the insulin receptor and not the IGF1 receptor101. 22

Studies have shown, even independent of insulin administration, that insulin has positive

effects on its own synthesis. For example, the overexpression of the insulin receptor in β-cells

resulted in a three-fold increase of β-cell insulin content140. Additionally, the specific effect of

insulin on insulin biosynthesis via insulin receptor signalling was demonstrated by treating β-cells

with IGF1 or an IGF1 receptor antagonist. Both treatments displayed no changes in insulin

promoter activity strongly suggesting that insulin’s effect on it’s biosynthesis is specifically

mediated through insulin binding to the insulin receptor135. Together, these data suggest that

insulin can promote insulin gene transcription in β-cells.

However this concept has been challenged since it’s introduction141. A study suggests that

insulin biosynthesis is dependent on the exposure of β-cells to nutrients and that glucose controls

insulin mRNA translation142. In this work, an effect of insulin on insulin synthesis was not

observed. Another argument is that if insulin promotes it’s own synthesis this could lead to an

infinite cycle of insulin synthesis in β-cells141. But insulin can only be released and signal upon

glucose stimulated secretion, therefore an unlimited insulin synthesis is unlikely. In fact, it does

make physiologically sense to stimulate insulin biosynthesis after the release to refill secretory

granules with insulin. Together, the discrepancy of the data highlights that further research directed

toward the autocrine effects of insulin on insulin biosynthesis is required.

1.3.3.2 Autocrine insulin effects on insulin secretion

The autocrine role of insulin on it’s own secretion is controversial135,141. In the past decades,

the autocrine effects of insulin have been reported as a positive, negative or none on insulin

secretion141. Early studies did suggest that insulin inhibits it’s own secretion through unknown

mechanisms135,143,144. However, a number of subsequent studies indicate the opposite and can show

a positive role of insulin on insulin secretion135,145-147.

Islets of the BIRKO mice were used to demonstrate in vitro that autocrine insulin signalling

is required for glucose sensing and insulin secretion of β-cells148. In these experiments, isolated β-

cells from BIRKO mice showed defects in the intracellular calcium homeostasis in response to

glucose challenges explaining the reduced secretion of insulin in response to the stimulus148.

Additional evidence for a positive effect of insulin on insulin secretion comes from studies modulating insulin receptor substrates. It is proposed that insulin signalling through insulin receptor substrates is responsible for mediating insulin exocytosis. Global knock-out of IRS1 leads to reduced insulin secretion in response to a glucose challenge147. Similar results were obtained

from mice with a β-cell specific knock-out of IRS2149, but it is not clear whether these are acute or

chronic effects, due to the life-long duration of the knockout. Strikingly, diabetic individuals with

a polymorphism in IRS1 show defects in insulin secretion supporting that autocrine insulin

signalling can stimulate insulin secretion, either directly or indirectly150. However, these in vivo

results are only reproducible to some degree. For example, isolated IRS1-/- islets show reduced

insulin secretion in response to glucose but IRS2-/- islets are unaffected151. Surprisingly, DNA

antisense mediated knockdown of IRS1 and IRS2 in rat islets led to an increase in insulin secretion

suggesting that insulin signalling might indeed have an inhibitory effect on its secretion152. The mechanism by which IRS signalling could potentially contribute to insulin secretion is not completely understood, but observations in IRS deficient islet show that the cytoplasmic calcium oscillations usually observed in the glucose response of β-cells are reduced in these mutant IRS1 islet cells145. Whether the regulation of cytoplasmic calcium through IRS signalling is mediated

by PI3 kinase signalling is controversial and both dependence and independence of PI3 kinase 24

have been have been reported145,153. Collectively, it is still controversial if insulin has a positive or negative effect on its own secretion and some studies even suggested no effects of insulin on insulin secretion138,140,154,155. Together, the discrepancy of the data on insulin stimulated insulin

secretion could be explained by the fact that there is no universal protocol. The mentioned studies

have been carried out in a number of different models consisting of in vivo and in vitro experiments in tissue of various species. Clearly, further systematic studies are required to resolve this question.

1.3.3.3 Autocrine insulin effects on β-cell proliferation

The rate of β-cell proliferation is highest in the prenatal state and gradually decreases with age156. Under normal, adolescent conditions β-cells undergo at an approximate rate of 0.5% cell

death and birth135. This balance can change under certain conditions135. For example, in pregnancy,

as well as in early stages of type 2 diabetes, a β-cell mass increase is observed135. Pancreatic islets

of the BIRKO mice are smaller compared to controls thus suggesting a positive effect of insulin

on β-cell proliferation131. Direct evidence that insulin is a positive regulator of β-cell proliferation

was obtained from studies stimulating primary mouse β-cells with insulin, which resulted in

increased proliferation mediated by Raf1 signalling157. The modification of insulin signalling

through manipulation of insulin receptor substrates provided further evidence that insulin

positively affects β-cell proliferation135. Reduced β-cell mass was observed in mice with a global

IRS2 knock-out151. A β-cell specific IRS2 knock-out leads to the reduction of β-cell mass in adult mice confirming results of global IRS2 knock-out studies149. This potential positive effect on

proliferation is suggested to be ensured by insulin signalling through insulin receptor substrates

and the Akt signalling branch135. This was demonstrated by the specific expression of a

constitutively active mutant of Akt in β-cells, which led to an increase in β-cell mass158. This study 25

suggested that the increase in β-cell mass was mediated by both increased β-cell size and β-cell

proliferation. On the contrary, another study suggested that insulin mediated Akt signalling only

affects β-cell size positively but the number of β-cells and therefore β-cell proliferation rate

remained unchanged159. The potential role of Akt signalling in β-cell proliferation was supported

by a study addressing a signalling component upstream of Akt. A β-cell specific knock-out of 3-

phosphoinositide-dependent protein kinase 1 led to a decrease in β-cell mass in mice suggesting

an involvement of the Akt signalling branch in β-cell proliferation160. Surprisingly, loss of function

experiments realized by the expression of a kinase-dead Akt mutant in β-cells did not affect β-cell

size or number161. This could be explained by the fact that even though a mutant was expressed

about 20% Akt activity remained, which is likely sufficient to maintain basal β-cell proliferation rates161. Together, evidence points toward a positive effect of insulin signalling via Akt on β-cell

proliferation in islets135.

On the contrary, early studies showed that an injection of rats with exogenous insulin leads

to a decrease in β-cell mass133. These studies are confirmed by recent work that analyzed prenatal

pancreas sections from mice lacking insulin genes162. The analysis revealed β-cell hyperplasia in

insulin deficient mice suggesting a negative effect of insulin on β-cell proliferation162.

1.3.3.4 Autocrine insulin effects on β-cell survival

A reduction of functional β-cell mass is one of the key symptoms in progressed stages of type 2 diabetes75. At this stage, circulating insulin levels are low due to β-cell

dysfunction/exhaustion and β-cell death75. Lower levels of circulating insulin and increased β-cell

death in type 2 diabetes led to the hypothesis that insulin has an anti-apoptotic effect on β-cells.

Despite their smaller islet sizes the islets of the BIRKO mice did not show increased β-cell

death at 2 weeks of age based on TUNEL staining131,163. However, experiments with isolated

human and murine islets demonstrated that the administration of insulin can protect β-cells from

serum withdraw induced apoptosis137. The physiological doses of insulin used in these experiments

did not activate Akt signalling, suggesting that the anti-apoptotic effect of insulin on β-cells is not mediated by Akt signalling but rather signalling through Erk. This hypothesis was supported by a study utilizing a kinase-dead Akt mutant in β-cells, which did not affect β-cell number161.

Interestingly, the knockout of 3-phosphoinositide-dependent protein kinase 1 in β-cells caused increased islet apoptosis suggesting that the anti-apoptotic effect of insulin on β-cells is carried out via PI3 kinase dependent signalling but likely independent of Akt160. Further evidence for an anti-

apoptotic role of insulin comes from studies that manipulated insulin receptor substrates. Indeed, the global knock-out of IRS2 led to decreased β-cell mass115. However, a β-cell specific deletion

of IRS2 did not lead to β-cell apoptosis adding controversy to the proposed insulin receptor

substrate dependent anti-apoptotic effect of insulin149,151. Together, the role of insulin on β-cells

survival remains controversial and requires more studies to determine the exact signalling

mechanisms which are involved in this process135.

1.3.3.5 Interplay between insulin and IGF1 signalling in β-cells

Given that insulin receptors can form heterodimers with IGF1 receptors and both insulin and

IGF1 can bind to either receptor the question was raised how tightly IGF1 signalling is tied to insulin receptor signalling and how it influences β-cell function and survival. Evidence for an interaction between the two pathways in β-cells came from the observation that mice lacking IGF1 receptor specifically in β-cells displayed glucose intolerance a phenotype previously observed in 27

the BIRKO mouse131,164. The glucose intolerance in the IGF1 receptor β-cell knockout mice was

due to a reduced expression of glucose transporter 2 in these cells, which led to a faulty sensing of

extracellular glucose concentrations164.

To elucidate the interaction between IGF1 and insulin signalling in β-cells a double knock-

out mouse model was developed which lacked both the insulin and IGF1 receptor specifically in

β-cells163. Strikingly, only double knock-out mice developed hyperglycemia under basal

conditions while a single knockout of either the insulin receptor or IGF1 receptor in β-cells did not

change basal blood glucose levels within 50 days after birth163. Single knock-out mice displayed

glucose intolerance but a remarkably more severe glucose intolerant phenotype was observed in

the double knock-out mice163. Additionally, double knockout-mice had a significantly higher rate

of β-cell death compared to single-knockouts leading to a decreased β-cell mass in 5 week-old

mice compared to single knock-out or wild type controls163. Interestingly, β-cell insulin content

and secretion were significantly lower in double knock-out mice compared to single knock-outs163.

Together, these data demonstrate that β-cell function and survival is not exclusively mediated by either insulin receptor or IGF1 receptor signalling but that likely an interplay of both insulin and

IGF1 is responsible for the maintenance of functional β-cells163.

1.3.3.6 Lessons from the BIRKO mice

BIRKO mice provide a powerful tool to observe and understand the autocrine effects of insulin signalling165. Studies involving the BIRKO mice provided evidence for the essential role of insulin in β-cell function and survival and suggested a unifying mechanism that draws the connection between insulin resistance and loss of β-cell function a process during the development of type 2 diabetes131,165. 28

However, it should be considered that the knock-out mediating Cre recombinase is driven

by the rat insulin promoter. The rat insulin promoter has been shown to be active in the brain166.

Insulin receptors are expressed in the brain since insulin has shown to affect metabolism, memory and behaviour by binding receptors in the brain167. Therefore, results obtained from BIRKO mice

cannot be interpreted as exclusive effects of manipulated insulin signalling in the β-cell168.

Consequently, a promoter that is truly specific to β-cells should be applied to facilitate studies directed toward insulin’s function on β-cells. The mouse insulin 1 promoter has been suggested as a much more specific promoter to drive Cre expression exclusively in β-cells and studies to confirm the BIRKO results with this new model system are underway168,169.

1.4 Insulin resistance

1.4.1 Insulin resistance caused by genetic defects

One of the major symptoms of type 2 diabetes is insulin resistance in peripheral tissue. As a

consequence, the body is not able to take up glucose from the bloodstream resulting in

hyperglycemia. A number of genetic defects are known which can cause insulin resistance. For

example, a polymorphism of IRS1 is observed in some type 2 diabetes patients leading to

decreased insulin signalling through the PI3K pathway170,171. Additionally, many polymorphisms

in the human IRS2 gene have been observed but a correlation to incidences of type 2 diabetes

remains to be established172. Furthermore, regulatory subunits of PI3K can be affected by

polymorphisms that lead to hyperglycemia and ultimately type 2 diabetes173. Finally, rare cases of mutations in Akt or some of its downstream targets have also been reported in some patients suffering from type 2 diabetes174,175.

1.4.2 Insulin resistance caused by lipotoxicity

The accumulation of circulating triglycerides as a consequence of obesity leads to an

overexpression of hydrolyzing enzyme lipoprotein lipase, which is thought to be responsible for

causing insulin resistance in skeletal muscle176. c-Jun N-terminal kinases are major inhibitors of

insulin receptor signalling113. Free fatty acids, in particular, circulating palmitate levels are

elevated in obesity and induce the activation of c-Jun N-terminal kinases resulting in endoplasmic

reticulum (ER) stress and cytokine production177. Other lipid metabolites such as diacylglyerol can

cause insulin resistance by inducing IRS1 serine-307 phosphorylation reducing the tyrosine

phosphorylation on IRS1 consequently inhibiting the activation of PI3K through tyrosine

phosphorylated IRS1178. Moreover, an increase of saturated and a decrease of unsaturated fatty

acids is observed in type 2 diabetes and causes insulin insensitivity by reducing membrane

fluidity179.

1.4.3 Insulin resistance caused by tissue inflammation

The continuous expansion of adipocytes in the state of obesity leads to the secretion of

chemokines such as MCP-1. This process drives the recruitment of inflammatory macrophages

into adipose tissue causing a suppression of Akt signalling by the accumulation of the pro-

inflammatory cytokine TNFα180. Interleukin-1β, another cytokine secreted by inflamed adipose

tissue and immune cells, leads to a reduction in IRS1 expression and therefore contributes directly

to impaired insulin signalling and consequently hyperglycemia in type 2 diabetes181. In obesity, tissue inflammation is also caused by the Toll-like receptor driven activation of the NF-κB signalling pathway. This pathway is of fundamental importance for the development of insulin

resistance since mice with a reduced expression of Toll-like receptor signalling proteins are

protected from obesity induced insulin resistance182.

1.4.4 Insulin resistance caused by ER stress

The unfolded protein response is an adaptive quality control system for proper protein

folding and maturation in the ER. In obesity, this mechanism is enhanced due to a higher

conversion of metabolites. Crucial proteins such as PERK and IRE1α are involved in this process but also activate JNK, which leads to an inhibition of insulin signalling pathways.177 However,

the body developed mechanisms to counter-act this process. For example, the transcription factor

XBP-1 is activated by ER-stress and decreases c-Jun N-terminal kinases activation and therefore

increases insulin signalling.177

1.4.5 Insulin resistance in β-cells

Given that β-cells are targets of autocrine insulin signalling (Chapter 1.3.3) the question

arises if they display forms of insulin resistance or if they are affected by it. Indeed, an IRS1

polymorphism, which is associated with insulin resistance and type 2 diabetes, has been reported

to affect β-cells by reducing their insulin content, secretion and the number of secretory insulin

granules per β-cell150. Importantly, an exposure of primary β-cells to palmitic acid, a saturated

fatty acid results in insulin resistance that is caused by JNK mediated phosphorylation of insulin

receptor substrates183. This interferes the binding of IRS to the insulin receptor inhibiting insulin

signalling183. This condition corresponds to the effects of lipotoxicity on other peripheral tissue

such as the liver in insulin resistant and diabetic conditions183. To simulate hyperglycemia in vitro,

rat β-cells were treated with glycosamine, which led to an inhibition of insulin receptor and insulin 31

receptor substrate phosphorylation thus interfering insulin signalling in β-cells184. This inhibition

of insulin signalling by hypoglycemic conditions led to increased β-cell apoptosis demonstrating

the important role of insulin signalling on β-cell survival184. Collectively, there is strong evidence

for insulin resistance in β-cells, which highlights the requirement for research directed towards the

mechanisms of autocrine insulin signalling in this cell type.

1.5 Endocytosis

1.5.1 Endocytic pathways

Endocytosis describes the uptake of extracellular material into the cell. In this process the

cell invaginates parts of the plasma membrane to internalize cargo31. The process of endocytosis

can be divided in multiple pathways dependent on the cargo, the involved mechanism and the size

of the formed vesicle (Figure 1.3)31,185. These pathways describe a complex network of vesicles

and their trafficking, which involves the internalization and sorting of material. Specialized cells

such as macrophages and neutrophils are responsible for clearing large pathogens (e.g. bacteria or

yeast) in the organism by a process termed phagocytosis185. Macrophages bind bacteria with

antibodies located on their plasma membrane and engulf bacteria in organelles termed phagosomes

in which they are degraded.185 Multiple subtypes of phagocytosis have been defined and are

classified by the involved proteins and the nature of the ingested particle186.

Another mode of endocytosis found in a broad range of cell types is the process of pinocytosis, which describes the fluid phase uptake of small particles by membrane ruffling into the cell31,185. This is an unspecific process, which involves the uptake of solubilized cargo from

the extracellular medium31,185. In contrast, receptor mediated endocytosis describes the specific internalization of ligands which bind to receptors localized on the plasma membrane31,185. These 32

receptors can localize in different domains on the plasma membrane. Characterized by their protein

composition receptor mediated endocytosis can be further subdivided into modes: clathrin-

dependent, caveolin-dependent, or clathrin- and caveolin-independent endocytosis185.

1.5.1.1 Clathrin-mediated endocytosis

Clathrin-mediated endocytosis is suggested to be the major pathway for receptor mediated

endocytosis in mammalian cells187. A recent publication suggests that up to 95% of internalized

receptor-bound cargo enters the cell via this pathway187. Clathrin is a protein which can form a

molecular coat around pits in the plasma membrane31. This coat is composed of subunits which

each contain three clathrin heavy chains strongly interconnected with their respective light chains

which together form a stable coat-like structure31,185. Upon ligand binding to the receptor, the clathrin-coated pit invaginates. Subsequently, dynamin assembles around the neck of the pit and pinches it off the plasma membrane generating the clathrin coated vesicle188. Shortly after internalization an ATPase targets the clathrin light chains to drive the coat disassembly from the clathrin coated vesicle189. Subsequently, effector proteins get recruited to the membrane of the

vesicle to mediate further transport steps.

Rab GTPases play an essential role in directing the transport of vesicles originated from clathrin-mediated endocytosis190. Rab proteins cycle between an inactive, cytoplasmic GDP-

bound state and an active GTP- and membrane bound state190. Rab5 labels early endosomes and

is an essential component for the biogenesis of the entire endolysosomal system191. In particular,

Rab5 recruits effectors such as the early endosomal antigen 1 (EEA1) to membranes where it is

responsible for tethering endosomal membranes to initiate endosomal fusion192. Depending on the

internalized cargo, Rab5-positive early endosomes can be either recycled back to the plasma 33

membrane via recycling endosomes labeled with Rab 11 or mature into late endosomes by an

exchange of Rab5 with Rab7193,194. Late endosomes fuse with lysosomes where cargo and receptor

degradation can take place31. Together, clathrin-mediated endocytic routes can be divided into a

recycling and degradation pathway31. Which particular route internalized cargo follows is ligand and receptor specific. For example, the iron transporter transferrin and its receptor follow the recycling pathway while the epidermal growth factor (EGF) and the EGF-receptor are trafficked through the degradative pathways to lysosomes195,196.

1.5.1.2 Caveolin-mediated endocytosis

The plasma membrane of the cell is a highly dynamic environment composed of a variety of

lipids. These lipids can form functional platforms termed lipid rafts197. Since lipid rafts are highly

mobile, intracellular scaffolding domains are responsible for anchoring these compartments to the

plasma membrane prior to membrane budding198. One of these scaffolding proteins is Caveolin198.

Caveolins are expressed in three different isoforms. Caveolin-1 (Cav1) is ubiquitously expressed while Cav-2 expression is restricted to white adipose tissue, endothelial, smooth muscle and pancreatic islet cells198. Cav-3 is predominantly expressed in cardiomyocytes198. While their

expression is tissue specific their role in mediating endocytosis is similar. Caveolins spatially limit

lipid rafts in the plasma membrane and form caveolae, membrane pits which act as entry portals

into the cell in caveolin-mediated endocytosis198. Similar to clathrin-mediated endocytosis,

caveolae pinch off the plasma membrane via the assembly of dynamin at the neck of the membrane

invagination188. However, the dynamics of caveolae and whether they are indeed internalized into

the cell was always controversial and cavaeolae have been suggested as both dynamic and stable

structures of the plasma membrane199-201. Since these controversial studies often use different cell 34

types, it is likely that the dynamics of caveolae are cell type specific. However, it has been

demonstrated that several pathogens such as the HIV or the polyoma virus enter cells through the

endocytosis of caveolae, suggesting that caveolae are indeed internalized into the cell.202,203 The internalization of caveoalae has shown to be dependent on Cav1 phosphorylation at tyrosine 14 mediated by the Src kinase201,204,205. The fate of the internalized caveolin coated vesicle is

controversial. Initially these organelles were referred to as caveosomes201. However the definition

of this organelle has been revised206. The current consensus is that internalized caveolin coated

vesicles merge with the classic endocytic pathways and traffic to a variety of intracellular

organelles such as endosomes, lysosomes and the ER206,207. Together, the internalized caveolin

coated vesicle is seen as an intermediate organelle feeding into endocytic routes rather than an

independent trafficking organelle.

1.5.1.3 Other endocytic pathways

Besides the vesicles derived from either clathrin- or caveolin-mediated endocytosis there is

a number of endocytic pathways which receive their organelles independent from clathrin or

caveolin positive membrane structures. For example, clathrin-independent carriers (CLIC)

originate from lipid rafts which are neither positive for clathrin nor caveolin protein208. The

GTPase activating protein GRAF1 is thought to be the regulating factor mediating the internalization of endosomes in the CLIC pathway209. Flotillin-1 (Flot-1) is a protein localized in

plasma and vesicular membranes describing a pathway distinct from classical caveolin or clathrin

mediated endocytic routes210. Flot-1 mediated endocytosis has been implicated in toll-like receptor

signalling thus defining an important subset of endosomes for intracellular signalling211. Together,

endocytic pathways are complex networks of vesicles originating from various membrane domains

ensuring directed intracellular trafficking and signalling.

Figure 1.3: Endocytic entry portals to the cell. A simplified schematic of the major endocytic entry pathways in mammalian cells. The green structures represent dynamin. This schematic was adapted with permission from reference 212.

1.5.2 The role of endocytosis in insulin receptor signalling

The internalization of tyrosine kinase receptors is a major mechanism to regulate ligand

binding induced signalling213. Depending on the cell type, the INSR can be internalized either

through caveolin- or clathrin-mediated endocytosis214,215. INSR internalization and signalling

through caveolae has been studied in many tissues and in particular detail in adipocytes216. Studies

in primary adipocytes showed that a binding of insulin to its receptor caused the

autophosphorylation of the receptor tyrosine kinase which in turn phosphorylated Cav1 at tyrosine

14 causing the internalization of the receptor complex through caveolin-mediated endocytosis214.

Notable is the tissue dependency of INSR trafficking routes after internalization. In adipocytes, only a minor amount of internalized INSR complexes is degraded in lysosomes suggesting a recycling of INSR to the plasma membrane217. Conversely, in hepatocytes the majority of the

internalized INSR complex is transported to lysosomes for degradation218. A mathematical model

suggested that the internalization of the INSR is a mechanism mediating the negative feedback

loop in insulin signalling by the dephosphorylation of the internalized receptor217. The role of

caveolin in insulin receptor signalling appears to be of an essential nature. Studies in human

adipocytes showed, that IRS1 binds directly to Cav1 giving the scaffolding protein a fundamental

importance in directing proteins involved in INSR signalling to the receptor219. This link between

Cav1 and INSR signalling is further supported by results demonstrating that a Cav1 knockdown

leads to an increased degradation of IRS1 in murine embryonic fibroblasts and a reduced

expression of INSR in adipose tissue220,221. Lastly, inhibition of INSR endocytosis by the

overexpression of a dominant negative dynamin mutant leads to an impaired Erk signalling upon

insulin stimulation in a dose and time dependent manner in adipocytes222. Together, a large set of

data is pointing towards a direct involvement of endocytosis in the regulation of INSR signalling.

However, the mechanistic details especially in autocrine insulin signalling processes in β-cells remain to be resolved216.

1.6 Intracellular calcium signalling

Calcium is one of the most important signalling molecules in the cell. It has been implicated

in the regulation of a wide variety of cellular events such as endocytosis and exocytosis, cell death

and proliferation, cell adhesion and motility, cell-to-cell signalling, and gene transcription223-226.

Local calcium signals are involved in the regulation of intracellular trafficking events. For example, the glucose-stimulated release of insulin from secretory granules of β-cells is dependent on local increases in cytosolic calcium levels227. It is well established that the depletion of endoplasmic reticulum (ER) calcium and increase in cytosolic calcium are involved in the

execution of the programmed cell death called apoptosis via pathways regulated by the Bcl2 37

protein family and caspase signalling cascades225,228. During this process, the ER releases calcium

leading to ER-stress, a pro-apoptotic phenomenon. Calcium released from the ER can be taken up

by mitochondria, which in turn release the proapototic factor cytochrome c, further promoting cell

death229. Nuclear calcium signalling, however, is known to control gene expression. In this context

calcium can act as an expression enhancer or suppressor224. Collectively, decades of research have

strongly highlighted the physiological importance of intracellular calcium signalling defined by

the interplay of intracellular organelles. The mechanism by which calcium gets exchanged within these compartments is specific to the respective organelle.

In general, calcium can be transported across membranes via 3 different transport mechanisms230. Calcium can diffuse through channels down its electro-chemical gradient. Calcium

can also be transported against the concentration gradient via molecular pumps, which consume

ATP, or shuttled through ion exchangers, which make calcium trafficking dependent on other ion gradients230,231. Each cellular compartment has a specific set of calcium transporters. In this

context, organelles can act as discrete calcium stores or calcium buffers in the cell231.

1.6.1 Mechanisms of calcium signalling in the plasma membrane

The plasma membrane separates the low cytoplasmic calcium concentrations (100-200 nM)

from the extracellular medium, which has many orders of magnitude higher calcium content (1-2

mM)232. To maintain this gradient, the plasma membrane is equipped with a number of pumps and

exchangers. Their distribution and presence is cell type specific. All plasma membranes of

eukaryotic cells express the plasma membrane calcium ATPase (PMCA) a molecular pump which

is able to transport calcium out of the cell and against the concentration gradient by the hydrolysis

of ATP232. Calcium removal from the cytosol can further be executed by sodium calcium

exchangers (NCX). These antiporter ion exchangers use the energy stored in the electrochemical

gradient of sodium to facilitate calcium movement. It allows three sodium ions to flow down the

gradient across the membrane in exchange for the counter transport of one calcium ion232.

In contrast to the export of calcium, the cell allows the rapid influx of calcium from the extracellular environment by opening channels embedded in the plasma membrane. Transient receptor potential (TRP) channels can mediate the influx of calcium into the cell233. TRP channels

mediate sensations such as temperature, taste, pressure or vision. Therefore the channels can be

activated by extracellular stimuli like spices, stretch or osmotic pressure. TRP channels are rather

non-selective and mediate the influx of ions such as sodium and magnesium as well as calcium233.

The elevation of intracellular calcium can be executed by the opening of voltage gated calcium channels (VGCC)234. VGCCs are composed of several subunits. According to the subunit

composition and the conduction of different calcium currents, VGCCs can be divided into 3

different classes235. Due to structural and functional difference each channel class is involved in

different cellular processes. The VGCC 1 family initiates endocrine secretion, muscle contraction,

gene transcription and is regulated primarily by second messenger-activated protein

phosphorylation pathways. The VGCC 2 family initiates synaptic signal transmission and is

regulated primarily by direct interaction with SNARE or G proteins. The VGCC 3 family is

associated with the mediation of cardiac muscle contraction and is activated and inactivated more

rapidly and at lower membrane potentials than other voltage gated calcium channels235.

1.6.2 Mechanisms of calcium signalling in the endoplasmic reticulum

The endoplasmic reticulum (ER) is the most well characterized intracellular calcium store.

Its resting calcium content is significantly higher (300-800 µM) than the cytoplasmic calcium

concentration (100-200 nM)236. The ER calcium content is primarily regulated by the calcium-

importing pump sarco/endoplasmic reticulum calcium-ATPase (SERCA) and the calcium export

channels IP3 receptor (IP3R) and ryanodine receptor (RyR)237-239. By hydrolysing one molecule of ATP, SERCA raises ER calcium by transporting two calcium ions from the cytosol across the

ER membrane. SERCA activity can also be regulated directly by phospholamban, which acts in

an inhibitory manner. This inhibition can be released by protein kinase A dependent

phosphorylation of phospholamban239.

The release of ER calcium is primarily mediated by the IP3R and the RyR. Three IP3R

238 subtypes as well as alternative splicing variants of IP3R1 and IP3R2 have been identified . The

IP3R subtypes share about 65-85% homology and are expressed in an overlapping manner where

most cells express more than one subtype238. Upon extracellular stimulation by various agonists,

such as growth factors, phospholipase-C is activated and phosphatidylinositol 4,5-bisphosphate is

hydrolysed. This process generates IP3. Subsequently, IP3 binds to the IP3R, leading to calcium

release from the ER238.

The RyR channel is present in three different isoforms. RyR1 is primarily expressed in

skeletal muscle tissue, whereas the RyR2 is highly expressed in the heart muscle. The third RyR3

isoform is expressed more widely, but has been shown to be especially expressed in the brain237.

RyR activity can be activated by a process of calcium-induced calcium release. In many cell types,

RyR receptor activity is coupled to the activity of voltage gated calcium channels located on the

plasma membrane237. The initial release of calcium from the plasma membrane (by VGCC’s) or the ER (mediated by e.g. IP3R) can enhance RyR activity and lead to the propagation of calcium waves. As a consequence, small calcium release events can lead to greater calcium release from the ER lumen237. 40

1.6.3 Mechanisms of calcium signalling in the Golgi network

The Golgi network is closely linked to the ER and the major site of post translational protein

modifications such as glycosylation and cleavage240. The activity of key enzymes mediating these

processes is strongly dependent on calcium240. Therefore, the Golgi apparatus is equipped with

calcium channels and pumps to regulate its calcium content. The calcium concentration in the

Golgi was estimated to be in a range of 100-300 µM241. Since this concentration is significantly higher than the resting cytosolic calcium concentration, the Golgi apparatus was described as an intracellular calcium store. Interestingly, calcium channels and pumps are specifically distributed on sub-compartments of the Golgi network. The cis-Golgi, closely attached to the ER contains

241 SERCA pumps for calcium uptake and IP3R for calcium release . The trans-Golgi network,

mostly responsible for protein packaging and forming of transport vesicles contains RyRs for calcium release and the Golgi specific calcium pump secretory pathway calcium-ATPase (SPCA), which can transport calcium into the Golgi by consuming ATP242. SPCA activity has been

associated with increases in cytosolic calcium in a calcium-induced calcium uptake mechanism.

In contrast to the SERCA pumps of the ER, SPCA pumps can transport manganese along with

calcium to prevent manganese toxicity caused by increased manganese content in the cytosol242.

1.6.4 Mechanisms of calcium signalling in the nucleus

Although the nucleus-limiting nuclear envelope contains a complete set of calcium

regulating pumps and channels, nuclear calcium content is similar to that of the cytosol224. Calcium simply diffuses through the rather large nuclear pores in the nuclear envelope. Calcium channels and pumps of the nuclear envelope have been implicated in local calcium signalling224. It has been

demonstrated that the import or export of proteins from and to the nucleus is dependent on calcium.

In fact the opening of the nuclear pore complex is associated with elevated local calcium levels

derived from the nuclear envelope lumen whereas low calcium levels cause the nuclear pore to

close243.

1.6.5 Mechanisms of calcium signalling in mitochondria

Mitochondrial calcium uptake and release play an important role in the control of multiple

physiological processes, such as cytoplasmic calcium signalling and ATP production244. A dysregulation of mitochondrial calcium triggers the cascade of events that can ultimately lead to cell death245. Mitochondrial calcium release and accumulation are based on calcium exchangers,

channels and pumps. The driving force for calcium accumulation in mitochondria is the membrane

potential across the inner mitochondrial membrane244. Calcium exchangers use the concentration

gradient of calcium-, hydrogen- and sodium ions across the inner membrane to drive the release

of calcium back into the cytosol. Using this machinery, the mitochondrial calcium concentration

can reach as high as 20 µM244.

Due to its characteristic morphology with an outer and a cristae forming inner membrane,

mitochondria have a characteristic set of calcium transporters to shuttle calcium across two

membranes. The permeability transition pore (PTP) shuttles calcium directly across the two

membranes and is the only mechanism known to export calcium directly out of the mitochondria

matrix246. The opening of PTPs and subsequent release of calcium is mediated by high luminal

calcium concentrations (calcium-induced calcium release). PTPs cause mitochondria to become

permeable to small molecules, which draw water in the matrix by increasing the organelle's

osmotic load. Consequently, mitochondria swell and may rupture. Subsequently, cytochrome c can

be released into the cytosol and may cause apoptosis246.

Voltage gated calcium channels are responsible for transporting calcium from the cytosol

across the outer mitochondrial membrane. Conversely, the calcium-sodium antiporter NCLX

(sodium/calcium exchange protein 6) has been identified recently as an exchanger exclusively

expressed and localized on the inner mitochondrial membrane244. NCLX mediates the sodium

dependent calcium efflux from mitochondria. NCLX has been identified as the major calcium-

sodium exchanger since a catalytically inactive mutant of NCLX blocks the calcium-sodium exchange in isolated mitochondria244.

The mitochondrial calcium uniporter (MCU) is located on the inner membrane and

responsible for direct calcium transport into the lumen247,248. MCU possesses two transmembrane

domains forming a gated ion channel. The down regulation of MCU leads to a significant reduction

mitochondrial calcium uptake highlighting MCU as the major channel responsible for calcium

uptake into mitochondria. The activation of MCU is mediated by motifs of a subunit identified as

MICU1 (mitochondrial calcium uptake 1)249.

1.6.6 Mechanisms of calcium signalling in endolysosomes

After the pinching from the plasma membranes the luminal pH of endosomes decreases to

dissolve the internalized ligands from their receptors. The acidification of the endosomal lumen

can be correlated to their maturation state. In this process the near neutral pH of the freshly formed

vesicle decreases on the way to lysosomes to an acidic pH 531. These endocytic vesicles and

lysosomes are therefore often termed acidic organelles and have been traditionally suggested as

calcium stores250,251. Due to their small size, fast dynamics and changing luminal pH, calcium 43

measurements within endolysosomes have been technically challenging. Early pioneering work

by Gerasimenko and colleagues relied on the dye Oregon Green488 BAPTA-5 N taken up into

cells from the extracellular media, to estimate a calcium concentration of ∼28 μM in ‘early’

endosomes (defined as those imaged within 3 minutes after endocytosis). As the endosomes

matured, the calcium was seen to drop to 8.5 μM 5 minutes after endocytosis, and then further

decreased to 3 μM 20 minutes after endocytosis252. On the other hand, Christensen and colleagues

reported Ca2+ levels of 400-600 μM in lysosome-like structures loaded with FFP18-AM, a dye

reported to label cell membranes253. This wide range of values demonstrates, that the luminal

calcium concentrations in endosomes are highly dynamic. In fact these fluctuations have been

suggested to play a role in mediating vesicle fusion and fission254. Interestingly, defects in

lysosomal calcium handling have been associated with lysosomal storage disorders such as

Niemann–Pick type C and Mucolipidosis type IV, which are characterized by neurological

defects226. This suggests a central role of endolysosomal calcium in essential cellular functions.

Consequently, research has been directed toward the understanding of the role and mechanisms behind the regulation of luminal calcium in endosomes. So far four types of channels are thought to be involved in the regulation of luminal calcium in endosomes and will be discussed in further detail below.

1.6.6.1 Transient receptor potential channels

Transient receptor potential (TRP) channels reside in membranes as tetramers251. TRP

channels of the mucolopin family have been characterized in three isoforms which are expressed

in vertebrates and are predominantly localized in membranes of endosomes and lysosomes251. TRP

mucolipin 1 is distributed along early and late endosomes and was also found to be localized on 44

lysosomes255. TRP mucolipin 1 reaches the vesicular membrane either by a direct transport of the

newly synthesized protein from the Golgi or via an indirect route which includes the transport of

the protein to the plasma membrane prior to membrane invagination and endocytosis255. It is suggested that TRP mucolipin 1 is responsible for lipid sorting to lysosomes since mutations in

TRP mucolipin 1 are the cause for the lysosomal storage disorder Mucolipidosis type IV reflected by defects in lipid endocytosis255. However it is unclear if these defects in late endosomal sorting

are secondary to the accumulation of lipids caused by the mutations in TRP mucolipin 1255.

Interestingly, the depletion of TRP mucolipin 1 in the human HeLa cell line by RNA interference led primarily to a decrease in lysosomal pH while low-density lipoprotein trafficking was unaffected256. These results suggest that the trafficking defects observed in humans with TRP

mucolipin 1 mutations are likely secondary to an incomplete digestion of material in lysosomes

due to the altered luminal pH caused by TRP mucolipin 1 malfunction256.

The second isoform of the family, TRP mucolipin 2, is localized in the plasma membrane,

recycling and late endosomes and lysosomes255. TRP mucolipin 2 is thought to be an inactive

channel which acts as a negative regulator for the third isoform TRP mucolipin 3255. The

mechanism for this regulation is unknown but likely mediated by the first 28 residues of TRP

mucolipin 2 since a selective mutation of this region leads to increased TRP mucolipin 3 activity257.

TRP mucolipin 3 is highly expressed in the inner ear and a mouse with gain of function TRP mucolipin 3 expressed displays hearing loss255. It is localized predominantly on early endosomes and the maximum activity of TRP mucolipin 3 was determined at a luminal pH of 6.5 which is found in freshly internalized vesicles only255. In contrast to TRP mucolipin 1 and 2, the mechanism

for the function of TRP mucolipin 3 is better characterized. Like all TRP channels it is permeable

to calcium but inhibited by hydrogen ions consistent with the observation, that this channel is 45

predominantly active at near neutral pH values255. However, the specific mode of activation or

255 inhibition of TRP mucolipin 1 and 2 is less clear but both NAADP and PI(3,5)P2 have been

suggested as activators. Collectively, TRP mucolipins are a family of calcium channels specifically

localized on vesicles of the endolysosomal system and while their precise mode of action remains

to be elucidated their important role in vesicular trafficking by the regulation of luminal calcium

is well established255.

1.6.6.2 Two pore channels

Two pore channels (TPC) are localized throughout the endolysosomal system and are arranged as dimers within the lipid bilayer251. In humans and mice there is two functional TPC

isoforms. A third isoform has been identified as a pseudo gene in most mammals, including

humans and mice258. TPC1 and 2 are ubiquitously expressed throughout the human body258. TPC1

is localized throughout the endolysosomal system including recycling endosomes and lysosomes.

On the contrary, TPC2 was observed to be predominantly localized on mature endocytic vesicles

such as late endosomes and lysosomes. The physiological role of two pore channels is associated

with cell differentiation in the nervous system. Interestingly, during the differentiation of mouse

embryonic stem cells into neuronal progenitor cells a significant decrease of TPC2 expression was

detected which gradually returned to normal levels during later stages of neuronal cell

differentiation259. The knockdown of TPC in embryonic stem cells led to an acceleration of stem

cell differentiation into neuronal progenitors but these cells failed to differentiate into functional

neurons259. In line with these results an overexpression of TPC2 led to the inability of embryonic

stem cells to differentiate into neuronal progenitors259. Together, these data suggest a role of TPC2

mode of action in neuronal cell differentiation and similar effects have been observed in myoblast 46

and osteoblast differentiation258. Recently TPC2 has been implicated in the mediation of the fusion

between autophagosomes and lysosomes during autophagy. For example, the overexpression of

TPC2 in HeLa cells inhibited this fusion which resulted in an accumulation of autophagosomes

within the cell while a knockdown of TPC2 consequently led to a decrease in intracellular

autophagosomes260. Interestingly, the inhibited autophagosome-lysosome fusion was associated

with an increase in the luminal pH suggesting a correlation between the calcium content and pH

in the lumina of endolysosomal vesicles260. It remains to be determined if the defects in vesicle

fusion are caused by the altered pH or calcium, or if one is a consequence of the other.

The mechanisms behind two-pore channel activation and inactivation remain highly

controversial. However nicotinic acid adenine dinucleotide phosphate (NAADP) and

phosphoinositides are the strongest candidates for activators of TPCs on endolysosomes261,262. The evidence for NAADP being the activator of two pore channels is striking258. For example, RNA

interference mediated knockdown of TPC1 in neuronal precursors led to an inhibited differentiation which was mediated by NAADP in wild type cells263. The same study shows the

mobilization of calcium from lysosomes via NAADP263. The overexpression of TPC2 in the

human embryonic kidney cell line HEK293 led to a significant increase of radioactively labeled

NAADP binding to cellular membranes261. Furthermore, NAADP caused a significant increase of

calcium release from intracellular stores in cells overexpressing TPC2261. Importantly, the

sensitivity of two pore channels to NAADP is suggested to be concentration dependent with a

maximum TPC2 activation at NAADP concentrations of 30 nM in HEK293 cells264. Interestingly,

the thapsigargin induced emptying of endoplasmic reticulum calcium did not affect lysosomal

calcium content suggesting that ER and acidic organelle calcium contents are not functionally coupled264. Remarkably, the same study did not find an increased response to NAADP when 47

murine TPC1 was overexpressed suggesting different sensitivities of TPC1 and TPC2 to

NAADP264. This hypothesis is supported by studies that overexpressed either human TPC1 or human TPC2 in rat astrocytes and the overexpression TPC2 led to a much greater response of cells to NAADP than the overexpression of TPC1 did265. Collectively numerous studies strongly

suggest that two pore channels are targets of NAADP. If two pore channels bind NAADP directly

like a receptor or if adaptor proteins are responsible for the interaction remains to be determined.

Recently the concept of NAADP as the activator of two pore channels has been challenged.

For example, the double knock out of both two-pore channel isoforms in β-cells did not affect their

response to NAADP262. The same study demonstrated in artificially enlarged lysosomes, that two

pore channels were likely sodium channels which are activated by the phosphoinositide

262 PI(3,5)P2 . This was supported by a follow up study, which demonstrated that two pore channels

actually conduct sodium ions and are activated by ATP rather than by NAADP questioning the

concept of two pore channels as NAADP sensitive calcium channels266. Collectively, the mode of

action of two pore channels is highly debated and the mechanisms explaining their function need

to be further elucidated.

1.6.6.3 ATP gated ionotropic receptors

ATP-gated ionotropic receptors, also termed P2X receptors, are expressed in 7 isoforms in

vertebrates251. Calcium fluxes induced by P2X receptor activity have been associated with the

regulation of muscle contraction, neurotransmitter secretion, vesicle fusion and cell survival251,267.

The P2X4 receptors are found as trimmers on lysosomal membranes in a number of cell types251,267. P2X receptors are activated by ATP and inhibited by acidic pH, which raises the

question if the localization of P2X4 receptor is exclusively on lysosomes or potentially also on 48

less acidic late endosomal compartments. Interestingly, the P2X4 receptor has the highest calcium

permeability among the P2X receptor isoforms suggesting endolysosomes as compartment with

high calcium fluxes267. Secondary structures of the open and closed conformation of the P2X4

receptor have been established and the ATP binding sites to mediate channel opening are now

known267. Collectively, the mode of action of P2X receptors is now well established and the

observations regarding their functional roles in intracellular calcium homeostasis are underway267.

1.6.6.4 Ryanodine receptors

Historically, ryanodine receptors have been described as calcium release channels of the sarcoplasmic and endoplasmic reticulum31. However, one study suggested that ryanodine receptors

can localize to compartments of the endolysosomal system in β-cells268. In this context, it was

demonstrated that nanomolar concentrations of ryanodine can increase cytoplasmic calcium

concentrations which caused insulin secretion in β-cells. Interestingly, this calcium was not

mobilized from the endoplasmic reticulum strongly suggesting that ryanodine receptors in β-cells

are not exclusively localized to the ER268. Confocal microscopy analysis of primary β-cells

suggested that ryanodine receptors could localize to endosomes since staining of endogenous

protein showed a colocalization to the early endosomal antigen 1268. Together, there is indirect

evidence that ryanodine receptors could be potential regulators of endosomal calcium. However,

further functional studies need to be carried out to test this concept.

1.7 Calcium signalling in the pancreatic β-cell

Calcium (Ca2+) is an essential second messenger ion and mediates crucial processes such as

insulin secretion, the major function of the pancreatic β-cell269. In this process, glucose enters β- 49

cells through GLUT2 transporters located at the plasma membrane. The subsequent metabolism

of glucose during glycolysis and the Krebs cycle leads to an increase in the ATP:ADP ratio in the

cytoplasm. This causes the closure of ATP-sensitive potassium channels on the plasma membrane.

The subsequent depolarization of the outer plasma membrane opens voltage-gated Ca2+ channels leading to an influx of extracellular Ca2+ into the cell. Soluble N-ethylmaleimide-sensitive factor

attachment protein receptors (SNARE) located on the membrane of insulin granules respond to

this Ca2+ increase by binding to their partner SNARE proteins on the plasma membrane causing

the fusion of the insulin granule with the plasma membrane to release insulin in the blood

stream269. Interestingly, the acute stimulation of β-cell with free fatty acids stimulates an increase

in cytoplasmic calcium and promotes insulin secretion270. However, a chronic exposure has an

opposite effect highlighting that under diabetic conditions with increased circulating levels of fatty

acids β-cell calcium influx and therefore insulin secretion can be harmed270.

Besides affecting insulin secretion, intracellular Ca2+ fluxes in a variety of organelles affect

important processes in β-cells270. For example, the ER is able to take up cytoplasmic Ca2+ through

sarco-endoplasmic reticulum Ca2+-ATPase (SERCA) pumps270. This can be observed in the

glucose response of β-cells, when the metabolism of glucose leads to an increase in intracellular

ATP which in turns activates SERCA pumps and consequently decreases and transports

cytoplasmic calcium into the ER prior to the massive increase in cytoplasmic calcium upon the

opening of the voltage gated calcium channels270. In type 2 diabetes it is suggested that the elevated

levels of free fatty acids negatively influence ER calcium homeostasis. This condition has been

simulated in vitro by the incubation of β-cells with palmitate271. This led to a reversible decrease

in ER calcium but also resulted in ER stress and β-cell death271. Together, the proper regulation of

ER Ca2+ is essential for β-cell survival and can be affected under type 2 diabetic conditions270. 50

Another important Ca2+ store in β-cells are mitochondria. This organelle is able to take up

large amounts of cytoplasmic Ca2+ through mitochondrial Ca2+ uniporters (MCU)270.

Mitochondrial fluxes can be observed during the glucose stimulation of β-cells270. In this process,

increasing mitochondrial Ca2+ stimulates the oxidative metabolism of glucose and contributes

therefore directly to the synthesis of ATP – an important step for the initiation of insulin secretion

by β-cells270. In type 2 diabetic conditions it was shown that glucolipotoxic effects can harm

mitochondrial calcium uptake and therefore delay the increase of the ATP/ADP ratio in the

cytoplasm which in turns delays insulin secretion which is dependent on the blockade of ATP

sensitive potassium channels270. Interestingly, mitochondrial Ca2+ uniporter expression was not

changed under these conditions but the structure of the mitochondrial network was impaired

suggesting that this could attribute for the decreased uptake of cytoplasmic calcium into

mitochondria during the glucose response of β-cells under diabetic conditions270.

The role of endosomes in β-cell calcium homeostasis is controversial270. Two pore channels

are suggested to be localized on endosomes and are also expressed in β-cells261. One model

proposes NAADP as the major activator of two pore channels. Indeed, β-cells from two pore

channel 2 knockout mice fail to respond to NAADP261. Since glucose was found to increase intracellular NAADP concentrations in β-cells it was hypothesized that calcium mobilized from endosomes via NAADP could potentially contribute to the cytoplasmic calcium increase during the glucose response of β-cells270. Surprisingly, β-cells from two pore channel 1 and 2 double

knockout mice displayed an unchanged increase in cytoplasmic calcium during the glucose

response of β-cells, which argues against the previous model262. Another model suggests the

mobilization of calcium from β-cell endosomes via ryanodine binding to it’s receptor –

independent of NAADP268. The same group also proposed endosomes as calcium buffers rather 51

than calcium releasing stores during the glucose response of β-cells268. Together, the physiological

role of endosomal calcium in β-cells is still unclear and the mechanism of calcium mobilization

from these organelles is poorly understood.

1.8 Measuring calcium in live cells

The field of signal transduction has benefited tremendously from a number of cell

physiology techniques enabling real-time analysis of Ca2+ signals. Of all second messengers, the measurement of Ca2+ is the most advanced, and this has permitted advances in understanding Ca2+ signal coding and the mechanisms controlling diverse cellular functions. Direct analysis of Ca2+ fluxes involves either electrophysiological measurements of Ca2+ channel fluxes or Ca2+ imaging.

The many roles of Ca2+ signalling have been primarily established using various imaging

techniques. In general, intracellular Ca2+ can be measured using light microscopy or electron

microscopy. The Ca2+ content in various cellular compartments can be analyzed by the detection

of element-specific x-ray emissions upon excitation of the specimen with an electron beam272.

Light microscopy-based approaches allow for live cell imaging and are currently more common273-

275. This can involve dyes or engineered protein probes. Most of the existing live-cell dyes for Ca2+ measurements are based on the Ca2+-binding properties of the carboxylic acid BAPTA, a potent

Ca2+ buffer. However, chemical probes based on BAPTA can have a significant Ca2+ buffering capacity of intracellular Ca2+ and could therefore delay or obliterate natural Ca2+ fluxes275. Upon binding Ca2+, BAPTA-based probes change their fluorescent intensity or properties such as

emission and/or excitation wavelength. Therefore, intensiometric or ratiometric dyes can be used to monitor Ca2+ fluxes in live cells. Strengths of Ca2+ dyes include their rapid response to dynamic

changes in Ca2+, high dynamic range, resistance to photobleaching and the fact they do not need 52

to be transfected into cells275. The biggest caveat involved in the use of Ca2+ dyes is the rather unspecific uptake into multiple cellular compartments. The era of Ca2+ imaging using genetically

encoded sensors started with the adaptation of the luminescent protein Aequorin276. This 22-kDa

photoprotein, isolated from the jellyfish Aequorea victoria, is luminescent upon binding Ca2+.

However, this process is consumptive meaning that Aequorin can only be used to monitor an increase in Ca2+ from an artificially low level, but cannot be used to monitor steady state or

dynamic fluxes in Ca2+ concentration starting at physiological levels. This pitfall was overcome

by the introduction of the fluorescent probes based on green fluorescent protein273. So-called

“cameleon” probes are based on fluorescent resonance energy transfer (FRET)-based detection of

the conformational change calmodulin undergoes upon binding Ca2+ bringing the fluorescent

proteins into close proximity allowing energy transfer during donor excitation. One caveat of the

FRET-based Ca2+ sensors is the size of the rather large construct, harbouring two fluorescent

proteins in addition to calmodulin and M13 domains, makes it difficult to transfect, and a proper

targeting to intracellular organelles might be challenging in some cell types. It should be noted that

the core elements of Ca2+ biosensors may also alter the Ca2+ homeostasis of the observed cells or

interact with various signalling pathways. For example, it has been reported that the

overexpression of calmodulin can induce cell death277. It has also been shown that calmodulin interacts directly with Ca2+ channels235. Consequently, overexpression of a calmodulin-based

biosensor could affect the Ca2+ homeostasis in the cell. However, the introduction of circular

permutated fluorescent proteins significantly reduced the size of calmodulin-based Ca2+ indicators,

potentially making them less disruptive within microdomains278. The circular permutation

approach involves a single fluorescent protein that is split into two pieces and attached to the C-

and N-terminus of the Ca2+-sensing calmodulin/ M13 domain. The conformational change 53

calmodulin undergoes upon Ca2+ binding rearranges the confirmation of the fluorescent probe and

changes its fluorescent properties such as emission or excitation wavelength and/or intensity.

These probes allow ratiometric Ca2+ imaging using a significantly smaller construct compared to

FRET-based cameleon probes. Collectively, these tools continue to enable the discovery of critical

mechanisms in signal transduction.

1.9 Goals and objectives

Endosomes are rapidly moving cargo transporters in the cell shaping the intracellular and

plasma membrane environment. Additionally, endocytosis acts as a mechanism for signal

transduction. The goal of this work was to characterize endosomes of the β cell as platforms in

insulin receptor trafficking and signalling and to determine their contribution to the regulation of

Ca2+ homeostasis in this endocrine cell type.

In order to characterize insulin receptor trafficking through the endolysosomal system in living β cells, a novel molecular tool needed to be developed. The work presented in chapter 2 proposes a novel tagging strategy for tyrosine kinase receptors. The goal was to test whether a fluorescent protein tag located between functional domains of the insulin receptor protein sustains the receptors function but enables at the same time the visualization of the insulin receptor in live- cell imaging. To discover potential links between insulin receptor trafficking and signalling in β- cells a systematic mapping of the receptor’s trafficking routes was required. The objective was to characterize the trafficking patterns of insulin receptors in β-cells using confocal and TIRF

microscopy. Results of this analysis are presented in chapter 2.

After the identification and characterization of the protein involved in insulin receptor

internalization in β-cells, the goal was to determine the proteins effect on insulin receptor 54

signalling and the physiological meaning of this event. The results of experiments addressing this objective are shown in chapter 3 and characterize the impact of insulin receptor endocytosis in autocrine insulin signalling.

The goal of the work presented in chapter 4 was to develop molecular tools to enable the measurements of calcium and pH in the lumina of β-cell endosomes to characterize their impact on intracellular calcium homeostasis in this cell type. Together, the overall objective of the investigations presented in this thesis was to characterize β-cell endosomes and their role in insulin receptor trafficking, signalling and calcium homeostasis and the contribution of these organelles to the maintenance of β-cell function.

Chapter 2: Insulin receptor trafficking in β-cells

2.1 Rationale

The pathogenesis of type 2 diabetes is associated with defects in both insulin signalling and

pancreatic β-cell function75,113,135. Insulin receptor signalling in the β-cell is an established

mechanism which is responsible for maintaining β-cell function135. It has been shown that

autocrine insulin signalling affects insulin synthesis, secretion and β-cell survival (Chapter

1.3.3)135. Insulin receptors, like many other tyrosine kinases, are rapidly internalized upon ligand binding279. Interestingly, it has been demonstrated that dynamin, a key enzyme in endocytic vesicle

synthesis, is required for insulin-stimulated Erk activation in adipocytes222 highlighting the

connection between insulin receptor trafficking and signalling. However, since dynamin is

required for the formation of both clathrin coated or caveolin coated endocytic vesicles and certain

raft-dependent pathways, this finding does not distinguish between the two pathways185,207.

Little is known about the mechanisms involved in insulin receptor internalization in

pancreatic β-cells, and what has been reported280 differs from findings in other cell types281,282.

One of the main challenges in the study of insulin receptor trafficking is the discrepancy between the behaviour of fluorescently tagged insulin receptors and the localization of endogenous insulin receptors. This can be partially explained by the fact that previous studies have fused fluorescent proteins to the N-termini or C-termini of the insulin receptor283,284, which are critical domains for

insulin receptor function98. The goal of the studies presented in this chapter was to thoroughly

investigate the internalization and trafficking routes of functional insulin receptors by labeling

insulin receptor proteins between functional domains.

2.2 Results

2.2.1 Subcellular localization of endogenous insulin receptors

In most cell types, insulin receptors have been found in multiple cellular compartments, including the plasma membrane, endosomes, lysosomes, secretory granules, and the nucleus279,285-

287. We examined insulin receptor localization in human and mouse pancreatic β-cells, both in vivo

and in vitro. In vivo, insulin receptors were found distributed throughout β-cells (Figure 2.1 A, B).

Confocal imaging of primary dispersed human β–cells in vitro confirmed that insulin receptors

were localized on vesicular and membrane structures throughout the cell (Figure 2.1 C), rather

than primarily on the plasma membrane, confirming multiple reports214,288 and pointing to a critical role for receptor internalization in this cell type289. Subcellular fractionation, which required large amounts of cell lysate was performed in NIH-3T3 fibroblasts and confirmed the localization of insulin receptors on the plasma and vesicular membranes (Figure 2.1 D).

Figure 2.1: Endogenous localization of insulin receptors. (A) Islets in pancreatic tissue sections from 24 week-old mice immunostained for insulin receptors (InsR, green), nuclei (blue). Scale bar = 50 µm. (B) 3D reconstruction of InsR staining (red) in (A), nuclei (blue) (C) Confocal section of endogenous InsR localization in dispersed primary human β-cells. Insets show AMCA-insulin staining. Scale bar = 10 µm. (D) Fractionation of NIH-3T3 cells identifies InsR localized at the plasma membrane (PM -Na+/K+ pump) and on intracellular vesicular membranes (ICM – LAMP2). C – Cytoplasmic fraction. Note: due to the procedure the loadings per lane are not even amounts of protein.

2.2.2 Development of functional fluorescent insulin receptor fusion proteins

To accurately track the route of insulin receptors in living cells, the development of

fluorescently labeled receptor which resembles the localization of endogenous receptors was

required (Figure 2.1). We employed a novel tagging strategy whereby pH-resistant fluorescent

proteins were placed at the extracellular domain of the insulin receptor in between the furin-like

region and the transmembrane domain, avoiding the interruption of known functional domains

(Figure 1.1 B, Figure 2.2 A)98. TagRFP and TagBFP were used because they are bright,

monomeric, and most importantly pH-resistant, making them ideal for studying traffic from within

the endosomal lumen290,291. Indeed, the receptor localized to similar patterns as endogenous receptors (Figure 2.2 B,C; Figure 2.1 C).

Several control experiments were conducted to ensure the functionality of these interdomain- tagged insulin receptors and determine whether their cellular distribution matched endogenous insulin receptor proteins. First, it was confirmed that interdomain-tagged InsRA-TagRFP and

InsRB-TagRFP colocalized with FITC-labeled insulin in cultured β-cells (Figure 2.2 D).

Importantly, InsRA-TagRFP or InsRB-TagRFP signalled in a manner comparable to endogenous receptors. For this experiment HEK-293T cells were chosen over MIN6 cells to avoid signalling artifacts potentially caused by autocrine insulin signalling. Furthermore embryonic kidney derived

HEK-293T cells represent a classical insulin target. Specifically, interdomain-tagged insulin receptors expressed in HEK-293T cells mediated Erk activation in a temporal pattern that was similar to endogenous receptors (Figure 2.2 E,F). These data indicate that interdomain-tagged

InsRA-TagRFP and InsRB-TagRFP proteins can be used to monitor the dynamics of functional insulin receptors. 58

Second, the subcellular localization of tagged insulin receptors was assessed by confocal

microscopy and stringent object-based colocalization analysis. To determine maximum biological

colocalization in this system, cells were transfected with InsRA-TagRFP and InsRA-TagBFP (i.e.

the same InsR isoform with different fluorescent tags) (Figure 2.2 G). As illustrated by the Venn

diagram in the inset of Figure 2.2 G, not all InsRA-TagRFP objects were positive for InsRA-

TagBFP objects, and vice versa. This is expected and is likely due to the existence of objects with

sub-threshold expression of one InsR isoform, as well as different signal-to-noise ratios between

TagRFP and TagBFP. Similarly, there was significant intracellular colocalization between InsRA-

TagRFP and InsRB-TagRFP (Figure 2.2 H), suggesting similar trafficking routes for each of the

isoforms, and between insulin receptor homodimers and heterodimers108. The newly created

interdomain tagged insulin receptors mirror the pattern observed for endogenous β-cell insulin

receptors in vivo and in vitro (Figure 2.1). This is in contrast to the near exclusive plasma

membrane localization of insulin receptors tagged at their C-termini (InsRA-C-eGFP) reported in

previous publications (Figure 2.2 I,J)283. In dynamic studies, clusters of C-terminal tagged insulin receptors exhibited dramatically reduced mobility within the plasma membrane compared to interdomain-tagged InsRA-TagRFP (10.5 s ± 2.6 s vs. 3.4 s ± 0.05 s domain life time, n=4, p≤0.05).

Together, our studies of inter-domain-tagged insulin receptors indicate that they are functional and

internalized in a pattern that is indistinguishable from endogenous insulin receptors.

Figure 2.2: Design and validation of functional fluorescent protein-tagged insulin receptors. (A) Schematic of inter-domain tagged insulin receptors Orange structure = InsR; Red structure = TagRFP (B,C) Expression of InsRA-TagRFP and InsRB-TagRFP in MIN6 cells. (D) Representative confocal image of colocalization between internalized FITC-insulin (1 h, 200 nM) and interdomain-tagged InsRA-TagRFP in MIN6 cells. (E,F) Over expression of interdomain tagged InsR sustains insulin-stimulated (50 nM) Erk phosphorylation in HEK 293T cells (n = 4). (G) Colocalization of identical insulin receptor isoforms tagged with different fluorescent proteins in MIN6 cells (n = 10). Inset Venn diagrams, here and throughout, can be used visualize the colocalization of the color-coded 60

proteins. (H) Colocalization of fluorescently labeled insulin receptor A and B isoforms in MIN6 cells. (I,J) C-terminal- tagged insulin receptors have a primarily plasma membrane localization that does not colocalize with interdomain- tagged insulin receptors in MIN6 cells (n = 10). Scale bars = 10 µm

2.2.3 Localization of insulin receptors in β-cell endolysosomal compartments.

We sought to determine the internalization and trafficking route of functional insulin

receptors by comparing their localization to endosomal pathway markers. First, we examined

whether insulin receptors colocalized with epidermal growth factor (EGF), an established

endosomal cargo of the clathrin pathway, in a pulse chase experiment. Fluorescent A488-EGF to

InsRA-TagRFP showed very limited colocalization (<5%) at short-chase times, indicating that the

proximal routes of endocytosis were distinct (Figure 2.3 A). The significantly increased

colocalization at longer chase times indicated that the vesicles of the two different internalization

routes eventually merged into more mature compartments such as lysosomes (Figure 2.3 A’). Next,

we assessed the colocalization of InsRA-TagRFP with Rab5a, an endosomal marker associated

with clathrin-dependent receptor-mediated endocytosis191 in β-cells. We found virtually no

colocalization between Rab5a and InsR (Figure 2.3 B). Similarly, InsRA-TagRFP did not

colocalize with Rab7-labelled late endosomes or Rab11a-labelled recycling endosomes,

suggesting that insulin receptors spend little, if any, time in endocytic vesicles labeled with these

Rab-GTPases (Figure 2.3 C,D). Since fluorescent protein overexpression may alter trafficking

patterns, we also performed detailed colocalization analysis of insulin receptors and endogenous

Rab markers of clathrin-dependent endocytosis. Indeed, endogenous insulin receptors showed minimal colocalization with endogenous clathrin in mouse β-cells (Figure 2.3 E). Similarly, tagged insulin receptors did not significantly colocalize with endogenous Rab5a, Rab7, or Rab4a (Figure

2.3 F-H). Together, these data suggest that insulin receptors are mainly internalized in β-cells via a pathway that is independent of clathrin and the Rab GTPases studied here.

Figure 2.3: Insulin receptors do not associate with markers of clathrin-dependent endocytosis. (A, A’) Pulse-chase colocalization analysis of Alexafluor488-labeled EGF relative to InsRA-TagRFP indicates separate entry pathways but eventual fusion into a shared mature pool of endosomes in MIN6 cells. A significant increase in the degree of colocalization was observed at a 45 min chase time compared to 0 min chase time (n = 4 per time point). Scale bar = 5 µm. (B-D) Colocalization analysis of InsRA-TagRFP with TagBFP-tagged Rab5a (early endosomes), TagBFP-Rab7 (late endosomes), and TagBFP-Rab11a (recycling endosomes) in MIN6 cells (n = 10). Similar results observed with InsRB-TagRFP. Scale bar = 5 µm. (E) Colocalization analysis of immunolabeled endogenous insulin receptors with immunolabeled endogenous clathrin in MIN6 cells (n =10). Scale bar = 10 µm. (F- H) Colocalization analysis of tagged insulin receptors with immunolabeled endogenous Rab5a, Rab7, and Rab4a (marker for recycling endosomes) in MIN6 cells. Scale bar = 10 µm.

Given the observation that insulin receptors did not significantly colocalize with proteins or cargo

that mark ‘classical’ endosomes in β-cells, we examined alternative internalization and trafficking

routes. We decided to investigate the role of caveolin-1 (Cav1) because insulin receptors colocalize

with Cav1 in adipocytes, and Cav1 knockout mice show impaired insulin signalling in other tissues

221,292,293. Total internal reflection fluorescence microscopy (TIRFM), whereby an evanescent wave excites only <200 nm of the cell, was used to directly examine the plasma membrane and sub-plasma membrane space in β-cells. These experiment revealed a colocalization of endogenous insulin receptor and Cav1 protein at the plasma membrane of isolated human β-cells and in MIN6 cells overexpressing fluorescently labeled insulin receptors and Cav1 (Figure 2.4 A,B). Studies in

β-cells and other cell types have indicated that internalized insulin receptors travel to lysosomes279,294, but the intracellular route of insulin receptors internalized via Cav1 has not been studied in β-cells. Confocal imaging demonstrated that Cav1-mRFP colocalized with InsRA-

TagRFP deep inside the cell, but to a lesser extent than the colocalization between the proteins at the plasma membrane (Figure 2.4 A-C). Flotillin-I (Flot1) has been described in clathrin- independent endocytosis210, is known to associate with caveolae210,295, and has been implicated in

insulin signalling in other cell types296,297, but it has not been examined in pancreatic β-cells.

InsRA-TagBFP showed robust colocalization with Flot1-mRFP positive vesicles by standard confocal imaging (Figure 2.4 D). Flot1-mRFP also colocalized with both Cav1-eGFP and LAMP2- eGFP (Figure 2.4 E,F), suggesting a distribution of internalized receptors to early and late compartments in the endolysosomal system.

A significant proportion of insulin receptors were found in lysosomes, as demonstrated by the colocalization of InsRA-TagRFP with LAMP2-eGFP (Figure 2.4 G). The colocalization of

Cav1 and Flot1 prompted me to determine whether some Cav1 can be found on lysosomes, and 63

indeed some colocalization between Cav1-mRFP and LAMP2-eGFP was observed (Figure 2.4 H),

consistent with previous reports localizing Cav1 to endolysosomal compartments206,298. The concept of the transport of internalized insulin receptors in Flotillin-1 vesicles to lysosomes was supported by staining of endogenous proteins in isolated primary mouse β-cells (Figure 2.4 I,J).

The relative colocalization of each of these markers to the functional tagged insulin receptors is summarized in Figure 2.4 K,L. Taken together, the data suggest that InsR are internalized from the plasma membrane via Cav1 positive vesicles and transported in Flot1 positive endosomes to lysosomes.

Figure 2.4: β-cell insulin receptors are transported to lysosomes in Cav1 and Flot-1 positive vesicles. (A) Immunolabeling and TIRF microscopy of dispersed human islet cells demonstrates colocalization of endogenous Cav1 to endogenous insulin receptors at the plasma membrane (n = 20). Scale bar = 5 µm. (B) TIRF imaging reveals a high degree of colocalization of Cav1-mTFP to InsRA-TagRFP at the plasma membrane of MIN6 cells (n = 10). Scale bar = 5 µm. (C) Confocal imaging of Cav1-mRFP and InsRA-TagBFP in MIN6 cells (n = 10). Scale bars = 10

µm. (D-H) Colocalization between InsRA-TagBFP and Flot1-mRFP, Flot1-mRFP and Cav1-eGFP, Flot1-mRFP and LAMP2-eGFP, InsRA-TagRFP and LAMP2-eGFP, Cav1-mRFP and LAMP2-eGFP in MIN6 cells demonstrates a Cav1-Flot1-LAMP2 endocytic trafficking route to lysosomes (n = 10). Scale bars = 10 µm; F: Scale bar = 5 µm. (I,J) Immunolabeling of endogenous insulin receptors, endogenous Flot1, and endogenous LAMP2 (lysosomes) in primary 12 week-old mouse islet cells. Scale bars = 10 µm. (K) Summary of object-based colocalization of tagged proteins compared with InsRA-TagRFP in MIN6 cells. Note that InsRA controls represent the maximum colocalization in this system (n = 10). (L) Summary of colocalization within vesicular pools in the Cav1/Flot1/LAMP2 pathway of MIN6 cells (n = 10).

2.2.4 Insulin receptor dynamics in Cav1 positive membrane domains

In order to examine the relationship between Cav1 and insulin receptors in living cells, we expressed mRFP-tagged Cav1 in MIN6 cells to levels that were comparable to those found in primary murine β-cells (Figure 2.5 A). The expression levels are crucial since an overexpression of Cav1 can lead to altered trafficking routes206. Importantly, MIN6 cells lack significant levels of

Cav1 expression. The re-expression of Cav1 via transfection of plasmids leads to a Cav1 expression comparable to primary β-cells. These transfected MIN6 cells are therefore a model system enabling the observation of Cav1 dynamics in living cells under physiological Cav1 expression levels. We employed two-color, time-lapse TIRFM to specifically assess the plasma membrane complexes. This procedure revealed that Cav1-mTFP accumulated immediately prior to the internalization of the insulin receptors into the intracellular space (Figure 2.5 B,C). Taken together, these data strongly suggest that Cav1 is a key coat protein involved in the internalization of functional insulin receptors in pancreatic β-cells.

Figure 2.5: Cav1 accumulates in insulin receptor positive membrane compartments prior internalization. (A) Cav1 levels in Cav1-mRFP transfected MIN6 cells relative to endogenous levels in primary mouse islets. (B, B’) Live-cell TIRF imaging in MIN6 cells reveals the reciprocal recruitment of InsRA-TagRFP and Cav1-mTFP to membrane domains prior to the internalization of insulin receptors. (C) Intensity analysis of InsRA-TagRFP positive membrane domains during the process of vesicle budding. *p < 0.05, (n = 15).

2.3 Discussion

The present data illustrates important technical considerations for the analysis of tyrosine- kinase receptor trafficking. Fluorescent tagging of proteins has the potential to provide insight into

their sub-cellular localization and trafficking kinetics. Despite the success and popularity of this

approach, attaching fluorescent proteins to key domains has been shown to disrupt the function of

some proteins, producing spurious results299,300. The insulin receptor is one of the most well studied proteins, with clearly defined functions for numerous domains. To the best of my knowledge, N- terminal- or C-terminal-tagged insulin receptors have not been shown to localize with endogenous insulin receptors or to signal with similar efficiency to downstream targets, associating a major caveat to all previous studies. Indeed, analysis of C-terminal tagged insulin receptors in β-cells led

to controversial results280-282,301. We overcame this technical problem by tagging the insulin receptor between known functional domains, a method applied to other proteins302,303. We demonstrated that interdomain-tagged insulin receptors have similar functionality when compared to untagged, endogenous receptors. We also employed monomeric fluorescent proteins that, unlike weak dimers such as GFP, do not accelerate the formation of dimers between tagged proteins.

These fluorescent proteins were also highly pH-resistant in order to reduce signal loss in the acidic endo/lysosomal lumens (the extracellular interdomain location of the fluorescent protein tag becomes luminal after endocytosis). This tagging strategy is likely to be broadly applicable to other tyrosine kinase receptors, and we expect novel insights to be gained by using this approach in other systems. Using these functional, tagged insulin receptors for live cell imaging and immunofluorescent labeling of endogenous insulin receptors, We re-evaluated the molecular mechanisms of insulin receptor internalization and transport in β-cells. These new molecular probes were combined with TIRFM, and confocal imaging to determine the trafficking route of the insulin receptors.

The data support the concept that Cav1 and flotillin-1 define a receptor trafficking endosomal route to lysosomes. Indeed, the observation that insulin receptors do not colocalize to

Rab5a-positive early endosomes or Rab7-positive late endosomes suggested that they traffic via a clathrin-independent pathway. The study represents the first analysis of flotillin-1 expression and function in pancreatic β-cells. It also sheds light on the ultimate fate of internalized insulin receptors in β-cells. The data suggest that many of the insulin receptors are found at LAMP2- positive lysosomes, and likely exclude a major role for Rab11a or Rab4 positive-recycling endosomes. However, this finding does not exclude recycling of insulin receptors from a pathway independent of Rab11a. Indeed, recent data do suggest that insulin might be recycled in β-cells 68

after clathrin-independent bulk-like endocytosis304. Together, by generating a novel fluorescently

labeled insulin receptor construct we were able to characterize the proteins involved in insulin

receptor internalization and subsequent sorting in pancreatic β-cells.

2.4 Materials and methods

2.4.1 Cell culture and islet isolation

Primary mouse β-cells were isolated, dispersed and cultured as previously described 294.

MIN6 β-cells were cultured in DMEM media containing 25 mM glucose (Sigma-Aldrich, St Louis,

MO) supplemented with 10% (v/v) FBS (Life Technologies, Burlington, ON) and penicillin/streptomycin (100 µg/ml; Life Technologies) at 37°C and 5% CO2.

2.4.2 Cell fractionation

Cell fractionation was performed with NIH-3T3 cells, which were harvested and processed

according to the instructions given in the Plasma Membrane Protein Extraction Kit (Abcam,

Toronto, ON). Fractions were analysed using standard Western Immunoblot procedures.

2.4.3 Treatments of cell cultures

For FITC-insulin (Life Technologies) uptake, MIN6 cells cultured in glass bottom 24 well

plates (MatTek Corporation, Ashland, MA) were starved in 5 mM glucose DMEM containing 10%

(v/v) FBS for 24 h. Prior treatment, cells were starved for 2 hrs in 5 mM glucose DMEM media

without serum. Subsequently, the starvation media was replaced by 5 mM glucose DMEM

containing 200 nM FITC-insulin and cells were incubated for 1 hr at 37°C and 5% CO2. Prior imaging, cells were washed twice with PBS. Live cells were imaged in Ringer’s buffer (119 mM

NaCl, 4.7 mM KCl, 25 mM NaHCO3, 2.5 mM CaCl2, 1.2 mM MgSO4, 1.2 mM H2PO4) containing

5 mM Glucose.

For insulin treatment and subsequent immunoblot analysis of various proteins, MIN6 cells

were starved in 5 mM DMEM containing 0.5% (v/v) FBS for 24 hrs. Subsequently, the media was

replaced with Ringers buffer supplemented with 0.2% (w/v) bovine serum albumin (Sigma-

Aldrich, St Louis, MO) and cells were incubated for 2 hrs at 37°C and 5% CO2. For the treatment,

human recombinant insulin (Sigma-Aldrich) was diluted in Ringer’s buffer supplemented with

0.2% (w/v) bovine serum albumin and cells were treated for the time periods as indicated at 37°C and 5% CO2 .

For Alexa488 labelled EGF uptake, InsRA-TagRFP transfected MIN6 cells grown on

coverslips were pulsed for 1 min with fluorescently labeled A488-EGF (final concentration 600

ng/ml, Life Technologies) in regular 25 mM Glucose DMEM media supplemented with 10% (v/v)

FBS. After the indicated chase times, cells were fixed in 4% (w/v) paraformaldehyde (Sigma-

Aldrich) for 20 minutes. Coverslips were mounted using Prolong Gold Antifade reagent (Life

Technologies).

2.4.4 Plasmids and molecular cloning

Cav1-mRFP has been described previously 305. Cav1-eGFP was purchased from Addgene

(#14433). LAMP2-eGFP, Flotillin-1-eGFP, InsR-A/B-C-eGFP plasmids were generous gifts from

J. Lippincott-Schwartz, Bethesda, MD, USA; Ai Yamamoto, New York, NY, USA and Ingo

Leibiger, Stockholm, Sweden; respectively. PCR amplifications of DNA fragments were

performed using AccuPrime Pfx polymerase (Life Technologies) according to the manufacturer’s

instructions. Prior ligation with the target vector, all PCR products were subcloned into pCR2.1

TOPO vector using the TOPO TA cloning kit (Life Technologies) according to the manufacturer’s instructions. Subsequently, the PCR products were excised from the pCR2.1 TOPO vector, gel purified and ligated with the digested target vector using T4 DNA ligase according to the manufacturer’s instruction. The primer sequences and PCR-generated restriction sites are shown in Table 2.1.

To generate Cav1-mTFP and Cav1-mTurquoise, human Cav1 was PCR-amplified from p-

Cav1-mRFP using primers #1, #2 and inserted into the p-mTFP-NI and p-mTurquoise vector respectively (kindly provided by R.E. Campbell, University of Alberta, Edmonton, Canada) using

EcoRI and KpnI restriction sites. To generate InsRA-EBFP2 and InsRB-EBFP2 plasmids, EBFP2 cDNA was PCR amplified from pEBFP2-Endosome (kindly provided by R.E. Campbell) using primers #3,#4 and inserted into pcDNA3.1(-) vector (Life Technologies) using ApaI and Hind III restriction sites creating pcDNA3.1(-)-EBFP2. The intracellular domains of the human insulin receptor A and B isoforms were PCR amplified from pNTK2-hIRA and pNTK2-hIRB (kindly provided by A. Ullrich, Max Planck Institute for Biochemistry, Martinsried, Germany) using the primers #5,#6 and inserted into pcDNA3.1(-)-EBFP2 using AgeI and HindIII restriction sites creating pcDNA3.1(-)-EBFP2-InsR-intracellular. The extracellular domains of the human insulin receptor A and B isoforms were PCR amplified from pNTK2-hIRA and pNTK2-hIRB using primers #7,#8 and inserted into pcDNA3.1(-)-EBFP2-InsR-intracellular using ApaI and BsiWI restriction sites to create pcDNA3.1(-)-InsRA-EBFP2 and pcDNA3.1(-)-InsRB-EBFP2.

Subsequently, we employed a brighter, pH resistant fluorescent proteins that could replace the surprisingly dim EBFP2. To generate InsRA-TagRFP and InsRB-TagRFP plasmids, TagRFP was

PCR amplified from pTagRFP-C (Evrogen, Moscow, Russia) using primers #9,#10 and inserted into pcDNA3.1(-)-InsRA-EBFP2 and pcDNA3.1(-)-InsRB-EBFP2 to using BsiWI and AgeI 71

restriction sites creating InsRA-TagBFP and InsRB-TagBFP plasmids. TagBFP was PCR amplified from pTagBFP-C (Evrogen) using primers #11,#12 and inserted into pcDNA3.1(-)-

InsRA-EBFP2 and pcDNA3.1(-)-InsRB-EBFP2 to replace EBFP2 by TagBFP using BsiWI and

AgeI restriction sites. To generate TagBFP-Rab5a, human Rab5a cDNA was PCR amplified from pCMV6-Entry-Rab5A (Origene, Rockville, MD) using primers #15,#16 and inserted into pTagBFP-C using SacI and BamHI restriction sites. To generate TagBFP-Rab7, human Rab7 cDNA was PCR amplified from pCMV6-Entry-Rab7 (Origene) using primers #17,#18 and inserted into pTagBFP-C using SacI and BamHI restriction sites. To generate TagBFP-Rab11a, human Rab11a cDNA was PCR amplified from pcDNA3.1(+)-eGFP-Rab11A (kindly provided by

R. Lippe, Montral, Canada) using primers #19,#20 and inserted into pTagBFP-C using SacI and

BamHI restriction sites.

generated Primer restriction sequence # site(s) 1 EcoRI 5’ CCGAATCCATGTCTGGGGGCAAATACGTAGACTCGG 3’ 2 KpnI 5’ CCGGTACCGGTATTTCTTTCTGCAAGTTGATGCGGACATTGCTG 3’ 3 ApaI, BsiWI 5’ GTGGGCCCGTCCGTACGATGGTGAGCAAGGGC 3’ 4 AgeI, HindIII 5’ CCCAAGCTTCGGACCGGTCTTGTACAGCTCGTC 3’ 5 AgeI 5’ CCACCGGTCCGTCAAATATTGCAAAAATTATCATC 3’ 6 HindIII 5’ GGGAAGCTTTTAGGAAGGATTGGACCGAGGC 3’ 7 ApaI 5’ GGGGGCCCGCCGCCATGGGCACCGGGGGCCGGC 3’ 8 BsiWI 5’ CCCCGTACGGACGTCTAAATAGTCTGTCAGGTA 3’ 9 BsiWI 5’ CCCGTACGATCGAATTCCCCGTGTCTAAGGGCGAAGAGCTG 3’ 10 AgeI 5’ GGACCGGTATCTGATCCGGAATTAAGTTTGTGCCCCAGTTTGC 3’ 11 BsiWI 5’ CCCGTACGATCGAATTCCCCAGCGAGCTGATTAAGGAGAACATGCAC 3’ 12 AgeI 5’ GGACCGGTATCTGATCCGGAATTAAGCTTGTGCCCCAGTTTGCTAGGG 3’ 13 BsiWI 5’ CCCGTACGATCGAATTCCCCGTGAGCAAGGGCGAGGAGCTGTTCAC 3’ 14 AgeI 5’ GGACCGGTATCTGATCCGGACTTGTACAGCTCGTCCATGCCGAGAG 3’ 15 SacI 5’ GGCGAGCTCAAATGGCTAGTCGAGGCGCAACAAG 3’ 16 BamHI 5’ CGCGGATCCTTACAGATCCTCTTCTGAGATGAGTTTC 3’ 17 SacI 5’ GGCGAGCTCAAATGGGCAGCCGCGACCACCTG 3’ 18 BamHI 5’ CGCGGATCCTTACAGATCCTCTTCTGAGATGAGTTTC 3’ 19 SacI 5’ GGCGAGCTCAAATGGGCACCCGCGACGACGAG 3’ 20 BamHI 5’ CGCGGATCCTTAGATGTTCTGACAGCACTGCACCTTTGG 3’ Table 2.1: Primer sequences

2.4.5 Transfection

Plasmid DNA (2 μg) was transfected into 1 million MIN6 cells using the NEON

Transfection system (Life Technologies) at two 1200 V pulses and a pulse width of 20 ms. Cells

were analyzed or fixed 48 hrs after transfection.

2.4.6 Immunofluorescence

For immunofluorescence analysis, cells were fixed in 4% (w/v) paraformaldehyde (Sigma-

Aldrich) for 20 minutes and permeabilized subsequently in 0.1% (v/v) Triton X-100 (Sigma-

Aldrich) for 15 minutes. Primary antibodies (InsR, Cav1, Rab7 antibodies were obtained from Cell

Signaling, Danvers, MA; Flotillin-1 antibodies were obtained from Epitomics, Burlingame, CA;

Rab4a, Rab5a antibodies were obtained from Santa Cruz Biotechnolgy, Dallas, TX; LAMP2 and

Na/K pump antibodies were obtained from abcam, Eugene, USA) were applied for 12 hours at

4°C. Coverslips were washed in PBS and secondary antibodies (Alexa 488, Alexa 594 Life

Technologies) were applied for 2 hours at room temperature. After washing in PBS, coverslips were mounted with Prolong Gold Antifade reagent (Life technologies).

2.4.7 Imaging

TIRFM life cell imaging was performed on a Zeiss Axiovert 200M with a 100x Alpha-Plan-

Fluar NA 1.45 oil objective (Zeiss, Germany) and a TIRF laser angle modifier (Zeiss). Cells were kept at 37°C in a temperature controlled incubation chamber (Harvard Apparatus, Holliston, MA).

Images were acquired with a CoolSNAP HQ2 CCD camera (Photometrics, Tucson, AZ). 445 nm and 532 nm diode pumped crystal lasers were used to excite mTFP and TagRFP respectively. The 73

TIRF system was upgraded during the study to a 405 nm, 488 nm, 561 nm solid state diode laser

system which was also used to excite TagRFP and eGFP tagged proteins.

Confocal imaging of fixed or live samples was performed with an Olympus Fluoview

FV1000 laser scanning confocal microscope. 488 nm Argon, 543,633 nm HeNe and 405 nm diode

lasers were used to excite fluorescent proteins or dyes. UPlan 60X NA 1.35 Oil and U-Plan S Apo

100X NA 1.40 Oil objectives (Olympus, Tokyo, Japan) were used to acquire images.

2.4.8 Image Analysis

The ImageJ distribution Fiji was used to process confocal micrographs306. Chromatic

aberration between individual channels was corrected using the Fiji plugin StackReg307.

Subsequently, the local background was subtracted using the rolling ball method308. Object based

colocalization analysis of endosomes was performed based on the distance of the object centres

between the different channels using the Fiji plugin JaCoP309. CellProfiler software and its

standard modules were used to track endosomal dynamics including life time and intensity in live

cell recordings310.

2.4.9 Immunoblot

MIN6 cells were washed with Ringers buffer prior to lysis with RIPA buffer (50 mM β-

glycerol phosphate, 10 mM HEPES, 1% Triton X-100, 70 mM NaCl, 2 mM EGTA, 1 mM Na3VO4, and 1 mM NaF) supplemented with complete EDTA-free protease inhibitor cocktail (Roche,

Laval, QC). Protein quantification was determined by the Bradford method. Membranes were probed with antibodies following standard procedures.

2.4.10 Statistics

Data are expressed as mean with S.E.M. Means were considered statistically significantly different if p≤0.05. Student’s t-tests were used for comparison between two means.

Chapter 3: The role of Caveolin-1 in insulin receptor trafficking and signalling

3.1 Rationale

Anti-apoptotic and pro-proliferative effects of autocrine insulin signalling involve the

Raf1/Mek/Erk pathway157,311, but the mechanisms that bias towards this arm over the PI3K/Akt

arm of the insulin signalling cascade have not been identified. However, previous work in

adipocytes showed that vesicle pinching from the plasma membrane biases insulin signalling along

the Erk branch while Akt signalling was unaffected when dynamin-dependent endocytosis was

inhibited222. Given the observation that Cav1 colocalizes and accumulates at insulin receptor

positive membrane domains prior to internalization (Chapter 2) I wanted to investigate the specific

role of this scaffolding protein in insulin receptor trafficking and signalling. Interestingly, a

relationship between Cav1 phosphorylation and insulin signalling has been described for a variety

of tissues281,282,312. However the role of Cav1 in insulin signalling in β-cells is unclear and it was

the goal of the work presented in this chapter to observe a potential effect of Cav1 on insulin

receptor trafficking and signalling in this cell type.

3.2 Results

3.2.1 Binding kinetics of Cav1 and insulin receptors

A potential interaction between Cav1 and insulin receptors upon insulin stimulation was

examined with co-immunoprecipitation. Indeed, insulin treatment resulted in a dose-dependent

increase in binding of Cav1 to the insulin receptor in NIH-3T3 cells (Figure 3.1). NIH-3T3 cells

were chosen over MIN6 cells due to their higher levels of endogenous Cav1 expression and to

avoid interference of applied insulin doses with autocrine insulin signalling events. Together with

the live-cell imaging data (Figure 2.5), these experiments indicate that insulin stimulates the

recruitment of Cav1 to insulin receptor positive membrane domains to support receptor

internalization and signalling.

Figure 3.1: Cav1 binds to insulin receptors in an insulin dependent manner. Co-immunoprecipitation of insulin receptors from NIH-3T3 cells reveals an insulin dependent binding of Cav1 to the insulin receptor (n = 3). *p<0.05

3.2.2 The effects Cav1 phosphorylation on insulin receptor internalization

The colocalization studies (Chapter 2.2.3) showed a clear association between Cav1 and

insulin receptors, but loss-of-function studies were required to determine whether Cav1 drives the

process of insulin receptor internalization. Thus, I co-expressed mTFP-labeled constitutively

active or dominant negative Cav1 mutants, harbouring phosphomimetic or non-phosphorylatable

mutations at tyrosine 14205,305, along with TagRFP-labeled insulin receptors. TIRF microscopy demonstrated that expression of the dominant negative Cav1-Y14F-mTFP mutant increased InsR density at the plasma membrane compared to cells expressing wildtype Cav1 (Figure 3.2 A-F). 77

In collaboration with Haoning Cen, we tested the effects of modified Cav1 phosphorylation on InsR internalization with time-lapse TIRF microscopy. For this experiment, we cloned an eGFP interdomain-tagged InsR construct (InsR-lum-eGFP) to take advantage of the superior photostability of eGFP. The pH-sensitivity of eGFP can be disregarded for this experiment since the fluorescent tag is facing the extracellular pH neutral environment when the receptor is residing at the membrane. Stable MIN6 cell lines expressing Cav1 mutants showed that the expression of the phospho-mimetic Cav1-Y14D-mRFP mutant leads to a significantly shorter lifetime of InsRA domains at the plasma membrane prior internalization compared to controls (Figure 3.2 G). These data strongly suggest that Cav1 phosphorylation promotes the internalization of insulin receptors in pancreatic β-cells. Furthermore it can be concluded that under basal conditions, Cav1 is present predominantly in an active state promoting constant insulin receptor turnover at the plasma membrane.

Figure 3.2: Cav1 phosphorylation modulates insulin receptor domain size and internalization. (A-C) TIRF microscopy of MIN6 cells expressing InsRA-TagRFP and Cav1 mutant proteins. Scale bars = 10 µm. (D-F) Overexpression of the Cav1-Y14F mutant leads to increased InsRA-TagRFP domain density, increased InsRA- TagRFP domain size, and a higher content of InsRA-TagRFP at the plasma membrane of MIN6 cells. (G) Quantification of TIRF time lapse imaging of InsRA-lum-eGFP domain life time at the plasma membrane of stable MIN6 cell lines expressing various Cav1 mutants. *p < 0.05, n > 4.

3.2.3 The effects of Cav1 phosphorylation on insulin signalling in vitro.

Previously, we observed effects of Cav1 phosphorylation on receptor internalization

(Chapter 3.2.2). Additionally, dynamin-dependent insulin receptor internalization has been

implicated in the selective activation of Erk, but not Akt, by insulin in the rat hepatoma H4IIE cell

line222. Consequently, we wanted to establish the functional consequences of altered Cav1

phosphorylation in insulin signalling. Overexpressing wildtype Cav1 or the constitutively active

Cav1-Y14D mutant was sufficient to significantly increase Erk phosphorylation in β-cells in the absence of exogenous insulin (Figure 3.3 A). In the presence of 2 nM insulin, the dominant negative Cav1-Y14F mutant significantly suppressed Erk activation (Figure 3.3 A). On the other hand, neither basal nor insulin-stimulated Akt phosphorylation were affected by the expression of wildtype or mutant Cav1 (Figure 3.3 B). Similar results were obtained in experiments where endogenous Cav1 phosphorylation was inhibited in NIH-3T3 cells by the Src kinase inhibitor PP2

(Figure 3.3 C). NIH-3T3 cells were used over MIN6 cells since they allowed us to validate the inhibitory effects of PP2 on Cav1 phosphorylation due to the high Cav1 expression levels in this cell type. Together, these data suggest a role for Cav1 phosphorylation in Erk signalling.

Figure 3.3: Cav1 phosphorylation enhances insulin-stimulated Erk, but not Akt, signalling in vitro. (A, B) Overexpression of wildtype Cav1-mRFP or the phosphomimetic mutant Cav1-Y14D significantly increases basal insulin signalling to Erk. Erk signalling stimulated by 2 nM insulin is significantly reduced in cells overexpressing the dominant negative mutant Cav1-Y14F. Akt signalling is unaffected by the overexpression of Cav1 mutants. Experiments were performed in MIN6 cells treated for 5 minutes with the indicated doses of insulin (n = 10). (C) Insulin stimulated (5 min) Erk, but not Akt signalling is significantly reduced in NIH-3T3 cells previously treated for 2 hrs with the 10 µM of Src kinase inhibitor PP2 (n = 4). *p < 0.05.

3.2.4 The effects of Cav1 deficiency in vivo.

The effects of Cav1 on insulin receptor trafficking and signalling in vitro needed to be confirmed with in vivo experiments. For this purpose, a mouse models deficient of Caveolin 1 81

(Cav1-/-) was used. Pancreatic tissue sections from Cav1-/- mice were obtained to study the effects

of Cav1 loss in vivo (Figure 3.4 A). Cav1-/- islet cells exhibited significantly reduced insulin receptor staining in vesicular structures (Figure 3.4 B). These data suggest a reduced

internalization of insulin receptors in islet cells of Cav1-/- mice confirming the results obtained in

vitro (Chapter 3.2.2) but can also be interpreted as a potentially reduced expression or increased

degradation of insulin receptors in islets obtained from Cav1 deficient mice. Most notably, these

experiments revealed a striking reduction in Erk signalling in vivo, as demonstrated by a significant

reduction of nuclear Erk (Figure 3.4 C,D). In contrast, Akt activation was not altered in Cav1-/- β- cells (Figure 3.4 E). Together, these data demonstrate the functional importance of Cav1-mediated

InsR endocytosis in pancreatic β-cells and point to receptor internalization as a bifurcation point in insulin signalling.

Figure 3.4: Cav1 loss decreases Insr internalization and reduces Erk signalling in vivo. (A) Immunolabeling of pancreatic sections from Cav1-/- or Cav1+/+ mice. Scale bar = 50 µm. (B) Reduced Insr containing intracellular vesicles in islets of Cav1-/- mice. *p < 0.05. (n = 9). Scale bar = 25 µm. (C-E) Reduced Erk nuclear translocation in islet cells from Cav1-/- mice with no significant changes in Akt activation (n=3 mice, 22 (Erk); 6 (Akt) islets). Scale bar = 50 µm

To address the physiological consequences of Cav1-dependent Erk signalling, we assessed the effect of in vivo Cav1 loss on β-cell survival. Multiple reports have previously shown that insulin signalling has a positive effect on β-cell mass, through dual effects on β-cell growth and survival132,135,157,294,313,314. Analysis of pancreatic sections of Cav1-/- animals revealed a significant increase in apoptosis and a significant decrease in β-cell mass compared to wildtype controls

(Figure 3.5). Together, the in vivo and ex vivo data obtained from Cav1 deficient mice further 83

supports the importance of Cav1 in insulin receptor signalling, which is essential for the maintenance of β-cell survival.

Figure 3.5: Cav1 loss leads to a reduced β-cell mass and increased islet cell apoptosis. (A) Pancreatic islet cells of mice lacking Cav1 display increased cell death indicated by cleaved caspase 3 immunolabelling (n=15) Scale bar = 10 µm (B) Immunolabeled pancreatic tissue sections (A488-Insulin, green; DRAQ5, red) show reduced β-cell mass in mice lacking Cav1 compared to wild type littermate controls (n = 3 mice, 10 sections per mouse). Scale bar = 1 mm. *p<0.05

3.3 Discussion

The role of insulin signalling defects in pancreatic β-cells remains underappreciated,

although conceptually it links the two most widely recognized hallmarks of diabetes progression,

‘insulin resistance’ and β-cell dysfunction (including inappropriate insulin hyper-secretion) 314.

Indeed, reduced insulin receptor expression and loss of insulin signalling has been observed in islets from patients with type 2 diabetes315,316. Evidence from multiple animal models also suggests that the loss of β-cell insulin signalling is sufficient for diabetes progression317. Although the Akt arm of the insulin signalling pathway has received the most attention, previous studies have shown that physiological levels of insulin318 have little effect on Akt in β-cells 137, but instead appear to selectively signal through the Raf1/Mek/Erk pathway137,294,311. Our data suggest that Erk and Akt signalling occur from insulin receptors localized in different nanodomains. Our data support the 84

concept that Akt signalling occurs mostly at the plasma membrane319. Since Akt activation is only

detected after super-physiological doses of insulin in β-cells137,318, it is possible that this occurs

mainly via the cross-activation of Igf1 receptors, which have only 500-fold lower affinity for

insulin98. In contrast, we propose that Erk signalling occurs predominantly from internalized (or

internalizing) receptors in this system, and perhaps others320. It is known that Erk shuttles to the

nucleus upon activation to exert its effects on gene transcription321,322. Thus, it may be

advantageous for Erk signalling to occur from organelles (endosomes or lysosomes) located closer

to the nucleus than to the plasma membrane. Our data suggest that the balance between Erk and

Akt signalling may be dictated by Cav1-dependent insulin receptor internalization.

Multiple studies have implicated Cav1 in insulin receptor internalization in

adipocytes281,282,312,323. Electron microscopy illustrated that Cav1-positive membrane pits harbor insulin-receptors323. The concept of caveolae as nanodomains for insulin receptors at the plasma

membrane has been suggested for several tissues324-327. Cav1, and the associated cavins, are

generally negative regulators of raft-dependent endocytosis328,329 while pCav1 tyrosine

phosphorylation has been reported to influence pinocytosis and promote integrin

internalization330,331. The demonstration that pCav1 promotes InsR internalization and Erk

signalling defines a novel role for tyrosine phosphorylated Cav1 in receptor internalization and

signalling.

3.4 Materials and methods

3.4.1 Immunoprecipitation

Immunoprecipitation was performed by incubating 1 mg of protein lysate with InsR

antibodies (Cell Signaling) at 4°C for 12 hrs. Subsequently, the solution was incubated with 85

PureProteome™ Protein G Magnetic Beads (Millipore, Billerica, Massachusetts, USA) and

subsequently washed according to the manufacturer’s instructions. InsR protein complexes were

separated from the beads by 10 min incubation at 95°C. The resulting protein solution was

analyzed by standard immunoblot procedures.

3.4.2 Plasmids, cell culture, transfection, immunoblots, imaging and image analysis

Cav1-Y14F-mRFP and Cav1-Y14D-mRFP plasmids have been described previously305.

Cav1 mutants tagged with mTFP were generated as described in section 2.4.4 for the respective wild type mTFP labeled variants using primers #1,#2 (Table 2.1) and the respective mRFP labeled mutants were used as a template for mutant Cav1 protein.

To generate InsRA-lum-eGFP, eGFP was PCR amplified from peGFP-N1 (Life technologies) using primers #13,#14 (Table 2.1) and inserted into pcDNA3.1(-)-InsRA-TagRFP to replace TagRFP by eGFP using BsiWI and AgeI restriction sites.

Cell culture conditions, imaging setups, image analysis, immunoblots, and generation of all other used plasmids in this chapter as well as transfection conditions are described in chapter 2.4.

3.4.3 Generation of MIN6 cell lines

Native MIN6 cells were transfected with Cav1-wt-mRFP, Cav1-Y14F-mRFP or Cav1-

Y14D-mRFP respectively using the NEON transfection system. Cells were cultured in selective media (400ug/ml G418/Geneticin, Life technologies) for 10 passages. For subsequent passages the

G-418/Geneticin concentration was reduced to a maintaining concentration of 50ug/ml.

3.4.4 Pancreatic tissue immunostaining

Paraffinized tissue sections were de-paraffinized with three Xylene washes and rehydrated

with ethanol solutions (100%, 95%, 70%), followed by a PBS wash. Epitope retrieval was

performed by incubating sections in sodium citrate buffer (10 mM sodium citrate, 0.05% Tween-

20, pH 6.0) for 15 minutes at 95˚C. The sections were briefly washed in PBS and blocked with

DAKO Protein Block solution for 30 minutes. The sections were incubated with primary

antibodies overnight at 4˚C. Following four PBS washes, the sections were incubated with

secondary antibodies for 1 hour at room temperature. The sections were finally washed and

mounted using Prolong Gold Antifade.

3.4.5 Mice

The caveolin-1 knockout (Cav1−/−) mice used in this study were originally produced by T.V.

Kurzchalia (MPI-CBG, Dresden, Germany)332. These mice were housed in the facility at the

Université catholique de Louvain in Belgium.

3.4.6 Statistics

Data are expressed as mean with S.E.M. Means were considered statistically significantly different if p≤0.05. Student’s t-tests were used for comparison between two means.

Chapter 4: Endosomal Ca2+ handling in β-cells

4.1 Rationale

Calcium ions (Ca2+) play many essential roles in cellular signalling. The plasma membrane

separates the low cytoplasmic Ca2+ concentration (<200 nM in a quiescent cell) from the much

higher extracellular Ca2+ levels (>1 mM). Multiple organelles participate in global cellular Ca2+ homeostasis, while also signalling locally to regulate specific subcellular events223,333,334.

Fluorescent protein-based biosensors enable direct measurements of Ca2+ dynamics within the

lumina of defined Ca2+ handling organelles, and provide minimally invasive windows into their respective roles in cellular physiology335. Some organelles function primarily as Ca2+ stores, whereas other organelles are transient Ca2+ buffers that act to shape cellular Ca2+ signals and

protect cells from excitotoxicity333. The endoplasmic reticulum (ER) is the most well characterized

intracellular Ca2+ store, with Ca2+ levels of 250-600 μM 336. ER Ca2+ concentration is primarily

regulated by Ca2+-importing pumps called sarco/endoplasmic reticulum Ca2+-ATPases (SERCAs),

2+ 333,337 as well as Ca release channels including the IP3R and RyR . The Golgi network also stores

Ca2+ (100-300 μM) at levels that facilitate post-translational protein modifications240,338. On the other hand, direct measurements in living cells indicate that other organelles, such as the nucleus and mitochondria, rapidly take up Ca2+ but do not act as long-term stores for significant amounts of Ca2+ 333. Roles in Ca2+ handling have been proposed for other organelles, particularly the acidic

organelles of the endosomal and lysosomal systems339, but direct and specific measurements of

Ca2+ within those lumina have been challenging due to the disproportionate pH sensitivity of

existing Ca2+ biosensors275. Thus, despite the fact that endosomes are important signalling organelles340, the physiological role of endosomal Ca2+ fluxes remains poorly understood.

The calcium homeostasis of β-cell endosomes is of particular interest. Glucose-stimulated

insulin release from pancreatic β-cells is strongly dependent on the influx of intracellular Ca2+ through voltage-gated Ca2+ channels in the plasma membrane341,342. On the contrary, chronically

elevated cytoplasmic Ca2+ can also induce cell death229, making the control of these Ca2+ influx signals critical. It has been previously hypothesized that organelles close to the plasma membrane may buffer the influx of Ca2+ within β-cells during glucose stimulation343. However, real-time

changes in endosomal Ca2+ during glucose stimulation in β-cells have never been accessed due to

technical limitations.

The highly acidic nature of endosomes dictates that biosensors with sufficient pH

insensitivity are required for luminal Ca2+ imaging in this compartment. Although current Förster

resonance energy transfer (FRET)-based ‘cameleon’ probes are acceptable for ER and other

organelles271,337,344, they are large (> 70 kDa) and typically incorporate highly pH-sensitive

fluorescent protein variants that are quenched in acid environments. Single fluorescent protein

Ca2+ biosensors (e.g. G-CaMP)278,345 are smaller, but also typically employ pH-sensitive

fluorescent proteins278,346. Recently, an expanded series of Ca2+ indicators via directed evolution

of G-CaMP3 has been developed346. One variant in this series, known as GEM-GECO1, exhibits

a blue-green ratiometric emission, a Kd of 340 nM, an exceptionally high dynamic range (11,000%

change in vitro) and is relatively pH insensitive346. Specifically, GEM-GECO-1 still maintains

50% of its maximum dynamic range at the acidic pH of 6.1, and we therefore considered that it

might be suitable for Ca2+ imaging in endosomes of living cells.

4.2 Results

4.2.1 Development of an endosomal targeted calcium sensor

To generate an endosomal lumen targeted Ca2+ biosensor, tetanus-insensitive vesicle-

associated membrane protein (TiVAMP, also known as VAMP7) was used as a targeting protein.

TiVAMP is a SNARE protein that drives endosomal fusion and is known to be localized to

endosomes347-349. The functional domain responsible for membrane tethering is located at the cytoplasmic N-terminus of TiVAMP350. It has been previously reported that C-terminal tagging of

TiVAMP leads to a functional protein with the tethered fusion partner localized to the endosomal

lumen350. GEM-GECO1 was fused to the C-terminus of TiVAMP-GEM-GECO1 via a 61 amino

acid linker that was included to mitigate functional interference with its fusion partners. To validate

the proper localization of TiVAMP-GEM-GECO1, the sensor was coexpressed with markers of

specific endolysosomal compartments. The endosomal calcium sensor colocalized with red

fluorescent markers for early endosomes (TagRFP-Rab5a, Figure 4.1 A), late endosomes

(TagRFP-Rab7, Figure 4.1 B) and Lysotracker, a tracer dye for acidic vesicles (Figure 4.1 C). By

this colocalization analysis we observed that ~70% of the TiVAMP-GEM-GECO1 positive

endosomal population is marked by Rab5a (23%), Rab7 (24%) or Lysotracker (22%). The

remaining minority of ~30% TiVAMP-GEM-GECO1 likely localized to endosomal

compartments, which are not labeled in this analysis (e.g. recycling endosomes). Taken together

with the known cellular localization of TiVAMP, these data confirm that the Ca2+ biosensor

TiVAMP-GEM-GECO1 localizes to both early and late endosomes in β-cells.

Figure 4.1: TiVAMP-GEM-GECO1 is a luminal Ca2+ biosensor localized to early and late endosomes. (A) TiVAMP-GEM-GECO1 colocalizes with early endosomes labelled by TagRFP-Rab5a. (B) TiVAMP-GEM- GECO1 colocalizes with TagRFP-Rab7 positive late endosomes. (C) TiVAMP-GEM-GECO1 colocalizes to acidic vesicles labelled by the tracer dye Lysotracker Red DND-99. Representative images are shown. Scale bar equals 10 µm. Inset Venn Diagrams visualize the degree of vesicle colocalization obtained by object based colocalization analysis (n = 10 cells for each condition).

4.2.2 Validation of the Ca2+ sensing capabilities of TiVAMP-GEM-GECO1 in situ

Next, the functionality of TiVAMP-GEM-GECO1 was examined. First, we simply modified endosomal Ca2+ by changing the Ca2+ content of the extracellular media entering MIN6 cells 91

transfected with TiVAMP-GEM-GECO1. A switch from Ca2+-free media to standard media containing 2 mM Ca2+ significantly increased the endosomal Ca2+ concentration detected with

TiVAMP-GEM-GECO1. Conversely, endosomal Ca2+ was reduced by incubating cells in buffer

2+ containing 0 mM CaCl2 or 1 mM of the Ca chelator EGTA, compared with standard 2 mM CaCl2

(Figure 4.2 A, B). These data suggest that TiVAMP-GEM-GECO1 can reflect changes in

extracellular Ca2+, possibly due to the simple fluid phase endocytosis of extracellular media.

Dynamic changes in endosomal Ca2+ were assessed with time-lapse imaging. TiVAMP-

GEM-GECO1-transfected MIN6 cells were initially incubated in standard 2 mM CaCl2 Ringer’s

2+ solution, after which this baseline solution was replaced with a high Ca (20 mM CaCl2) Ringer’s solution containing ionomycin to promote Ca2+ flux across membranes. As expected, endosomal

Ca2+ levels increased significantly compared to baseline (Figure 4.2 C). Subsequently, the elevated

endosomal Ca2+ was depleted by perfusion of the cells with Ca2+ free Ringer’s solution containing

ionomycin and 1 mM EGTA. The TiVAMP-GEM-GECO1 biosensor reflected this change with a

change in the emission ratios, which corresponded to a lower relative Ca2+ concentration compared

to baseline (Figure 4.2 C). Note that the baseline emission ratio for endosomal Ca2+ is between the

maximum and minimum ratios obtained during this experiment. This maximum-minimum pattern

of TiVAMP-GEMCO1 could be observed both in averages of all endosomes within a cell, as well

as with analysis of populations of single endosomes (Figure 4.2 C,D). Taken together, these data

suggest that TiVAMP-GEM-GECO1 dynamically reports luminal Ca2+ changes in endosomes and

that it has adequate dynamic range to sense changes in luminal Ca2+ in these specific

compartments.

Figure 4.2: TiVAMP-GEM-GECO1 senses changes in endosomal Ca2+. (A,B) Endosomal Ca2+ was modified by fluid phase internalization. A: MIN6 cells were incubated with either CaCl2 free or 2 mM CaCl2 containing 2+ Ringer’s. B: Extracellular Ca of 2 mM CaCl2 Ringer’s was with 1 mM EGTA and compared to cells incubated in regular Ringer’s media containing 2 mM CaCl2. The bar graphs represent averaged endosomal GEM-GECO1 ratios per cell (n = 4). (C) Live-cell perfusion demonstrates the responsiveness and dynamic range of TiVAMP-GEM-GECO1 to induced changes in endosomal Ca2+ content (averaged per cell). Inset graph shows a one-minute average of endosomal GEM-GECO1 ratios at the end of each treatment as a fold change to the baseline (n = 4). (D) GEM-GECO1 ratio analysis of the population of single endosomes per time point in one cell in response to indicated treatments in a live cell perfusion experiment. The black line represents the average endosomal Ca2+ content at each time point. * p < 0.05 4.2.3 Luminal Ca2+ during endosomal maturation

During the course of our experiments, a remarkable heterogeneity in Ca2+ levels in the total pool of TiVAMP-GEM-GECO1 labeled endosomes was observed (Figure 4.2 2D). Single endosome population analysis of MIN6 cells bathed in standard 2 mM CaCl2 buffer revealed that

Ca2+ levels varied dramatically between endosomes within a single cell (Figure 4.3 A-D). While this heterogeneity can be caused to some degree by the movement of the vesicle between the 93

acquisitions of the individual channels during ratiometric imaging, we still observed remarkable differences in fluorescent ratios by observing individual vesicles (Figure 4.3 D). We therefore tested the hypothesis that this heterogeneity in luminal Ca2+ levels was associated with the maturation of endosomes toward the lysosomal compartment194. Indeed, by analyzing only endosomes labeled with TagRFP-Rab5a and TiVAMP-GEM-GECO1, we found a lower relative endosomal Ca2+ concentration in early endsomes compared to late endosomes labeled by TagRFP-

Rab7 and TiVAMP-GEM-GECO1 (Figure 4.3 E,F). The increase in luminal Ca2+ composition of endosomes as they mature and fuse with lysosomes is consistent with the process of endosomal acidification during the transport of the organelle to lysosomes, which is thought to increase the driving force for Ca2+ uptake351. Collectively, the data suggest that Ca2+ in TiVAMP-labeled endosomes increases during the maturation from Rab5a-positive ‘early’ endosomes to Rab7- positive ‘late’ endosomes.

Figure 4.3: Ca2+ enrichment of endosomes during maturation. (A-D) Heterogeneity in relative endosomal Ca2+ content in a MIN6 cell visualized with TiVAMP-GEM-GECO1. Arrowheads point to endosomes with different luminal Ca2+ content. (E,F) Analysis of relative single endosome Ca2+ content of early, Rab5a labeled and late, Rab7 labeled endosomes (8 cells). * p <0.05; >1600 endosomes analyzed per population.

4.2.4 Development of biosensors for quantitative Ca2+ and pH measurements.

From the above results, it was apparent that TiVAMP-GEM-GECO1 could qualitatively

report on endosomal Ca2+ dynamics. However, to achieve semi-quantitative interpretation of the

GEM-GECO1 emission ratio, we required a means of accounting for differences in both Ca2+ and pH in single endosomes. Endosomes are challenging organelles for semi-quantitative approaches since their luminal composition is highly dynamic 351. In addition, both the maximal fluorescence

2+ response and the Ca dissociation constant (Kd) of GEM-GECO1 are dependent on the pH, despite

their improved pH resistance when compared to other Ca2+ sensors346. To achieve semi-

quantitative pH measurements, we employed mKeima, a fluorescent protein that is known to have

352,353 pH-dependent excitation peaks at 440 nm and 590 nm (pKa = 6.0) , making it a suitable ratiometric pH biosensor. To generate a probe for pH monitoring in endosomes, we fused mKeima to TiVAMP to enable endosomal pH measurements. TiVAMP-mKeima was co-expressed with

TiVAMP-GEM-GECO1 for quantitative Ca2+ imaging in live cells. As expected, the biosensors

TiVAMP-GEM-GECO1 and TiVAMP-mKeima colocalized in the same organelles (Figure 4.4).

Together, this biosensor pairs provides the molecular tools for a quantification of calcium

concentrations and pH in single endosomes of a living cell. In collaboration with the laboratory of

Robert E. Campbell at the University of Alberta we were able to publish the first measurements of

endosomal calcium in living cells using the presented genetically encoded biosensors in

combination with a sophisticated in vitro calibration (Albrecht, Zhao et al. Cell Calcium, in press).

Figure 4.4: A biosensor pair for quantitative Ca2+ and pH measurements in living cells. Simultaneous imaging of mKeima and GEM-GECO1 targeted to the same population of endosomes via TiVAMP. The merge panel shows the combined merge of 2 ratios (mKeima and GEM-GECO1) according to the 4 colors shown at the bottom of each panel.

4.2.5 Endosomal Ca2+ fluxes in the glucose response of β-cells.

It has been reported, that Ca2+ concentrations within some endosomal lumina are not very far from the cytosolic concentrations354. Additionally it has been hypothesized, that β-cell endosomes may buffer the influx of Ca2+ during glucose stimulation343. With the newly generated biosensor (Chapter 4.2.1) it is now possible to test this hypothesis by measuring real-time changes in endosomal Ca2+ during glucose stimulation. Fluorescence imaging of TiVAMP-GEM-GECO1- positive endocytic vesicles after switching extracellular glucose from 3 mM to 20 mM revealed an elevation of Ca2+ within the endosome lumen (Figure 4.5 A,B). To further characterize this phenomenon, we co-expressed TiVAMP-GEM-GECO1 and the early endosomal marker TagRFP-

Rab5a. Early endosomes were identified in the TagRFP channel and the GEM-GECO1 intensity

ratios for these objects were tracked to analyze relative early endosomal Ca2+ content. Ca2+ increases were measured in single Rab5-positive early endosomes upon glucose stimulation

(Figure 4.5 C). Indeed, the average early endosomal Ca2+ content increased under elevated glucose conditions. The change of endosomal Ca2+ upon glucose stimulation was independent of the

luminal pH, which remained constant while the endosomal Ca2+ content doubled under these acute

high glucose conditions (Figure 4.5 D). Interestingly, the endosomal Ca2+ did not typically return

to baseline immediately after the return to non-stimulatory glucose after stimulation, possibly

supporting the concept that a sub-population of endosomes may act as relatively long-acting Ca2+ buffers. These data were supported by endosomal Ca2+ measurements in a single glucose-

stimulated human β-cell (Figure 4.5 E). Together, these data suggest that a population of

endosomes may act as a previously unappreciated component of the β-cell Ca2+ handling network

during the glucose response.

Figure 4.5: Early endosomes enrich Ca2+ in glucose-stimulated β-cells. (A,B) Average and individual whole-cell endosomal Ca2+ content in response to glucose (n = 8). (C) Early, Rab5a positive endosomes were analyzed for their relative Ca2+ content in response to glucose. (D) Average whole-cell endosomal pH in response to glucose. 20 mM NH4Cl was perfused as a positive control for mKeima (n = 4). (D inset) Relation between endosomal pH and calcium content in the glucose response of a β-cell (n = 3). Error bars represent SEM. (E) Average whole-cell endosomal Ca2+ content in response to glucose in a human pancreatic β-cell.

4.3 Discussion

The goal of the work presented in this chapter was to develop a pH-resistant Ca2+ biosensor to directly measure Ca2+ concentration in single endosomes and to determine whether endosomes play any role in pancreatic β-cell Ca2+ homeostasis. To accomplish these goals, we paired the

GEM-GECO1 fluorescent Ca2+ probe with the pH-sensitive mKeima fluorescent protein, and

targeted both proteins to the luminal side of a defined sub-population of endosomes. We found

endosomal Ca2+ was higher in more acidic Rab7-positive late endosomes when compared with

Rab5-positive early endosomes. Our results also identify Rab5-positive early endosomes as an organelle compartment that can actively enrich Ca2+ in glucose-stimulated β-cells, demonstrating

a previously unappreciated role for these organelles in intracellular Ca2+ handling in pancreatic β-

cells.

We demonstrated that the biosensor pair of TiVAMP-GEM-GECO1 and TiVAMP-mKeima

can be used simultaneously to quantify the pH and the absolute Ca2+ concentration in single

endosomes. Control experiments demonstrated that TiVAMP-GEM-GECO1 responds primarily

to Ca2+ and only to pH to a lesser degree. Using this biosensor pair, we identified a remarkable

heterogeneity of endosomal Ca2+ content in β-cells. We determined that this heterogeneity of

endosomal Ca2+ is associated with organelle maturation and acidification. Specifically, later

endosomes with lower luminal pH have higher endosomal Ca2+ concentrations.

Live-cell, intra-organelle Ca2+ imaging is a powerful approach to understanding the

fundamental biology of endosomes and other organelles335. The GEM-GECO1 probe has been

extensively tested in vitro where it exhibits robust ratiometric Ca2+ sensing, with sufficient

dynamic range and relative pH insensitivity346. GEM-GECO1 is significantly smaller than

previous biosensors based on Ca2+-dependent FRET between two fluorescent proteins. We

propose that the combined use of endosome-targeted GEM-GECO1 and mKeima marks a

significant improvement over alternate approaches. Together with this previous work350, our data demonstrate that linking GEM-GECO1 to TiVAMP permits high localization specificity, to an extent that is not possible with dye-based approaches 355. 100

The results provide an improved understanding of dynamic Ca2+ homeostasis in β-cells and,

as such, take a step towards further elucidating the physiological control of insulin secretion and

other Ca2+-dependent processes in this key endocrine cell type334,337,356,357. In response to elevated extracellular glucose levels, cytoplasmic Ca2+ levels increase to drive the docking and fusion of

secretory insulin granules with the plasma membrane of β-cells342. Interestingly, alterations in β-

cell Ca2+ homeostasis have been implicated in the development of type 2 diabetes358. Specifically,

it has been proposed that excessive Ca2+ influx leads to an increased β-cell death by apoptosis, a

phenomenon associated with diabetes359. In this context, previous work suggested that endosomes

might act as Ca2+ buffers in β-cells responding to high glucose343. The present work provides

experimental data that are consistent with this model.

The degree to which endosomes contribute to the total Ca2+ buffering ability of intracellular organelles remains to be elucidated. Endosomes occupy a small volume of many cell types (0.65-

2%), but this may be higher in β-cells. We speculate that endosomes may play a role as physiologically relevant local Ca2+ buffers only near the plasma membrane, shaping Ca2+ signals that originate in close proximity. Unlike larger Ca2+-handling organelles such as mitochondria

(3.9% of the total β-cell volume) or ER (20% of the total β-cell volume)360-362, endosomes may not

play a primary role in shaping Ca2+ signals originating from within the cell. The novel endosomal

Ca2+ biosensor promises to shed light on the mechanisms involved in endosomal Ca2+ homeostasis

in intact living cells and resolve current controversies around the nature of this important

organelle262,363,364.

101

4.4 Material and methods

4.4.1 Cloning, plasmids and transfection

Synthetic DNA oligonucleotides used for cloning and library construction were purchased

from Integrated DNA Technologies (Coralville, Iowa). TagRFP-Rab5a and TagRFP-Rab7 as well

as general cloning techniques are described in chapter 2.4.4. The sequences of all oligonucleotides

used in this chapter are provided in Table 4.1.

MIN6 β-cells were cultured as described in chapter 2.4.1. All constructs were transfected

into MIN6 cells using the NEON Transfection system. 2 µg of plasmid DNA were used to

electroporate 1 million MIN6 cells. Cells were electroporated with two 1200 V pulses with a pulse

width of 20 ms.

Primary handpicked human islets from an 11 year-old male donor were dispersed and electroporated using the NEON transfection system (2 µg DNA per 1 million cells, 1000 V, 2 pulses, 30ms pulse width) and subsequently cultured in CMRL medium for 72 hrs prior imaging.

Primer name Primer sequence (5’ to 3’) Fw_NcoI_6xhis_mKeima GCGATGCCATGGGTCATCATCATCATCATCATGGTACAATGGTCGAC TCTAGAATGGTGAGTGTGATCGCTAAACAAATGACC Rv_mKeima _KpnI_ HindIII GCGAAAGCTTCTATCCGGTACCCATGGTACTTCCACCTGTGCCACC Fw_KpnI _GEM GCGAGGTACCACCATGGTCGACTCATCACGTC Rv_GECO-Stop-HindIII GCGATGAAGCTTCTACTTCGCTGTCATCATTTGTACAAACTCTTCGTA GTTT Fw_ApaI_TiVAMP GGGGGCCCGCCGCCATGGCGATTCTTTTTGCTGTTGTTG Rv_TiVAMP_NotI CGCGGCCGCTTTCTTCACACAGCTTGGCCATG Fw_EcoRI_GEM-GECO1 CGAATTCTAACGCCGCGACGTGCGACTGCG Rv_GEM-GECO1_HindIII CAAGCTTCTACTTCGCTGTCATCATTTGTACAAAC Fw_XbaI_mKeima CCTCTAGAATGGTGAGTGTGATCGCTAAACAAATGACCTACAAGG Rv_mKeima_HindIII GGAAGCTTCTAACCGAGCAAAGAGTGGCGTGCAATGG Table 4.1: Primer sequences

102

4.4.2 Microscopy and image analysis

Co-localization images were acquired using a widefield inverted Zeiss Axiovert 200M

microscope equipped with a 100x 1.45NA objective. Image stacks were deconvolved using

Slidebook Software to obtain confocal image planes. Object based colocalization studies were

performed using the Fiji/ImageJ plugin JaCoP309.

Live cell imaging of MIN6 and primary cells was performed on a wide-field microscope

setup (Zeiss Axiovert 200M) with a mounted 40x Plan-NeoFluar 1.3NA oil objective (Zeiss, Jena,

Germany)337. Cells were cultured and imaged on poly-D-lysine coated No 1.5 25 mm circular borosilicate coverslips (Electron Microscopy Sciences, Hatfield, Pennsylvania) and were kept at

37°C in a temperature controlled incubation chamber (Harvard Apparatus, Holliston,

Massachusetts) during imaging. Images were acquired with a CoolSNAP HQ2 CCD camera

(Photometrics, Tucson, Arizona). GEM-GECO1 was excited with a selective bandpass filter

(386/23 nm) and emissions were detected with selective bandpass filters (440/40 nm and 520/32 nm) using a single filter cube with a mounted dichroic mirror. The Sutter Lambda 10-2 emission filter wheel is capable of switching between different emission filters within 75 ms. Ratiometric mKeima imaging was performed by using selective excitation filters (430/25 nm and 575/50 nm) and a 632/60 nm emission filter. The excitation filters were mounted in a Sutter instruments DG4 light source enabling excitation switches in < 2 ms. The exposure times for GEM-GECO1 and mKeima detection were kept at ≤ 1s.

Time-lapse image sequences, as well as still images, were analyzed using Slidebook software

(Intelligent Imaging Innovations, Denver, Colorado), Cell Profiler 2.0365, and the ImageJ

distribution Fiji306. Local background subtraction was performed to correct for cellular

autofluorescence308. Live-cell experiments were performed with preheated solutions and stable 103

perfusion at 1 ml/min, and complete solution changes were achieved in <60 s. Live cells were

imaged in Ringer’s buffer (119 mM NaCl, 4.7 mM KCl, 25 mM NaHCO3, 2.5 mM CaCl2, 1.2 mM

MgSO4, 1.2 mM H2PO4) supplemented with glucose as indicated in the figures.

4.4.3 Statistics

Data are expressed as mean with S.E.M. Means were considered statistically significantly different if p≤0.05. Student’s t-tests were used for comparison between two means.

104

Chapter 5: Conclusion

5.1 Summary and impact

Traditionally, endosomes have been described as important cargo transport organelles of the

cells ensuring the uptake of nutrients. However, emerging evidence highlights the role of these

organelles in intracellular signalling events. In this thesis work, we focused on endosomes of

pancreatic β-cells and their role in autocrine insulin signalling and calcium homeostasis. β-cells

are fundamentally important endocrine cells in higher organisms: Through the secretion of insulin

they provide the peptide which enables peripheral cells to take up glucose – the key carbohydrate which is metabolized to produce ATP, the source of energy in each cell of an organism. It is therefore of particular interest to understand the molecular mechanisms contributing to the proper function of this highly specialized cell type.

Autocrine insulin signalling has been shown to be a major contributor to proper β-cell function (Chapter 1.3.3). In the work presented in this thesis I developed a tool which allows for the first time to track functional fluorescent protein tagged insulin receptors within living cells

(Chapter 2.2.2). Using this tool I could establish a link between insulin receptor internalization and signalling in β-cells. In particular, phosphorylated Cav1 positively affects insulin receptor internalization and biases insulin signalling towards the Erk signalling branch (Chapter 3.2.3).

These results suggest an internalization of insulin receptors through Cav1 into flotillin-1-positive

vesicles that eventually fuse or mature into lysosomes. Internalized receptors signal predominantly

through Erk while receptors residing at the plasma membrane target the Akt signalling branch

(Figure 5.1).

105

Figure 5.1: Working model of insulin receptor trafficking and signalling in β-cells. My model proposes that Erk signalling is initiated from InsR internalized via the phosphorylation of Cav1, whereas Akt signalling is transmitted from receptors located at the plasma membrane.

It is critical to understand the precise mechanisms driving insulin receptor internalization and signal transduction in order to develop approaches to modulate insulin sensitivity in obesity and early stages of type 2 diabetes. The data presented in this thesis highlights that drugs which target the trafficking kinetics of insulin receptors could have the potential to direct and stimulate insulin signalling along specific signalling pathways. My approach to tag insulin receptors between functional domains provides a molecular tool which is suitable for high throughput screening and can be applied to a variety of approaches in the search for molecules which target the insulin receptor trafficking pathways and therefore potentially alter insulin sensitivity in tissues.

Additionally, the new targeting strategy could be applied to membrane receptors of similar structure such as the IGF1-R or EGF-R to shed light on their trafficking patterns in living cells.

106

In addition to their role in insulin receptor trafficking and signalling, I characterized

endosomes of β-cells as potential contributors to the intracellular calcium homeostasis. The biggest

challenge was to develop a sensor, which is specifically localized to endosomes and capable of

sensing Ca2+ in the changing pH environment of these vesicles. By targeting GEM-GECO1 to the

endosomal lumen I could establish a calcium reporter, which is capable of sensing endosomal

calcium changes within physiological ranges (Chapter 4.2). To the best of my knowledge, this is

the first genetically encoded calcium sensor specifically targeted to endosomes. This development

now allows investigators to observe fluxes in endosomal calcium in living cells having the

potential to answer a broad range of biological questions. For example, the ongoing debate about

the mechanism by which endosomes regulate their luminal calcium is largely controversial due to

the lack of a suitable sensor that allows endosomal calcium measurements in situ. Here, I introduce

a sensor that can be applied to studies directed towards the mechanism by which endosomes

regulate their calcium content. The endosomal calcium content is thought to contribute directly to

the fusion behaviour of these vesicles, however live cell studies with sensors specifically localized

to endosomal population of interest was challenging due to a lack of a genetically encoded sensor

capable of measuring luminal calcium.

By introducing a new strategy to tag membrane receptors and developing a biosensor to monitor endosomal calcium, I created molecular tools that allow the characterization of endosomes beyond their classical role as cargo transporters. In this context, the question arises if there is a functional relationship between caveolin-mediated insulin receptor endocytosis and calcium fluxes in endosomes. Interestingly, Cav1 positive plasma membrane domains have been shown to contain the calcium channel transient receptor potential channel 1 (TRPC1)366. TRPC1 is also known to localize on endosomes post internalisation255. Remarkably, TRPC1 has two identified caveloin-1 107

binding sites suggesting an interaction between these proteins, which potentially regulates the

specific localization of TRPC1 in the plasma membrane366. Indeed, studies in Cav1 deficient mice

showed that Cav1 is required for the specific subcellular localization of TRPC1 in endothelial

cells367. This hypothesis is supported by results showing that intracellular calcium fluxes mediated by the administration of ATP originate from endothelial cell plasma membrane regions positive

for Cav1368. Recently this model was expanded by the demonstration that ATP can mobilize

calcium from endocytic vesicles derived from caveolin-mediated endocytosis369. Collectively,

these data suggest for endothelial cells that endosomes originated from Cav1 positive membrane

domains can indeed act as calcium stores370. If these concepts are translatable to β-cells remains

an open question. However, the tools presented in this thesis allow further research which can

further observe the physiological role of caveloin1 mediated insulin receptor internalization and

the role of these vesicles in the calcium homeostasis of the β-cells. Together, experimental

evidence presented here and in the literature suggests that caveloin1-mediated endocytosis is an

important mechanism to ensure β-cell function by both regulating autocrine insulin signalling and

intracellular calcium homeostasis370.

5.2 Caveats and limitations

The studies presented in this thesis were performed with state-of-the-art technology but a

number of limitations apply to the introduced tools and concepts. Although I created a tagged

insulin receptor that was deemed functional based on Erk signalling, further validations are

required. For example, biochemical binding assays are required to test the affinity of the novel

construct to insulin compared to untagged receptors. Additionally, it is unclear at this point how

the introduction of the tag affects the secondary structure of the insulin receptor. X-ray 108

crystallography would be an appropriate tool to determine the effects of the inter domain tagging strategy on the structural properties of native insulin receptors. Inter domain tagging furthermore requires the use of pH resistant proteins since the tag resides in the endosomal lumen post internalization. This limits the selection of potential fluorescent tags for receptor trafficking analysis. Another drawback is, that the expression of the construct was driven by a strong CMV promoter leading to an overexpression of the insulin receptor in cells possibly masking or altering physiological trafficking or signalling patterns. Consequently, physiological promoters (e.g. insulin promoter for studies in β-cells) should be used in follow up studies to further characterize trafficking patterns. Additionally, the artificial introduction of protein into cells might lead to a competition between endogenous and exogenous receptor protein. A potential solution to this caveat can be found by genome editing and an introduction of the tag sequence into the chromosomal DNA leading to an endogenous like expression of the tagged receptor without competition of unlabelled receptors.

The major caveat of the endosomal calcium sensor TiVAMP-GEM-GECO1 is that it is exclusively localized to endosomes that recruit the SNARE TiVAMP. While this enables a very specific localization of the sensor, it does fail to monitor calcium in the entire endosomal pool.

Furthermore, for quantitative measurements of calcium in endosomal lumina, a pH correction is required to account for the slight pH sensitivity of GEM-GECO1. While this has been demonstrated successfully354, the introduction of a pH sensor requires additional calibrations that induce further systematic error affecting the accuracy of the obtained calcium concentrations.

Additionally, the introduction of a second ratiometric sensor uses up more available wavelength on the light spectrum making it nearly impossible to use a marker to label specific vesicle populations, such as early or late endosomes. Therefore, a biosensor which allows direct 109

measurement of endosomal calcium with a truly pH insensitive fluorescent reporter would be desirable.

5.3 Future directions

Although conclusive, the work presented in this thesis raises a number of questions for further investigations. While I describe a Cav1-Flot1-LAMP2 trafficking route of β-cell insulin receptors in the present study, the role or functional meaning of this trafficking route remains to be elucidated. How is the cellular physiology affected when this trafficking route is intercepted?

Future work directed to the function of this trafficking route should address the effects of knockouts of genes involved in this trafficking pathway. However, the most interesting question to answer would be: what is the difference in the molecular composition of insulin receptors signalling from internalized compartments versus plasma membrane localized receptors? The composition of the insulin receptor complex at different stages of trafficking could give interesting insights into which scaffolding proteins are responsible for a signalling through Erk or Akt. The results could bring up more specific proteins worth targeting in a strategy developed towards the reestablishment of insulin sensitivity in diabetic patients. Together, I provide a model of branch- biased insulin signalling in β-cells determined by the internalization status of the receptor.

However, the molecular details, especially the involved scaffolding proteins of the receptor remain to be determined.

In this thesis, I present the first genetically encoded calcium sensor targeted to the lumina of endosomes. The field of fluorescent genetically encoded calcium sensor is constantly emerging.

Hopefully, future research will result in a truly pH insensitive calcium sensor which can be targeted to endosomes via TiVAMP-GECO1 avoiding the requirement of pH correction for the fluorescent 110

intensities obtained from the calcium reporter. This would allow quantitative measurement of endosomal calcium along with specific pathway markers. By targeting GEM-GECO1 to a SNARE protein in the secretory pathway of β-cells, the fusion of secretory insulin granules with the plasma membrane can be studied directly and the role of luminal calcium can be observed in conditions with altered insulin secretion. Collectively, I provide a toolbox that enables future studies directed towards an establishment of mechanisms underlying endosomal calcium homeostasis role in living cells.

111

References

1 Danaei, G. et al. National, regional, and global trends in fasting plasma glucose and diabetes prevalence since 1980: systematic analysis of health examination surveys and epidemiological studies with 370 country-years and 2.7 million participants. Lancet 378, 31-40, doi:10.1016/S0140-6736(11)60679-X (2011). 2 Inzucchi, S. E. Clinical practice. Diagnosis of diabetes. The New England journal of medicine 367, 542-550, doi:10.1056/NEJMcp1103643 (2012). 3 Pelletier, C. et al. Report summary. Diabetes in Canada: facts and figures from a public health perspective. Chronic diseases and injuries in Canada 33, 53-54 (2012). 4 McBrien, K. A. et al. Health care costs in people with diabetes and their association with glycemic control and kidney function. Diabetes care 36, 1172-1180, doi:10.2337/dc12- 0862 (2013). 5 Morrish, N. J., Wang, S. L., Stevens, L. K., Fuller, J. H. & Keen, H. Mortality and causes of death in the WHO Multinational Study of Vascular Disease in Diabetes. Diabetologia 44 Suppl 2, S14-21 (2001). 6 Afkarian, M. et al. Kidney disease and increased mortality risk in type 2 diabetes. Journal of the American Society of Nephrology : JASN 24, 302-308, doi:10.1681/ASN.2012070718 (2013). 7 Martins-Mendes, D. et al. The independent contribution of diabetic foot ulcer on lower extremity amputation and mortality risk. Journal of diabetes and its complications, doi:10.1016/j.jdiacomp.2014.04.011 (2014). 8 American Diabetes, A. Diagnosis and classification of diabetes mellitus. Diabetes care 33 Suppl 1, S62-69, doi:10.2337/dc10-S062 (2010). 9 Kawashima, Y. et al. Leprechaunism (Donohue syndrome): a case bearing novel compound heterozygous mutations in the insulin receptor gene. Endocrine journal 60, 107-112 (2013). 10 Parveen, B. A. & Sindhuja, R. Rabson-Mendenhall syndrome. International journal of dermatology 47, 839-841, doi:10.1111/j.1365-4632.2008.03591.x (2008). 11 Kadowaki, T. et al. Two mutant alleles of the insulin receptor gene in a patient with extreme insulin resistance. Science 240, 787-790 (1988). 12 Ardon, O., Procter, M., Tvrdik, T., Longo, N. & Mao, R. Sequencing analysis of insulin receptor defects and detection of two novel mutations in INSR gene. Molecular Genetics and Metabolism Reports 1, 71-84, doi:10.1016/j.ymgmr.2013.12.006 (2014). 13 Semple, R. K., Williams, R. M. & Dunger, D. B. What is the best management strategy for patients with severe insulin resistance? Clinical endocrinology 73, 286-290, doi:10.1111/j.1365-2265.2010.03810.x (2010). 14 Timsit, J., Bellanne-Chantelot, C., Dubois-Laforgue, D. & Velho, G. Diagnosis and management of maturity-onset diabetes of the young. Treatments in endocrinology 4, 9- 18 (2005). 15 Kota, S. K., Meher, L. K., Jammula, S., Kota, S. K. & Modi, K. D. Genetics of type 2 diabetes mellitus and other specific types of diabetes; its role in treatment modalities. Diabetes & metabolic syndrome 6, 54-58, doi:10.1016/j.dsx.2012.05.014 (2012). 112

16 Edghill, E. L. et al. Insulin mutation screening in 1,044 patients with diabetes: mutations in the INS gene are a common cause of neonatal diabetes but a rare cause of diabetes diagnosed in childhood or adulthood. Diabetes 57, 1034-1042, doi:10.2337/db07-1405 (2008). 17 Borowiec, M. et al. Mutations at the BLK locus linked to maturity onset diabetes of the young and beta-cell dysfunction. Proceedings of the National Academy of Sciences of the United States of America 106, 14460-14465, doi:10.1073/pnas.0906474106 (2009). 18 Ahmad, S. I. & SpringerLink ebooks - Biomedical and Life Sciences (2013). in Advances in experimental medicine and biology v 771 1 online resource (Springer Science+Business Media ;Landes Bioscience,, New YorkAustin, Tex., 2012). 19 Johnson, J. D. et al. Increased islet apoptosis in Pdx1+/- mice. The Journal of clinical investigation 111, 1147-1160, doi:10.1172/JCI16537 (2003). 20 International Association of, D. et al. International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes care 33, 676-682, doi:10.2337/dc09-1848 (2010). 21 Barbour, L. A. et al. Cellular mechanisms for insulin resistance in normal pregnancy and gestational diabetes. Diabetes care 30 Suppl 2, S112-119, doi:10.2337/dc07-s202 (2007). 22 Sorenson, R. L. & Brelje, T. C. Adaptation of islets of Langerhans to pregnancy: beta-cell growth, enhanced insulin secretion and the role of lactogenic hormones. Hormone and metabolic research = Hormon- und Stoffwechselforschung = Hormones et metabolisme 29, 301-307, doi:10.1055/s-2007-979040 (1997). 23 Crowther, C. A. et al. Effect of treatment of gestational diabetes mellitus on pregnancy outcomes. The New England journal of medicine 352, 2477-2486, doi:10.1056/NEJMoa042973 (2005). 24 Das, S. L. et al. Newly diagnosed diabetes mellitus after acute pancreatitis: a systematic review and meta-analysis. Gut 63, 818-831, doi:10.1136/gutjnl-2013-305062 (2014). 25 Adler, H. et al. Pancreatectomy for metastatic disease: a systematic review. European journal of surgical oncology : the journal of the European Society of Surgical Oncology and the British Association of Surgical Oncology 40, 379-386, doi:10.1016/j.ejso.2013.12.022 (2014). 26 Bluestone, J. A., Herold, K. & Eisenbarth, G. Genetics, pathogenesis and clinical interventions in type 1 diabetes. Nature 464, 1293-1300 (2010). 27 Lieberman, S. M. & DiLorenzo, T. P. A comprehensive guide to antibody and T-cell responses in type 1 diabetes. Tissue antigens 62, 359-377 (2003). 28 Nagata, M. & Yoon, J. W. Studies on autoimmunity for T-cell-mediated beta-cell destruction. Distinct difference in beta-cell destruction between CD4+ and CD8+ T-cell clones derived from lymphocytes infiltrating the islets of NOD mice. Diabetes 41, 998- 1008 (1992). 29 Serreze, D. V. et al. B lymphocytes are critical antigen-presenting cells for the initiation of T cell-mediated autoimmune diabetes in nonobese diabetic mice. Journal of immunology 161, 3912-3918 (1998). 30 Monti, P., Heninger, A. K. & Bonifacio, E. Differentiation, expansion, and homeostasis of autoreactive T cells in type 1 diabetes mellitus. Current diabetes reports 9, 113-118 (2009). 31 Lodish, H. F. Molecular cell biology. 6th edn, (W.H. Freeman, 2008). 113

32 Concannon, P., Rich, S. S. & Nepom, G. T. Genetics of type 1A diabetes. The New England journal of medicine 360, 1646-1654, doi:10.1056/NEJMra0808284 (2009). 33 Burren, O. S. et al. T1DBase: update 2011, organization and presentation of large-scale data sets for type 1 diabetes research. Nucleic acids research 39, D997-1001, doi:10.1093/nar/gkq912 (2011). 34 Morton, N. E. et al. Heterozygous expression of insulin-dependent diabetes mellitus (IDDM) determinants in the HLA system. American journal of human genetics 35, 201- 213 (1983). 35 Concannon, P. et al. Type 1 diabetes: evidence for susceptibility loci from four genome- wide linkage scans in 1,435 multiplex families. Diabetes 54, 2995-3001 (2005). 36 Ronningen, K. S., Keiding, N., Green, A., Europe, E. A. S. G. & Diabetes. Correlations between the incidence of childhood-onset type I diabetes in Europe and HLA genotypes. Diabetologia 44 Suppl 3, B51-59 (2001). 37 Weintrob, N. et al. Type 1 diabetes environmental factors and correspondence analysis of HLA class II genes in the Yemenite Jewish community in Israel. Diabetes care 24, 650- 653 (2001). 38 Wen, L. et al. Innate immunity and intestinal microbiota in the development of Type 1 diabetes. Nature 455, 1109-1113, doi:10.1038/nature07336 (2008). 39 Dessein, R., Peyrin-Biroulet, L. & Chamaillard, M. Intestinal microbiota gives a nod to the hygiene hypothesis in type 1 diabetes. Gastroenterology 137, 381-383, doi:10.1053/j.gastro.2009.05.026 (2009). 40 Akerblom, H. K. et al. Dietary manipulation of beta cell autoimmunity in infants at increased risk of type 1 diabetes: a pilot study. Diabetologia 48, 829-837, doi:10.1007/s00125-005-1733-3 (2005). 41 Norris, J. M. et al. Omega-3 polyunsaturated fatty acid intake and islet autoimmunity in children at increased risk for type 1 diabetes. JAMA : the journal of the American Medical Association 298, 1420-1428, doi:10.1001/jama.298.12.1420 (2007). 42 Virtanen, S. M. et al. Age at introduction of new foods and advanced beta cell autoimmunity in young children with HLA-conferred susceptibility to type 1 diabetes. Diabetologia 49, 1512-1521, doi:10.1007/s00125-006-0236-1 (2006). 43 Craig, M. E., Nair, S., Stein, H. & Rawlinson, W. D. Viruses and type 1 diabetes: a new look at an old story. Pediatric diabetes 14, 149-158, doi:10.1111/pedi.12033 (2013). 44 Horwitz, M. S. et al. Diabetes induced by Coxsackie virus: initiation by bystander damage and not molecular mimicry. Nature medicine 4, 781-785 (1998). 45 Dotta, F. et al. Coxsackie B4 virus infection of beta cells and natural killer cell insulitis in recent-onset type 1 diabetic patients. Proceedings of the National Academy of Sciences of the United States of America 104, 5115-5120, doi:10.1073/pnas.0700442104 (2007). 46 Johnson, S. R., Cooper, M. N., Jones, T. W. & Davis, E. A. Long-term outcome of insulin pump therapy in children with type 1 diabetes assessed in a large population- based case-control study. Diabetologia 56, 2392-2400, doi:10.1007/s00125-013-3007-9 (2013). 47 Shapiro, A. M. et al. Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. The New England journal of medicine 343, 230-238, doi:10.1056/NEJM200007273430401 (2000).

114

48 Ludwig, B. et al. Islet Transplantation at the Dresden Diabetes Center: Five Years' Experience. Hormone and metabolic research = Hormon- und Stoffwechselforschung = Hormones et metabolisme, doi:10.1055/s-0034-1385876 (2014). 49 Fox, I. J. et al. Stem cell therapy. Use of differentiated pluripotent stem cells as replacement therapy for treating disease. Science 345, 1247391, doi:10.1126/science.1247391 (2014). 50 Naujok, O., Burns, C., Jones, P. M. & Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet? Molecular therapy : the journal of the American Society of Gene Therapy 19, 1759-1768, doi:10.1038/mt.2011.165 (2011). 51 D'Amour, K. A. et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nature biotechnology 24, 1392-1401, doi:10.1038/nbt1259 (2006). 52 Ramiya, V. K. et al. Reversal of insulin-dependent diabetes using islets generated in vitro from pancreatic stem cells. Nature medicine 6, 278-282, doi:10.1038/73128 (2000). 53 Rezania, A. et al. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nature biotechnology, doi:10.1038/nbt.3033 (2014). 54 Hu, F. B. Globalization of diabetes: the role of diet, lifestyle, and genes. Diabetes care 34, 1249-1257, doi:10.2337/dc11-0442 (2011). 55 Sladek, R. et al. A genome-wide association study identifies novel risk loci for type 2 diabetes. Nature 445, 881-885, doi:10.1038/nature05616 (2007). 56 Scott, L. J. et al. A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 316, 1341-1345, doi:10.1126/science.1142382 (2007). 57 Kaprio, J. et al. Concordance for type 1 (insulin-dependent) and type 2 (non-insulin- dependent) diabetes mellitus in a population-based cohort of twins in Finland. Diabetologia 35, 1060-1067 (1992). 58 McCarthy, M. I. Genomics, type 2 diabetes, and obesity. The New England journal of medicine 363, 2339-2350, doi:10.1056/NEJMra0906948 (2010). 59 Lyssenko, V. & Laakso, M. Genetic screening for the risk of type 2 diabetes: worthless or valuable? Diabetes care 36 Suppl 2, S120-126, doi:10.2337/dcS13-2009 (2013). 60 Wang, J., Stancakova, A., Kuusisto, J. & Laakso, M. Identification of undiagnosed type 2 diabetic individuals by the finnish diabetes risk score and biochemical and genetic markers: a population-based study of 7232 Finnish men. The Journal of clinical endocrinology and metabolism 95, 3858-3862, doi:10.1210/jc.2010-0012 (2010). 61 Lindstrom, J. & Tuomilehto, J. The diabetes risk score: a practical tool to predict type 2 diabetes risk. Diabetes care 26, 725-731 (2003). 62 Billings, L. K. & Florez, J. C. The genetics of type 2 diabetes: what have we learned from GWAS? Annals of the New York Academy of Sciences 1212, 59-77, doi:10.1111/j.1749- 6632.2010.05838.x (2010). 63 Bjornholm, M. et al. Absence of functional insulin receptor substrate-3 (IRS-3) gene in humans. Diabetologia 45, 1697-1702, doi:10.1007/s00125-002-0945-z (2002). 64 Pascoe, L. et al. Common variants of the novel type 2 diabetes genes CDKAL1 and HHEX/IDE are associated with decreased pancreatic beta-cell function. Diabetes 56, 3101-3104, doi:10.2337/db07-0634 (2007).

115

65 Grarup, N. et al. Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes 56, 3105-3111, doi:10.2337/db07-0856 (2007). 66 Knutson, K. L., Spiegel, K., Penev, P. & Van Cauter, E. The metabolic consequences of sleep deprivation. Sleep medicine reviews 11, 163-178, doi:10.1016/j.smrv.2007.01.002 (2007). 67 Lang, I. A. et al. Association of urinary bisphenol A concentration with medical disorders and laboratory abnormalities in adults. JAMA : the journal of the American Medical Association 300, 1303-1310, doi:10.1001/jama.300.11.1303 (2008). 68 Suez, J. et al. Artificial sweeteners induce glucose intolerance by altering the gut microbiota. Nature, doi:10.1038/nature13793 (2014). 69 Malina, R. M. & Katzmarzyk, P. T. Validity of the body mass index as an indicator of the risk and presence of overweight in adolescents. The American journal of clinical nutrition 70, 131S-136S (1999). 70 Centers for Disease, C. & Prevention. Prevalence of overweight and obesity among adults with diagnosed diabetes--United States, 1988-1994 and 1999-2002. MMWR. Morbidity and mortality weekly report 53, 1066-1068 (2004). 71 Hofker, M. & Wijmenga, C. A supersized list of obesity genes. Nature genetics 41, 139- 140, doi:10.1038/ng0209-139 (2009). 72 Malik, V. S., Popkin, B. M., Bray, G. A., Despres, J. P. & Hu, F. B. Sugar-sweetened beverages, obesity, type 2 diabetes mellitus, and cardiovascular disease risk. Circulation 121, 1356-1364, doi:10.1161/CIRCULATIONAHA.109.876185 (2010). 73 Muoio, D. M. & Newgard, C. B. Mechanisms of disease: Molecular and metabolic mechanisms of insulin resistance and β-cell failure in type 2 diabetes. Nature Reviews Molecular Cell Biology 9, 193-205, doi:10.1038/nrm2327 (2008). 74 Shoelson, S. E., Lee, J. & Goldfine, A. B. Inflammation and insulin resistance. The Journal of clinical investigation 116, 1793-1801, doi:10.1172/JCI29069 (2006). 75 Donath, M. Y. & Shoelson, S. E. Type 2 diabetes as an inflammatory disease. Nature reviews. Immunology 11, 98-107, doi:10.1038/nri2925 (2011). 76 Chen, C., Hosokawa, H., Bumbalo, L. M. & Leahy, J. L. Regulatory effects of glucose on the catalytic activity and cellular content of glucokinase in the pancreatic beta cell. Study using cultured rat islets. The Journal of clinical investigation 94, 1616-1620, doi:10.1172/JCI117503 (1994). 77 Poitout, V. & Robertson, R. P. Minireview: Secondary beta-cell failure in type 2 diabetes--a convergence of glucotoxicity and lipotoxicity. Endocrinology 143, 339-342, doi:10.1210/endo.143.2.8623 (2002). 78 Harding, H. P. et al. Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in secretory cell survival. Molecular cell 7, 1153-1163 (2001). 79 Scheuner, D. et al. Control of mRNA translation preserves endoplasmic reticulum function in beta cells and maintains glucose homeostasis. Nature medicine 11, 757-764, doi:10.1038/nm1259 (2005). 80 Larsson, H. & Ahren, B. Effects of arginine on the secretion of insulin and islet amyloid polypeptide in humans. Pancreas 11, 201-205 (1995). 116

81 Westermark, P., Wernstedt, C., O'Brien, T. D., Hayden, D. W. & Johnson, K. H. Islet amyloid in type 2 human diabetes mellitus and adult diabetic cats contains a novel putative polypeptide hormone. The American journal of pathology 127, 414-417 (1987). 82 Matveyenko, A. V. & Butler, P. C. Beta-cell deficit due to increased apoptosis in the human islet amyloid polypeptide transgenic (HIP) rat recapitulates the metabolic defects present in type 2 diabetes. Diabetes 55, 2106-2114, doi:10.2337/db05-1672 (2006). 83 Izzedine, H. et al. Drug-induced diabetes mellitus. Expert opinion on drug safety 4, 1097- 1109, doi:10.1517/14740338.4.6.1097 (2005). 84 Black, H. R. et al. Principal results of the Controlled Onset Verapamil Investigation of Cardiovascular End Points (CONVINCE) trial. JAMA : the journal of the American Medical Association 289, 2073-2082, doi:10.1001/jama.289.16.2073 (2003). 85 Copstein, L. A., Zelmanovitz, T., Goncalves, L. F. & Manfro, R. C. Posttransplant diabetes mellitus in cyclosporine-treated renal allograft patients: a case-control study. Transplantation proceedings 36, 882-883, doi:10.1016/j.transproceed.2004.04.008 (2004). 86 Drachenberg, C. B. et al. Islet cell damage associated with tacrolimus and cyclosporine: morphological features in pancreas allograft biopsies and clinical correlation. Transplantation 68, 396-402 (1999). 87 Carr, A. et al. Diagnosis, prediction, and natural course of HIV-1 protease-inhibitor- associated lipodystrophy, hyperlipidaemia, and diabetes mellitus: a cohort study. Lancet 353, 2093-2099, doi:10.1016/S0140-6736(98)08468-2 (1999). 88 Knowler, W. C. et al. Reduction in the incidence of type 2 diabetes with lifestyle intervention or metformin. The New England journal of medicine 346, 393-403, doi:10.1056/NEJMoa012512 (2002). 89 Tuomilehto, J. et al. Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance. The New England journal of medicine 344, 1343-1350, doi:10.1056/NEJM200105033441801 (2001). 90 Pernicova, I. & Korbonits, M. Metformin--mode of action and clinical implications for diabetes and cancer. Nature reviews. Endocrinology 10, 143-156, doi:10.1038/nrendo.2013.256 (2014). 91 Shaw, R. J. et al. The kinase LKB1 mediates glucose homeostasis in liver and therapeutic effects of metformin. Science 310, 1642-1646, doi:10.1126/science.1120781 (2005). 92 Franciosi, M. et al. Metformin therapy and risk of cancer in patients with type 2 diabetes: systematic review. PloS one 8, e71583, doi:10.1371/journal.pone.0071583 (2013). 93 Brietzke, S. A. Oral Antihyperglycemic Treatment Options for Type 2 Diabetes Mellitus. The Medical clinics of North America 99, 87-106, doi:10.1016/j.mcna.2014.08.012 (2015). 94 Wideman, R. D. & Kieffer, T. J. Mining incretin hormone pathways for novel therapies. Trends in endocrinology and metabolism: TEM 20, 280-286, doi:10.1016/j.tem.2009.02.005 (2009). 95 Kahn, S. E. The relative contributions of insulin resistance and beta-cell dysfunction to the pathophysiology of Type 2 diabetes. Diabetologia 46, 3-19, doi:10.1007/s00125-002- 1009-0 (2003). 96 Sorli, C. New Developments in Insulin Therapy for Type 2 Diabetes. The American Journal of Medicine 127, S39-S48, doi:10.1016/j.amjmed.2014.07.006 (2014). 117

97 Inzucchi, S. E. et al. Management of hyperglycemia in type 2 diabetes: a patient-centered approach: position statement of the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD). Diabetes care 35, 1364-1379, doi:10.2337/dc12-0413 (2012). 98 De Meyts, P. & Whittaker, J. Structural biology of insulin and IGF1 receptors: implications for drug design. Nature reviews. Drug discovery 1, 769-783, doi:10.1038/nrd917 (2002). 99 Robinson, D. R., Wu, Y. M. & Lin, S. F. The protein tyrosine kinase family of the human genome. Oncogene 19, 5548-5557, doi:10.1038/sj.onc.1203957 (2000). 100 Hubbard, S. R. Structural analysis of receptor tyrosine kinases. Progress in biophysics and molecular biology 71, 343-358 (1999). 101 De Meyts, P. Insulin and its receptor: structure, function and evolution. BioEssays : news and reviews in molecular, cellular and developmental biology 26, 1351-1362, doi:10.1002/bies.20151 (2004). 102 Petryszak, R. et al. Expression Atlas update--a database of gene and transcript expression from microarray- and sequencing-based functional genomics experiments. Nucleic acids research 42, D926-D932, doi:10.1093/nar/gkt1270 (2013). 103 Chiang, S. H. et al. Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature 410, 944-948, doi:10.1038/35073608 (2001). 104 Joslin, E. P. & Kahn, C. R. Joslin's diabetes mellitus. 14th edn, (Lippincott Williams & Willkins, 2005). 105 Steiner, D. F. & Oyer, P. E. The biosynthesis of insulin and a probable precursor of insulin by a human islet cell adenoma. Proceedings of the National Academy of Sciences of the United States of America 57, 473-480 (1967). 106 Seino, S. & Bell, G. I. Alternative splicing of human insulin receptor messenger RNA. Biochemical and biophysical research communications 159, 312-316 (1989). 107 Schaffer, L. & Ljungqvist, L. Identification of a disulfide bridge connecting the alpha- subunits of the extracellular domain of the insulin receptor. Biochemical and biophysical research communications 189, 650-653 (1992). 108 Belfiore, A., Frasca, F., Pandini, G., Sciacca, L. & Vigneri, R. Insulin receptor isoforms and insulin receptor/insulin-like growth factor receptor hybrids in physiology and disease. Endocrine reviews 30, 586-623, doi:10.1210/er.2008-0047 (2009). 109 McKern, N. M. et al. Structure of the insulin receptor ectodomain reveals a folded-over conformation. Nature 443, 218-221, doi:10.1038/nature05106 (2006). 110 Menting, J. G. et al. How insulin engages its primary binding site on the insulin receptor. Nature 493, 241-245, doi:10.1038/nature11781 (2013). 111 Ebina, Y. et al. The human insulin receptor cDNA: the structural basis for hormone- activated transmembrane signalling. Cell 40, 747-758 (1985). 112 Baron, V., Kaliman, P., Gautier, N. & Van Obberghen, E. The insulin receptor activation process involves localized conformational changes. The Journal of biological chemistry 267, 23290-23294 (1992). 113 Boucher, J., Kleinridders, A. & Kahn, C. R. Insulin receptor signaling in normal and insulin-resistant states. Cold Spring Harbor perspectives in biology 6, doi:10.1101/cshperspect.a009191 (2014).

118

114 Araki, E. et al. Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature 372, 186-190, doi:10.1038/372186a0 (1994). 115 Withers, D. J. et al. Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900- 904, doi:10.1038/36116 (1998). 116 Laustsen, P. G. et al. Lipoatrophic diabetes in Irs1(-/-)/Irs3(-/-) double knockout mice. Genes & development 16, 3213-3222, doi:10.1101/gad.1034802 (2002). 117 Fantin, V. R., Wang, Q., Lienhard, G. E. & Keller, S. R. Mice lacking insulin receptor substrate 4 exhibit mild defects in growth, reproduction, and glucose homeostasis. American journal of physiology. Endocrinology and metabolism 278, E127-133 (2000). 118 Versteyhe, S. et al. Insulin receptor substrates-5 and -6 are poor substrates for the insulin receptor. Molecular medicine reports 3, 189-193, doi:10.3892/mmr_00000239 (2010). 119 Cho, H. et al. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 292, 1728-1731, doi:10.1126/science.292.5522.1728 (2001). 120 Duvel, K. et al. Activation of a metabolic gene regulatory network downstream of mTOR complex 1. Molecular cell 39, 171-183, doi:10.1016/j.molcel.2010.06.022 (2010). 121 Eijkelenboom, A. & Burgering, B. M. FOXOs: signalling integrators for homeostasis maintenance. Nature reviews. Molecular cell biology 14, 83-97, doi:10.1038/nrm3507 (2013). 122 Kim, K. H. et al. Regulatory role of glycogen synthase kinase 3 for transcriptional activity of ADD1/SREBP1c. The Journal of biological chemistry 279, 51999-52006, doi:10.1074/jbc.M405522200 (2004). 123 Kitamura, T. et al. Insulin-induced phosphorylation and activation of cyclic nucleotide phosphodiesterase 3B by the serine-threonine kinase Akt. Molecular and cellular biology 19, 6286-6296 (1999). 124 Pages, G. et al. Defective thymocyte maturation in p44 MAP kinase (Erk 1) knockout mice. Science 286, 1374-1377 (1999). 125 Taniguchi, C. M., Emanuelli, B. & Kahn, C. R. Critical nodes in signalling pathways: insights into insulin action. Nature Reviews Molecular Cell Biology 7, 85-96, doi:10.1038/nrm1837 (2006). 126 Jacob, K. K. & Stanley, F. M. Elk-1, C/EBPalpha, and Pit-1 confer an insulin-responsive phenotype on prolactin promoter expression in Chinese hamster ovary cells and define the factors required for insulin-increased transcription. The Journal of biological chemistry 276, 24931-24936, doi:10.1074/jbc.M102826200 (2001). 127 Mahajan, M. A. & Stanley, F. M. Insulin-activated Elk-1 recruits the TIP60/NuA4 complex to increase prolactin gene transcription. Molecular and cellular endocrinology 382, 159-169, doi:10.1016/j.mce.2013.09.021 (2014). 128 Bost, F. et al. The extracellular signal-regulated kinase isoform ERK1 is specifically required for in vitro and in vivo adipogenesis. Diabetes 54, 402-411 (2005). 129 Nyman, E. et al. A Single Mechanism Can Explain Network-wide Insulin Resistance in Adipocytes from Obese Patients with Type 2 Diabetes. Journal of Biological Chemistry 289, 33215-33230, doi:10.1074/jbc.M114.608927 (2014). 130 Monetti, M., Nagaraj, N., Sharma, K. & Mann, M. Large-scale phosphosite quantification in tissues by a spike-in SILAC method. Nature methods 8, 655-658, doi:10.1038/nmeth.1647 (2011). 119

131 Kulkarni, R. N. et al. Tissue-specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes. Cell 96, 329-339 (1999). 132 Okada, T. et al. Insulin receptors in beta-cells are critical for islet compensatory growth response to insulin resistance. Proceedings of the National Academy of Sciences of the United States of America 104, 8977-8982, doi:10.1073/pnas.0608703104 (2007). 133 Best, C. H. & Haist, R. E. The effect of insulin administration on the insulin content of the pancreas. The Journal of physiology 100, 142-146 (1941). 134 Leibiger, B. et al. Selective insulin signaling through A and B insulin receptors regulates transcription of insulin and glucokinase genes in pancreatic beta cells. Molecular cell 7, 559-570 (2001). 135 Leibiger, I. B., Leibiger, B. & Berggren, P. O. Insulin signaling in the pancreatic beta- cell. Annual review of nutrition 28, 233-251, doi:10.1146/annurev.nutr.28.061807.155530 (2008). 136 Wu, H. et al. Insulin stimulates pancreatic-duodenal homoeobox factor-1 (PDX1) DNA- binding activity and insulin promoter activity in pancreatic beta cells. The Biochemical journal 344 Pt 3, 813-818 (1999). 137 Johnson, J. D. et al. Insulin protects islets from apoptosis via Pdx1 and specific changes in the human islet proteome. Proceedings of the National Academy of Sciences of the United States of America 103, 19575-19580, doi:10.1073/pnas.0604208103 (2006). 138 Luciani, D. S. & Johnson, J. D. Acute effects of insulin on beta-cells from transplantable human islets. Molecular and cellular endocrinology 241, 88-98, doi:10.1016/j.mce.2005.06.006 (2005). 139 Wang, M., Li, J., Lim, G. E. & Johnson, J. D. Is dynamic autocrine insulin signaling possible? A mathematical model predicts picomolar concentrations of extracellular monomeric insulin within human pancreatic islets. PloS one 8, e64860, doi:10.1371/journal.pone.0064860 (2013). 140 Xu, G. G. & Rothenberg, P. L. Insulin receptor signaling in the beta-cell influences insulin gene expression and insulin content: evidence for autocrine beta-cell regulation. Diabetes 47, 1243-1252 (1998). 141 Rhodes, C. J., White, M. F., Leahy, J. L. & Kahn, S. E. Direct autocrine action of insulin on beta-cells: does it make physiological sense? Diabetes 62, 2157-2163, doi:10.2337/db13-0246 (2013). 142 Wicksteed, B., Alarcon, C., Briaud, I., Lingohr, M. K. & Rhodes, C. J. Glucose-induced translational control of proinsulin biosynthesis is proportional to preproinsulin mRNA levels in islet beta-cells but not regulated via a positive feedback of secreted insulin. The Journal of biological chemistry 278, 42080-42090, doi:10.1074/jbc.M303509200 (2003). 143 Elahi, D. et al. Feedback inhibition of insulin secretion by insulin: relation to the hyperinsulinemia of obesity. The New England journal of medicine 306, 1196-1202, doi:10.1056/NEJM198205203062002 (1982). 144 Iversen, J. & Miles, D. W. Evidence for a feedback inhibition of insulin on insulin secretion in the isolated, perfused canine pancreas. Diabetes 20, 1-9 (1971). 145 Aspinwall, C. A., Lakey, J. R. & Kennedy, R. T. Insulin-stimulated insulin secretion in single pancreatic beta cells. The Journal of biological chemistry 274, 6360-6365 (1999).

120

146 Bouche, C. et al. Insulin enhances glucose-stimulated insulin secretion in healthy humans. Proceedings of the National Academy of Sciences of the United States of America 107, 4770-4775, doi:10.1073/pnas.1000002107 (2010). 147 Kulkarni, R. N. et al. Islet secretory defect in insulin receptor substrate 1 null mice is linked with reduced calcium signaling and expression of sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA)-2b and -3. Diabetes 53, 1517-1525 (2004). 148 Otani, K. et al. Reduced beta-cell mass and altered glucose sensing impair insulin- secretory function in betaIRKO mice. American journal of physiology. Endocrinology and metabolism 286, E41-49, doi:10.1152/ajpendo.00533.2001 (2004). 149 Cantley, J. et al. Pancreatic deletion of insulin receptor substrate 2 reduces beta and alpha cell mass and impairs glucose homeostasis in mice. Diabetologia 50, 1248-1256, doi:10.1007/s00125-007-0637-9 (2007). 150 Marchetti, P. et al. Insulin secretory function is impaired in isolated human islets carrying the Gly(972)-->Arg IRS-1 polymorphism. Diabetes 51, 1419-1424 (2002). 151 Kubota, N. et al. Disruption of insulin receptor substrate 2 causes type 2 diabetes because of liver insulin resistance and lack of compensatory beta-cell hyperplasia. Diabetes 49, 1880-1889 (2000). 152 Araujo, E. P. et al. Restoration of insulin secretion in pancreatic islets of protein-deficient rats by reduced expression of insulin receptor substrate (IRS)-1 and IRS-2. The Journal of endocrinology 181, 25-38 (2004). 153 Xu, G. G., Gao, Z. y., Borge, P. D. & Wolf, B. A. Insulin Receptor Substrate 1-induced Inhibition of Endoplasmic Reticulum Ca2+ Uptake in -Cells: AUTOCRINE REGULATION OF INTRACELLULAR Ca2+HOMEOSTASIS AND INSULIN SECRETION. Journal of Biological Chemistry 274, 18067-18074, doi:10.1074/jbc.274.25.18067 (1999). 154 Malaisse, W. J., Malaisse-Lagae, F., Lacy, P. E. & Wright, P. H. Insulin secretion by isolated islets in presence of glucose, insulin and anti-insulin serum. Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine 124, 497-500 (1967). 155 Schatz, H. & Pfeiffer, E. F. Release of immunoreactive and radioactively prelabelled endogenous (pro)-insulin from isolated islets of rat pancreas in the presence of exogenous insulin. The Journal of endocrinology 74, 243-249 (1977). 156 Bouwens, L. Regulation of Pancreatic Beta-Cell Mass. Physiological Reviews 85, 1255- 1270, doi:10.1152/physrev.00025.2004 (2005). 157 Beith, J. L., Alejandro, E. U. & Johnson, J. D. Insulin stimulates primary beta-cell proliferation via Raf-1 kinase. Endocrinology 149, 2251-2260, doi:10.1210/en.2007-1557 (2008). 158 Bernal-Mizrachi, E., Wen, W., Stahlhut, S., Welling, C. M. & Permutt, M. A. Islet beta cell expression of constitutively active Akt1/PKB alpha induces striking hypertrophy, hyperplasia, and hyperinsulinemia. The Journal of clinical investigation 108, 1631-1638, doi:10.1172/JCI13785 (2001). 159 Tuttle, R. L. et al. Regulation of pancreatic beta-cell growth and survival by the serine/threonine protein kinase Akt1/PKBalpha. Nature medicine 7, 1133-1137, doi:10.1038/nm1001-1133 (2001).

121

160 Hashimoto, N. et al. Ablation of PDK1 in pancreatic beta cells induces diabetes as a result of loss of beta cell mass. Nature genetics 38, 589-593, doi:10.1038/ng1774 (2006). 161 Bernal-Mizrachi, E. et al. Defective insulin secretion and increased susceptibility to experimental diabetes are induced by reduced Akt activity in pancreatic islet beta cells. The Journal of clinical investigation 114, 928-936, doi:10.1172/JCI20016 (2004). 162 Duvillie, B. et al. Increased islet cell proliferation, decreased apoptosis, and greater vascularization leading to beta-cell hyperplasia in mutant mice lacking insulin. Endocrinology 143, 1530-1537, doi:10.1210/endo.143.4.8753 (2002). 163 Ueki, K. et al. Total insulin and IGF-I resistance in pancreatic beta cells causes overt diabetes. Nature genetics 38, 583-588, doi:10.1038/ng1787 (2006). 164 Kulkarni, R. N. et al. beta-cell-specific deletion of the Igf1 receptor leads to hyperinsulinemia and glucose intolerance but does not alter beta-cell mass. Nature genetics 31, 111-115, doi:10.1038/ng872 (2002). 165 Kahn, C. R. The Gordon Wilson Lecture. Lessons about the control of glucose homeostasis and the pathogenesis of diabetes from knockout mice. Transactions of the American Clinical and Climatological Association 114, 125-148 (2003). 166 Ristow, M. et al. Frataxin deficiency in pancreatic islets causes diabetes due to loss of beta cell mass. The Journal of clinical investigation 112, 527-534, doi:10.1172/JCI18107 (2003). 167 Gray, S. M., Meijer, R. I. & Barrett, E. J. Insulin regulates brain function, but how does it get there? Diabetes 63, 3992-3997, doi:10.2337/db14-0340 (2014). 168 Johnson, J. D. A practical guide to genetic engineering of pancreatic β-cellsin vivo: Getting a grip on RIP and MIP. Islets 6, e944439, doi:10.4161/19382014.2014.944439 (2014). 169 Zhou, L., Trinder, M., Riopel, M., Li, J. & Wang, R. Temporally Controlled Knockout of the β-Cell Insulin Receptor During In Utero Development Induces an Islet Compensatory Response. Canadian Journal of Diabetes 38, S18, doi:10.1016/j.jcjd.2014.07.048 (2014). 170 Almind, K., Inoue, G., Pedersen, O. & Kahn, C. R. A common amino acid polymorphism in insulin receptor substrate-1 causes impaired insulin signaling. Evidence from transfection studies. The Journal of clinical investigation 97, 2569-2575, doi:10.1172/JCI118705 (1996). 171 Burguete-Garcia, A. I. et al. Association of Gly972Arg polymorphism of IRS1 gene with type 2 diabetes mellitus in lean participants of a national health survey in Mexico: a candidate gene study. Metabolism: clinical and experimental 59, 38-45, doi:10.1016/j.metabol.2009.07.007 (2010). 172 Bernal, D. et al. Insulin receptor substrate-2 amino acid polymorphisms are not associated with random type 2 diabetes among Caucasians. Diabetes 47, 976-979 (1998). 173 Barroso, I. et al. Candidate gene association study in type 2 diabetes indicates a role for genes involved in beta-cell function as well as insulin action. PLoS biology 1, E20, doi:10.1371/journal.pbio.0000020 (2003). 174 George, S. et al. A family with severe insulin resistance and diabetes due to a mutation in AKT2. Science 304, 1325-1328, doi:10.1126/science.1096706 (2004). 175 Prudente, S. et al. The TRIB3 Q84R polymorphism and risk of early-onset type 2 diabetes. The Journal of clinical endocrinology and metabolism 94, 190-196, doi:10.1210/jc.2008-1365 (2009). 122

176 Ferreira, L. D., Pulawa, L. K., Jensen, D. R. & Eckel, R. H. Overexpressing human lipoprotein lipase in mouse skeletal muscle is associated with insulin resistance. Diabetes 50, 1064-1068 (2001). 177 Ozcan, U. et al. Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, 457-461, doi:10.1126/science.1103160 (2004). 178 Yu, C. et al. Mechanism by which fatty acids inhibit insulin activation of insulin receptor substrate-1 (IRS-1)-associated phosphatidylinositol 3-kinase activity in muscle. The Journal of biological chemistry 277, 50230-50236, doi:10.1074/jbc.M200958200 (2002). 179 Bakan, E. et al. Effects of type 2 diabetes mellitus on plasma fatty acid composition and cholesterol content of erythrocyte and leukocyte membranes. Acta diabetologica 43, 109- 113, doi:10.1007/s00592-007-0224-4 (2006). 180 Kamei, N. et al. Overexpression of monocyte chemoattractant protein-1 in adipose tissues causes macrophage recruitment and insulin resistance. The Journal of biological chemistry 281, 26602-26614, doi:10.1074/jbc.M601284200 (2006). 181 Jager, J., Gremeaux, T., Cormont, M., Le Marchand-Brustel, Y. & Tanti, J. F. Interleukin-1beta-induced insulin resistance in adipocytes through down-regulation of insulin receptor substrate-1 expression. Endocrinology 148, 241-251, doi:10.1210/en.2006-0692 (2007). 182 Shi, H. et al. TLR4 links innate immunity and fatty acid-induced insulin resistance. The Journal of clinical investigation 116, 3015-3025, doi:10.1172/JCI28898 (2006). 183 Solinas, G., Naugler, W., Galimi, F., Lee, M. S. & Karin, M. Saturated fatty acids inhibit induction of insulin gene transcription by JNK-mediated phosphorylation of insulin- receptor substrates. Proceedings of the National Academy of Sciences of the United States of America 103, 16454-16459, doi:10.1073/pnas.0607626103 (2006). 184 D'Alessandris, C. et al. Increased O-glycosylation of insulin signaling proteins results in their impaired activation and enhanced susceptibility to apoptosis in pancreatic beta-cells. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 18, 959-961, doi:10.1096/fj.03-0725fje (2004). 185 Conner, S. D. & Schmid, S. L. Regulated portals of entry into the cell. Nature 422, 37-44, doi:10.1038/nature01451 (2003). 186 Aderem, A. & Underhill, D. M. Mechanisms of phagocytosis in macrophages. Annual review of immunology 17, 593-623, doi:10.1146/annurev.immunol.17.1.593 (1999). 187 Bitsikas, V., Correa, I. R. & Nichols, B. J. Clathrin-independent pathways do not contribute significantly to endocytic flux. eLife 3, doi:10.7554/eLife.03970 (2014). 188 Hinshaw, J. E. & Schmid, S. L. Dynamin self-assembles into rings suggesting a mechanism for coated vesicle budding. Nature 374, 190-192, doi:10.1038/374190a0 (1995). 189 Schmid, S. L., Braell, W. A., Schlossman, D. M. & Rothman, J. E. A role for clathrin light chains in the recognition of clathrin cages by 'uncoating ATPase'. Nature 311, 228- 231 (1984). 190 Stenmark, H. Rab GTPases as coordinators of vesicle traffic. Nature reviews. Molecular cell biology 10, 513-525, doi:10.1038/nrm2728 (2009). 191 Zeigerer, A. et al. Rab5 is necessary for the biogenesis of the endolysosomal system in vivo. Nature 485, 465-470, doi:10.1038/nature11133 (2012).

123

192 Christoforidis, S., McBride, H. M., Burgoyne, R. D. & Zerial, M. The Rab5 effector EEA1 is a core component of endosome docking. Nature 397, 621-625, doi:10.1038/17618 (1999). 193 Ullrich, O., Reinsch, S., Urbe, S., Zerial, M. & Parton, R. G. Rab11 regulates recycling through the pericentriolar recycling endosome. The Journal of cell biology 135, 913-924 (1996). 194 Rink, J., Ghigo, E., Kalaidzidis, Y. & Zerial, M. Rab conversion as a mechanism of progression from early to late endosomes. Cell 122, 735-749, doi:10.1016/j.cell.2005.06.043 (2005). 195 Bleil, J. D. & Bretscher, M. S. Transferrin receptor and its recycling in HeLa cells. The EMBO journal 1, 351-355 (1982). 196 Kurten, R. C., Cadena, D. L. & Gill, G. N. Enhanced degradation of EGF receptors by a sorting nexin, SNX1. Science 272, 1008-1010 (1996). 197 Lingwood, D. & Simons, K. Lipid rafts as a membrane-organizing principle. Science 327, 46-50, doi:10.1126/science.1174621 (2010). 198 Reeves, V. L., Thomas, C. M. & Smart, E. J. Lipid rafts, caveolae and GPI-linked proteins. Advances in experimental medicine and biology 729, 3-13, doi:10.1007/978-1- 4614-1222-9_1 (2012). 199 Le, P. U., Guay, G., Altschuler, Y. & Nabi, I. R. Caveolin-1 is a negative regulator of caveolae-mediated endocytosis to the endoplasmic reticulum. The Journal of biological chemistry 277, 3371-3379, doi:10.1074/jbc.M111240200 (2002). 200 Pelkmans, L. & Zerial, M. Kinase-regulated quantal assemblies and kiss-and-run recycling of caveolae. Nature 436, 128-133, doi:10.1038/nature03866 (2005). 201 Kiss, A. L. Caveolae and the regulation of endocytosis. Advances in experimental medicine and biology 729, 14-28, doi:10.1007/978-1-4614-1222-9_2 (2012). 202 Campbell, S. M., Crowe, S. M. & Mak, J. Lipid rafts and HIV-1: from viral entry to assembly of progeny virions. Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology 22, 217-227 (2001). 203 Richterova, Z. et al. Caveolae are involved in the trafficking of mouse polyomavirus virions and artificial VP1 pseudocapsids toward cell nuclei. Journal of virology 75, 10880-10891, doi:10.1128/JVI.75.22.10880-10891.2001 (2001). 204 Tiruppathi, C., Song, W., Bergenfeldt, M., Sass, P. & Malik, A. B. Gp60 activation mediates albumin transcytosis in endothelial cells by tyrosine kinase-dependent pathway. The Journal of biological chemistry 272, 25968-25975 (1997). 205 Li, S., Seitz, R. & Lisanti, M. P. Phosphorylation of caveolin by src tyrosine kinases. The alpha-isoform of caveolin is selectively phosphorylated by v-Src in vivo. The Journal of biological chemistry 271, 3863-3868 (1996). 206 Hayer, A. et al. Caveolin-1 is ubiquitinated and targeted to intralumenal vesicles in endolysosomes for degradation. The Journal of cell biology 191, 615-629, doi:10.1083/jcb.201003086 (2010). 207 Parton, R. G. & del Pozo, M. A. Caveolae as plasma membrane sensors, protectors and organizers. Nature reviews. Molecular cell biology 14, 98-112, doi:10.1038/nrm3512 (2013).

124

208 Howes, M. T. et al. Clathrin-independent carriers form a high capacity endocytic sorting system at the leading edge of migrating cells. The Journal of cell biology 190, 675-691, doi:10.1083/jcb.201002119 (2010). 209 Lundmark, R. et al. The GTPase-activating protein GRAF1 regulates the CLIC/GEEC endocytic pathway. Current biology : CB 18, 1802-1808, doi:10.1016/j.cub.2008.10.044 (2008). 210 Glebov, O. O., Bright, N. A. & Nichols, B. J. Flotillin-1 defines a clathrin-independent endocytic pathway in mammalian cells. Nature cell biology 8, 46-54, doi:10.1038/ncb1342 (2006). 211 Fork, C., Hitzel, J., Nichols, B. J., Tikkanen, R. & Brandes, R. P. Flotillin-1 facilitates toll-like receptor 3 signaling in human endothelial cells. Basic research in cardiology 109, 439, doi:10.1007/s00395-014-0439-4 (2014). 212 Khandare, J., Calderón, M., Dagia, N. M. & Haag, R. Multifunctional dendritic polymers in nanomedicine: opportunities and challenges. Chemical Society Reviews 41, 2824, doi:10.1039/c1cs15242d (2012). 213 Goh, L. K. & Sorkin, A. Endocytosis of receptor tyrosine kinases. Cold Spring Harbor perspectives in biology 5, a017459, doi:10.1101/cshperspect.a017459 (2013). 214 Fagerholm, S., Ortegren, U., Karlsson, M., Ruishalme, I. & Stralfors, P. Rapid insulin- dependent endocytosis of the insulin receptor by caveolae in primary adipocytes. PloS one 4, e5985, doi:10.1371/journal.pone.0005985 (2009). 215 Jose, M., Biosca, J. A., Trujillo, R. & Itarte, E. Characterization of the hepatic insulin receptor undergoing internalization through clathrin-coated vesicles and endosomes. FEBS letters 334, 286-288 (1993). 216 Stralfors, P. Caveolins and caveolae, roles in insulin signalling and diabetes. Advances in experimental medicine and biology 729, 111-126, doi:10.1007/978-1-4614-1222-9_8 (2012). 217 Brannmark, C., Palmer, R., Glad, S. T., Cedersund, G. & Stralfors, P. Mass and information feedbacks through receptor endocytosis govern insulin signaling as revealed using a parameter-free modeling framework. The Journal of biological chemistry 285, 20171-20179, doi:10.1074/jbc.M110.106849 (2010). 218 Gorden, P., Freychet, P., Carpentier, J. L., Canivet, B. & Orci, L. Receptor-linked degradation of 125I-insulin is mediated by internalization in isolated rat hepatocytes. The Yale journal of biology and medicine 55, 101-112 (1982). 219 Stenkula, K. G. et al. Human, but not rat, IRS1 targets to the plasma membrane in both human and rat adipocytes. Biochemical and biophysical research communications 363, 840-845, doi:10.1016/j.bbrc.2007.09.065 (2007). 220 Chen, J. et al. Regulation of insulin receptor substrate-1 expression levels by caveolin-1. Journal of cellular physiology 217, 281-289, doi:10.1002/jcp.21498 (2008). 221 Cohen, A. W. et al. Caveolin-1-deficient mice show insulin resistance and defective insulin receptor protein expression in adipose tissue. American journal of physiology. Cell physiology 285, C222-235, doi:10.1152/ajpcell.00006.2003 (2003). 222 Ceresa, B. P., Kao, A. W., Santeler, S. R. & Pessin, J. E. Inhibition of clathrin-mediated endocytosis selectively attenuates specific insulin receptor signal transduction pathways. Molecular and cellular biology 18, 3862-3870 (1998).

125

223 Johnson, J. D. & Chang, J. P. Function- and agonist-specific Ca2+ signalling: the requirement for and mechanism of spatial and temporal complexity in Ca2+ signals. Biochemistry and cell biology = Biochimie et biologie cellulaire 78, 217-240 (2000). 224 Bengtson, C. P. & Bading, H. Nuclear calcium signaling. Advances in experimental medicine and biology 970, 377-405, doi:10.1007/978-3-7091-0932-8_17 (2012). 225 Hajnoczky, G., Davies, E. & Madesh, M. Calcium signaling and apoptosis. Biochemical and biophysical research communications 304, 445-454 (2003). 226 Morgan, A. J., Platt, F. M., Lloyd-Evans, E. & Galione, A. Molecular mechanisms of endolysosomal Ca2+signalling in health and disease. Biochemical Journal 439, 349-374, doi:10.1042/bj20110949 (2011). 227 Kasai, H., Hatakeyama, H., Ohno, M. & Takahashi, N. Exocytosis in islet beta-cells. Advances in experimental medicine and biology 654, 305-338, doi:10.1007/978-90-481- 3271-3_14 (2010). 228 Distelhorst, C. W. & Bootman, M. D. Bcl-2 interaction with the inositol 1,4,5- trisphosphate receptor: role in Ca(2+) signaling and disease. Cell calcium 50, 234-241, doi:10.1016/j.ceca.2011.05.011 (2011). 229 Orrenius, S., Zhivotovsky, B. & Nicotera, P. Regulation of cell death: the calcium- apoptosis link. Nature reviews. Molecular cell biology 4, 552-565, doi:10.1038/nrm1150 (2003). 230 Taylor, C. W. & Dale, P. Intracellular Ca(2+) channels - a growing community. Molecular and cellular endocrinology 353, 21-28, doi:10.1016/j.mce.2011.08.028 (2012). 231 Zampese, E. & Pizzo, P. Intracellular organelles in the saga of Ca2+ homeostasis: different molecules for different purposes? Cellular and molecular life sciences : CMLS 69, 1077-1104, doi:10.1007/s00018-011-0845-9 (2012). 232 Catterall, W. A., Hulme, J. T., Jiang, X. & Few, W. P. Regulation of sodium and calcium channels by signaling complexes. Journal of receptor and signal transduction research 26, 577-598, doi:10.1080/10799890600915100 (2006). 233 Nieto-Posadas, A., Jara-Oseguera, A. & Rosenbaum, T. TRP channel gating physiology. Current topics in medicinal chemistry 11, 2131-2150 (2011). 234 Catterall, W. A. Signaling complexes of voltage-gated sodium and calcium channels. Neuroscience letters 486, 107-116, doi:10.1016/j.neulet.2010.08.085 (2010). 235 Catterall, W. A. Structure and regulation of voltage-gated Ca2+ channels. Annual review of cell and developmental biology 16, 521-555, doi:10.1146/annurev.cellbio.16.1.521 (2000). 236 Stutzmann, G. E. & Mattson, M. P. Endoplasmic reticulum Ca(2+) handling in excitable cells in health and disease. Pharmacological reviews 63, 700-727, doi:10.1124/pr.110.003814 (2011). 237 Kimlicka, L. & Van Petegem, F. The structural biology of ryanodine receptors. Science China. Life sciences 54, 712-724, doi:10.1007/s11427-011-4198-2 (2011). 238 Zhang, S., Fritz, N., Ibarra, C. & Uhlen, P. Inositol 1,4,5-trisphosphate receptor subtype- specific regulation of calcium oscillations. Neurochemical research 36, 1175-1185, doi:10.1007/s11064-011-0457-7 (2011).

126

239 Moller, J. V., Olesen, C., Winther, A. M. & Nissen, P. The sarcoplasmic Ca2+-ATPase: design of a perfect chemi-osmotic pump. Quarterly reviews of biophysics 43, 501-566, doi:10.1017/S003358351000017X (2010). 240 Traub, L. M. & Kornfeld, S. The trans-Golgi network: a late secretory sorting station. Current opinion in cell biology 9, 527-533 (1997). 241 Pizzo, P., Lissandron, V., Capitanio, P. & Pozzan, T. Ca(2+) signalling in the Golgi apparatus. Cell calcium 50, 184-192, doi:10.1016/j.ceca.2011.01.006 (2011). 242 Micaroni, M., Perinetti, G., Berrie, C. P. & Mironov, A. A. The SPCA1 Ca2+ pump and intracellular membrane trafficking. Traffic 11, 1315-1333, doi:10.1111/j.1600- 0854.2010.01096.x (2010). 243 Sarma, A. & Yang, W. Calcium regulation of nucleocytoplasmic transport. Protein & cell 2, 291-302, doi:10.1007/s13238-011-1038-x (2011). 244 Drago, I., Pizzo, P. & Pozzan, T. After half a century mitochondrial calcium in- and efflux machineries reveal themselves. The EMBO journal 30, 4119-4125, doi:10.1038/emboj.2011.337 (2011). 245 Cali, T., Ottolini, D. & Brini, M. Mitochondrial Ca(2+) as a key regulator of mitochondrial activities. Advances in experimental medicine and biology 942, 53-73, doi:10.1007/978-94-007-2869-1_3 (2012). 246 Rasola, A. & Bernardi, P. Mitochondrial permeability transition in Ca(2+)-dependent apoptosis and necrosis. Cell calcium 50, 222-233, doi:10.1016/j.ceca.2011.04.007 (2011). 247 Baughman, J. M. et al. Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Nature 476, 341-345, doi:10.1038/nature10234 (2011). 248 De Stefani, D., Raffaello, A., Teardo, E., Szabo, I. & Rizzuto, R. A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. Nature 476, 336- 340, doi:10.1038/nature10230 (2011). 249 Hoffman, N. E. et al. MICU1 motifs define mitochondrial calcium uniporter binding and activity. Cell reports 5, 1576-1588, doi:10.1016/j.celrep.2013.11.026 (2013). 250 Patel, S. & Docampo, R. Acidic calcium stores open for business: expanding the potential for intracellular Ca2+ signaling. Trends in cell biology 20, 277-286, doi:10.1016/j.tcb.2010.02.003 (2010). 251 Patel, S. & Cai, X. Evolution of acidic Ca stores and their resident Ca-permeable channels. Cell calcium, doi:10.1016/j.ceca.2014.12.005 (2014). 252 Gerasimenko, J. V., Tepikin, A. V., Petersen, O. H. & Gerasimenko, O. V. Calcium uptake via endocytosis with rapid release from acidifying endosomes. Current biology : CB 8, 1335-1338 (1998). 253 Christensen, K. A., Myers, J. T. & Swanson, J. A. pH-dependent regulation of lysosomal calcium in macrophages. Journal of cell science 115, 599-607 (2002). 254 Hay, J. C. Calcium: a fundamental regulator of intracellular membrane fusion? EMBO reports 8, 236-240, doi:10.1038/sj.embor.7400921 (2007). 255 Puertollano, R. & Kiselyov, K. TRPMLs: in sickness and in health. AJP: Renal Physiology 296, F1245-F1254, doi:10.1152/ajprenal.90522.2008 (2009). 256 Miedel, M. T. et al. Membrane traffic and turnover in TRP-ML1-deficient cells: a revised model for mucolipidosis type IV pathogenesis. The Journal of experimental medicine 205, 1477-1490, doi:10.1084/jem.20072194 (2008). 127

257 Cuajungco, M. P. & Samie, M. A. The varitint-waddler mouse phenotypes and the TRPML3 ion channel mutation: cause and consequence. Pflugers Archiv : European journal of physiology 457, 463-473, doi:10.1007/s00424-008-0523-4 (2008). 258 Parrington, J. & Tunn, R. Ca2+signals, NAADP and two-pore channels: role in cellular differentiation. Acta Physiologica 211, 285-296, doi:10.1111/apha.12298 (2014). 259 Zhang, Z. H., Lu, Y. Y. & Yue, J. Two pore channel 2 differentially modulates neural differentiation of mouse embryonic stem cells. PloS one 8, e66077, doi:10.1371/journal.pone.0066077 (2013). 260 Lu, Y. et al. Two pore channel 2 (TPC2) inhibits autophagosomal-lysosomal fusion by alkalinizing lysosomal pH. The Journal of biological chemistry 288, 24247-24263, doi:10.1074/jbc.M113.484253 (2013). 261 Calcraft, P. J. et al. NAADP mobilizes calcium from acidic organelles through two-pore channels. Nature 459, 596-600, doi:10.1038/nature08030 (2009). 262 Wang, X. et al. TPC proteins are phosphoinositide- activated sodium-selective ion channels in endosomes and lysosomes. Cell 151, 372-383, doi:10.1016/j.cell.2012.08.036 (2012). 263 Brailoiu, E. et al. Messenger-specific role for nicotinic acid adenine dinucleotide phosphate in neuronal differentiation. The Journal of biological chemistry 281, 15923- 15928, doi:10.1074/jbc.M602249200 (2006). 264 Zong, X. et al. The two-pore channel TPCN2 mediates NAADP-dependent Ca(2+)- release from lysosomal stores. Pflugers Archiv : European journal of physiology 458, 891-899, doi:10.1007/s00424-009-0690-y (2009). 265 Pereira, G. J. et al. Nicotinic acid adenine dinucleotide phosphate (NAADP) regulates autophagy in cultured astrocytes. The Journal of biological chemistry 286, 27875-27881, doi:10.1074/jbc.C110.216580 (2011). 266 Cang, C. et al. mTOR regulates lysosomal ATP-sensitive two-pore Na(+) channels to adapt to metabolic state. Cell 152, 778-790, doi:10.1016/j.cell.2013.01.023 (2013). 267 Samways, D. S., Li, Z. & Egan, T. M. Principles and properties of ion flow in P2X receptors. Frontiers in cellular neuroscience 8, 6, doi:10.3389/fncel.2014.00006 (2014). 268 Johnson, J. D., Kuang, S., Misler, S. & Polonsky, K. S. Ryanodine receptors in human pancreatic beta cells: localization and effects on insulin secretion. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 18, 878-880, doi:10.1096/fj.03-1280fje (2004). 269 Rutter, G. A., Tsuboi, T. & Ravier, M. A. Ca2+ microdomains and the control of insulin secretion. Cell calcium 40, 539-551, doi:10.1016/j.ceca.2006.08.015 (2006). 270 Gilon, P., Chae, H. Y., Rutter, G. A. & Ravier, M. A. Calcium signaling in pancreatic beta-cells in health and in Type 2 diabetes. Cell calcium, doi:10.1016/j.ceca.2014.09.001 (2014). 271 Gwiazda, K. S., Yang, T. L., Lin, Y. & Johnson, J. D. Effects of palmitate on ER and cytosolic Ca2+ homeostasis in beta-cells. American journal of physiology. Endocrinology and metabolism 296, E690-701, doi:10.1152/ajpendo.90525.2008 (2009). 272 LeFurgey, A. & Ingram, P. Calcium measurements with electron probe X-ray and electron energy loss analysis. Environmental health perspectives 84, 57-73 (1990). 273 Mank, M. & Griesbeck, O. Genetically encoded calcium indicators. Chemical reviews 108, 1550-1564, doi:10.1021/cr078213v (2008). 128

274 Lindenburg, L. & Merkx, M. Colorful calcium sensors. Chembiochem : a European journal of chemical biology 13, 349-351, doi:10.1002/cbic.201100739 (2012). 275 Brownlee, C. Cellular calcium imaging: so, what's new? Trends in cell biology 10, 451- 457 (2000). 276 Shimomura, O. & Johnson, F. H. Calcium binding, quantum yield, and emitting molecule in aequorin bioluminescence. Nature 227, 1356-1357 (1970). 277 Yu, W. et al. Calmodulin overexpression causes Ca(2+)-dependent apoptosis of pancreatic beta cells, which can be prevented by inhibition of nitric oxide synthase. Laboratory investigation; a journal of technical methods and pathology 82, 1229-1239 (2002). 278 Nakai, J., Ohkura, M. & Imoto, K. A high signal-to-noise Ca(2+) probe composed of a single green fluorescent protein. Nature biotechnology 19, 137-141, doi:10.1038/84397 (2001). 279 Posner, B. I., Kahn, M. N. & Bergeron, J. J. Internalization of insulin: structures involved and significance. Adv Exp Med Biol 189, 159-173 (1985). 280 Uhles, S., Moede, T., Leibiger, B., Berggren, P.-O. & Leibiger, I. B. Selective gene activation by spatial segregation of insulin receptor B signaling. Faseb J 21, 1609-1621 (2007). 281 Fagerholm, S., Ortegren, U., Karlsson, M., Ruishalme, I. & Str√•lfors, P. Rapid insulin- dependent endocytosis of the insulin receptor by caveolae in primary adipocytes. PLoS ONE 4, e5985 (2009). 282 Kabayama, K. et al. Dissociation of the insulin receptor and caveolin-1 complex by ganglioside GM3 in the state of insulin resistance. Proc Natl Acad Sci U S A 104, 13678- 13683 (2007). 283 Uhles, S., Moede, T., Leibiger, B., Berggren, P.-O. & Leibiger, I. B. Isoform-specific insulin receptor signaling involves different plasma membrane domains. J Cell Biol 163, 1327-1337 (2003). 284 Gerdes, J. M. et al. Ciliary dysfunction impairs beta-cell insulin secretion and promotes development of type 2 diabetes in rodents. Nature communications 5, 5308, doi:10.1038/ncomms6308 (2014). 285 Nelson, J. D., LeBoeuf, R. C. & Bomsztyk, K. Direct recruitment of insulin receptor and ERK signaling cascade to insulin-inducible gene loci. Diabetes 60, 127-137, doi:10.2337/db09-1806 (2011). 286 Saltiel, A. R. & Pessin, J. E. Insulin signaling in microdomains of the plasma membrane. Traffic 4, 711-716 (2003). 287 McClain, D. A. Mechanism and role of insulin receptor endocytosis. Am J Med Sci 304, 192-201 (1992). 288 Posner, B. I. & Bergeron, J. J. Assessment of internalization and endosomal signaling: studies with insulin and EGF. Methods in enzymology 535, 293-307, doi:10.1016/B978- 0-12-397925-4.00017-1 (2014). 289 Leibiger, I. B., Brismar, K. & Berggren, P.-O. Novel aspects on pancreatic beta-cell signal-transduction. Biochem Biophys Res Commun 396, 111-115 (2010). 290 Merzlyak, E. M. et al. Bright monomeric red fluorescent protein with an extended fluorescence lifetime. Nat Methods 4, 555-557 (2007).

129

291 Subach, O. M. et al. Conversion of red fluorescent protein into a bright blue probe. Chem Biol 15, 1116-1124 (2008). 292 Razani, B. et al. Caveolin-1-deficient mice are lean, resistant to diet-induced obesity, and show hypertriglyceridemia with adipocyte abnormalities. J Biol Chem 277, 8635-8647 (2002). 293 Trajkovski, M. et al. MicroRNAs 103 and 107 regulate insulin sensitivity. Nature 474, 649-653 (2011). 294 Alejandro, E. U. et al. Acute insulin signaling in pancreatic beta-cells is mediated by multiple Raf-1 dependent pathways. Endocrinology 151, 502-512, doi:en.2009-0678 [pii] 10.1210/en.2009-0678 (2010). 295 Bickel, P. E. et al. Flotillin and epidermal surface antigen define a new family of caveolae-associated integral membrane proteins. The Journal of biological chemistry 272, 13793-13802 (1997). 296 Baumann, C. A. et al. CAP defines a second signalling pathway required for insulin- stimulated glucose transport. Nature 407, 202-207, doi:10.1038/35025089 (2000). 297 Liu, J., Deyoung, S. M., Zhang, M., Dold, L. H. & Saltiel, A. R. The stomatin/prohibitin/flotillin/HflK/C domain of flotillin-1 contains distinct sequences that direct plasma membrane localization and protein interactions in 3T3-L1 adipocytes. J Biol Chem 280, 16125-16134 (2005). 298 Mundy, D. I., Li, W. P., Luby-Phelps, K. & Anderson, R. G. Caveolin targeting to late endosome/lysosomal membranes is induced by perturbations of lysosomal pH and cholesterol content. Mol. Biol. Cell 23, 864-880 (2012). 299 Baens, M. et al. The dark side of EGFP: defective polyubiquitination. PLoS ONE 1, e54 (2006). 300 Ketelaar, T., Anthony, R. G. & Hussey, P. J. Green fluorescent protein-mTalin causes defects in actin organization and cell expansion in Arabidopsis and inhibits actin depolymerizing factor's actin depolymerizing activity in vitro. Plant Physiol 136, 3990- 3998 (2004). 301 Matthews, L. C., Taggart, M. J. & Westwood, M. Modulation of caveolin-1 expression can affect signalling through the phosphatidylinositol 3-kinase/Akt pathway and cellular proliferation in response to insulin-like growth factor I. Endocrinology 149, 5199-5208, doi:10.1210/en.2007-1211 (2008). 302 Baehler, P. J., Biondi, R. M., van Bemmelen, M., Veron, M. & Reymond, C. D. Random insertion of green fluorescent protein into the regulatory subunit of cyclic adenosine monophosphate-dependent protein kinase. Methods Mol Biol 183, 57-68 (2002). 303 Rocheleau, J. V., Edidin, M. & Piston, D. W. Intrasequence GFP in class I MHC molecules, a rigid probe for fluorescence anisotropy measurements of the membrane environment. Biophys J 84, 4078-4086 (2003). 304 Wen, D. et al. Bulk-like endocytosis plays an important role in the recycling of insulin granules in pancreatic beta cells. Protein Cell 3, 618-626 (2012). 305 Goetz, J. G., Lajoie, P., Wiseman, S. M. & Nabi, I. R. Caveolin-1 in tumor progression: the good, the bad and the ugly. Cancer metastasis reviews 27, 715-735, doi:10.1007/s10555-008-9160-9 (2008). 306 Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682 (2012). 130

307 Thevenaz, P., Ruttimann, U. E. & Unser, M. A pyramid approach to subpixel registration based on intensity. IEEE transactions on image processing : a publication of the IEEE Signal Processing Society 7, 27-41, doi:10.1109/83.650848 (1998). 308 Sternberg, S. R. Biomedical Image-Processing. Computer 16, 22-34 (1983). 309 Bolte, S. & Cordelieres, F. P. A guided tour into subcellular colocalization analysis in light microscopy. Journal of microscopy 224, 213-232, doi:10.1111/j.1365- 2818.2006.01706.x (2006). 310 Lamprecht, M. R., Sabatini, D. M. & Carpenter, A. E. CellProfiler: free, versatile software for automated biological image analysis. BioTechniques 42, 71-75 (2007). 311 Alejandro, E. U. et al. Pancreatic beta-cell Raf-1 is required for glucose tolerance, insulin secretion, and insulin 2 transcription. Faseb J 25, 3884-3895, doi:10.1096/fj.10-180349 (2011). 312 Kimura, A., Mora, S., Shigematsu, S., Pessin, J. E. & Saltiel, A. R. The insulin receptor catalyzes the tyrosine phosphorylation of caveolin-1. J Biol Chem 277, 30153-30158 (2002). 313 Johnson, J. D. & Alejandro, E. U. Control of pancreatic beta-cell fate by insulin signaling: The sweet spot hypothesis. Cell Cycle 7, 1343-1347 (2008). 314 Mehran, A. E. et al. Hyperinsulinemia drives diet-induced obesity independently of brain insulin production. Cell Metab 16, 723-737, doi:10.1016/j.cmet.2012.10.019 (2012). 315 Gunton, J. E. et al. Loss of ARNT/HIF1beta Mediates Altered Gene Expression and Pancreatic-Islet Dysfunction in Human Type 2 Diabetes. Cell 122, 337-349 (2005). 316 Folli, F. et al. Altered insulin receptor signalling and beta-cell cycle dynamics in type 2 diabetes mellitus. PLoS ONE 6, e28050, doi:10.1371/journal.pone.0028050 (2011). 317 Zhao, J. et al. Increased beta-cell apoptosis and impaired insulin signaling pathway contributes to the onset of diabetes in OLETF rats. Cell Physiol Biochem 21, 445-454, doi:10.1159/000129637 (2008). 318 Wang, M., Li, J., Lim, G. E. & Johnson, J. D. Is dynamic autocrine insulin signaling possible? A mathematical model predicts picomolar concentrations of extracellular monomeric insulin within human pancreatic islets. PLoS ONE in press (2013). 319 Gao, X. et al. PI3K/Akt signaling requires spatial compartmentalization in plasma membrane microdomains. Proc Natl Acad Sci U S A 108, 14509-14514 (2011). 320 Wang, P. Y., Weng, J. & Anderson, R. G. OSBP is a cholesterol-regulated scaffolding protein in control of ERK 1/2 activation. Science 307, 1472-1476 (2005). 321 Lidke, D. S. et al. ERK nuclear translocation is dimerization-independent but controlled by the rate of phosphorylation. J Biol Chem 285, 3092-3102 (2010). 322 Abe, K., Hisatomi, R. & Misawa, M. Amyloid beta peptide specifically promotes phosphorylation and nuclear translocation of the extracellular signal-regulated kinase in cultured rat cortical astrocytes. J Pharmacol Sci 93, 272-278 (2003). 323 Gustavsson, J. et al. Localization of the insulin receptor in caveolae of adipocyte plasma membrane. Faseb J 13, 1961-1971 (1999). 324 Oh, Y. S. et al. Regulation of insulin response in skeletal muscle cell by caveolin status. J Cell Biochem 99, 747-758 (2006). 325 Gomez-Ruiz, A., de Miguel, C., Campion, J., Martinez, J. A. & Milagro, F. I. Time- dependent regulation of muscle caveolin activation and insulin signalling in response to high-fat diet. FEBS Lett 583, 3259-3264 (2009). 131

326 Oh, Y. S. et al. A potential role for skeletal muscle caveolin-1 as an insulin sensitivity modulator in ageing-dependent non-obese type 2 diabetes: studies in a new mouse model. Diabetologia 51, 1025-1034 (2008). 327 Wang, H., Wang, A. X. & Barrett, E. J. Caveolin-1 is required for vascular endothelial insulin uptake. American journal of physiology Endocrinology and metabolism 300, E134-144 (2011). 328 Chaudhary, N. et al. Endocytic Crosstalk: Cavins, Caveolins, and Caveolae Regulate Clathrin-Independent Endocytosis. PLoS biology 12, e1001832 (2014). 329 Le, P. U., Guay, G., Altschuler, Y. & Nabi, I. R. Caveolin-1 is a negative regulator of caveolae-mediated endocytosis to the endoplasmic reticulum. J. Biol. Chem. 277, 3371- 3379 (2002). 330 Cheng, Z.-J. et al. Co-regulation of Caveolar and Cdc42-dependent Fluid Phase Endocytosis by Phosphocaveolin-1. J. Biol. Chem. 285, 15119-15125, doi:10.1074/jbc.M109.069427 (2010). 331 del Pozo, M. A. et al. Phospho-caveolin-1 mediates integrin-regulated membrane domain internalization. Nature cell biology 7, 901-908, doi:10.1038/ncb1293 (2005). 332 Drab, M. et al. Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science 293, 2449-2452, doi:10.1126/science.1062688 (2001). 333 Clapham, D. E. Calcium signaling. Cell 131, 1047-1058 (2007). 334 Johnson, J. D., Bround, M. J., White, S. A. & Luciani, D. S. Nanospaces between endoplasmic reticulum and mitochondria as control centres of pancreatic beta-cell metabolism and survival. Protoplasma 249 Suppl 1, S49-58, doi:10.1007/s00709-011- 0349-3 (2012). 335 Lindenburg, L. & Merkx, M. Colorful calcium sensors. ChemBioChem 13, 349-351 (2012). 336 Demaurex, N. & Frieden, M. Measurements of the free luminal ER Ca(2+) concentration with targeted "cameleon" fluorescent proteins. Cell Calcium 34, 109-119 (2003). 337 Luciani, D. S. et al. Roles of IP3R and RyR Ca2+ channels in endoplasmic reticulum stress and beta-cell death. Diabetes 58, 422-432, doi:10.2337/db07-1762 (2009). 338 Pizzo, P., Lissandron, V., Capitanio, P. & Pozzan, T. Ca(2+) signalling in the Golgi apparatus. Cell Calcium 50, 184-192 (2011). 339 Patel, S. & Muallem, S. Acidic Ca(2+) stores come to the fore. Cell Calcium 50, 109-112 (2011). 340 Platta, H. W. & Stenmark, H. Endocytosis and signaling. Curr Opin Cell Biol 23, 393- 403 (2011). 341 Misler, S., Barnett, D. W., Gillis, K. D. & Pressel, D. M. Electrophysiology of Stimulus- Secretion Coupling in Human Beta-Cells. Diabetes 41, 1221-1228 (1992). 342 Sakurada, M. et al. Relation between glucose-stimulated insulin secretion and intracellular calcium accumulation studied with a superfusion system of a glucose- responsive pancreatic beta-cell line MIN6. Endocrinology 132, 2659-2665 (1993). 343 Johnson, J. D., Kuang, S., Misler, S. & Polonsky, K. S. Ryanodine receptors in human pancreatic beta cells: localization and effects on insulin secretion. Faseb J 18, 878-880 (2004).

132

344 Alam, M. R. et al. Mitochondrial Ca2+ uptake 1 (MICU1) and mitochondrial ca2+ uniporter (MCU) contribute to metabolism-secretion coupling in clonal pancreatic beta- cells. The Journal of biological chemistry 287, 34445-34454, doi:10.1074/jbc.M112.392084 (2012). 345 Akerboom, J. et al. Optimization of a GCaMP calcium indicator for neural activity imaging. J Neurosci 32, 13819-13840 (2012). 346 Zhao, Y. et al. An expanded palette of genetically encoded Ca²+ indicators. Science 333, 1888-1891 (2011). 347 Pryor, P. R. et al. Combinatorial SNARE complexes with VAMP7 or VAMP8 define different late endocytic fusion events. EMBO Rep 5, 590-595 (2004). 348 Advani, R. J. et al. VAMP-7 mediates vesicular transport from endosomes to lysosomes. J Cell Biol 146, 765-776 (1999). 349 Martinez-Arca, S. et al. A dual mechanism controlling the localization and function of exocytic v-SNAREs. Proc Natl Acad Sci U S A 100, 9011-9016 (2003). 350 Martinez-Arca, S., Alberts, P., Zahraoui, A., Louvard, D. & Galli, T. Role of tetanus neurotoxin insensitive vesicle-associated membrane protein (TI-VAMP) in vesicular transport mediating neurite outgrowth. J Cell Biol 149, 889-900 (2000). 351 Huotari, J. & Helenius, A. Endosome maturation. Embo J 30, 3481-3500 (2011). 352 Violot, S., Carpentier, P., Blanchoin, L. & Bourgeois, D. Reverse pH-dependence of chromophore protonation explains the large Stokes shift of the red fluorescent protein mKeima. J Am Chem Soc 131, 10356-10357 (2009). 353 Piatkevich, K. D. et al. Monomeric red fluorescent proteins with a large Stokes shift. Proc Natl Acad Sci U S A 107, 5369-5374 (2010). 354 Albrecht, T., Zhao, Y., Nguyen, T. H., Campbell, R. E. & Johnson, J. D. Fluorescent biosensors illuminate calcium levels within defined beta-cell endosome subpopulations. Cell calcium 57, 263-274, doi:10.1016/j.ceca.2015.01.008 (2015). 355 Kamiya, M. & Johnsson, K. Localizable and highly sensitive calcium indicator based on a BODIPY fluorophore. Anal Chem 82, 6472-6479 (2010). 356 Dror, V. et al. Glucose and endoplasmic reticulum calcium channels regulate HIF-1beta via presenilin in pancreatic beta-cells. J Biol Chem 283, 9909-9916, doi:10.1074/jbc.M710601200 (2008). 357 Johnson, J. D. & Misler, S. Nicotinic acid-adenine dinucleotide phosphate-sensitive calcium stores initiate insulin signaling in human beta cells. Proc Natl Acad Sci U S A 99, 14566-14571 (2002). 358 Rorsman, P., Braun, M. & Zhang, Q. Regulation of calcium in pancreatic alpha- and beta-cells in health and disease. Cell Calcium 51, 300-308 (2012). 359 Johnson, J. D. & Luciani, D. S. Mechanisms of pancreatic beta-cell apoptosis in diabetes and its therapies. Adv Exp Med Biol 654, 447-462, doi:10.1007/978-90-481-3271-3_19 (2010). 360 Dean, P. M. Ultrastructural morphometry of the pancreatic -cell. Diabetologia 9, 115-119 (1973). 361 Marbet, P., Rahner, C., Stieger, B. & Landmann, L. Quantitative microscopy reveals 3D organization and kinetics of endocytosis in rat hepatocytes. Microsc Res Tech 69, 693- 707 (2006).

133

362 Griffiths, G., Back, R. & Marsh, M. A quantitative analysis of the endocytic pathway in baby hamster kidney cells. J Cell Biol 109, 2703-2720 (1989). 363 Calcraft, P. J. et al. NAADP mobilizes calcium from acidic organelles through two-pore channels. Nature 459, 596-600 (2009). 364 Hay, J. C. Calcium: a fundamental regulator of intracellular membrane fusion? EMBO Rep 8, 236-240 (2007). 365 Carpenter, A. E. et al. CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol 7, R100 (2006). 366 Brazer, S. C., Singh, B. B., Liu, X., Swaim, W. & Ambudkar, I. S. Caveolin-1 contributes to assembly of store-operated Ca2+ influx channels by regulating plasma membrane localization of TRPC1. The Journal of biological chemistry 278, 27208-27215, doi:10.1074/jbc.M301118200 (2003). 367 Murata, T. et al. Genetic evidence supporting caveolae microdomain regulation of calcium entry in endothelial cells. The Journal of biological chemistry 282, 16631-16643, doi:10.1074/jbc.M607948200 (2007). 368 Isshiki, M. et al. Endothelial Ca2+ waves preferentially originate at specific loci in caveolin-rich cell edges. Proceedings of the National Academy of Sciences of the United States of America 95, 5009-5014 (1998). 369 Isshiki, M., Nishimoto, M., Mizuno, R. & Fujita, T. FRET-based sensor analysis reveals caveolae are spatially distinct Ca2+ stores in endothelial cells. Cell calcium 54, 395-403, doi:10.1016/j.ceca.2013.09.002 (2013). 370 Guerrero-Hernandez, A., Gallegos-Gomez, M. L., Sanchez-Vazquez, V. H. & Lopez- Mendez, M. C. Acidic intracellular Ca(2+) stores and caveolae in Ca(2+) signaling and diabetes. Cell calcium 56, 323-331, doi:10.1016/j.ceca.2014.08.005 (2014).

134

Appendix

Appendix A Plasmid maps and sequences

A.1 pcDNA-3.1-(-)-InsRA-TagRFP

913 3735 4473 5778 ApaI BsiWI AgeI HindIII 10210 bp

InsR-A-PartI TagRFP InsR-PartII

>InsRA-TagRFP ORF sequence ATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAG AGGTGTGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGGACACTTGCAGATACTCTTGAT GTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCGAG AGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTTTAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGG AACTCGGCCTCTACAACCTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACTTGGCCACTATCGACTGGTCCCG TATCCTGGATTCCGTGGAGGATAATCACATCGTGTTGAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACC AACTGCCCCGCCACCGTCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCATAGTCACTGCCAGAAAGTTTGCCCGACCATCTGTAAGTCACACG GCTGCACCGCCGAAGGCCTCTGTTGCCACAGCGAGTGCCTGGGCAACTGTTCTCAGCCCGACGACCCCACCAAGTGCGTGGCCTGCCGCAACTTCTA CCTGGACGGCAGGTGTGTGGAGACCTGCCCGCCCCCGTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGACCTGCACCAC AAATGCAAGAACTCGCGGAGGCAGGGCTGCCACCAATACGTCATTCACAACAACAAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCA GCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGA GCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATT GAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGG AAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCACCACTCAGGGGAAACT CTTCTTCCACTATAACCCCAAACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACATTGCC CTGAAGACCAATGGGGACAAGGCATCCTGTGAAAATGAGTTACTTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGC CGTACTGGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGCCCCTTATCAGAATGTGACGGAGTTCGATGGGCAGGATGC GTGTGGTTCCAACAGTTGGACGGTGGTAGACATTGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAACCACCCAGGGTGGCTGATGCGGGGT CTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAGACCCTGGTCACCTTTTCGGATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTATG TCCAGACAGATGCCACCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCATCATCCCAGATTATTCTGAAGTGGAAACCACCCTCCGA CCCCAATGGCAACATCACCCACTACCTGGTTTTCTGGGAGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGCCTCAAAGGGCTGAAG CTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAACCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCT GTCCAAAGACAGACTCTCAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGCACAACGTGGTTTTCGTCCCCAG GCCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCACGGTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTG CCCACGAGTCCGGAGGAGCACAGGCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACACTTCACGGGCTATCGCATCG AGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTGTGGCAGCCTACGTCAGTGCGAGGACCATGCCTGAAGCCAAGGCTGATGACAT TGTTGGCCCTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAGGAGCCCAATGGTCTGATCGTGCTGTATGAA GTGAGTTATCGGCGATATGGTGATGAGGAGCTGCATCTCTGCGTCTCCCGCAAGCACTTCGCTCTGGAACGGGGCTGCAGGCTGCGTGGGCTGTCAC CGGGGAACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGCTCTTGGACGGAACCCACCTATTTCTACGTGACAGACTATTTAGACGT CCGTACGATCGAATTCCCCGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCAC TTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCG ACATCCTGGCTACCAGCTTCATGTACGGCAGCAGAACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTT CACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAG ATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCAACACCGAGATGCTGTACCCCGCTGACGGCG GCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTCAAGACCACATACAGATCCAAGAAACCCGCTAA GAACCTCAAGATGCCCGGCGTCTACTATGTGGACCACAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGGTGGCT GTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTCCGGATCAGATACCGGTCCGTCAAATATTGCAAAAATTATCATCGGCC CCCTCATCTTTGTCTTTCTCTTCAGTGTTGTGATTGGAAGTATTTATCTATTCCTGAGAAAGAGGCAGCCAGATGGGCCGCTGGGACCGCTTTACGC TTCTTCAAACCCTGAGTATCTCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCGGACGAGTGGGAGGTGTCTCGAGAGAAGATCACCCTC CTTCGAGAGCTGGGGCAGGGCTCCTTCGGCATGGTGTATGAGGGCAATGCCAGGGACATCATCAAGGGTGAGGCAGAGACCCGCGTGGCGGTGAAGA CGGTCAACGAGTCAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAGGCCTCGGTCATGAAGGGCTTCACCTGCCATCACGTGGTGCGCCTCCT GGGAGTGGTGTCCAAGGGCCAGCCCACGCTGGTGGTGATGGAGCTGATGGCTCACGGAGACCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCT GAGAATAATCCTGGCCGCCCTCCCCCTACCCTTCAAGAGATGATTCAGATGGCGGCAGAGATTGCTGACGGGATGGCCTACCTGAACGCCAAGAAGT TTGTGCATCGGGACCTGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAAAATTGGAGACTTTGGAATGACCAGAGACATCTATGAAAC GGATTACTACCGGAAAGGGGGCAAGGGTCTGCTCCCTGTACGGTGGATGGCACCGGAGTCCCTGAAGGATGGGGTCTTCACCACTTCTTCTGACATG TGGTCCTTTGGCGTGGTCCTTTGGGAAATCACCAGCTTGGCAGAACAGCCTTACCAAGGCCTGTCTAATGAACAGGTGTTGAAATTTGTCATGGATG GAGGGTATCTGGATCAACCCGACAACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGTGCTGGCAATTCAACCCCAAGATGAGGCCAACCTTCCT GGAGATTGTCAACCTGCTCAAGGACGACCTGCACCCCAGCTTTCCAGAGGTGTCGTTCTTCCACAGCGAGGAGAACAAGGCTCCCGAGAGTGAGGAG CTGGAGATGGAGTTTGAGGACATGGAGAATGTGCCCCTGGACCGTTCCTCGCACTGTCAGAGGGAGGAGGCGGGGGGCCGGGATGGAGGGTCCTCGC TGGGTTTCAAGCGGAGCTACGAGGAACACATCCCTTACACACACATGAACGGAGGCAAGAAAAACGGGCGGATTCTGACCTTGCCTCGGTCCAATCC TTCCTAA 135

A.2 pcDNA-3.1-(-)-InsRB-TagRFP

ApaI BsiWI AgeI HindIII

InsR-B-PartI TagRFP InsR-PartII

913 3771 4509 5814 10246 bp

> InsRB-TagRFP ORF sequence ATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAG AGGTGTGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGGACACTTGCAGATACTCTTGAT GTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCGAG AGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTTTAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGG AACTCGGCCTCTACAACCTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACTTGGCCACTATCGACTGGTCCCG TATCCTGGATTCCGTGGAGGATAATCACATCGTGTTGAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACC AACTGCCCCGCCACCGTCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCATAGTCACTGCCAGAAAGTTTGCCCGACCATCTGTAAGTCACACG GCTGCACCGCCGAAGGCCTCTGTTGCCACAGCGAGTGCCTGGGCAACTGTTCTCAGCCCGACGACCCCACCAAGTGCGTGGCCTGCCGCAACTTCTA CCTGGACGGCAGGTGTGTGGAGACCTGCCCGCCCCCGTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGACCTGCACCAC AAATGCAAGAACTCGCGGAGGCAGGGCTGCCACCAATACGTCATTCACAACAACAAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCA GCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGA GCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATT GAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGG AAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCACCACTCAGGGGAAACT CTTCTTCCACTATAACCCCAAACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACATTGCC CTGAAGACCAATGGGGACAAGGCATCCTGTGAAAATGAGTTACTTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGC CGTACTGGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGCCCCTTATCAGAATGTGACGGAGTTCGATGGGCAGGATGC GTGTGGTTCCAACAGTTGGACGGTGGTAGACATTGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAACCACCCAGGGTGGCTGATGCGGGGT CTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAGACCCTGGTCACCTTTTCGGATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTATG TCCAGACAGATGCCACCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCATCATCCCAGATTATTCTGAAGTGGAAACCACCCTCCGA CCCCAATGGCAACATCACCCACTACCTGGTTTTCTGGGAGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGCCTCAAAGGGCTGAAG CTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAACCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCT GTCCAAAGACAGACTCTCAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGCACAACGTGGTTTTCGTCCCCAG AAAAACCTCTTCAGGCACTGGTGCCGAGGACCCTAGGCCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCACG GTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAGCACAGGCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCA TCTCCGGCTTGCGACACTTCACGGGCTATCGCATCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTGTGGCAGCCTACGTCAG TGCGAGGACCATGCCTGAAGCCAAGGCTGATGACATTGTTGGCCCTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAG CCGAAGGAGCCCAATGGTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGGAGCTGCATCTCTGCGTCTCCCGCAAGCACTTCG CTCTGGAACGGGGCTGCAGGCTGCGTGGGCTGTCACCGGGGAACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGCTCTTGGACGGA ACCCACCTATTTCTACGTGACAGACTATTTAGACGTCCGTACGATCGAATTCCCCGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATG AAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCA AGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAGAACCTTCATCAACCACACCCAGGGCAT CCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACC AGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGG AGGCCAACACCGAGATGCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAA CTTCAAGACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACCACAGACTGGAAAGAATCAAGGAGGCC GACAAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTCCGGATCAGATA CCGGTCCGTCAAATATTGCAAAAATTATCATCGGCCCCCTCATCTTTGTCTTTCTCTTCAGTGTTGTGATTGGAAGTATTTATCTATTCCTGAGAAA GAGGCAGCCAGATGGGCCGCTGGGACCGCTTTACGCTTCTTCAAACCCTGAGTATCTCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCG GACGAGTGGGAGGTGTCTCGAGAGAAGATCACCCTCCTTCGAGAGCTGGGGCAGGGCTCCTTCGGCATGGTGTATGAGGGCAATGCCAGGGACATCA TCAAGGGTGAGGCAGAGACCCGCGTGGCGGTGAAGACGGTCAACGAGTCAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAGGCCTCGGTCAT GAAGGGCTTCACCTGCCATCACGTGGTGCGCCTCCTGGGAGTGGTGTCCAAGGGCCAGCCCACGCTGGTGGTGATGGAGCTGATGGCTCACGGAGAC CTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTGGCCGCCCTCCCCCTACCCTTCAAGAGATGATTCAGATGGCGGCAGAGA TTGCTGACGGGATGGCCTACCTGAACGCCAAGAAGTTTGTGCATCGGGACCTGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAAAAT TGGAGACTTTGGAATGACCAGAGACATCTATGAAACGGATTACTACCGGAAAGGGGGCAAGGGTCTGCTCCCTGTACGGTGGATGGCACCGGAGTCC CTGAAGGATGGGGTCTTCACCACTTCTTCTGACATGTGGTCCTTTGGCGTGGTCCTTTGGGAAATCACCAGCTTGGCAGAACAGCCTTACCAAGGCC TGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGGAGGGTATCTGGATCAACCCGACAACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGTG CTGGCAATTCAACCCCAAGATGAGGCCAACCTTCCTGGAGATTGTCAACCTGCTCAAGGACGACCTGCACCCCAGCTTTCCAGAGGTGTCGTTCTTC CACAGCGAGGAGAACAAGGCTCCCGAGAGTGAGGAGCTGGAGATGGAGTTTGAGGACATGGAGAATGTGCCCCTGGACCGTTCCTCGCACTGTCAGA GGGAGGAGGCGGGGGGCCGGGATGGAGGGTCCTCGCTGGGTTTCAAGCGGAGCTACGAGGAACACATCCCTTACACACACATGAACGGAGGCAAGAA AAACGGGCGGATTCTGACCTTGCCTCGGTCCAATCCTTCCTAA

136

A.3 pcDNA-3.1-(-)-InsRA-TagBFP

ApaI BsiWI AgeI HindIII

InsR-A-PartI TagBFP InsR-PartII

926 3748 4474 5779 10211 bp

> InsRA-TagBFP ORF sequence ATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAG AGGTGTGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGGACACTTGCAGATACTCTTGAT GTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCGAG AGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTTTAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGG AACTCGGCCTCTACAACCTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACTTGGCCACTATCGACTGGTCCCG TATCCTGGATTCCGTGGAGGATAATCACATCGTGTTGAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACC AACTGCCCCGCCACCGTCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCATAGTCACTGCCAGAAAGTTTGCCCGACCATCTGTAAGTCACACG GCTGCACCGCCGAAGGCCTCTGTTGCCACAGCGAGTGCCTGGGCAACTGTTCTCAGCCCGACGACCCCACCAAGTGCGTGGCCTGCCGCAACTTCTA CCTGGACGGCAGGTGTGTGGAGACCTGCCCGCCCCCGTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGACCTGCACCAC AAATGCAAGAACTCGCGGAGGCAGGGCTGCCACCAATACGTCATTCACAACAACAAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCA GCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGA GCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATT GAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGG AAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCACCACTCAGGGGAAACT CTTCTTCCACTATAACCCCAAACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACATTGCC CTGAAGACCAATGGGGACAAGGCATCCTGTGAAAATGAGTTACTTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGC CGTACTGGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGCCCCTTATCAGAATGTGACGGAGTTCGATGGGCAGGATGC GTGTGGTTCCAACAGTTGGACGGTGGTAGACATTGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAACCACCCAGGGTGGCTGATGCGGGGT CTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAGACCCTGGTCACCTTTTCGGATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTATG TCCAGACAGATGCCACCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCATCATCCCAGATTATTCTGAAGTGGAAACCACCCTCCGA CCCCAATGGCAACATCACCCACTACCTGGTTTTCTGGGAGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGCCTCAAAGGGCTGAAG CTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAACCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCT GTCCAAAGACAGACTCTCAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGCACAACGTGGTTTTCGTCCCCAG GCCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCACGGTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTG CCCACGAGTCCGGAGGAGCACAGGCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACACTTCACGGGCTATCGCATCG AGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTGTGGCAGCCTACGTCAGTGCGAGGACCATGCCTGAAGCCAAGGCTGATGACAT TGTTGGCCCTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAGGAGCCCAATGGTCTGATCGTGCTGTATGAA GTGAGTTATCGGCGATATGGTGATGAGGAGCTGCATCTCTGCGTCTCCCGCAAGCACTTCGCTCTGGAACGGGGCTGCAGGCTGCGTGGGCTGTCAC CGGGGAACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGCTCTTGGACGGAACCCACCTATTTCTACGTGACAGACTATTTAGACGT CCGTACGATCGAATTCCCCAGCGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGGACAACCATCACTTCAAGTGCACA TCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTA CTAGCTTCCTCTACGGCAGCAAGACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTCAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAG AGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTG AACTTCACATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTTCACCGAGACGCTGTACCCCGCTGACGGCGGCCTGGAAGGCA GAAACGACATGGCCCTGAAGCTCGTGGGCGGGAGCCATCTGATCGCAAACATCAAGACCACATATAGATCCAAGAAACCCGCTAAGAACCTCAAGAT GCCTGGCGTCTACTATGTGGACTACAGACTGGAAAGAATCAAGGAGGCCAACAACGAGACCTACGTCGAGCAGCACGAGGTGGCAGTGGCCAGATAC TGCGACCTCCCTAGCAAACTGGGGCACAAGCTTAATTCCGGATCAGATACCGGTCCGTCAAATATTGCAAAAATTATCATCGGCCCCCTCATCTTTG TCTTTCTCTTCAGTGTTGTGATTGGAAGTATTTATCTATTCCTGAGAAAGAGGCAGCCAGATGGGCCGCTGGGACCGCTTTACGCTTCTTCAAACCC TGAGTATCTCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCGGACGAGTGGGAGGTGTCTCGAGAGAAGATCACCCTCCTTCGAGAGCTG GGGCAGGGCTCCTTCGGCATGGTGTATGAGGGCAATGCCAGGGACATCATCAAGGGTGAGGCAGAGACCCGCGTGGCGGTGAAGACGGTCAACGAGT CAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAGGCCTCGGTCATGAAGGGCTTCACCTGCCATCACGTGGTGCGCCTCCTGGGAGTGGTGTC CAAGGGCCAGCCCACGCTGGTGGTGATGGAGCTGATGGCTCACGGAGACCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCT GGCCGCCCTCCCCCTACCCTTCAAGAGATGATTCAGATGGCGGCAGAGATTGCTGACGGGATGGCCTACCTGAACGCCAAGAAGTTTGTGCATCGGG ACCTGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAAAATTGGAGACTTTGGAATGACCAGAGACATCTATGAAACGGATTACTACCG GAAAGGGGGCAAGGGTCTGCTCCCTGTACGGTGGATGGCACCGGAGTCCCTGAAGGATGGGGTCTTCACCACTTCTTCTGACATGTGGTCCTTTGGC GTGGTCCTTTGGGAAATCACCAGCTTGGCAGAACAGCCTTACCAAGGCCTGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGGAGGGTATCTGG ATCAACCCGACAACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGTGCTGGCAATTCAACCCCAAGATGAGGCCAACCTTCCTGGAGATTGTCAA CCTGCTCAAGGACGACCTGCACCCCAGCTTTCCAGAGGTGTCGTTCTTCCACAGCGAGGAGAACAAGGCTCCCGAGAGTGAGGAGCTGGAGATGGAG TTTGAGGACATGGAGAATGTGCCCCTGGACCGTTCCTCGCACTGTCAGAGGGAGGAGGCGGGGGGCCGGGATGGAGGGTCCTCGCTGGGTTTCAAGC GGAGCTACGAGGAACACATCCCTTACACACACATGAACGGAGGCAAGAAAAACGGGCGGATTCTGACCTTGCCTCGGTCCAATCCTTCCTAA

137

A.4 pcDNA-3.1-(-)-InsRB-TagBFP

ApaI BsiWI AgeI HindIII

InsR-B-PartI TagBFP InsR-PartII

923 3781 4507 5812 10244 bp

> InsRB-TagBFP ORF sequence ATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAG AGGTGTGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGGACACTTGCAGATACTCTTGAT GTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCGAG AGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTTTAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGG AACTCGGCCTCTACAACCTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACTTGGCCACTATCGACTGGTCCCG TATCCTGGATTCCGTGGAGGATAATCACATCGTGTTGAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACC AACTGCCCCGCCACCGTCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCATAGTCACTGCCAGAAAGTTTGCCCGACCATCTGTAAGTCACACG GCTGCACCGCCGAAGGCCTCTGTTGCCACAGCGAGTGCCTGGGCAACTGTTCTCAGCCCGACGACCCCACCAAGTGCGTGGCCTGCCGCAACTTCTA CCTGGACGGCAGGTGTGTGGAGACCTGCCCGCCCCCGTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGACCTGCACCAC AAATGCAAGAACTCGCGGAGGCAGGGCTGCCACCAATACGTCATTCACAACAACAAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCA GCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGA GCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATT GAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGG AAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCACCACTCAGGGGAAACT CTTCTTCCACTATAACCCCAAACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACATTGCC CTGAAGACCAATGGGGACAAGGCATCCTGTGAAAATGAGTTACTTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGC CGTACTGGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGCCCCTTATCAGAATGTGACGGAGTTCGATGGGCAGGATGC GTGTGGTTCCAACAGTTGGACGGTGGTAGACATTGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAACCACCCAGGGTGGCTGATGCGGGGT CTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAGACCCTGGTCACCTTTTCGGATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTATG TCCAGACAGATGCCACCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCATCATCCCAGATTATTCTGAAGTGGAAACCACCCTCCGA CCCCAATGGCAACATCACCCACTACCTGGTTTTCTGGGAGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGCCTCAAAGGGCTGAAG CTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAACCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCT GTCCAAAGACAGACTCTCAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGCACAACGTGGTTTTCGTCCCCAG AAAAACCTCTTCAGGCACTGGTGCCGAGGACCCTAGGCCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCACG GTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAGCACAGGCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCA TCTCCGGCTTGCGACACTTCACGGGCTATCGCATCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTGTGGCAGCCTACGTCAG TGCGAGGACCATGCCTGAAGCCAAGGCTGATGACATTGTTGGCCCTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAG CCGAAGGAGCCCAATGGTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGGAGCTGCATCTCTGCGTCTCCCGCAAGCACTTCG CTCTGGAACGGGGCTGCAGGCTGCGTGGGCTGTCACCGGGGAACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGCTCTTGGACGGA ACCCACCTATTTCTACGTGACAGACTATTTAGACGTCCGTACGATCGAATTCCCCAGCGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATG GAGGGCACCGTGGACAACCATCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGTGGTCGAGG GCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACTAGCTTCCTCTACGGCAGCAAGACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTT CAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGAC GGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCACATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTTCACCG AGACGCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAACGACATGGCCCTGAAGCTCGTGGGCGGGAGCCATCTGATCGCAAACATCAAGACCAC ATATAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCTGGCGTCTACTATGTGGACTACAGACTGGAAAGAATCAAGGAGGCCAACAACGAGACC TACGTCGAGCAGCACGAGGTGGCAGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAGCTTAATTCCGGATCAGATACCGGTCCGTCAA ATATTGCAAAAATTATCATCGGCCCCCTCATCTTTGTCTTTCTCTTCAGTGTTGTGATTGGAAGTATTTATCTATTCCTGAGAAAGAGGCAGCCAGA TGGGCCGCTGGGACCGCTTTACGCTTCTTCAAACCCTGAGTATCTCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCGGACGAGTGGGAG GTGTCTCGAGAGAAGATCACCCTCCTTCGAGAGCTGGGGCAGGGCTCCTTCGGCATGGTGTATGAGGGCAATGCCAGGGACATCATCAAGGGTGAGG CAGAGACCCGCGTGGCGGTGAAGACGGTCAACGAGTCAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAGGCCTCGGTCATGAAGGGCTTCAC CTGCCATCACGTGGTGCGCCTCCTGGGAGTGGTGTCCAAGGGCCAGCCCACGCTGGTGGTGATGGAGCTGATGGCTCACGGAGACCTGAAGAGCTAC CTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTGGCCGCCCTCCCCCTACCCTTCAAGAGATGATTCAGATGGCGGCAGAGATTGCTGACGGGA TGGCCTACCTGAACGCCAAGAAGTTTGTGCATCGGGACCTGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAAAATTGGAGACTTTGG AATGACCAGAGACATCTATGAAACGGATTACTACCGGAAAGGGGGCAAGGGTCTGCTCCCTGTACGGTGGATGGCACCGGAGTCCCTGAAGGATGGG GTCTTCACCACTTCTTCTGACATGTGGTCCTTTGGCGTGGTCCTTTGGGAAATCACCAGCTTGGCAGAACAGCCTTACCAAGGCCTGTCTAATGAAC AGGTGTTGAAATTTGTCATGGATGGAGGGTATCTGGATCAACCCGACAACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGTGCTGGCAATTCAA CCCCAAGATGAGGCCAACCTTCCTGGAGATTGTCAACCTGCTCAAGGACGACCTGCACCCCAGCTTTCCAGAGGTGTCGTTCTTCCACAGCGAGGAG AACAAGGCTCCCGAGAGTGAGGAGCTGGAGATGGAGTTTGAGGACATGGAGAATGTGCCCCTGGACCGTTCCTCGCACTGTCAGAGGGAGGAGGCGG GGGGCCGGGATGGAGGGTCCTCGCTGGGTTTCAAGCGGAGCTACGAGGAACACATCCCTTACACACACATGAACGGAGGCAAGAAAAACGGGCGGAT TCTGACCTTGCCTCGGTCCAATCCTTCCTAA 138

A.5 pcDNA-3.1-(-)-TiVAMP-GEM-GECO1

ApaI NotI EcoRI Hind III

TiVAMP GEM-GECO1

1582 1609 913 7444 bp 3012

> TiVAMP-GEM-GECO1 ORF sequence ATGGCGATTCTTTTTGCTGTTGTTGCCAGGGGGACCACTATCCTTGCCAAACATGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTC TGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACATGGCAATTATTTGTTTCATTACATCTGCCAAGACAGGATTGTATATCTTTGTAT CACTGATGATGATTTTGAACGTTCCCGAGCCTTTAATTTTCTGAATGAGATAAAGAAGAGGTTCCAGACTACTTACGGTTCAAGAGCACAGACAGCA CTTCCATATGCCATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTC AAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACAGA AAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCCATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATC ATCGTATCAATTGTGTTCATCTATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGCTGTGTGAAGAAAGCGGCCGCCACTGTGCTGG ATATCTGCAGAATTCTAACGCCGCGACGTGCGACTGCGGCGCAAGCGGCGACTGACGCTTCTAGAGGTTCTCATCATCATCATCATCATGGTATGGC TAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGATGATAAGGATCTCGCCACAATGGTCGACTCATCACGTCGTAAGTGGAAT AAGACAGGTCACGCAGTCAGAGCTATAGGTCGGCTGAGCTCACCAGAGAACGTGTATATCAAGGCCGACGAGCAGAAGAACGGCATCAAGGCGTACT TCAAGATCCGCCACAACATCGAGGGCGGCGGCGTGCAGCTCGCCTACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGA CAACCACTACCTGAGCGTGCAGTCCATACTTTCGAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATC ACTCTCGGCATGGACGAGCTGTACAAGGGTGGCAGCGGTGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCAGGTCGAGC TGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGTGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCAC CGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGTCCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGAC TTCTTCAAGTCCGCCATGCCCGAAGGCTACATCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCG AGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAGCACGCGTGA CCAACTGACTGAAGAGCAGATCGCAGAATTTAAAGAGGCTTTCTCCCTATTTGACAAGGACGGGGATGGGACGATAACAACCAAGGAGCTGGGGACG GTGATGCGGTCTCTGGGGCAGAACCCCACAGAAGCAGAGCTGCAGGACATGATCAATGAAGTAGATGCCGACGGTGACGGCACAATCGACTTCCCTG AGTTCCTGACAATGATGGCACCTAAAATGCAGGACACAGACAGTGAAGAAGAAATTAGAGAAGCGTTCCGTGTGTTTGATAAGGACGGCAATGGCTA CATCGGCGCAGCAGAGCTTCGCCACGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAAATGATCAGGGTAGCAGACATCGAT GGGGATGGTCAGGTAAACTACGAAGAGTTTGTACAAATGATGACAGCGAAGTAG

139

A.6 pcDNA-3.1-(-)-TiVAMP-mKeima

ApaI NotI EcoRI Hind III

TiVAMP mKeima

1582 1609 913 6766 bp 2333

> TiVAMP-mKeima ORF sequence ATGGCGATTCTTTTTGCTGTTGTTGCCAGGGGGACCACTATCCTTGCCAAACATGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTC TGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACATGGCAATTATTTGTTTCATTACATCTGCCAAGACAGGATTGTATATCTTTGTAT CACTGATGATGATTTTGAACGTTCCCGAGCCTTTAATTTTCTGAATGAGATAAAGAAGAGGTTCCAGACTACTTACGGTTCAAGAGCACAGACAGCA CTTCCATATGCCATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTC AAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACAGA AAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCCATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATC ATCGTATCAATTGTGTTCATCTATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGCTGTGTGAAGAAAGCGGCCGCCACTGTGCTGG ATATCTGCAGAATTCTAACGCCGCGACGTGCGACTGCGGCGCAAGCGGCGACTGACGCTTCTAGAATGGTGAGTGTGATCGCTAAACAAATGACCTA CAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGAGAGCAGACAGTAAAGCTC ACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACAGCTTCAGTACGGAAGCATACCATTCACCAAGTACCCTGAAGACA TCCCTGATTATTTCAAGCAGTCATTCCCTGAGGGATATACATGGGAGAGGAGCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTC CAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATCTCTGGTGAGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGG GAACCCAGCACTGAGCGTCTCTTTGCACGAGATGGAATGCTGATAGGAAACGATTATATGGCTCTGAAGTTGGAAGGAGGTGGTCACTATTTGTGTG AATTTAAATCTACTTACAAGGCAAAGAAGCCTGTGAGGATGCCAGGGCGCCACGAGATTGACCGCAAACTGGATGTAACCAGTCACAACAGGGATTA CACATCTGTTGAGCAGTGTGAAATAGCCATTGCACGCCACTCTTTGCTCGGTTAG

140