An ERG Enhancer–Based Reporter Identifies Leukemia Cells With

Published OnlineFirst June 7, 2019; DOI: 10.1158/0008-5472.CAN-18-3215

Cancer Molecular Cell Biology Research

An ERG Enhancer–Based Reporter Identiﬁes Leukemia Cells with Elevated Leukemogenic Potential Driven by ERG-USP9X Feed-Forward Regulation Nasma Aqaqe1, Muhammad Yassin1, Abed Alkader Yassin1, Nour Ershaid1, Chen Katz-Even1, Adi Zipin-Roitman1, Eitan Kugler3,4,5, Eric R. Lechman2, Olga I. Gan2, Amanda Mitchell2, John E. Dick2, Shai Izraeli3,4,5, and Michael Milyavsky1

Abstract

Acute leukemia is a rapidly progressing blood cancer with fraction was enriched for leukemia-initiating cells in a low survival rates. Unfavorable prognosis is attributed to xenograft assay. We identified the ubiquitin hydrolase insufficiently characterized subpopulations of leukemia USP9X as a novel ERG transcriptional target that sustains stem cells (LSC) that drive chemoresistance and leukemia ERGþ85–positive cells by controlling ERG ubiquitination. relapse. Here we utilized a genetic reporter that assesses Therapeutic targeting of USP9X led to preferential inhibi- stemness to enrich and functionally characterize LSCs. We tion of the ERG-dependent leukemias. Collectively, these observed heterogeneous activity of the ERGþ85 enhancer– results characterize human leukemia cell functional hetero- based fluorescent reporter in human leukemias. Cells geneity and suggest that targeting ERG via USP9X inhibi- with high reporter activity (tagBFPHigh) exhibited elevated tion may be a potential treatment strategy in patients with expression of stemness and chemoresistance genes and leukemia. demonstrated increased clonogenicity and resistance to chemo- and radiotherapy as compared with their tagBFPNeg Significance: This study couples a novel experimental tool counterparts. The tagBFPHigh fraction was capable of regen- with state-of-the-art approaches to delineate molecular erating the original cellular heterogeneity and demonstrat- mechanisms underlying stem cell-related characteristics in ed increased invasive ability. Moreover, the tagBFPHigh leukemia cells.

Introduction as well as functional variability, exists among the subsets of leukemia cells obtained from the same patient (3, 4). Functional Acute leukemia is a highly aggressive group of blood malig- heterogeneity model posits that a fraction of acute leukemia cells nancies that originate from hematopoietic stem cells (HSC). displays sufficient regenerative capacity to propagate the disease, Accumulation of blast cells in the bone marrow due to deregu- withstand chemotherapy, and cause leukemia relapse. Functional lation of molecular pathways controlling self-renewal and differ- resemblance of these leukemic cells to normal hematopoietic entiation of immature blood cells is the main feature of leuke- stem cells (HSC) contributed to their nomination as leukemia mia (1, 2). Well-recognized and prognostic genetic heterogeneity, stem cells (LSC; refs. 5, 6). Although recent studies have shown that phenotypic and 1Department of Pathology, Sackler Faculty of Medicine, Tel Aviv University, Tel genetic heterogeneity within tumors constitutes a major source Aviv, Israel. 2Princess Margaret Cancer Centre, University Health Network and of therapeutic resistance (7), efficient tools to identify and pull out Department of Molecular Genetics, University of Toronto, Toronto, Ontario, functional stem cell from the heterogeneous cell population are Canada. 3Department of Pediatric Hemato-Oncology, Schneider Children Med- 4 still lacking. Experimentally, the presence of functional human ical Center Petah-Tikva, Israel. The Gene Development and Environment fi Pediatric Research Institute, Pediatric Hemato-Oncology, Edmond and Lily Safra LSCs can be proved by their capacity to engraft immunode cient Children's Hospital, Sheba Medical Center, Tel Hashomer, Ramat Gan, Israel. mice and induce leukemia growth in their hematopoietic 5Department of Molecular Human Genetics and Biochemistry, Sackler Faculty of organs (8, 9). Up to date, enrichment for LSCs has been reached Medicine, Tel Aviv University, Tel Aviv, Israel. by focusing on: cell surface markers (10), metabolism (11, 12), Note: Supplementary data for this article are available at Cancer Research cell-cycle quiescence (13), and miRNA bioactivity (14). These Online (http://cancerres.aacrjournals.org/). studies and others demonstrated extraordinary inter- and even fl N. Aqaqe and M. Yassin contributed equally to this article. intra-sample (3) heterogeneity for LSC activity that was in u- enced by disease stage and type of therapy (10, 15, 16). Further- Corresponding Author: Michael Milyavsky, Tel Aviv University, Sackler Faculty more, prior studies emphasized the need to devise approaches of Medicine, Tel Aviv 6997801, Israel. Phone: 9725-4591-5351; fi E-mail: [email protected] that enable identi cation and isolation of viable human LSCs based on stemness state of the single cell to pinpoint molecular Cancer Res 2019;79:3862–76 regulators that maintain LSC properties. doi: 10.1158/0008-5472.CAN-18-3215 Here, we capitalized on our recent findings that a þ85 2019 American Association for Cancer Research. enhancer of ERG transcription factor (TF) can be used as a

3862 Cancer Res; 79(15) August 1, 2019

An ERGþ85 Enhancer Regulates Leukemia Stemness

probe of cellular stemness state in human normal and leukemic Leukemia xenotransplantation model cells when integrated into a lentiviral reporter system (17). All animal experimental protocols were approved by the Insti- Indeed, we and others demonstrated that the endogenous tutional Animal Care and Use Committee of Tel-Aviv University ERGþ85 enhancer is particularly active in human HSCs and (Tel Aviv, Israel). Jurkat cells were transplanted intrafemorally (IF) asubsetofleukemiasaswellassensitive to the net activity of as described previously (22) into 8- to 10-week-old NOD-scid the multiple TFs, termed heptad, implicated in stemness pro- IL2Rgnull-3/GM/SF (NSG-SGM3) mice, which were injected gram regulation (18–20). intraperitoneally with busulfan (30 mg/kg) 24 hours before Herein, by barcoding leukemia cell lines and patient sample transplantation. Human engraftment in the injected and non- with ERGþ85 reporter, we attempted to enrich and characterize injected bones was analyzed 6–8 weeks posttransplantation by leukemia subpopulations endowed with LSC properties that flow cytometry analysis using human-specific CD45-Alexa Fluor included superior leukemia initiation, invasion, and drug resis- 750–conjugated antibody, EGFP, and tagBFP positivity. The tance. Gene expression analysis of the subpopulations with dif- frequency of repopulating cells was calculated using ELDA soft- ferent levels of ERGþ85 reporter activity uncovered ERG/USP9X ware (23). feed-forward–regulatory relationships that can be targeted therapeutically. DNA constructs and cloning Dual promoter lentiviral reporter vectors (pMIN and pMIN- ERGþ85) were described elsewhere (17). The ERGþ85 fragment Materials and Methods was amplified using Prime GXL high fidelity polymerase Full list of references can be found in the Supplementary Data. (Clontech) from PGL2-ERGþ85 vector (24) and cloned into pMIN upstream of mCMV. Full-length human ERG cDNA was Acute myeloid lymphoma patient samples subcloned instead of EGFP into a bidirectional lentiviral vector The study was approved by the Institutional Review Boards MA1 (25). of Tel Aviv University (Tel Aviv, Israel) and University Health USP9X shRNAs were cloned into pLKO1-puro TRC plasmid Network (Toronto, Ontario, Canada). Written informed con- using EcoRI and AgeI restriction sites. Target sequences for shRNA sent (according to the Declaration of Helsinki) was obtained experiments were CCTAAGGTTAAGTCGCCCTCG (shScramble), from all patients. Acute myeloid lymphoma (AML) samples CCACCTCAAACCAAGGATCAA (shUSP9X#1), CGCCTGATTC- were cultured in StemSpanTM SFEM II medium (StemCell TTCCAATGAAA (shUSP9X #2), and GAGAGTTTATTCACTGTC- Technologies) supplemented with growth factors [IL3 TTA (shUSP9X #3). (10ng/mL),IL6(10ng/mL),G-CSF(10ng/mL),TPO (25 ng/mL), SCF (50 ng/mL), and FLT3L (50 ng/mL)] on Virus preparation and transduction procedure preestablished confluent MS-5 stromal cells. Viral particles were generated by transient transfection of 293T cells using CMVDeltaR8.91 and pMD2G constructs as described Cell lines and drug treatments elsewhere (26). Leukemia cells were infected by addition of viral ELF-153, KASUMI-1, AML193, and ME1 were cultured as supernatant to obtain 10%–30% infection rate. Jurkat cells were recommended by the manufacturer (DSMZ). Jurkat, THP1, and selected with puromycin (3 mg/mL) for 3 days in the USP9X K562 were described elsewhere and grown in RPMI supplemented knockdown experiments. After selection completion, cells were with FBS (10%), L-glutamine (1%), and penicillin/streptomycin replated for the downstream experiments. (1%). TEX cell line was grown as described elsewhere (21). All cell lines were authenticated by short tandem repeat profiling using Quantitative RT-PCR and microarrays PowerPlex16 HS kit (Promega). Cell number and viability was RNA was extracted with the TRIzol reagent (Invitrogen) and estimated using hemocytometer and Trypan blue exclusion assay, reverse transcribed with SuperScript III (Invitrogen). Real-time respectively. For radiation treatment experiments, cells were PCR reactions were prepared with SYBR Green PCR Master Mix exposed to ionizing radiation using Cs-137 source at the (Applied Biosystems) in triplicates and analyzed on Applied dose rate 2.8 Gy/minute using GMBH BioBeam 8000 gamma Biosystems 7900HT instruments. Absolute gene expression was irradiation device (Gamma service). To quantitate clonogenic quantified with SDS software (Applied Biosystems) based on the growth potential of the leukemic cells, we plated Jurkat standard curve method and presented after normalization for cells (500 cells/plate for nontreated and 10,000 cells/plate for GAPDH. List of primers is presented in Supplementary Table S1. irradiated) in MethoCult H4100 (StemCell Technologies) sup- RNA from 100,000 or more sorted cells was used for microarray plemented with FBS (30%, MultiCell), 5637 cells' conditioned analysis by Human Gene Clariom S Assay (Thermo Fisher Scien- medium (10%), L-glutamine (1%), and penicillin/streptomycin tific). Data were processed, normalized, and log2 transformed. (1%), 2-mercaptoethanol (50 mmol/L). Serial replating experi- Microarray raw data are included as Supplementary Data. The data ments were performed by harvesting all the colonies from meth- can be viewed in the following link (https://www.ncbi.nlm.nih. ylcellulose, followed by plating 1,000 cells into new methylcel- gov/geo/query/acc.cgi?acc¼GSE131079). lulose. Colonies were counted under the microscope after 12– 14 days of incubation. All cells were maintained in a humidified Flow cytometry sorting and analysis incubator at 37 C and 5% CO2. All cell lines were tested negative EGFP and tagBFP expression were analyzed using Gallios Flow for Mycoplasma by PCR at least once during the period of this Cytometer and Cytoflex Flow Cytometer (Beckman Coulter, Inc.) study. Ara-C and doxorubicin were purchased from Sigma, For the intracellular ERG protein-level analysis, cells were fixed in WP1130 from Cayman Chemicals, S63845 from Apex, and G9 formaldehyde (1.4%), permeabilized in ethanol (100%), fol- was provided by Dr. N. Donato (University of Michigan, Ann lowed by labeling with anti-ERG rabbit mAb conjugated with PE Arbor, MI). (clone A7L1G, Cell Signaling Technology, 1:50) or rabbit anti-IgG

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3863

Aqaqe et al.

control (sc-2027, Santa Cruz Biotechnology). Jurkat cells were Protein G bead complexes at 4C for 3 hours, followed by bead sorted using BD FACSAria Fusion sorter (BD Biosciences). In ERG wash (four times) with NaCl (100 mmol/L) and IGEPAL CA-630 overexpression experiments, anti-CD271-APC (Miltenyi Biotec, (0.1%). Then, immunoprecipitated complexes were boiled in 1:50) was used for sorting of ERG-transduced Jurkat cells. Laemmli buffer for Western blot analysis. ERG ubiquitination was detected in the above prepared extracts using anti-ubiquitin Apoptosis analysis antibody (Santa Cruz Biotechnology, sc-8017). Apoptosis was measured using Annexin V (Invitrogen) and Zombie NIR Fixable Viability Dye (BioLegend) according to the Survival analysis manufacturer's protocols. Cells were analyzed with Gallios flow Patients from different AML cohorts (41, 42) were used to cytometer (Beckman Coulter). Flow cytometry data were analyzed determine association between USP9X levels (measured by RNA- using Kaluza flow cytometry analysis software (Beckman Coulter). seq RPKM analysis or microarray) and survival [overall survival (OS) and event-free survival]. Survival curves were analyzed Western blotting analysis according to the Kaplan–Meier method and compared using the The following primary antibodies were used: mouse anti- log-rank test. b-actin (clone 8H10D10, Cell Signaling Technology, 1:2,000), rabbit anti-USP9X (gene ID 8239, Bethyl Laboratories, 1:1,000), Chromatin immunoprecipitation sequencing gene-set rabbit anti-ERG (sc-354, polyclonal, Santa Cruz Biotechnology, enrichment analysis 1:2,000), mouse monoclonal anti-ubiquitin (Santa Cruz Biotech- Chromatin immunoprecipitation sequencing (ChIP-seq) nology, sc-8017, 1:1,000), and mouse anti-GAPDH (clone 258, gene-set enrichment analysis was performed using GREAT Invitrogen, 1:2,000). algorithm (43). ChIP-seq datasets used for the enrichment analysis were GSE49091 (44), GSE25000 (45), GSE29181 Migration assay (38), and GSE50625 (46). Costar Transwells (insert diameter 6.5 mm, 5 mm/pore) were coated with 100 mL Matrigel (Corning, 356231), covered with ChIP-seq diagrams medium, and polymerized for 30 minutes at 30C. The bottom ChIP-seq results were extracted from the following studies: þ chamber was filled with 600 mL of MS-5 conditioned medium. CD34 cord blood (GSE23730; ref. 47), SKNO1 (GSE23730; Sorted leukemia cells were allowed to migrate at 37C for ref. 47), Kasumi1 (GSE76464; ref. 48). Wig files were converted 48 hours. The transwells were removed and the cell suspension to bigwig files and processed using UCSC genome browser (49). was analyzed by flow cytometer to determine the cell number and phenotype. Protein–protein analysis Protein–protein interaction analysis was performed using esyN Gene-set enrichment analysis platform (50). Gene-set enrichment analysis (GSEA) was performed using the GSEA Java Desktop tool (v3). Gene expression levels were Gene expression resources for USP9X expression analysis obtained from microarray analysis of three independent replica- USP9X expression in the different stages of hematopoietic hier- tive experiments comparing tagBFPhigh and tagBFPneg cells. archy was extracted from GSE42414 (http://jdstemcellresearch. Expression levels and genes were ranked using the SAM algorithm ca/node/32; ref. 51). USP9X expression for each AML cyto- (27, 28). The GSEA preranked tool was used to interrogate the genetic group in The Cancer Genome Atlas (TCGA) was enrichment of various expression signatures including: HSC's extracted from https://cancergenome.nih.gov/cancersselected/ super enhancer (29), HSC_R (30), Ara-C resistance (31), doxo- acutemyeloidleukemia. USP9X expression in chronic myeloid rubicin resistance (32), activated b-catenin pathway (33), early T- leukemia phases was extracted from GSE4170 (52). USP9X cell development (34), targets of HOXA9 and MEIS1 up/down expression in the different AML cytogenetic-risk clusters was (35), high BAALC AML (36), epithelial-to-mesenchymal transi- extracted from GSE1159 (53). tion (EMT) up (37), and TAL1 bound and negatively/positively correlated (38). Gene-set enrichment analysis for RNA-seq data was performed using GSAASeqSP 2.0 (39). Results Identification and characterization of leukemia cells with Analysis of ERG ubiquitination heterogeneous ERGþ85 reporter activities ERG ubiquitination analysis was performed essentially as To characterize functional heterogeneity among cells in human described elsewhere (40) with slight modifications. Briefly, leukemia, we utilized stem cell enhancer element from ERG TF ELF153 cells were pretreated with MG132 proteasome inhibitor regulatory region (ERGþ85). This element contains binding sites (5 mmol/L) and then treated with WP1130 USP9X inhibitor for numerous stem cell regulators and possesses high activity in (5 mmol/L) for 16 hours. Cells were lysed in lysis buffer [HEPES the most primitive normal hematopoietic cells and in the subset (25 mmol/L, pH 7.5), NaCl (400 mmol/L), IGEPAL CA-630 of human bulk AML and T-ALL (20). On the basis of our findings (0.5%), DTT (1 mmol/L), glycerol (5%) and protease inhibitors]. that ERGþ85 enhancer is particularly active in human HSPCs and The soluble fraction of the lysate was diluted to adjust NaCl and a subset of AMLs, we recently developed a lentiviral fluorescent IGEPAL CA-630 concentrations to 100 mmol/L and 0.125%, reporter in which ERGþ85 enhancer regulates tagBFP expression, respectively, and then precleared with magnetic Dynabeads Pro- while a constitutively active EF1/SV40 promoter drives EGFP tein G for immunoprecipitation (Invitrogen, 10003D). Dyna- cassette (Fig. 1A; ref. 17). Using this tool, we measured ERGþ85 beads were incubated with ERG antibody for 10 minutes at room reporter activation in a wide range of human leukemia lines and temperature and lysates were incubated with ERG antibody- found that its activity positively correlates with the endogenous

3864 Cancer Res; 79(15) August 1, 2019 Cancer Research

An ERGþ85 Enhancer Regulates Leukemia Stemness

ERG protein levels (Supplementary Fig. S1; ref. 17). As ERGþ85 (IR)-induced cell death in the tagBFPHigh cells, which is consistent enhancer can bind numerous high variance TFs implicated in with their relative resistance to this injury. (Fig. 2B; Supplemen- regulation of stem cells in both T- and myeloid leukemogenesis, tary Fig. S2C). To further elaborate these findings, we flow sorted þ þ we hypothesized that this reporter can be a tool to track, charac- EGFP tagBFPHigh cells and EGFP tagBFPNeg cells (Fig. 2C) and terize, and link transcriptional and functional heterogeneity of measured their colony-forming capacity. Analysis showed that leukemia cells. To validate this hypothesis, we selected three individual tagBFPHigh cells had higher clonogenic capacity in leukemia lines (Jurkat, ELF-153, and Kasumi-1) in which we methylcellulose as compared with the tagBFPNeg cells under both discovered a distinct cell population characterized by the elevated normal and irradiation conditions (Fig. 2D). Importantly, treat- tagBFP activity as compared with the same line infected with a ment of the ERGþ85–expressing Jurkat cells with the additional vector lacking ERGþ85 enhancer (pMIN; Fig. 1B). Jurkat cells genotoxic stressor doxorubicin led to a similar increase in the exhibited the lowest activation of the ERGþ85 reporter, while ELF- proportion of tagBFPHigh cells, suggesting an inherent resistance 153 and Kasumi-1 lines had the intermediate and high activities, of this subpopulation to certain DNA-damaging agents (Fig. 2E). respectively, in correlation with their respective ERG levels To validate our findings in primary samples, we infected patient- (Supplementary Fig. S1B). derived AML samples (n ¼ 4) with the ERGþ85 reporter followed Relative chemo- and radioresistance are principal hallmarks of by treatment with Ara-C or doxorubicin, both commonly used cancer stem cells in leukemia (54) and solid tumors (55, 56). antileukemia drugs. Remarkably, we observed an elevated pro- However, the identity and the dynamics of therapy-resistant portion of tagBFPHigh cells among Ara-C and doxorubicin survi- leukemia cells among the bulk malignant cells remain unclear. vors in three of four samples tested (Fig. 2F; Supplementary To test whether cells with heterogeneous ERGþ85 activity differ in Fig. S2D). their response to genotoxic stress, we selected Jurkat leukemia In summary, we developed a tool to identify and characterize cell line with a distinctive tagBFPHigh and tagBFPNeg subpopula- leukemia cells with distinct stress tolerance characteristics. In tions (Fig. 1B). We detected no difference in the expansion rate addition, we defined ERGþ85High cells as "stress-resistant" subset between tagBFPHigh and tagBFPNeg cells during in vitro culturing in a population of leukemia cells. (Supplementary Fig. 2A). However, upon exposure of cells to ionizing radiation, we observed time-dependent enrichment ERGþ85High cells exhibit regenerative and invasive properties in the proportion of the viable tagBFPHigh cells pointing to To characterize the stability of cellular states identified by their relative resistance. (Fig. 2A; Supplementary Fig. S2B). FACS ERGþ85 reporter, we analyzed tagBFP expression dynamics in analysis revealed a diminished induction of the ionizing radiation sorted tagBFPHigh and tagBFPNeg Jurkat and ELF153 cells.

Figure 1. ERGþ85 enhancer–based reporter demonstrates heterogeneous activity among human leukemia lines. A, Diagram of the lentiviral vector with "stemness-related TFs" (colored geometric shapes) interacting with cis elements identiﬁable in ERGþ85 enhancer. B, Jurkat, ELF-153, and Kasumi-1 cell lines were infected with pMIN and pMIN-ERGþ85 vectors. Representative EGFP and tagBFP intensity and distribution in each cell line are shown.

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3865

Aqaqe et al.

Figure 2. Functional characterization of leukemic cells expressing various levels of the ERGþ85 reporter. A, Effect of ionizing radiation exposure (3 Gy) on the relative fraction of tagBFPHigh cells in the bulk Jurkat cells infected with the reporter as assessed by flow cytometry at indicated time points. n ¼ 5 independent irradiation and recovery experiments. B, Ionizing radiation (5 Gy) induced apoptosis in tagBFPNeg and tagBFPHigh Jurkat cells at 24 hours postirradiation, quantitated using Annexin V and Zombie-NIR assay. n ¼ 3 independent irradiation experiments. C, Gating strategy to sort tagBFPNeg and tagBFPHigh subpopulations in Jurkat cell line model. D, Clonogenic potential of tagBFPNeg and tagBFPHigh Jurkat cells exposed or not to irradiation (1 Gy; n ¼ 3). E, ERGþ85 enhancer activity analysis [measured as mean fluorescence intensity (MFI) ratio] after treatment of Jurkat cells with doxorubicin (100 nmol/L) for the indicated time (n ¼ 3). F, ERGþ85 enhancer activity analysis (measured as tagBFP mean fluorescence intensity) after treatment of AML 8227 sample with Ara-C (1 mmol/L) for 48 hours. One representative plot of three independent experiments is shown. , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001.

3866 Cancer Res; 79(15) August 1, 2019 Cancer Research

An ERGþ85 Enhancer Regulates Leukemia Stemness

FACS-assisted tagBFP analysis revealed that tagBFPHigh cells cells (Fig. 3B; Supplementary Fig. S3C). Of note, sorted tagBFPHigh capable to regenerate the original population consisting of and tagBFPNeg Jurkat cells contained a similar number of viral tagBFPHigh, tagBFPIntermediate, and tagBFPNeg cells. On the other integrations (Supplementary Fig. S3D). Collectively, these results hand, tagBFPNeg cells did not give rise to tagBFPHigh cells even over argue against a lentivirus integration bias effect or stochastic the extended period of 30 days in culture (Fig. 3A; Supplementary variation in tagBFP expression. Furthermore, continuum of cells Fig. S3). Similar pattern of tagBFP distribution was found when with various tagBFP levels in the progeny of the tagBFPHigh cells we measured ERGþ85 reporter activity in the progeny of an suggests gradual rather than on/off switch mechanism regulating individual Jurkat tagBFPHigh or tagBFPNeg cells plated in liquid ERGþ85 reporter dynamics. or methylcellulose colony-forming assays (Supplementary Fig. To determine a relative regenerative potential of tagBFPHigh S3A and S3B). and tagBFPNeg cells, we performed methycellulose colony serial ERG protein–level analysis by intracellular ﬂow cytometry and replating assay. We found that tagBFPHigh ELF-153 cells gave Western blotting revealed that tagBFPHigh Jurkat cells had a 2- to rise to more colonies compared with tagBFPNeg cells upon the 3-fold higher levels of ERG protein as compared with tagBFPNeg initial, secondary, and tertiary platings. Strikingly, no colonies

Figure 3. Regeneration and migration/invasion potential of tagBFPHigh and tagBFPNeg fractions. A, Flow cytometry–based analysis of tagBFP dynamics in sorted tagBFPHigh (blue histogram) and tagBFPNeg (red histogram) cells allowed to regenerate for a month. Dotted histograms represent tagBFP levels in tagBFPHigh and tagBFPNeg cells after the sort. A representative FACS plot is shown. Results are representative of eight independent experiments. B, Flow cytometric analysis of the endogenous ERG protein level in tagBFPNeg (red) and tagBFPHigh (blue) subpopulations. Pale histograms represent the isotype control staining for each fraction. A representative plot of three independent experiments is shown. C, Migration/invasion transwell assay scheme. D, Differential migration and invasion potential of tagBFPNeg and tagBFPHigh cells sorted from Jurkat and ELF153 cell lines. Mean SD of three (ELF153) and four (Jurkat) independent experiments is shown. , P < 0.01; , P < 0.001; ns, nonsigniﬁcant.

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3867

Aqaqe et al.

were generated by the tagBFPNeg cells upon the third plating 8-fold enrichment in LSCs in tagBFPHigh cells as compared with suggesting severely diminished self-renewal potential of this tagBFPNeg fraction (Fig. 4C; Supplementary Table S2). Interest- subpopulation (Supplementary Fig. S4A). To quantitate the ingly, while ERGþ85 reporter activity remained negative in the regenerative capacity of patient-derived AML blasts expressing leukemic engraftment formed by the tagBFPNeg cells, strong various levels of ERGþ85 reporter, we utilized stroma-supported regeneration of tagBFPNeg offspring was observed in mice that cultures and applied limiting dilution analysis (LDA) conditions. received tagBFPHigh cells (Fig. 4D). This in vivo heterogeneity The LDA results revealed 1.7- to 23-fold higher frequency of regeneration behavior agrees with our aforementioned in vitro culture-initiating cells in the tagBFPHigh population relative to findings. To assess directly whether tagBFPHigh fraction contains the tagBFPNeg fraction. In agreement with this, tagBFPHigh cells functional LSCs with self-renewal potential we performed serial were able to regenerate and demonstrated a substantial prolifer- transplantation assay using patient-derived AML sample ative potential (up to 40-fold expansion), whereas the majority of (#120791) infected with the ERGþ85 reporter. We found a þ the tagBFPNeg cell–initiated cultures failed to expand (Supple- gradual elevation in the proportion of the tagBFP cells with mentary Fig. S4B–S4D). To better characterize the stability of every round of transplantation (Supplementary Fig. S4E) that these functionally distinct states, we analyzed tagBFP dynamics in paralleled an increase in the LSC frequency (primary 1:50,000, sorted tagBFPHigh and tagBFPNeg primary AML cells at the day of tertiary 1:100; ref. 17). Thus, our in vivo results reveal that ERGþ85 sorting and after two weeks on stroma. Our results revealed that reporter–positive cells demarcate LSC-enriched cell population while tagBFPHigh cells could regenerate cells with high, interme- and LSCs properties, such as migration and invasion, are tightly diate, and low ERGþ85 reporter activity, the tagBFPNeg blasts did associated with high ERGþ85 activity. not give rise to the tagBFPHigh cells (Supplementary Fig. S4B– S4D). These results obtained with primary AML samples agree Transcriptional profiling of ERGþ85High and ERGþ85Neg states with our findings in the reporter-expressing leukemia cell lines. To reveal potential regulators that are responsible for the Elevated chemotactic migration and invasion capacities are distinct functional traits of ERGþ85-tagBFPHigh and ERGþ85- characteristics of stem-like cells in solid tumors as well as in tagBFPNeg Jurkat cells, we performed gene expression analysis on leukemia (57, 58). Thus, we hypothesized that leukemia cells, these fractions. 391 genes (366 upregulated and 25 downregu- which are characterized by the higher levels of stem cell–specific lated, FDR < 0.01) were differentially expressed between ERGþ85 enhancer, would exhibit distinct migration and invasion ERGþ85High and ERGþ85Neg states, albeit with the modest fold characteristics. To test this hypothesis, we utilized Transwell assay change (2.5–4.8 fold change range; Fig. 5A; Supplementary Fig. to examine migration of tagBFPHigh and tagBFPNeg cells toward S5A). To better understand the regulation mode of the tagBFPHigh MS5 conditioned medium and their invasion characteristics transcriptome, we investigated enrichment for the transcription through reconstituted basement membrane (Matrigel; Fig. 3C). factors known to interact with ERGþ85 enhancer in the regulatory Sorted tagBFPHigh Jurkat cells had higher migration rate as com- regions of the differentially expressed genes. By utilizing a TF- pared with sorted tagBFPNeg cells. In the additional cell model, specific ChIP-seq datasets, we revealed a strong enrichment for ELF153, we detected similar migration characteristics in sorted ERG and TAL1 factors in the upregulated genes in the ERGþ85High ELF-153 ERGþ85–expressing cells. Strikingly, in Jurkat and ELF- fraction (Fig. 5B), demonstrating preferential role of these tran- 153–based models, but not in Kasumi-1, only tagBFPHigh cells scription factors in governing ERGþ85High gene expression pro- demonstrated the invasion ability through the Matrigel layer file. In addition, unsupervised gene ontology analysis of regions while virtually no such ability was observed in the tagBFPNeg bound by ERG in Jurkat cells highlighted pathways regulating population (Fig. 3D; Supplementary Fig. S4F). Thus, these func- T-cell activation and HSC function and implicated additional tional assays reveal an increased invasive potential of ERGþ85High transcriptional regulators such as MEIS1 and b-catenin (Supple- cells. Furthermore, we provide evidence of ERGþ85High cells' mentary Fig. S5B). capability to regenerate the original "phenotypic" heterogeneity. GSEA of the differentially expressed genes (Supplementary Combined with elevated stress tolerance, these functional char- Table S3) revealed positive enrichment for gene signatures impli- acteristics indicate that ERGþ85High cells persist preferentially in a cated in maintaining HSC identity (HSC super-enhancer– "stem-like" state. associated genes), HSC/LSC function (HSC_R, HOXA9 and MEIS1), chemotherapy resistance (Ara-C, doxorubicin), EMT, and ERGþ85-tagBFP reporter enriches for LSCs early T-cell development in ERGþ85High cells (Fig. 5C; Supple- The ability to initiate and sustain leukemia is the gold-standard mentary Fig. S5C). In agreement with ChIP-seq–based functional assay for LSCs identification (59). To test whether ERGþ85 activity annotations, GSEA independently revealed enrichment of MEIS1, and associated phenotypic heterogeneity correlate with leukemo- TAL1 targets, and activated b-catenin pathway in the ERGþ85High genic potential, we performed an in vivo limiting dilution analysis cells. This analysis of ERGþ85High and ERGþ85Neg transcriptomes (LDA). To that end, increased doses of tagBFPHigh and tagBFPNeg suggests that cell-to-cell variability in ERGþ85 activation defines Jurkat cells were transplanted intrafemorally into immunode- leukemia cells with distinct developmental, differentiation, and ficient recipients (Fig. 4A). Both tagBFPHigh and tagBFPNeg cells fitness potentials, which are consistent with the functional het- initiated local leukemic engraftment in the injected bone with the erogeneity we described previously. higher blast load formed by the tagBFPHigh cells (Fig. 4B). To determine the clinical relevance of the transcriptional sig- Migration and leukemia regeneration in the noninjected bones nature identified in ERGþ85High Jurkat cells, we tested its perfor- characterize LSCs with the highest initiating potential (60). Strik- mance in the stratification of various primary AML and T-ALL ingly, only tagBFPHigh cells were able to repopulate collateral datasets. We found significant enrichment of ERGþ85High-specific bones in agreement with their elevated regenerative, migratory, transcripts in AML samples that expressed high levels of ERG as and invasive potentials observed in vitro. Using repopulation of compared with samples expressing low levels of ERG. Strikingly, the noninjected bone marrow as LDA read-out, we found an analysis of three independent studies (61–63) demonstrated that

3868 Cancer Res; 79(15) August 1, 2019 Cancer Research

An ERGþ85 Enhancer Regulates Leukemia Stemness

Figure 4. Engraftment capability of tagBFPHigh cells in NSG-mice. A, Study design for leukemia establishment and engraftment analysis. B, Leukemic engraftment in the injected bone [right femur (RF)] and in the noninjected collateral bones was analyzed 8 weeks postinjection of Jurkat cells (1 105 cells/mouse). Each symbol represents engraftment level in a single recipient. Horizontal lines represent mean for each group. Welch t test was used. C, Leukemia- initiating cell frequency of tagBFPHigh (black line) and tagBFPNeg (red line) Jurkat cells was determined using LDA. The dotted lines indicate the 95% conﬁdence interval. Supplementary Table S2 contains information regarding cell dose and the number of recipients used to calculate the leukemia-initiating cell frequency. D, Flow cytometry analysis of tagBFPHigh (blue) and tagBFPNeg (red) Jurkat cells regeneration capacity in vivo. A representative FACS plot of a single mouse recipient is shown. ns, nonsigniﬁcant.

ERGþ85High characteristic gene program was significantly dynamic nature of the TF network interacting with this genomic enriched in AML and T-ALL samples obtained at relapse as element (64–66). Positive and negative feedback loops that compared with samples obtained at the diagnostic stage can reinforce or diminish TF expression (and thus stabilize (Fig. 5D). In conclusion, our combined transcriptomics and ERGþ85Neg or ERGþ85High states) are general phenomenon bioinformatics analysis uncovered distinct transcriptional finger- in the developmental TF networks (67). Thus, we hypothesized prints associated with dynamic ERGþ85High subpopulation with that potential regulators of the heptad TFs can be differentially potential functional and clinical importance. expressed in ERGþ85High versus ERGþ85Neg states. To validate this hypothesis, we performed bioinformatics analysis of ERG/USP9X–positive feedback loop regulates heptad TFs potential gene-regulatory interactions between heptad TFs network stability and differentially expressed genes and observed a number of Our results demonstrate that ERGþ85 reporter activity regulatory interactions between the two groups (Fig. 6A). Fur- varies among Jurkat cells, which is consistent with the highly thermore, we confirmed by qRT-PCR assay differences

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3869

Aqaqe et al.

Figure 5. tagBFPHigh cells enriched with stemness and chemo-resistant gene sets. A, Statistical analysis of microarray (SAM) plot. The two parallel dashed lines are the cut-off threshold specified by the actual false discovery rate, and the total number of upregulated (red dots) and downregulated (green dots) genes are given. High 2 B, ChIP-seq enrichment analysis of the relevant TFs in tagBFP signature genes. Scores are calculated using -log10(P) (Enrichment Factor-EF) formula and the algorithm explained elsewhere. C, GSEA. Transcripts were ranked from top upregulated to top downregulated (in tagBFPHigh vs. tagBFPNeg fractions) and the ranked list was investigated using GSEA analysis. D, Clinical relevance of tagBFPHigh signature enrichments in different AML/T-ALL–related gene sets. AML cohort of TCGA with profiled transcriptome was used: the top 15% most expressing ERG AML patients and the 15% lowest were defined as ERGhigh and ERGlow AML patients, respectively. Database: AML, TCGA.

3870 Cancer Res; 79(15) August 1, 2019 Cancer Research

An ERGþ85 Enhancer Regulates Leukemia Stemness

Figure 6. USP9X is an ERG target gene with a prognostic impact. A, Literature-based functional interaction analysis of the heptad TFs and genes differentially expressed between tagBFPNeg and tagBFPHigh cell subsets. esyN online tool was used to generate this interaction network. B, qRT-PCR based validation of the selected genes (SMAD3 and USP9X) predicted by microarray proﬁling to be differentially expressed in tagBFPNeg and tagBFPHigh subpopulations. n ¼ 3 independent experiments. CHIP-seq datasets are listed in Materials and Methods. C, USP9X gene expression difference between ERG-expressing AMLs (the highest and the lowest 30% cutoff was used to deﬁne ERGHigh and ERGLow groups). D, Kaplan–Meier estimates of OS according to USP9X expression levels that were calculated using RNA-seq datasets from AML-TCGA study. E, Normalized expression of ERG and USP9X genes in Jurkat tagBFPNeg cells infected with the control (1074) or ERG-overexpressing (1074-ERG) vectors. Bars represent means SD; n ¼ 3 qRT-PCR experiments. F, ERGþ85 reporter activity analysis in tagBFPNeg Jurkat cells 3 or 10 days postinfection with control (1074, black contour plot) or ERG-overexpressing (1074-ERG, green contour plot) vectors. A representative contour plot analysis of four independent experiments is shown. G, ERG protein enrichment in USP9X regulatory region located 3-kb upstream of the transcriptional start site (TSS) was detected by querying the published ERG ChIP-seq datasets for normal CD34þ cells, SKNO1, and KASUMI-1 leukemia cell lines. , P < 0.0001. Welch t test was used.

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3871

Aqaqe et al.

3872 Cancer Res; 79(15) August 1, 2019 Cancer Research

An ERGþ85 Enhancer Regulates Leukemia Stemness

suggested by microarrays for several genes implicated in these two different shRNAs (shUSP9X #2 and shUSP9X #3) led to the regulatory interactions (e.g., USP9X and SMAD3)aswellasin reduction in ERGþ85 reporter activity coupled with a decrease in leukemogenesis (e.g., ID2, EZH2, ALCAM, CD28) in indepen- ERG protein levels (Fig. 7B). These results confirm that endoge- dently sorted Jurkat subpopulations (Fig. 6B; Supplementary nous USP9X regulates ERG protein and uncovers high sensitivity Fig. S5D). of the ERG transcriptional network to changes in one of its To investigate whether predicted regulatory interactions affect components. ERGþ85-associated TF network dynamics and if so, by what To further substantiate the role of USP9X in regulation of mechanism, we focused on studying ERG and USP9X factors. leukemia cell properties, we utilized two partially selective USP9X USP9X is a deubiquitinase enzyme that can regulate stability of deubiquitinase inhibitors WP1130 (70) and G9 (71) combined numerous cancer-related proteins in solid cancers, including with leukemia lines differing in their ERGþ85 reporter activity ERG (40), MCL1 (68), and b-catenin (69). In agreement (Supplementary Fig. S7C). WP1130 as well as G9 treatment with higher expression of USP9X in ERGþ85High fraction induced a dose-dependent decline in viability in all cell lines; of Jurkat cells (Fig. 6B), we also revealed a higher expression of however, leukemia lines that transactivated ERGþ85 reporter USP9X in AML samples characterized by elevated ERG levels (e.g., TEX, ME1 and ELF153) were more sensitive to USP9X (Fig. 6C). These findings point to a previously unrecognized inhibitor–mediated growth inhibition than cell lines lacking positive correlation between the expressions of these two factors ERGþ85 transactivation (e.g., K562, THP1, AML193; Fig. 7C; in human leukemia. Supplementary Fig. S7D). To test whether MCL1 plays a major To provide insights into the potential involvement of USP9X in role in the preferential sensitivity of the ERGþ85High cells to the human leukemogenesis, we investigated changes in the USP9X USP9X inhibitor, we treated the same cell line panel with the expression in leukemia samples with established disease para- MCL1-specific inhibitor S63845 (72). We found no correlation meters. Using TCGA, we uncovered that high USP9X levels in between the ERGþ85 reporter activity and viability decline upon patients with AML are associated with lower overall survival, treatment with S63845 (Supplementary Fig. S7E), suggesting that higher relapse rate, and poor cytogenetics (Fig. 6D; Supplemen- MCL1 inhibition solely could not explain the ERGþ85 activity– tary Fig. S6A–S6G). dependent sensitivity of cells to USP9X targeting. To extend our To investigate the potential transcriptional regulation of USP9X findings, we treated patient-derived AML samples containing gene by ERG, we ectopically expressed ERG cDNA in ERGþ85Neg ERGþ85-positive fraction with WP1130 (Fig. 7D). Variable Jurkat cells. We observed USP9X mRNA upregulation in ERG- degree of growth inhibition in four of five samples was detected. overexpressing cells as well as gradual tagBFP induction that To test directly whether USP9X inhibition affects the ubiqui- becomes pronounced only after 10 days (Fig. 6E and F). tination status of the endogenous ERG TF in leukemia, we treated Furthermore, we revealed enrichment of ERG transcription leukemia cells with WP1130 and performed ERG protein immu- factor in the USP9X promoter region in several AML cell noprecipitation followed by immunoblotting with an antibody þ lines and CD34 cord blood cells by analyzing published ChIP- against ubiquitin. Indeed, treatment of ELF153 cells with WP1130 seq datasets (Fig. 6G). Interestingly, human HSCs expressed resulted in the time-dependent increase in the level of ubiquiti- elevated USP9X levels relatively to the more differentiated nated endogenous ERG protein (Fig. 7E; Supplementary Fig. S8B). subtypes (Supplementary Fig. S6H). A more comprehensive We have previously shown that only ERGþ85High cells exhibit inspection revealed a canonical ETS TF DNA–binding motif in strong invasive properties in vitro and in vivo. To examine whether the USP9X promoter indicating a possible ERG-USP9X–positive this invasive potential can be affected by the novel ERGþ85 feedback loop (Supplementary Fig. S6I). regulator USP9X, we performed the invasion assay in the presence Collectively, our results highlight the existence of the genetic of WP1130. As can be seen in Fig. 7F, WP1130 exposure led to link between USP9X, ERG, and ERGþ85-associated stemness inhibition of tagBFPHigh cells' invasion. network and point to the functional involvement of USP9X in In agreement with our findings in the growth inhibition assays, human leukemia. we observed degradation of ERG protein upon WP1130 treatment in sensitive, but not resistant samples (Fig. 7G; Supplementary USP9X inhibition impairs ERGþ85 transcriptional network Fig. S8C). and inhibits leukemia cells' functionality To summarize, ERG regulates USP9X transcription by binding To validate whether alteration in USP9X levels would affect to its promoter while USP9X can stabilize ERG via deubiquitina- ERG expression and ERGþ85-tagBFP reporter activity, USP9X tion. Interference with this feed-forward regulation via USP9X expression was downregulated using RNA interference approach targeting can inhibit growth and invasion potential of the (Fig. 7A; Supplementary Fig. S7A and S7B). USP9X knockdown by ERGþ85-positive leukemias (Fig. 7H).

Figure 7. Functional interrogation of the ERG/USP9X feedback loop. A, Jurkat cells were infected with the indicated viruses expressing USP9X or scramble shRNAs and then selected with puromycin (3 mg/mL) for 3 days. At day 5 after infection, cells were analyzed using qRT-PCR for USP9X mRNA reduction. n ¼ 3 independent experiments. B, ERGþ85 reporter activity and ERG protein expression analyses upon USP9X knockdown. The histograms shown are representative of three independent experiments. C, Differential sensitivity of tagBFPNeg and tagBFPHigh cells to USP9X inhibitor –WP1130. Cells were treated for 3 days with the indicated concentrations of WP1130 and analyzed for viability using FACS. Dye exclusion assay, n ¼ 3 independent experiments. D, Susceptibility of primary AML samples to WP1130 treatment. Cells were treated for 24–72 hours with the indicated concentrations of USP9X inhibitor and then cell number and viability were determined by ﬂow cytometry. E, Ubiquitination status of ERG after WP1130 treatment. ELF153 cells were treated with WP1130 in the presence of MG132. Immunoprecipitation was performed using anti-ERG antibody and immunoblotting was performed using anti-ubiquitin antibody. Input ERG protein is shown in the bottom image. F, Effect of WP1130 on the invasive phenotype of tagBFPHigh and tagBFPNeg subpopulations in ELF153 cells. Mean SD of three experiments. G, Western blot analysis of ERG protein level after treatment (16 hours) with the indicated concentrations of WP1130. H, Schematic depiction of the proposed ERG- and USP9X-positive feedback loop relationships. , P < 0.05; , P < 0.01; , P < 0.0001; ns, nonsigniﬁcant.

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3873

Aqaqe et al.

Discussion expression of genes related to EMT and activated b-catenin by Advanced tools suitable for separating functionally distinct ERGþ85High cells, as discovered by our current transcriptomics subpopulations of leukemia cells are obligatory for investigation analysis of Jurkat subsets, can provide potential clues on regula- and efficient targeting of LSCs. Moreover, functional characteriza- tors implicated in invasive, migratory, and chemo-resistance tion of LSC subpopulations can benefit from a real-time cell phenotypes (57, 80). In addition, high expression of ALCAM tracking tool to conduct diverse in vitro and in vivo studies. While (CD166) in ERGþ85High cells, which is required for efficient in our recent study (17) we described the bioinformatics and migration and homing of HSCs, might also yield therapeutic experimental strategy to identify one such tool as a marker for opportunity to target these cells (81, 82). stemness state (ERGþ85 enhancer) and developed a fluorescent Positive feedback loop between ERG TF and its deubiquitinase lentiviral reporter that can accurately recapitulate this enhancer USP9X, which we revealed here, exemplifies a distinctive utiliza- endogenous activity, in this study, we advanced this reporter system tion of the differential ERGþ85 reporter activity for reconstructing for functional and molecular dissection of leukemia cell hetero- gene-regulatory networks implicated in leukemia cells' functional geneity. Furthermore, we identified the USP9X as ERG-inducible heterogeneity. It can provide plausible molecular mechanism deubiquitinase with a role in leukemia cells' invasion and growth. pertaining increased radiation/chemotherapy tolerance and acti- Cell-to-cell functional heterogeneity has being recognized as one vation of b-catenin pathway as we observed in ERGþ85High cells. of the driving forces for leukemia therapy failure and disease Indeed, elevated USP9X can stabilize antiapoptosis regulator relapse (3, 4, 31, 73). So far, cell characterization strategies based MCL1 (68, 83) and b-catenin (69). USP9X's ability to reinforce on metabolic state labeling (74), dye efflux (75), or differential cell ERGþ85 stemness program can provide molecular support to surface markers (73) provided solid support for the existence of our bioinformatics analysis that demonstrated USP9X elevation the functionally distinct leukemia subpopulations in the same in the poor prognosis and relapsed AML samples. Importantly, sample. Cell-to-cell heterogeneous activity of the ERGþ85 reporter, we demonstrated that leukemia lines and patient AMLs are as imaged by our system, allows dissection of the functional variably sensitive to WP1130 treatment. These findings advocate heterogeneity according to the stemness program–related activity. the usage of USP9X inhibitors (40, 84) as a promising approach Indeed, elevated expression of normal HSC-associated transcripts in targeting leukemias that are dependent on ERG/USP9X axis. in human leukemias constitutes an adverse predictor of patient In conclusion, our results validate a novel experimental tool to survival independent of other genetic and clinical criteria (30, 76). dissect leukemia cells' functional heterogeneity. We believe that Reduced apoptosis induction, superior chemo- and radioresistance insights obtained with this approach can assist in developing of tagBFPHigh subpopulation, as revealed in this work, coupled personalized treatments aimed to target stem-like subpopulations with marked enrichment for the relapse-associated gene signature in human leukemia. point to the association between the two characteristics. Moreover, fl adapting of this reporter labeling strategy to the high-throughput Disclosure of Potential Con icts of Interest drug screen holds the potential for the early identification of small S. Izraeli is a consultant/advisory board member at SIGHTDX. No potential conflicts of interest were disclosed by the other authors. molecules capable targeting relapse-initiating cells. Using this reporter in multiple established and primary AML Authors' Contributions þ High samples, we showed that only ERG 85 leukemic cells are cap- Conception and design: N. Aqaqe, M. Yassin, A.A. Yassin, S. Izraeli, M. Milyavsky Neg able of giving rise to ERGþ85 cells and sustain multiple rounds Development of methodology: N. Aqaqe, M. Yassin, A.A. Yassin, S. Izraeli, or replating. These findings suggestive of the extensive regenerative M. Milyavsky and self-renewal potential of the ERGþ85High fraction agree with Acquisition of data (provided animals, acquired and managed patients, þ our previous findings with normal cord blood–derived CD34 provided facilities, etc.): M. Yassin, A.A. Yassin, N. Ershaid, E. Kugler, E.R. Lechman, O.I. Gan, A. Mitchell, M. Milyavsky cells in which high ERGþ85 activity characterize cells with the þ Analysis and interpretation of data (e.g., statistical analysis, biostatistics, most immature (CD34 D38 ) phenotype (17). The lack of computational analysis): N. Aqaqe, M. Yassin, A.A. Yassin, M. Milyavsky Neg High noticeable transition from ERGþ85 cells toward ERGþ85 Writing, review, and/or revision of the manuscript: N. Aqaqe, M. Yassin, cells in spite of prolonged in vitro or in vivo growth is surprising, E. Kugler, S. Izraeli, M. Milyavsky giving the stochastic-state transitions previously reported in breast Administrative, technical, or material support (i.e., reporting or organizing cancer (77). This finding may indicate that ERGþ85 enhancer– data, constructing databases): N. Aqaqe, M. Yassin, N. Ershaid, C. Katz-Even, fi A. Zipin-Roitman, A. Mitchell, M. Milyavsky based reporter enables identi cation of the more stable cell states Study supervision: E.R. Lechman, J.E. Dick, S. Izraeli, M. Milyavsky that could not be identified by approaches utilizing a limited pre- defined set of cell surface markers or transient/metabolic labeling. Acknowledgments Indeed, only by using an extensive repertoire of cell surface The authors thank Dr. J.E. Pimanda (Prince of Wales Clinical School, markers, distinct leukemia stem cells lineages were identified in University of New South Wales Sydney, Sydney, Australia) for providing the þ aspecific murine leukemia model driven by MLL-AF9 (78). PGL2-ERG 85 luciferase vector, Dr. N. Donato (University of Michigan, fi Ann Arbor, MI) for providing G9, Dr. L. Broday (Tel Aviv University, In addition, our ndings shed light on the understanding of Tel Aviv, Israel) for providing reagents and assistance with ubiquitination LSC phenotypes and permit their analysis in situ. ERGþ85 reporter assay, Dr. L. Shlush (Weizmann Institute of Science, Rehovot, Israel) for discovered at least two distinct self-renewing and leukemia- providing AML samples. This work was partially supported by Israel Science initiating lineages in Jurkat cells that differ in their functional Foundation (ISF 1512/14 to M. Milyavsky), Varda and Boaz Dotan Research capabilities. Boosted migratory/invasive activity in vitro combined Center in Hemato-Oncology (to M. Milyavsky and S. Izraeli), and Israel with the capacity to repopulate distant bone marrow territories Cancer Research Fund (RCDA 14-171toM.Milyavsky).N.Aqaqeisa þ High recipient of a PhD scholarship from State of Israel Ministry of Science, in vivo suggests that ERG 85 cells can have important clinical Technology and Space. M. Yassin is a recipient of Israel Council for Higher implications. For example, exploration of various bone marrow Education PhD scholarship for minorities. This work was performed in niches can endow selective protection on ERGþ85High cells partial fulfillment of the requirements for a PhD degree of Muhammad from chemotherapy or targeted therapy (54, 79). Preferential Yassin, Nasma Aqaqe, and Eitan Kugler, the Dr. Miriam and

3874 Cancer Res; 79(15) August 1, 2019 Cancer Research

An ERGþ85 Enhancer Regulates Leukemia Stemness

Sheldon G. Adelson Graduate School of Medicine, Sackler Faculty of advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Medicine, Tel Aviv University, Israel. this fact.

The costs of publication of this article were defrayed in part by the Received October 18, 2018; revised March 21, 2019; accepted June 4, 2019; payment of page charges. This article must therefore be hereby marked published ﬁrst June 7, 2019.

References 1. Gilliland DG, Jordan CT, Felix CA. The molecular basis of leukemia. 22 McKenzie JL, Gan OI, Doedens M, Dick JE. Human short-term Hematol Am Soc Hematol Educ Progr 2004:80–97. doi: 10.1182/ashedu- repopulating stem cells are efficiently detected following intrafemoral þ cation-2004.1.80. transplantation into NOD/SCID recipients depleted of CD122 cells. 2. Dohner H, Weisdorf DJ, Bloomfield CD. Acute myeloid leukemia. N Engl J Blood 2005;106:1259–61. Med 2015;373:1136–52. 23. Hu Y, Smyth GK. ELDA: Extreme limiting dilution analysis for comparing 3. Klco JM, Spencer DH, Miller CA, Griffith M, Lamprecht TL, O'Laughlin M, depleted and enriched populations in stem cell and other assays. J Immu- et al. Functional heterogeneity of genetically defined subclones in acute nol Methods 2009;347:70–8. myeloid leukemia. Cancer Cell 2014;25:379–92. 24. Thoms JA, Birger Y, Foster S, Knezevic K, Kirschenbaum Y, Chandra- 4. Yanagisawa B, Ghiaur G, Smith BD, Jones RJ. Translating leukemia stem kanthan V, et al. ERG promotes T-acute lymphoblastic leukemia and is cells into the clinical setting: harmonizing the heterogeneity. Exp Hematol transcriptionally regulated in leukemic cells by a stem cell enhancer. Blood 2016;44:1130–7. 2011;117:7079–89. 5. Vedi A, Santoro A, Dunant CF, Dick JE, Laurenti E. Molecular landscapes of 25. Amendola M, Venneri MA, Biffi A, Vigna E, Naldini L. Coordinate dual- human hematopoietic stem cells in health and leukemia. Ann N Y Acad Sci gene transgenesis by lentiviral vectors carrying synthetic bidirectional 2016;1370:5–14. promoters. Nat Biotechnol 2005;23:108–16. 6. Greaves M. Leukaemia "firsts" in cancer research and treatment. Nat Rev 26. Milyavsky M, Gan OI, Trottier M, Komosa M, Tabach O, Notta F, et al. A Cancer 2016;16:163–72. distinctive DNA damage response in human hematopoietic stem cells 7. Marusyk A, Almendro V, Polyak K. Intra-tumour heterogeneity: a looking reveals an apoptosis-independent role for p53 in self-renewal. Cell Stem glass for cancer? Nat Rev Cancer 2012;12:323–34. Cell 2010;7:186–97. 8. Lapidot T, Sirard C, Vormoor J, Murdoch B, Hoang T, Caceres-Cortes J, et al. 27. Tan YD, Fornage M, Fu YX. Ranking analysis of microarray data: a A cell initiating human acute myeloid leukaemia after transplantation into powerful method for identifying differentially expressed genes. Genomics SCID mice. Nature 1994;367:645–8. 2006;88:846–54. 9. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a 28. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays hierarchy that originates from a primitive hematopoietic cell. Nat Med applied to the ionizing radiation response. Proc Natl Acad Sci U S A 2001; 1997;3:730–7. 98:5116–21. 10. Pollyea DA, Jordan CT. Therapeutic targeting of acute myeloid leukemia 29. van Galen P, Viny AD, Ram O, Ryan RJ, Cotton MJ, Donohue L, et al. A stem cells. Blood 2017;129:1627–35. multiplexed system for quantitative comparisons of chromatin landscapes. 11. Gerber JM, Smith BD, Ngwang B, Zhang H, Vala MS, Morsberger L, et al. A Molecular Cell 2016;61:170–80. clinically relevant population of leukemic CD34(þ)CD38() cells in acute 30. Eppert K, Takenaka K, Lechman ER, Waldron L, Nilsson B, van Galen P, myeloid leukemia. Blood 2012;119:3571–7. et al. Stem cell gene expression programs influence clinical outcome in 12. Ran D, Schubert M, Taubert I, Eckstein V, Bellos F, Jauch A, et al. Hetero- human leukemia. Nat Med 2011;17:1086–93. geneity of leukemia stem cell candidates at diagnosis of acute myeloid 31. Farge T, Saland E, de Toni F, Aroua N, Hosseini M, Perry R, et al. Chemo- leukemia and their clinical significance. Exp Hematol 2012;40:155–65.e1. therapy-resistant human acute myeloid leukemia cells are not enriched for 13. Guan Y, Gerhard B, Hogge DEE. Detection, isolation, and stimulation of leukemic stem cells but require oxidative metabolism. Cancer Discov 2017; quiescent primitive leukemic progenitor cells from patients with acute 7:716–35. myeloid leukemia (AML). Blood 2003;101:3142–9. 32. Kang HC, Kim IJ, Park JH, Shin Y, Ku JL, Jung MS, et al. Identification of 14. Lechman ER, Gentner B, Ng SWK, Schoof EM, van Galen P, Kennedy JA, genes with differential expression in acquired drug-resistant gastric cancer et al. miR-126 regulates distinct self-renewal outcomes in normal and cells using high-density oligonucleotide microarrays. Clin Cancer Res malignant hematopoietic stem cells. Cancer Cell 2016;29:602–6. 2004;10:272–84. 15. Thomas D, Majeti R. Biology and relevance of human acute myeloid 33. Kenny PA, Enver T, Ashworth A. Receptor and secreted targets of Wnt-1/ leukemia stem cells. Blood 2017;129:1577–85. beta-catenin signalling in mouse mammary epithelial cells. BMC Cancer 16. Ho TC, LaMere M, Stevens BM, Ashton JM, Myers JR, O'Dwyer KM, et al. 2005;5:3. doi: 10.1186/1471-2407-5-3. Evolution of acute myelogenous leukemia stem cell properties after treat- 34. Lee MS, Hanspers K, Barker CS, Korn AP, McCune JM. Gene expression þ ment and progression. Blood 2016;128:1671–8. profiles during human CD4 T cell differentiation. Int Immunol 2004;16: 17. Yassin M, Aqaqe N, Yassin AA, van Galen P, Kugler E, Bernstein BE, et al. A 1109–24. novel method for detecting the cellular stemness state in normal and 35. Hess JL, Bittner CB, Zeisig DT, Bach C, Fuchs U, Borkhardt A, et al. c-Myb leukemic human hematopoietic cells can predict disease outcome and drug is an essential downstream target for homeobox-mediated transformation sensitivity. Leukemia 2019 Jan 31. [Epub ahead of print]. doi: 10.1038/ of hematopoietic cells. Blood 2006;108:297–304. s41375-019-0386-z. 36. Langer C, Radmacher MD, Ruppert AS, Whitman SP, Paschka P, Mrozek 18. Beck D, Thoms JA, Perera D, Schutte J, Unnikrishnan A, Knezevic K, et al. K, et al. High BAALC expression associates with other molecular prognostic Genome-wide analysis of transcriptional regulators in human HSPCs markers, poor outcome, and a distinct gene-expression signature in cyto- reveals a densely interconnected network of coding and noncoding genes. genetically normal patients younger than 60 years with acute myeloid Blood 2013;122:e12–22. leukemia: a cancer and leukemia group B (CALGB) study. Blood 2008;111: 19. Wilson NK, Foster SD, Wang X, Knezevic K, Schutte€ J, Kaimakis P, et al. 5371–9. Combinatorial transcriptional control in blood stem/progenitor cells: 37. Gotzmann J, Fischer AN, Zojer M, Mikula M, Proell V, Huber H, et al. A genome-wide analysis of ten major transcriptional regulators. Cell Stem crucial function of PDGF in TGF-b-mediated cancer progression of hepa- Cell 2010;7:532–44. tocytes. Oncogene 2006;25:3170–85. 20. Diffner E, Beck D, Gudgin E, Thoms JAI, Knezevic K, Pridans C, et al. Activity 38. Sanda T, Lawton LN, Barrasa MI, Fan ZP, Kohlhammer H, Gutierrez A, of a heptad of transcription factors is associated with stem cell programs and et al. Core transcriptional regulatory circuit controlled by the TAL1 complex clinical outcome in acute myeloid leukemia. Blood 2013;121:2289–300. in human T cell acute lymphoblastic leukemia. Cancer Cell 2012;22: 21. Warner JK, Wang JCY, Takenaka K, Doulatov S, McKenzie JL, Harrington 209–21. L, et al. Direct evidence for cooperating genetic events in the leukemic 39. Xiong Q, Mukherjee S, Furey TS. GSAASeqSP: a toolset for gene set transformation of normal human hematopoietic cells. Leukemia 2005;19: association analysis of RNA-seq data. Sci Rep 2014;4:6347. doi: 10.1038/ 1794–1805. srep06347.

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3875

Aqaqe et al.

40. Wang S, Kollipara RK, Srivastava N, Li R, Ravindranathan P, Hernandez E, 63. Clappier E, Gerby B, Sigaux F, Delord M, Touzri F, Hernandez L, et al. et al. Ablation of the oncogenic transcription factor ERG by deubiquitinase Clonal selection in xenografted human T cell acute lymphoblastic leuke- inhibition in prostate cancer. Proc Natl Acad Sci U S A 2014;111:4251–6. mia recapitulates gain of malignancy at relapse. J Exp Med 2011;208: 41. Cancer Genome Atlas Research NetworkLey TJ, Miller C, Ding L, Raphael 653–61. BJ, Mungall AJ, et al. Genomic and epigenomic landscapes of adult de novo 64. Unnikrishnan A, Guan YF, Huang Y, Beck D, Thoms JA, Peirs S, et al. A acute myeloid leukemia. New Engl J of Med 2013;368:2059–74. quantitative proteomics approach identifies ETV6 and IKZF1 as new 42. Wouters BJ, Lowenberg€ B, Erpelinck-Verschueren CA, van Putten WL, Valk regulators of an ERG-driven transcriptional network. Nucleic Acids Res PJ, Delwel R. Double CEBPA mutations, but not single CEBPA mutations, 2016;44:10644–61. define a subgroup of acute myeloid leukemia with a distinctive gene 65. Schutte J, Wang H, Antoniou S, Jarratt A, Wilson NK, Riepsaame J, et al. An expression profile that is uniquely associated with a favorable outcome. experimentally validated network of nine haematopoietic transcription Blood 2009;113:3088–91. factors reveals mechanisms of cell state stability. Elife 2016;5:e11469. 43. McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, et al. 66. Wilson NK, Timms RT, Kinston SJ, Cheng YH, Oram SH, Landry JR, et al. GREAT improves functional interpretation of cis-regulatory regions. Nat Gfi1 expression is controlled by five distinct regulatory regions spread over Biotechnol 2010;28:495–501. 100 kilobases, with Scl/Tal1, Gata2, PU.1, Erg, Meis1, and Runx1 acting as 44. Sharma NL, Massie CE, Butter F, Mann M, Bon H, Ramos-Montoya A, upstream regulators in early hematopoietic cells. Mol Cell Biol 2010;30: et al. The ETS family member GABPa modulates androgen receptor 3853–63. signalling and mediates an aggressive phenotype in prostate cancer. 67. Wilkinson AC, Nakauchi H, Gottgens B. Mammalian transcription factor Nucleic Acids Res 2014;42:6256–69. networks: recent advances in interrogating biological complexity. Cell Syst 45. Palii CG, Perez-Iratxeta C, Yao Z, Cao Y, Dai F, Davison J, et al. Differential 2017;5:319–31. genomic targeting of the transcription factor TAL1 in alternate haemato- 68. Schwickart M, Huang X, Lill JR, Liu J, Ferrando R, French DM, et al. poietic lineages. EMBO J 2011;30:494–509. Deubiquitinase USP9X stabilizes MCL1 and promotes tumour cell surviv- 46. Kwiatkowski N, Zhang T, Rahl PB, Abraham BJ, Reddy J, Ficarro SB, et al. al. Nature 2010;463:103–7. Targeting transcription regulation in cancer with a covalent CDK7 inhib- 69. Taya S, Yamamoto T, Kanai-Azuma M, Wood SA, Kaibuchi K. The deubi- itor. Nature 2014;511:616–20. quitinating enzyme Fam interacts with and stabilizes beta-catenin. 47. Martens JH, Mandoli A, Simmer F, Wierenga BJ, Saeed S, Singh AA, et al. Genes Cells 1999;4:757–67. ERG and FLI1 binding sites demarcate targets for aberrant epigenetic 70. Bartholomeusz GA, Talpaz M, Kapuria V, Kong LY, Wang S, Estrov Z, et al. regulation by AML1-ETO in acute myeloid leukemia. Blood 2012;120: Activation of a novel Bcr/Abl destruction pathway by WP1130 induces 4038–48. apoptosis of chronic myelogenous leukemia cells. Blood 2007;109: 48. Mandoli A, Singh AA, Prange KHM, Tijchon E, Oerlemans M, Dirks R, 3470–8. et al. The hematopoietic transcription factors RUNX1 and ERG prevent 71. Peterson LF, Sun H, Liu Y, Potu H, Kandarpa M, Ermann M, et al. Targeting AML1-ETO oncogene overexpression and onset of the apoptosis program deubiquitinase activity with a novel small-molecule inhibitor as therapy in t(8;21) AMLs. Cell Rep 2016;17:2087–2100. for B-cell malignancies. Blood 2015;125:3588–97. 49. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, et al. 72. Kotschy A, Szlavik Z, Murray J, Davidson J, Maragno AL, Le Toumelin- The human genome browser at UCSC. Genome Res 2002;12:996–1006. Braizat G, et al. The MCL1 inhibitor S63845 is tolerable and effective in 50. Bean DM, Heimbach J, Ficorella L, Micklem G, Oliver SG, Favrin G. esyN: diverse cancer models. Nature 2016;538:477–82. Network building, sharing and publishing. PLoS One 2014;9:e106035. 73. Levine JHH, Simonds EFF, Bendall SCC, Davis KLL, Amir ED, Tadmor doi: 10.1371/journal.pone.0106035. MDD, et al. Data-driven phenotypic dissection of AML reveals progenitor- 51. Laurenti E, Doulatov S, Zandi S, Plumb I, Chen J, April C, et al. The like cells that correlate with prognosis. Cell 2015;162:184–97. transcriptional architecture of early human hematopoiesis identifies mul- 74. Pearce DJ, Taussig D, Simpson C, Allen K, Rohatiner AZ, Lister TA, et al. tilevel control of lymphoid commitment. Nat Immunol 2013;14:756–63. Characterization of cells with a high aldehyde dehydrogenase activity from 52. Radich JP, Dai H, Mao M, Oehler V, Schelter J, Druker B, et al. Gene cord blood and acute myeloid leukemia samples. Stem Cells 2005;23: expression changes associated with progression and response in chronic 752–60. myeloid leukemia. Proc Natl Acad Sci U S A 2006;103:2794–9. 75. Moshaver B, van Rhenen A, Kelder A, van der Pol M, Terwijn M, Bachas C, 53. Valk PJ, Verhaak RG, Beijen MA, Erpelinck CA, Barjesteh van Waalwijk van et al. Identification of a small subpopulation of candidate leukemia- Doorn-Khosrovani S, Boer JM, et al. Prognostically useful gene-expression initiating cells in the side population of patients with acute myeloid profiles in acute myeloid leukemia. N Engl J Med 2004;350:1617–28. leukemia. Stem Cells 2008;26:3059–67. 54. Ishikawa F, Yoshida S, Saito Y, Hijikata A, Kitamura H, Tanaka S, et al. 76. Ng SWK, Mitchell A, Kennedy JA, Chen WC, McLeod J, Ibrahimova N, et al. Chemotherapy-resistant human AML stem cells home to and engraft within A 17-gene stemness score for rapid determination of risk in acute leukae- the bone-marrow endosteal region. Nat Biotechnol 2007;25:1315–21. mia. Nature 2016;540:433–7. 55. Abdullah LN, Chow EK-H. Mechanisms of chemoresistance in cancer stem 77. Friedmann-Morvinski D, Verma IM. Dedifferentiation and reprogram- cells. Clin Transl Med 2013;2:3. ming: origins of cancer stem cells. EMBO Rep 2014;15:244–53. 56. Rycaj K, Tang DG. Cancer stem cells and radioresistance. Int J Radiat Biol 78. Guo G, Luc S, Marco E, Lin TW, Peng C, Kerenyi MA, et al. Mapping cellular 2014;90:615–21. hierarchy by single-cell analysis of the cell surface repertoire. Cell Stem Cell 57. Stavropoulou V, Kaspar S, Brault L, Sanders MA, Juge S, Morettini S, et al. 2013;13:492–505. MLL-AF9 expression in hematopoietic stem cells drives a highly invasive 79. Gilbert LA, Hemann MT. DNA damage-mediated induction of a chemore- AML expressing EMT-related genes linked to poor outcome. Cancer Cell sistant niche. Cell 2010;143:355–66. 2016;30:43–58. 80. Yeung J, Esposito MT, Gandillet A, Zeisig BB, Griessinger E, Bonnet D, et al. 58. Sato R, Semba T, Saya H, Arima Y. Concise review: stem cells and epithelial- b-Catenin mediates the establishment and drug resistance of MLL leukemic mesenchymal transition in cancer: biological implications and therapeutic stem cells. Cancer Cell 2010;18:606–18. targets. Stem Cells 2016;34:1997–2007. 81. Chitteti BR, Kobayashi M, Cheng Y, Zhang H, Poteat BA, Broxmeyer HE, 59. Kreso A, Dick JE. Evolution of the cancer stem cell model. Cell Stem Cell et al. CD166 regulates human and murine hematopoietic stem cells and the 2014;14:275–91. hematopoietic niche. Blood 2014;124:519–29. 60. Hope KJJ, Jin L, Dick JEE. Acute myeloid leukemia originates from a 82. Jin L, Hope KJ, Zhai Q, Smadja-Joffe F, Dick JE. Targeting of CD44 hierarchy of leukemic stem cell classes that differ in self-renewal capacity. eradicates human acute myeloid leukemic stem cells. Nat Med 2006;12: Nat Immunol 2004;5:738–43. 1167–74. 61. Shlush LI, Mitchell A, Heisler L, Abelson S, Ng SWK, Trotman-Grant A, et al. 83. Trivigno D, Essmann F, Huber SM, Rudner J. Deubiquitinase USP9x confers Tracing the origins of relapse in acute myeloid leukaemia to stem cells. radioresistance through stabilization of Mcl-1. Neoplasia 2012;14: Nature 2017;547:104–8. 893–904. 62. Li S, Garrett-Bakelman FE, Chung SS, Sanders MA, Hricik T, Rapaport F, 84. Potu H, Peterson LF, Kandarpa M, Pal A, Sun H, Durham A, et al. Usp9x et al. Distinct evolution and dynamics of epigenetic and genetic hetero- regulates Ets-1 ubiquitination and stability to control NRAS expression and geneity in acute myeloid leukemia. Nat Med 2016;22:792–9. tumorigenicity in melanoma. Nat Commun 2017;8:14449.

3876 Cancer Res; 79(15) August 1, 2019 Cancer Research

An ERG Enhancer −Based Reporter Identifies Leukemia Cells with Elevated Leukemogenic Potential Driven by ERG-USP9X Feed-Forward Regulation

Nasma Aqaqe, Muhammad Yassin, Abed Alkader Yassin, et al.

Cancer Res 2019;79:3862-3876. Published OnlineFirst June 7, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-18-3215

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2019/06/07/0008-5472.CAN-18-3215.DC1

Cited articles This article cites 82 articles, 26 of which you can access for free at: http://cancerres.aacrjournals.org/content/79/15/3862.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/79/15/3862.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/79/15/3862. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.