Published OnlineFirst June 7, 2019; DOI: 10.1158/0008-5472.CAN-18-3215 Cancer Molecular Cell Biology Research An ERG Enhancer–Based Reporter Identifies Leukemia Cells with Elevated Leukemogenic Potential Driven by ERG-USP9X Feed-Forward Regulation Nasma Aqaqe1, Muhammad Yassin1, Abed Alkader Yassin1, Nour Ershaid1, Chen Katz-Even1, Adi Zipin-Roitman1, Eitan Kugler3,4,5, Eric R. Lechman2, Olga I. Gan2, Amanda Mitchell2, John E. Dick2, Shai Izraeli3,4,5, and Michael Milyavsky1 Abstract Acute leukemia is a rapidly progressing blood cancer with fraction was enriched for leukemia-initiating cells in a low survival rates. Unfavorable prognosis is attributed to xenograft assay. We identified the ubiquitin hydrolase insufficiently characterized subpopulations of leukemia USP9X as a novel ERG transcriptional target that sustains stem cells (LSC) that drive chemoresistance and leukemia ERGþ85–positive cells by controlling ERG ubiquitination. relapse. Here we utilized a genetic reporter that assesses Therapeutic targeting of USP9X led to preferential inhibi- stemness to enrich and functionally characterize LSCs. We tion of the ERG-dependent leukemias. Collectively, these observed heterogeneous activity of the ERGþ85 enhancer– results characterize human leukemia cell functional hetero- based fluorescent reporter in human leukemias. Cells geneity and suggest that targeting ERG via USP9X inhibi- with high reporter activity (tagBFPHigh) exhibited elevated tion may be a potential treatment strategy in patients with expression of stemness and chemoresistance genes and leukemia. demonstrated increased clonogenicity and resistance to chemo- and radiotherapy as compared with their tagBFPNeg Significance: This study couples a novel experimental tool counterparts. The tagBFPHigh fraction was capable of regen- with state-of-the-art approaches to delineate molecular erating the original cellular heterogeneity and demonstrat- mechanisms underlying stem cell-related characteristics in ed increased invasive ability. Moreover, the tagBFPHigh leukemia cells. Introduction as well as functional variability, exists among the subsets of leukemia cells obtained from the same patient (3, 4). Functional Acute leukemia is a highly aggressive group of blood malig- heterogeneity model posits that a fraction of acute leukemia cells nancies that originate from hematopoietic stem cells (HSC). displays sufficient regenerative capacity to propagate the disease, Accumulation of blast cells in the bone marrow due to deregu- withstand chemotherapy, and cause leukemia relapse. Functional lation of molecular pathways controlling self-renewal and differ- resemblance of these leukemic cells to normal hematopoietic entiation of immature blood cells is the main feature of leuke- stem cells (HSC) contributed to their nomination as leukemia mia (1, 2). Well-recognized and prognostic genetic heterogeneity, stem cells (LSC; refs. 5, 6). Although recent studies have shown that phenotypic and 1Department of Pathology, Sackler Faculty of Medicine, Tel Aviv University, Tel genetic heterogeneity within tumors constitutes a major source Aviv, Israel. 2Princess Margaret Cancer Centre, University Health Network and of therapeutic resistance (7), efficient tools to identify and pull out Department of Molecular Genetics, University of Toronto, Toronto, Ontario, functional stem cell from the heterogeneous cell population are Canada. 3Department of Pediatric Hemato-Oncology, Schneider Children Med- 4 still lacking. Experimentally, the presence of functional human ical Center Petah-Tikva, Israel. The Gene Development and Environment fi Pediatric Research Institute, Pediatric Hemato-Oncology, Edmond and Lily Safra LSCs can be proved by their capacity to engraft immunode cient Children's Hospital, Sheba Medical Center, Tel Hashomer, Ramat Gan, Israel. mice and induce leukemia growth in their hematopoietic 5Department of Molecular Human Genetics and Biochemistry, Sackler Faculty of organs (8, 9). Up to date, enrichment for LSCs has been reached Medicine, Tel Aviv University, Tel Aviv, Israel. by focusing on: cell surface markers (10), metabolism (11, 12), Note: Supplementary data for this article are available at Cancer Research cell-cycle quiescence (13), and miRNA bioactivity (14). These Online (http://cancerres.aacrjournals.org/). studies and others demonstrated extraordinary inter- and even fl N. Aqaqe and M. Yassin contributed equally to this article. intra-sample (3) heterogeneity for LSC activity that was in u- enced by disease stage and type of therapy (10, 15, 16). Further- Corresponding Author: Michael Milyavsky, Tel Aviv University, Sackler Faculty more, prior studies emphasized the need to devise approaches of Medicine, Tel Aviv 6997801, Israel. Phone: 9725-4591-5351; fi E-mail: [email protected] that enable identi cation and isolation of viable human LSCs based on stemness state of the single cell to pinpoint molecular Cancer Res 2019;79:3862–76 regulators that maintain LSC properties. doi: 10.1158/0008-5472.CAN-18-3215 Here, we capitalized on our recent findings that a þ85 Ó2019 American Association for Cancer Research. enhancer of ERG transcription factor (TF) can be used as a 3862 Cancer Res; 79(15) August 1, 2019 Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst June 7, 2019; DOI: 10.1158/0008-5472.CAN-18-3215 An ERGþ85 Enhancer Regulates Leukemia Stemness probe of cellular stemness state in human normal and leukemic Leukemia xenotransplantation model cells when integrated into a lentiviral reporter system (17). All animal experimental protocols were approved by the Insti- Indeed, we and others demonstrated that the endogenous tutional Animal Care and Use Committee of Tel-Aviv University ERGþ85 enhancer is particularly active in human HSCs and (Tel Aviv, Israel). Jurkat cells were transplanted intrafemorally (IF) asubsetofleukemiasaswellassensitive to the net activity of as described previously (22) into 8- to 10-week-old NOD-scid the multiple TFs, termed heptad, implicated in stemness pro- IL2Rgnull-3/GM/SF (NSG-SGM3) mice, which were injected gram regulation (18–20). intraperitoneally with busulfan (30 mg/kg) 24 hours before Herein, by barcoding leukemia cell lines and patient sample transplantation. Human engraftment in the injected and non- with ERGþ85 reporter, we attempted to enrich and characterize injected bones was analyzed 6–8 weeks posttransplantation by leukemia subpopulations endowed with LSC properties that flow cytometry analysis using human-specific CD45-Alexa Fluor included superior leukemia initiation, invasion, and drug resis- 750–conjugated antibody, EGFP, and tagBFP positivity. The tance. Gene expression analysis of the subpopulations with dif- frequency of repopulating cells was calculated using ELDA soft- ferent levels of ERGþ85 reporter activity uncovered ERG/USP9X ware (23). feed-forward–regulatory relationships that can be targeted therapeutically. DNA constructs and cloning Dual promoter lentiviral reporter vectors (pMIN and pMIN- ERGþ85) were described elsewhere (17). The ERGþ85 fragment Materials and Methods was amplified using Prime GXL high fidelity polymerase Full list of references can be found in the Supplementary Data. (Clontech) from PGL2-ERGþ85 vector (24) and cloned into pMIN upstream of mCMV. Full-length human ERG cDNA was Acute myeloid lymphoma patient samples subcloned instead of EGFP into a bidirectional lentiviral vector The study was approved by the Institutional Review Boards MA1 (25). of Tel Aviv University (Tel Aviv, Israel) and University Health USP9X shRNAs were cloned into pLKO1-puro TRC plasmid Network (Toronto, Ontario, Canada). Written informed con- using EcoRI and AgeI restriction sites. Target sequences for shRNA sent (according to the Declaration of Helsinki) was obtained experiments were CCTAAGGTTAAGTCGCCCTCG (shScramble), from all patients. Acute myeloid lymphoma (AML) samples CCACCTCAAACCAAGGATCAA (shUSP9X#1), CGCCTGATTC- were cultured in StemSpanTM SFEM II medium (StemCell TTCCAATGAAA (shUSP9X #2), and GAGAGTTTATTCACTGTC- Technologies) supplemented with growth factors [IL3 TTA (shUSP9X #3). (10ng/mL),IL6(10ng/mL),G-CSF(10ng/mL),TPO (25 ng/mL), SCF (50 ng/mL), and FLT3L (50 ng/mL)] on Virus preparation and transduction procedure preestablished confluent MS-5 stromal cells. Viral particles were generated by transient transfection of 293T cells using CMVDeltaR8.91 and pMD2G constructs as described Cell lines and drug treatments elsewhere (26). Leukemia cells were infected by addition of viral ELF-153, KASUMI-1, AML193, and ME1 were cultured as supernatant to obtain 10%–30% infection rate. Jurkat cells were recommended by the manufacturer (DSMZ). Jurkat, THP1, and selected with puromycin (3 mg/mL) for 3 days in the USP9X K562 were described elsewhere and grown in RPMI supplemented knockdown experiments. After selection completion, cells were with FBS (10%), L-glutamine (1%), and penicillin/streptomycin replated for the downstream experiments. (1%). TEX cell line was grown as described elsewhere (21). All cell lines were authenticated by short tandem repeat profiling using Quantitative RT-PCR and microarrays PowerPlex16 HS kit (Promega). Cell number and viability was RNA was extracted with the TRIzol reagent (Invitrogen) and estimated using hemocytometer and Trypan blue exclusion assay, reverse transcribed with SuperScript III (Invitrogen). Real-time respectively. For radiation treatment experiments, cells were PCR reactions were prepared with