DOCSLIB.ORG

An ERG Enhancer–Based Reporter Identifies Leukemia Cells With

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An ERG Enhancer–Based Reporter Identifies Leukemia Cells With Published OnlineFirst June 7, 2019; DOI: 10.1158/0008-5472.CAN-18-3215 Cancer Molecular Cell Biology Research An ERG Enhancer–Based Reporter Identifies Leukemia Cells with Elevated Leukemogenic Potential Driven by ERG-USP9X Feed-Forward Regulation Nasma Aqaqe1, Muhammad Yassin1, Abed Alkader Yassin1, Nour Ershaid1, Chen Katz-Even1, Adi Zipin-Roitman1, Eitan Kugler3,4,5, Eric R. Lechman2, Olga I. Gan2, Amanda Mitchell2, John E. Dick2, Shai Izraeli3,4,5, and Michael Milyavsky1 Abstract Acute leukemia is a rapidly progressing blood cancer with fraction was enriched for leukemia-initiating cells in a low survival rates. Unfavorable prognosis is attributed to xenograft assay. We identified the ubiquitin hydrolase insufficiently characterized subpopulations of leukemia USP9X as a novel ERG transcriptional target that sustains stem cells (LSC) that drive chemoresistance and leukemia ERGþ85–positive cells by controlling ERG ubiquitination. relapse. Here we utilized a genetic reporter that assesses Therapeutic targeting of USP9X led to preferential inhibi- stemness to enrich and functionally characterize LSCs. We tion of the ERG-dependent leukemias. Collectively, these observed heterogeneous activity of the ERGþ85 enhancer– results characterize human leukemia cell functional hetero- based fluorescent reporter in human leukemias. Cells geneity and suggest that targeting ERG via USP9X inhibi- with high reporter activity (tagBFPHigh) exhibited elevated tion may be a potential treatment strategy in patients with expression of stemness and chemoresistance genes and leukemia. demonstrated increased clonogenicity and resistance to chemo- and radiotherapy as compared with their tagBFPNeg Significance: This study couples a novel experimental tool counterparts. The tagBFPHigh fraction was capable of regen- with state-of-the-art approaches to delineate molecular erating the original cellular heterogeneity and demonstrat- mechanisms underlying stem cell-related characteristics in ed increased invasive ability. Moreover, the tagBFPHigh leukemia cells. Introduction as well as functional variability, exists among the subsets of leukemia cells obtained from the same patient (3, 4). Functional Acute leukemia is a highly aggressive group of blood malig- heterogeneity model posits that a fraction of acute leukemia cells nancies that originate from hematopoietic stem cells (HSC). displays sufficient regenerative capacity to propagate the disease, Accumulation of blast cells in the bone marrow due to deregu- withstand chemotherapy, and cause leukemia relapse. Functional lation of molecular pathways controlling self-renewal and differ- resemblance of these leukemic cells to normal hematopoietic entiation of immature blood cells is the main feature of leuke- stem cells (HSC) contributed to their nomination as leukemia mia (1, 2). Well-recognized and prognostic genetic heterogeneity, stem cells (LSC; refs. 5, 6). Although recent studies have shown that phenotypic and 1Department of Pathology, Sackler Faculty of Medicine, Tel Aviv University, Tel genetic heterogeneity within tumors constitutes a major source Aviv, Israel. 2Princess Margaret Cancer Centre, University Health Network and of therapeutic resistance (7), efficient tools to identify and pull out Department of Molecular Genetics, University of Toronto, Toronto, Ontario, functional stem cell from the heterogeneous cell population are Canada. 3Department of Pediatric Hemato-Oncology, Schneider Children Med- 4 still lacking. Experimentally, the presence of functional human ical Center Petah-Tikva, Israel. The Gene Development and Environment fi Pediatric Research Institute, Pediatric Hemato-Oncology, Edmond and Lily Safra LSCs can be proved by their capacity to engraft immunode cient Children's Hospital, Sheba Medical Center, Tel Hashomer, Ramat Gan, Israel. mice and induce leukemia growth in their hematopoietic 5Department of Molecular Human Genetics and Biochemistry, Sackler Faculty of organs (8, 9). Up to date, enrichment for LSCs has been reached Medicine, Tel Aviv University, Tel Aviv, Israel. by focusing on: cell surface markers (10), metabolism (11, 12), Note: Supplementary data for this article are available at Cancer Research cell-cycle quiescence (13), and miRNA bioactivity (14). These Online (http://cancerres.aacrjournals.org/). studies and others demonstrated extraordinary inter- and even fl N. Aqaqe and M. Yassin contributed equally to this article. intra-sample (3) heterogeneity for LSC activity that was in u- enced by disease stage and type of therapy (10, 15, 16). Further- Corresponding Author: Michael Milyavsky, Tel Aviv University, Sackler Faculty more, prior studies emphasized the need to devise approaches of Medicine, Tel Aviv 6997801, Israel. Phone: 9725-4591-5351; fi E-mail: [email protected] that enable identi cation and isolation of viable human LSCs based on stemness state of the single cell to pinpoint molecular Cancer Res 2019;79:3862–76 regulators that maintain LSC properties. doi: 10.1158/0008-5472.CAN-18-3215 Here, we capitalized on our recent findings that a þ85 Ó2019 American Association for Cancer Research. enhancer of ERG transcription factor (TF) can be used as a 3862 Cancer Res; 79(15) August 1, 2019 Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst June 7, 2019; DOI: 10.1158/0008-5472.CAN-18-3215 An ERGþ85 Enhancer Regulates Leukemia Stemness probe of cellular stemness state in human normal and leukemic Leukemia xenotransplantation model cells when integrated into a lentiviral reporter system (17). All animal experimental protocols were approved by the Insti- Indeed, we and others demonstrated that the endogenous tutional Animal Care and Use Committee of Tel-Aviv University ERGþ85 enhancer is particularly active in human HSCs and (Tel Aviv, Israel). Jurkat cells were transplanted intrafemorally (IF) asubsetofleukemiasaswellassensitive to the net activity of as described previously (22) into 8- to 10-week-old NOD-scid the multiple TFs, termed heptad, implicated in stemness pro- IL2Rgnull-3/GM/SF (NSG-SGM3) mice, which were injected gram regulation (18–20). intraperitoneally with busulfan (30 mg/kg) 24 hours before Herein, by barcoding leukemia cell lines and patient sample transplantation. Human engraftment in the injected and non- with ERGþ85 reporter, we attempted to enrich and characterize injected bones was analyzed 6–8 weeks posttransplantation by leukemia subpopulations endowed with LSC properties that flow cytometry analysis using human-specific CD45-Alexa Fluor included superior leukemia initiation, invasion, and drug resis- 750–conjugated antibody, EGFP, and tagBFP positivity. The tance. Gene expression analysis of the subpopulations with dif- frequency of repopulating cells was calculated using ELDA soft- ferent levels of ERGþ85 reporter activity uncovered ERG/USP9X ware (23). feed-forward–regulatory relationships that can be targeted therapeutically. DNA constructs and cloning Dual promoter lentiviral reporter vectors (pMIN and pMIN- ERGþ85) were described elsewhere (17). The ERGþ85 fragment Materials and Methods was amplified using Prime GXL high fidelity polymerase Full list of references can be found in the Supplementary Data. (Clontech) from PGL2-ERGþ85 vector (24) and cloned into pMIN upstream of mCMV. Full-length human ERG cDNA was Acute myeloid lymphoma patient samples subcloned instead of EGFP into a bidirectional lentiviral vector The study was approved by the Institutional Review Boards MA1 (25). of Tel Aviv University (Tel Aviv, Israel) and University Health USP9X shRNAs were cloned into pLKO1-puro TRC plasmid Network (Toronto, Ontario, Canada). Written informed con- using EcoRI and AgeI restriction sites. Target sequences for shRNA sent (according to the Declaration of Helsinki) was obtained experiments were CCTAAGGTTAAGTCGCCCTCG (shScramble), from all patients. Acute myeloid lymphoma (AML) samples CCACCTCAAACCAAGGATCAA (shUSP9X#1), CGCCTGATTC- were cultured in StemSpanTM SFEM II medium (StemCell TTCCAATGAAA (shUSP9X #2), and GAGAGTTTATTCACTGTC- Technologies) supplemented with growth factors [IL3 TTA (shUSP9X #3). (10ng/mL),IL6(10ng/mL),G-CSF(10ng/mL),TPO (25 ng/mL), SCF (50 ng/mL), and FLT3L (50 ng/mL)] on Virus preparation and transduction procedure preestablished confluent MS-5 stromal cells. Viral particles were generated by transient transfection of 293T cells using CMVDeltaR8.91 and pMD2G constructs as described Cell lines and drug treatments elsewhere (26). Leukemia cells were infected by addition of viral ELF-153, KASUMI-1, AML193, and ME1 were cultured as supernatant to obtain 10%–30% infection rate. Jurkat cells were recommended by the manufacturer (DSMZ). Jurkat, THP1, and selected with puromycin (3 mg/mL) for 3 days in the USP9X K562 were described elsewhere and grown in RPMI supplemented knockdown experiments. After selection completion, cells were with FBS (10%), L-glutamine (1%), and penicillin/streptomycin replated for the downstream experiments. (1%). TEX cell line was grown as described elsewhere (21). All cell lines were authenticated by short tandem repeat profiling using Quantitative RT-PCR and microarrays PowerPlex16 HS kit (Promega). Cell number and viability was RNA was extracted with the TRIzol reagent (Invitrogen) and estimated using hemocytometer and Trypan blue exclusion assay, reverse transcribed with SuperScript III (Invitrogen). Real-time respectively. For radiation treatment experiments, cells were PCR reactions were prepared with
Load more

Recommended publications
  • ERG Dependence Distinguishes Developmental Control of Hematopoietic Stem Cell Maintenance from Hematopoietic Specification
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press ERG dependence distinguishes developmental control of hematopoietic stem cell maintenance from hematopoietic specification Samir Taoudi,1,2,6 Thomas Bee,3 Adrienne Hilton,1 Kathy Knezevic,3 Julie Scott,4 Tracy A. Willson,1,2 Caitlin Collin,1 Tim Thomas,1,2 Anne K. Voss,1,2 Benjamin T. Kile,1,2 Warren S. Alexander,2,5 John E. Pimanda,3 and Douglas J. Hilton1,2 1Molecular Medicine Division, The Walter and Eliza Institute of Medical Research, Melbourne, Parkville, Victoria 3052, Australia; 2Department of Medical Biology, The University of Melbourne, Melbourne, Parkville, Victoria 3010, Australia; 3Lowy Cancer Research Centre, The Prince of Wales Clinical School, University of New South Wales, Sydney 2052, Australia; 4Microinjection Services, The Walter and Eliza Institute of Medical Research, Melbourne, Parkville, Victoria 3052, Australia; 5Cancer and Haematology Division, The Walter and Eliza Institute of Medical Research, Melbourne, Parkville, Victoria 3052, Australia Although many genes are known to be critical for early hematopoiesis in the embryo, it remains unclear whether distinct regulatory pathways exist to control hematopoietic specification versus hematopoietic stem cell (HSC) emergence and function. Due to their interaction with key regulators of hematopoietic commitment, particular interest has focused on the role of the ETS family of transcription factors; of these, ERG is predicted to play an important role in the initiation of hematopoiesis, yet we do not know if or when ERG is required. Using in vitro and in vivo models of hematopoiesis and HSC development, we provide strong evidence that ERG is at the center of a distinct regulatory program that is not required for hematopoietic specification or differentiation but is critical for HSC maintenance during embryonic development.
    [Show full text]
  • Ubiquitin-Mediated Control of ETS Transcription Factors: Roles in Cancer and Development
    International Journal of Molecular Sciences Review Ubiquitin-Mediated Control of ETS Transcription Factors: Roles in Cancer and Development Charles Ducker * and Peter E. Shaw * Queen’s Medical Centre, School of Life Sciences, University of Nottingham, Nottingham NG7 2UH, UK * Correspondence: [email protected] (C.D.); [email protected] (P.E.S.) Abstract: Genome expansion, whole genome and gene duplication events during metazoan evolution produced an extensive family of ETS genes whose members express transcription factors with a conserved winged helix-turn-helix DNA-binding domain. Unravelling their biological roles has proved challenging with functional redundancy manifest in overlapping expression patterns, a common consensus DNA-binding motif and responsiveness to mitogen-activated protein kinase signalling. Key determinants of the cellular repertoire of ETS proteins are their stability and turnover, controlled largely by the actions of selective E3 ubiquitin ligases and deubiquitinases. Here we discuss the known relationships between ETS proteins and enzymes that determine their ubiquitin status, their integration with other developmental signal transduction pathways and how suppression of ETS protein ubiquitination contributes to the malignant cell phenotype in multiple cancers. Keywords: E3 ligase complex; deubiquitinase; gene fusions; mitogens; phosphorylation; DNA damage 1. Introduction Citation: Ducker, C.; Shaw, P.E. Cell growth, proliferation and differentiation are complex, concerted processes that Ubiquitin-Mediated Control of ETS Transcription Factors: Roles in Cancer rely on careful regulation of gene expression. Control over gene expression is maintained and Development. Int. J. Mol. Sci. through signalling pathways that respond to external cellular stimuli, such as growth 2021, 22, 5119. https://doi.org/ factors, cytokines and chemokines, that invoke expression profiles commensurate with 10.3390/ijms22105119 diverse cellular outcomes.
    [Show full text]
  • Inducible Transgene Expression in PDX Models
    Liu et al. Biomarker Research (2020) 8:46 https://doi.org/10.1186/s40364-020-00226-z RESEARCH Open Access Inducible transgene expression in PDX models in vivo identifies KLF4 as a therapeutic target for B-ALL Wen-Hsin Liu1, Paulina Mrozek-Gorska2, Anna-Katharina Wirth1, Tobias Herold1,3, Larissa Schwarzkopf1, Dagmar Pich2, Kerstin Völse1, M. Camila Melo-Narváez2, Michela Carlet1, Wolfgang Hammerschmidt2,4 and Irmela Jeremias1,5,6* Abstract Background: Clinically relevant methods are not available that prioritize and validate potential therapeutic targets for individual tumors, from the vast amount of tumor descriptive expression data. Methods: We established inducible transgene expression in clinically relevant patient-derived xenograft (PDX) models in vivo to fill this gap. Results: With this technique at hand, we analyzed the role of the transcription factor Krüppel-like factor 4 (KLF4) in B-cell acute lymphoblastic leukemia (B-ALL) PDX models at different disease stages. In competitive preclinical in vivo trials, we found that re-expression of wild type KLF4 reduced the leukemia load in PDX models of B-ALL, with the strongest effects being observed after conventional chemotherapy in minimal residual disease (MRD). A nonfunctional KLF4 mutant had no effect on this model. The re-expression of KLF4 sensitized tumor cells in the PDX model towards systemic chemotherapy in vivo. It is of major translational relevance that azacitidine upregulated KLF4 levels in the PDX model and a KLF4 knockout reduced azacitidine-induced cell death, suggesting that azacitidine can regulate KLF4 re-expression. These results support the application of azacitidine in patients with B-ALL as a therapeutic option to regulate KLF4.
    [Show full text]
  • Ten Commandments for a Good Scientist
    Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Wageningen 2010 Thesis committee Thesis supervisors Prof. dr. ir. Ivonne M.C.M. Rietjens Professor of Toxicology Wageningen University Prof. dr. Albertinka J. Murk Personal chair at the sub-department of Toxicology Wageningen University Thesis co-supervisor Dr. ir. Jacques J.M. Vervoort Associate professor at the Laboratory of Biochemistry Wageningen University Other members Prof. dr. Michael R. Muller, Wageningen University Prof. dr. ir. Huub F.J. Savelkoul, Wageningen University Prof. dr. Everardus J. van Zoelen, Radboud University Nijmegen Dr. ir. Toine F.H. Bovee, RIKILT, Wageningen This research was conducted under the auspices of the Graduate School VLAG Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 14 September 2010 at 4 p.m. in the Aula Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds. Ana María Sotoca Covaleda Thesis Wageningen University, Wageningen, The Netherlands, 2010, With references, and with summary in Dutch. ISBN: 978-90-8585-707-5 “Caminante no hay camino, se hace camino al andar. Al andar se hace camino, y al volver la vista atrás se ve la senda que nunca se ha de volver a pisar” - Antonio Machado – A mi madre.
    [Show full text]
  • Inhibition of Mitochondrial Complex II in Neuronal Cells Triggers Unique
    www.nature.com/scientificreports OPEN Inhibition of mitochondrial complex II in neuronal cells triggers unique pathways culminating in autophagy with implications for neurodegeneration Sathyanarayanan Ranganayaki1, Neema Jamshidi2, Mohamad Aiyaz3, Santhosh‑Kumar Rashmi4, Narayanappa Gayathri4, Pulleri Kandi Harsha5, Balasundaram Padmanabhan6 & Muchukunte Mukunda Srinivas Bharath7* Mitochondrial dysfunction and neurodegeneration underlie movement disorders such as Parkinson’s disease, Huntington’s disease and Manganism among others. As a corollary, inhibition of mitochondrial complex I (CI) and complex II (CII) by toxins 1‑methyl‑4‑phenylpyridinium (MPP+) and 3‑nitropropionic acid (3‑NPA) respectively, induced degenerative changes noted in such neurodegenerative diseases. We aimed to unravel the down‑stream pathways associated with CII inhibition and compared with CI inhibition and the Manganese (Mn) neurotoxicity. Genome‑wide transcriptomics of N27 neuronal cells exposed to 3‑NPA, compared with MPP+ and Mn revealed varied transcriptomic profle. Along with mitochondrial and synaptic pathways, Autophagy was the predominant pathway diferentially regulated in the 3‑NPA model with implications for neuronal survival. This pathway was unique to 3‑NPA, as substantiated by in silico modelling of the three toxins. Morphological and biochemical validation of autophagy markers in the cell model of 3‑NPA revealed incomplete autophagy mediated by mechanistic Target of Rapamycin Complex 2 (mTORC2) pathway. Interestingly, Brain Derived Neurotrophic Factor
    [Show full text]
  • X-Linked Diseases: Susceptible Females
    REVIEW ARTICLE X-linked diseases: susceptible females Barbara R. Migeon, MD 1 The role of X-inactivation is often ignored as a prime cause of sex data include reasons why women are often protected from the differences in disease. Yet, the way males and females express their deleterious variants carried on their X chromosome, and the factors X-linked genes has a major role in the dissimilar phenotypes that that render women susceptible in some instances. underlie many rare and common disorders, such as intellectual deficiency, epilepsy, congenital abnormalities, and diseases of the Genetics in Medicine (2020) 22:1156–1174; https://doi.org/10.1038/s41436- heart, blood, skin, muscle, and bones. Summarized here are many 020-0779-4 examples of the different presentations in males and females. Other INTRODUCTION SEX DIFFERENCES ARE DUE TO X-INACTIVATION Sex differences in human disease are usually attributed to The sex differences in the effect of X-linked pathologic variants sex specific life experiences, and sex hormones that is due to our method of X chromosome dosage compensation, influence the function of susceptible genes throughout the called X-inactivation;9 humans and most placental mammals – genome.1 5 Such factors do account for some dissimilarities. compensate for the sex difference in number of X chromosomes However, a major cause of sex-determined expression of (that is, XX females versus XY males) by transcribing only one disease has to do with differences in how males and females of the two female X chromosomes. X-inactivation silences all X transcribe their gene-rich human X chromosomes, which is chromosomes but one; therefore, both males and females have a often underappreciated as a cause of sex differences in single active X.10,11 disease.6 Males are the usual ones affected by X-linked For 46 XY males, that X is the only one they have; it always pathogenic variants.6 Females are biologically superior; a comes from their mother, as fathers contribute their Y female usually has no disease, or much less severe disease chromosome.
    [Show full text]
  • USP9X Regulates Centrosome Duplication and Promotes Breast Carcinogenesis
    ARTICLE Received 21 Feb 2016 | Accepted 31 Jan 2017 | Published 31 Mar 2017 DOI: 10.1038/ncomms14866 OPEN USP9X regulates centrosome duplication and promotes breast carcinogenesis Xin Li1,*, Nan Song1,*, Ling Liu1, Xinhua Liu1, Xiang Ding2, Xin Song3, Shangda Yang1, Lin Shan1, Xing Zhou1, Dongxue Su1, Yue Wang1, Qi Zhang1, Cheng Cao1, Shuai Ma1,NaYu1, Fuquan Yang2, Yan Wang1, Zhi Yao4, Yongfeng Shang1,5 & Lei Shi1,4 Defective centrosome duplication is implicated in microcephaly and primordial dwarfism as well as various ciliopathies and cancers. Yet, how the centrosome biogenesis is regulated remains poorly understood. Here we report that the X-linked deubiquitinase USP9X is physically associated with centriolar satellite protein CEP131, thereby stabilizing CEP131 through its deubiquitinase activity. We demonstrate that USP9X is an integral component of centrosome and is required for centrosome biogenesis. Loss-of-function of USP9X impairs centrosome duplication and gain-of-function of USP9X promotes centrosome amplification and chromosome instability. Significantly, USP9X is overexpressed in breast carcinomas, and its level of expression is correlated with that of CEP131 and higher histologic grades of breast cancer. Indeed, USP9X, through regulation of CEP131 abundance, promotes breast carcino- genesis. Our experiments identify USP9X as an important regulator of centrosome biogenesis and uncover a critical role for USP9X/CEP131 in breast carcinogenesis, supporting the pursuit of USP9X/CEP131 as potential targets for breast cancer intervention. 1 2011 Collaborative Innovation Center of Tianjin for Medical Epigenetics, Tianjin Key Laboratory of Medical Epigenetics, Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin 300070, China. 2 Laboratory of Proteomics, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China.
    [Show full text]
  • RUNX1 Together with a Compendium of Hematopoietic Regulators, Chromatin Modifiers and Basal Transcr
    Leukemia (2014) 28, 770–778 OPEN & 2014 Macmillan Publishers Limited All rights reserved 0887-6924/14 www.nature.com/leu ORIGINAL ARTICLE CBFB–MYH11/RUNX1 together with a compendium of hematopoietic regulators, chromatin modifiers and basal transcription factors occupies self-renewal genes in inv(16) acute myeloid leukemia A Mandoli1, AA Singh1, PWTC Jansen2, ATJ Wierenga3,4, H Riahi1, G Franci5, K Prange1, S Saeed1, E Vellenga3, M Vermeulen2, HG Stunnenberg1 and JHA Martens1 Different mechanisms for CBFb–MYH11 function in acute myeloid leukemia with inv(16) have been proposed such as tethering of RUNX1 outside the nucleus, interference with transcription factor complex assembly and recruitment of histone deacetylases, all resulting in transcriptional repression of RUNX1 target genes. Here, through genome-wide CBFb–MYH11-binding site analysis and quantitative interaction proteomics, we found that CBFb–MYH11 localizes to RUNX1 occupied promoters, where it interacts with TAL1, FLI1 and TBP-associated factors (TAFs) in the context of the hematopoietic transcription factors ERG, GATA2 and PU.1/SPI1 and the coregulators EP300 and HDAC1. Transcriptional analysis revealed that upon fusion protein knockdown, a small subset of the CBFb–MYH11 target genes show increased expression, confirming a role in transcriptional repression. However, the majority of CBFb–MYH11 target genes, including genes implicated in hematopoietic stem cell self-renewal such as ID1, LMO1 and JAG1, are actively transcribed and repressed upon fusion protein knockdown. Together these results suggest an essential role for CBFb–MYH11 in regulating the expression of genes involved in maintaining a stem cell phenotype. Leukemia (2014) 28, 770–778; doi:10.1038/leu.2013.257 Keywords: CBFb–MYH11; RUNX1; histone acetylation; acute myeloid leukemia; inv(16) INTRODUCTION Heterozygous Cbfb-Myh11 knock-in mice are embryonic lethal, Core-binding transcription factors (CBFs) have roles in stem cell with definitive hematopoiesis blocked at the stem-cell level.
    [Show full text]
  • The Histone Methyltransferase MMSET/WHSC1 Activates TWIST1 to Promote an Epithelial–Mesenchymal Transition and Invasive Properties of Prostate Cancer
    Oncogene (2013) 32, 2882–2890 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc ORIGINAL ARTICLE The histone methyltransferase MMSET/WHSC1 activates TWIST1 to promote an epithelial–mesenchymal transition and invasive properties of prostate cancer T Ezponda1, R Popovic1, MY Shah1, E Martinez-Garcia1, Y Zheng2, D-J Min1, C Will1, A Neri3, NL Kelleher1,2,JYu1 and JD Licht1 Epigenetic deregulation of gene expression has a role in the initiation and progression of prostate cancer (PCa). The histone methyltransferase MMSET/WHSC1 (Multiple Myeloma SET domain) is overexpressed in a number of metastatic tumors, but its mechanism of action has not been defined. In this work, we found that PCa cell lines expressed significantly higher levels of MMSET compared with immortalized, non-transformed prostate cells. Knockdown experiments showed that, in metastatic PCa cell lines, dimethylation of lysine 36 and trimethylation of lysine 27 on histone H3 (H3K36me2 and H3K27me3, respectively) depended on MMSET expression, whereas depletion of MMSET in benign prostatic cells did not affect chromatin modifications. Knockdown of MMSET in DU145 and PC-3 tumor cells decreased cell proliferation, colony formation in soft agar and strikingly diminished cell migration and invasion. Conversely, overexpression of MMSET in immortalized, non-transformed RWPE-1 cells promoted cell migration and invasion, accompanied by an epithelial–mesenchymal transition (EMT). Among a panel of EMT-promoting genes analyzed, TWIST1 expression was strongly activated in response to MMSET. Chromatin immunoprecipitation analysis demonstrated that MMSET binds to the TWIST1 locus and leads to an increase in H3K36me2, suggesting a direct role of MMSET in the regulation of this gene.
    [Show full text]
  • GATA3-Controlled Nucleosome Eviction Drives MYC Enhancer Activity in T-Cell Development and Leukemia
    Published OnlineFirst September 13, 2019; DOI: 10.1158/2159-8290.CD-19-0471 RESEARCH ARTICLE GATA3-Controlled Nucleosome Eviction Drives MYC Enhancer Activity in T-cell Development and Leukemia Laura Belver1, Alexander Y. Yang1, Robert Albero1, Daniel Herranz2,3, Francesco G. Brundu4, S. Aidan Quinn1, Pablo Pérez-Durán1, Silvia Álvarez1, Francesca Gianni1, Marissa Rashkovan1, Devya Gurung1, Pedro P. Rocha5, Ramya Raviram6,7, Clara Reglero1, Jose R. Cortés1, Anisha J. Cooke1, Agnieszka A. Wendorff1, Valentina Cordó8, Jules P. Meijerink8, Raúl Rabadan4,9, and Adolfo A. Ferrando1,4,10,11 ABSTRACT Long-range enhancers govern the temporal and spatial control of gene express ion; however, the mechanisms that regulate enhancer activity during normal and malig- nant development remain poorly understood. Here, we demonstrate a role for aberrant chromatin acces- sibility in the regulation of MYC expression in T-cell lymphoblastic leukemia (T-ALL). Central to this process, the NOTCH1-MYC enhancer (N-Me), a long-range T cell–specificMYC enhancer, shows dynamic changes in chromatin accessibility during T-cell specification and maturation and an aberrant high degree of chromatin accessibility in mouse and human T-ALL cells. Mechanistically, we demonstrate that GATA3- driven nucleosome eviction dynamically modulates N-Me enhancer activity and is strictly required for NOTCH1-induced T-ALL initiation and maintenance. These results directly implicate aberrant regulation of chromatin accessibility at oncogenic enhancers as a mechanism of leukemic transformation. SIGNIFICANCE: MYC is a major effector of NOTCH1 oncogenic programs in T-ALL. Here, we show a major role for GATA3-mediated enhancer nucleosome eviction as a driver of MYC expression and leuke- mic transformation.
    [Show full text]
  • The Erg Gene: a Human Gene Related to the Ets Oncogene (Cloning/Sequencing/Expression/Oncogene Homology) E
    Proc. Nati. Acad. Sci. USA Vol. 84, pp. 6131-6135, September 1987 Biochemistry The erg gene: A human gene related to the ets oncogene (cloning/sequencing/expression/oncogene homology) E. SHYAM P. REDDY*t, VEENA N. RAOI, AND TAKIS S. PAPAS: tLaboratory of Molecular Oncology and *Programme Resources, Inc., National Cancer Institute, Frederick, MD 21701 Communicated by Max Tishler, May 26, 1987 ABSTRACT We have isolated a cDNA clone representing the complete coding sequence of a human gene named erg, RP C P R P R C R related to the ets oncogene. Nucleotide sequence analysis of this X7 ,i cDNA (4.6 kilobases long) revealed that this gene encodes a (erg 1) ATG TAA AATAAA 363-residue protein whose predicted amino acid sequence showed a homology of -40% and -7O% to two domains corresponding to the 5' and 3' regions of v-ets oncogene, 200 bp respectively. A 3.2- to 3.6-kilobase and -5-kilobase transcript FIG. 1. Analysis of the coding region of the -5-kb human ergl of the erg gene, which differ in size from those ofthe previously mRNA performed on a single phage "4.6-kb cDNA spanning the described Hu-ets 1 and Hu-ets 2 genes, were observed in entire region. Hatched boxes represent 5' (left) and 3' (right) different cells. These results suggest that the erg gene is a homologous regions of v-ets oncogene. Initiation codon (ATG), member of the ets oncogene family. termination codon (TAA), and polyadenylylation signal (AATAAA) are also shown. Horizontal arrow represents an 8-bp sequence, a avian which is repeated twice as a direct repeat in another cDNA clone E26 is replication-defective acute leukemia virus, (erg2).
    [Show full text]
  • BAALC Potentiates Oncogenic ERK Pathway Through Interactions with MEKK1 and KLF4
    Leukemia (2015) 29, 2248–2256 © 2015 Macmillan Publishers Limited All rights reserved 0887-6924/15 www.nature.com/leu ORIGINAL ARTICLE BAALC potentiates oncogenic ERK pathway through interactions with MEKK1 and KLF4 K Morita1, Y Masamoto1, K Kataoka1, J Koya1, Y Kagoya1, H Yashiroda2, T Sato1,3, S Murata2 and M Kurokawa1,4 Although high brain and acute leukemia, cytoplasmic (BAALC) expression is a well-characterized poor prognostic factor in acute myeloid leukemia (AML), neither the exact mechanisms by which BAALC drives leukemogenesis and drug resistance nor therapeutic approaches against BAALC-high AML have been properly elucidated. In this study, we found that BAALC induced cell- cycle progression of leukemia cells by sustaining extracellular signal-regulated kinase (ERK) activity through an interaction with a scaffold protein MEK kinase-1 (MEKK1), which inhibits the interaction between ERK and MAP kinase phosphatase 3 (MKP3/DUSP6). BAALC conferred chemoresistance in AML cells by upregulating ATP-binding cassette proteins in an ERK-dependent manner, which can be therapeutically targeted by MEK inhibitor. We also demonstrated that BAALC blocks ERK-mediated monocytic differentiation of AML cells by trapping Krüppel-like factor 4 (KLF4) in the cytoplasm and inhibiting its function in the nucleus. Consequently, MEK inhibition therapy synergizes with KLF4 induction and is highly effective against BAALC-high AML cells both in vitro and in vivo. Our data provide a molecular basis for the role of BAALC in regulating proliferation and differentiation of AML cells and highlight the unique dual function of BAALC as an attractive therapeutic target against BAALC-high AML. Leukemia (2015) 29, 2248–2256; doi:10.1038/leu.2015.137 INTRODUCTION Previous reports have suggested a fundamental role of MEKK1 in 11,12 Acute myeloid leukemia (AML) is a clonal disorder characterized anti-apoptotic function in myeloid cells and leukemogenesis.
    [Show full text]