DOCSLIB.ORG

Mutations in the Drosophila Mitochondrial Trna Amidotransferase, Bene/Gata, Cause Growth Defects in Mitotic and Endoreplicating Tissues

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutations in the Drosophila Mitochondrial Trna Amidotransferase, Bene/Gata, Cause Growth Defects in Mitotic and Endoreplicating Tissues Copyright Ó 2008 by the Genetics Society of America DOI: 10.1534/genetics.107.084376 Mutations in the Drosophila Mitochondrial tRNA Amidotransferase, bene/gatA, Cause Growth Defects in Mitotic and Endoreplicating Tissues Jason Z. Morris,1 Leah Bergman, Anna Kruyer, Mikhail Gertsberg, Adriana Guigova, Ronald Arias and Monika Pogorzelska Department of Natural Sciences, Fordham University, New York, New York 10023 Manuscript received November 9, 2007 Accepted for publication December 5, 2007 ABSTRACT Rapid larval growth is essential in the development of most metazoans. In this article, we show that bene, a gene previously identified on the basis of its oogenesis defects, is also required for larval growth and viability. We show that all bene alleles disrupt gatA, which encodes the Drosophila homolog of glutamyl- tRNA(Gln) amidotransferase subunit A (GatA). bene alleles are now referred to as gatA. GatA proteins are highly conserved throughout eukaryotes and many prokaryotes. These enzymes are required for proper translation of the proteins encoded by the mitochondrial genome and by many eubacterial genomes. Mitotic and endoreplicating tissues in Drosophila gatA loss-of-function mutants grow slowly and never achieve wild- type size, and gatA larvae die before pupariation. gatA mutant eye clones exhibit growth and differentiation defects, indicating that gatA expression is required cell autonomously for normal growth. The gatA gene is widely expressed in mitotic and endoreplicating tissues. OR most metazoans, the energy stores available not regulate the growth of the endoreplicating tissues F during embryogenesis are sufficient to implement that contribute most to larval growth (Britton et al. the basic body plan, but not to attain the necessary size 2002). Organ size is also under the control of the hippo for reproductive development. Free-living larvae con- pathway, which regulates cell cycle and apoptosis sume and expend enormous resources to attain ap- (Saucedo and Edgar 2007). Drosophila size is also propriate size for adulthood. Larvae grow by increasing regulated by the cell growth/cell cycle regulators dMyc cell size and/or cell number in a manner consistent and cyclin D-Cdk4 and by the insulin–Tor-signaling with the needs of the organism and the availability of pathway, which acts to coordinate anabolic metabolism metabolic factors, including amino acids and energy. and cell growth with nutrient supply (Weinkove and Drosophila larvae increase their mass 200-fold Leevers 2000; Edgar 2006). during the 4-day larval period (Lilly and Duronio Several metabolic factors are essential for normal 2005). Some larval tissues, including the central nervous growth in Drosophila. The translation initiation factor system and the imaginal discs, grow via mitotic division, EIF4A regulates Drosophila growth in a dose-dependent but most larval growth is due to increasing cell size in manner (Galloni and Edgar 1999). EIF4A was also endoreplicating tissues. Cells in some of these tissues, recently shown to act downstream of the Drosophila such as the salivary gland and fat body, increase their BMP homolog, Dpp, in regulating cell growth in the DNA content to hundreds of times that of a normal amnioserosa (Li and Li 2006). The Minute genes, which diploid cell and achieve gigantic size. Adult cells that have long been known to mediate cell growth and cell require rapid growth, such as the nurse cells of the ovary, competition, encode many cytoplasmic ribosomal pro- also rely on endoreplication (Edgar and Orr-Weaver teins (Lambertsson 1998). Mutations in three other 2001). cytoplasmic ribosomal proteins, Pixie, RpL5, and RpL38, Multiple mechanisms in the fly control tissue and disrupt wing development downstream of the insulin organism size by coordinating cell growth and cell cycle pathway (Coelho et al. 2005). Defects in Bonsai, a mito- regulation with developmental programs and with chondrial ribosomal protein, result in small larvae that nutritional state. Most of the major intercellular signal- exhibit cell proliferation defects (Galloni and Edgar ing pathways, including Wnt, BMP, Notch, and Hedge- 1999; Galloni 2003). Whether these mutants grow hog, locally affect the size of mitotically dividing tissues poorly simply due to lack of permissive factors (e.g., via control of cell division and/or cell death, but they do efficient translation or energy production) or to instruc- tive signals regulating energy allocation to cell growth is an open question (see discussion). 1Corresponding author: Department of Natural Sciences, Fordham Mutants in benedict (bene) were first isolated in a clonal University, 113 W. 60th St., LOW 813, New York, NY 10023. screen in the Drosophila ovary for oogenesis defects Genetics 178: 979–987 (February 2008) 980 J. Z. Morris et al. (Morris et al. 2003). All three bene alleles isolated in the et al. 2004). PCR templates were sequenced (Fisher) and clonal screen are lethal in trans to each other or the analyzed using DNAStar software. Sequences were compared ltschul deficiency. Egg chambers with homozygous bene mutant to the Drosophila genome by BLAST (A et al. 1990) and aligned with ClustalW (Chenna et al. 2003). germ cells arrest in mid-oogenesis. The nurse cell Eye clones: w, ey-FLP, Gla-lacZ; FRT Rps3, P{ubi-GFP, w1}/ chromosomes in these clones contain less DNA than TM6B females were crossed by FRTe gatA50/TM3, Sb males, FRT those in similarly aged heterozygous egg chambers, and e gatA112/TM3, Sb males, or FRT 1/TM3, Sb males. We they fail to properly transition from polytene to poly- submerged adult offspring in 100% ethanol and photo- ploid chromosomal morphology. Instead, the nurse cell graphed the eyes with a Zeiss Stemi SV11 Apo microscope and a Zeiss Axio Cam HRc camera. chromosomes appear tightly condensed well into mid- Immunofluorescence and DAPI staining: Larvae were oogenesis. bene oocyte chromosomes appear stringy and dissected in Ringers or 13 insect PBS and fixed in 4% fragmented in contrast with the condensed, spherical formaldehyde in PBS. Subsequent washes were carried out in karyosome morphology of wild-type oocyte chromo- PBSTr (13 PBS with 1% triton) with the following exceptions: somes (Morris et al. 2003). The germ cell clone defects when antibody was used, primary blocking and incubation and subsequent washes were in PBSTrB (PBSTr with 1% BSA). in the ovary were cell autonomous; mutant polyploid Secondary blocking and incubation was in PBSTrB-S (PBSTrB nurse cells and meiotic oocytes displayed growth and with 5% normal donkey serum from Jackson Immunoresearch chromosome morphology phenotypes and other tissues Laboratories). Two micrograms of DAPI was added to the appeared wild type (Morris et al. 2003). penultimate wash. We photographed samples using a Nikon In this article, we molecularly identify bene as the gene Eclipse 50i microscope and a Photometric Coolsnap EZ camera. encoding Drosophila glutamyl-tRNA(Gln) amidotrans- Allele sequencing and sequence analysis: PCR templates for ferase subunit A (GatA), a protein required in many sequencing of the gatA- and NP15.6-coding regions were prokaryotes and in mitochondria for proper translation generated using the Expand Hi-Fidelity PCR kit (Boehringer of glutamine codons. We therefore rename the 50-40, Mannheim, Indianapolis). Products of PCR reactions were 112-38, and 145-30 alleles isolated in the clonal screen as purified from agarose gels using the QiaexII kit (QIAGEN, 50 112 145 Valencia, CA) and sequenced with gene-specific primers gatA , gatA , and gatA , respectively. We show that (Fisher). Sequences were assembled and analyzed using the gatA mutant larvae exhibit several growth and matura- Lasergene DNAStar programs Editseq and Seqman. ClustalW tion defects, including molting delays and decreased sequence alignments were generated using the DNAStar Mega- size of mitotic and endoreplicating tissues. The larvae lign program. 50 112 die before pupariation. Consistent with an essential role Northern blot: We crossed gatA /TM3,Sb kr-GFP by gatA / TM3,Sb kr-GFP. Five days after egg laying (AEL) we used the in mitochondrial function, we show that gatA is ex- GFP balancer to sort gatA50/gatA112 larvae from gatA/TM3, Sb pressed widely in many tissues in larvae and adults. We kr-GFP. Total RNA was purified using TRIZOL (Invitrogen, also show by mosaic analysis that gatA is required in eyes, San Diego) and mRNA was purified using the MAG mRNA as it is in egg chambers, for normal growth. purification kit (Ambion), using 115 mg total RNA from both larval classes. We ran and blotted the formaldehyde gel using standard techniques and probed the blot sequentially with random-primed 32P probes from PCR templates of NK15.6 and MATERIALS AND METHODS RP49. Drosophila stocks, culturing and scoring of larvae, and RT–PCR: Wild-type larvae were dissected 5 days AEL and genetic and molecular mapping: Stocks were maintained on the following tissues were isolated: gut (entire), imaginal discs standard Drosophila medium at 18°. All fly crosses and stocks for (mixed eye-antennal, leg, and wing), fat body, salivary gland experiments were grown at 25°. The Bloomington Drosophila (with some associated fat body), and brain (including optic Stock Center, the Drosophila Stock Center in Szeged, Hungary, lobes and ventral ganglia). We also dissected the ovaries from and the Lehmann, Treisman, and Johnston labs all provided adult females. We purified Trizol (Invitrogen), and we carried stocks. The following stocks were used: gatA50/TM3,Sb, gatA112/ out first-strand cDNA synthesis with the Superscript II kit TM3,Sb, gatA145/TM3,Sb, Df(3R)cha7,red1/TM6B, hs-hid/TM3,Sb, (Invitrogen) and poly(dT) primers. We used the following kr-GFP, P{neoFRT}82B, P{lacW}l(3)S092902/TM3,Sb, Df(3R) PCR primers that flank the third intron of gatA: sense primer Exel6182/TM6B, Df(3R)Exel6183/TM6B, w, ey-FLP, Gla-lacZ; FRT (GACTAAGAACATCTGGAGCG) and antisense primer (CAG Rps3, P{ubi-GFP,andw1}/ TM6B. ATGTAACCTGGTAAAAGGC). All gatA alleles and Df(3R)cha7,red1 were balanced over TM3,Sb,kr-GFP using hs-hid/TM3,Sb,kr-GFP.
Load more

Recommended publications
  • A Helicase-Independent Activity of Eif4a in Promoting Mrna Recruitment to the Human Ribosome
    A helicase-independent activity of eIF4A in promoting mRNA recruitment to the human ribosome Masaaki Sokabea and Christopher S. Frasera,1 aDepartment of Molecular and Cellular Biology, College of Biological Sciences, University of California, Davis, CA 95616 Edited by Alan G. Hinnebusch, National Institutes of Health, Bethesda, MD, and approved May 5, 2017 (received for review December 12, 2016) In the scanning model of translation initiation, the decoding site and at the solvent side of the mRNA entry channel (14). Importantly, latch of the 40S subunit must open to allow the recruitment and that study showed that a short mRNA that does not extend into the migration of messenger RNA (mRNA); however, the precise molec- entry channel fails to displace eIF3j. A similar observation was also ular details for how initiation factors regulate mRNA accommodation found for initiation mediated by the hepatitis C virus internal ribo- into the decoding site have not yet been elucidated. Eukaryotic some entry site, where an mRNA truncated after the initiation co- initiation factor (eIF) 3j is a subunit of eIF3 that binds to the mRNA don failed to displace eIF3j (11). Taken together, these studies entry channel and A-site of the 40S subunit. Previous studies have suggest a model in which a full accommodation of mRNA in the shown that a reduced affinity of eIF3j for the 43S preinitiation mRNA entry channel of the 40S subunit corresponds to a reduced complex (PIC) occurs on eIF4F-dependent mRNA recruitment. Because affinity of eIF3j for the 40S subunit. This model has allowed us to eIF3j and mRNA bind anticooperatively to the 43S PIC, reduced eIF3j exploit the change in eIF3j affinity for the 43S PIC to quantitatively affinity likely reflects a state of full accommodation of mRNA into the monitor the process of mRNA recruitment.
    [Show full text]
  • Ten Commandments for a Good Scientist
    Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Wageningen 2010 Thesis committee Thesis supervisors Prof. dr. ir. Ivonne M.C.M. Rietjens Professor of Toxicology Wageningen University Prof. dr. Albertinka J. Murk Personal chair at the sub-department of Toxicology Wageningen University Thesis co-supervisor Dr. ir. Jacques J.M. Vervoort Associate professor at the Laboratory of Biochemistry Wageningen University Other members Prof. dr. Michael R. Muller, Wageningen University Prof. dr. ir. Huub F.J. Savelkoul, Wageningen University Prof. dr. Everardus J. van Zoelen, Radboud University Nijmegen Dr. ir. Toine F.H. Bovee, RIKILT, Wageningen This research was conducted under the auspices of the Graduate School VLAG Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 14 September 2010 at 4 p.m. in the Aula Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds. Ana María Sotoca Covaleda Thesis Wageningen University, Wageningen, The Netherlands, 2010, With references, and with summary in Dutch. ISBN: 978-90-8585-707-5 “Caminante no hay camino, se hace camino al andar. Al andar se hace camino, y al volver la vista atrás se ve la senda que nunca se ha de volver a pisar” - Antonio Machado – A mi madre.
    [Show full text]
  • Initiation Factor Eif5b Catalyzes Second GTP-Dependent Step in Eukaryotic Translation Initiation
    Initiation factor eIF5B catalyzes second GTP-dependent step in eukaryotic translation initiation Joon H. Lee*†, Tatyana V. Pestova†‡§, Byung-Sik Shin*, Chune Cao*, Sang K. Choi*, and Thomas E. Dever*¶ *Laboratory of Gene Regulation and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892-2716; ‡Department of Microbiology and Immunology, State University of New York Health Science Center, Brooklyn, NY 11203; and §A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow, Russia Edited by Harry F. Noller, University of California, Santa Cruz, CA, and approved October 31, 2002 (received for review September 19, 2002) Initiation factors IF2 in bacteria and eIF2 in eukaryotes are GTPases In addition, when nonhydrolyzable GDPNP was substituted Met that bind Met-tRNAi to the small ribosomal subunit. eIF5B, the for GTP, eIF5B catalyzed subunit joining; however, the factor eukaryotic ortholog of IF2, is a GTPase that promotes ribosomal was unable to dissociate from the 80S ribosome after subunit subunit joining. Here we show that eIF5B GTPase activity is re- joining (7). quired for protein synthesis. Mutation of the conserved Asp-759 in To dissect the function of the eIF5B G domain and test the human eIF5B GTP-binding domain to Asn converts eIF5B to an model that two GTP molecules are required in translation XTPase and introduces an XTP requirement for subunit joining and initiation, we mutated conserved residues in the eIF5B G translation initiation. Thus, in contrast to bacteria where the single domain and tested the function of the mutant proteins in GTPase IF2 is sufficient to catalyze translation initiation, eukaryotic translation initiation.
    [Show full text]
  • Eif4a Is Stimulated by the Pre-Initiation Complex and Enhances Recruitment of Mrnas Regardless of Structural Complexity
    bioRxiv preprint doi: https://doi.org/10.1101/147959; this version posted June 13, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 eIF4A is stimulated by the pre-initiation complex and enhances recruitment of mRNAs regardless of structural 2 complexity 3 Paul Yourik1, Colin Echeverría Aitken1, Fujun Zhou1, Neha Gupta1,2, Alan G. Hinnebusch2,3, Jon R. Lorsch1,3 4 5 1Laboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child 6 Health and Development, National Institutes of Health, Bethesda, MD 20892 7 2Laboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and 8 Human Development, National Institutes of Health, Bethesda, MD 20892, USA 9 3Corresponding Author 10 11 ABSTRACT 12 eIF4A is a DEAD-box RNA-dependent ATPase thought to unwind RNA secondary structure in the 5'-untranslated 13 regions (UTRs) of mRNAs to promote their recruitment to the eukaryotic translation pre-initiation complex (PIC). We 14 show that the PIC stimulates the ATPase of eIF4A, indicating that the factor acts in association with initiating ribosomal 15 complexes rather than exclusively on isolated mRNAs. ATP hydrolysis by eIF4A accelerates the rate of recruitment for 16 all mRNAs tested, regardless of their degree of secondary structure, indicating that the factor plays important roles 17 beyond unwinding mRNA structure. Structures in the 5'-UTR and 3' of the start codon synergistically inhibit mRNA 18 recruitment, in a manner relieved by eIF4A, suggesting that the factor resolves global mRNA structure rather than just 19 secondary structures in the 5'-UTR.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Rps3/Us3 Promotes Mrna Binding at the 40S Ribosome Entry Channel and Stabilizes Preinitiation Complexes at Start Codons
    Rps3/uS3 promotes mRNA binding at the 40S ribosome entry channel and stabilizes preinitiation complexes at start codons Jinsheng Donga, Colin Echeverría Aitkenb, Anil Thakura, Byung-Sik Shina, Jon R. Lorschb,1, and Alan G. Hinnebuscha,1 aLaboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892; and bLaboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892 Contributed by Alan G. Hinnebusch, January 24, 2017 (sent for review December 15, 2016; reviewed by Jamie H. D. Cate and Matthew S. Sachs) Met The eukaryotic 43S preinitiation complex (PIC) bearing Met-tRNAi rearrangement to PIN at both near-cognate start codons (e.g., in a ternary complex (TC) with eukaryotic initiation factor (eIF)2-GTP UUG) and cognate (AUG) codons in poor Kozak context; hence scans the mRNA leader for an AUG codon in favorable “Kozak” eIF1 must dissociate from the 40S subunit for start-codon rec- context. AUG recognition provokes rearrangement from an open ognition (Fig. 1A). Consistent with this, structural analyses of PIC conformation with TC bound in a state not fully engaged with partial PICs reveal that eIF1 and eIF1A promote rotation of the “ ” the P site ( POUT ) to a closed, arrested conformation with TC tightly 40S head relative to the body (2, 3), thought to be instrumental bound in the “P ” state. Yeast ribosomal protein Rps3/uS3 resides IN in TC binding in the POUT conformation, but that eIF1 physically in the mRNA entry channel of the 40S subunit and contacts mRNA Met clashes with Met-tRNAi in the PIN state (2, 4), and is both via conserved residues whose functional importance was unknown.
    [Show full text]
  • Relevance of Translation Initiation in Diffuse Glioma Biology and Its
    cells Review Relevance of Translation Initiation in Diffuse Glioma Biology and its Therapeutic Potential Digregorio Marina 1, Lombard Arnaud 1,2, Lumapat Paul Noel 1, Scholtes Felix 1,2, Rogister Bernard 1,3 and Coppieters Natacha 1,* 1 Laboratory of Nervous System Disorders and Therapy, GIGA-Neurosciences Research Centre, University of Liège, 4000 Liège, Belgium; [email protected] (D.M.); [email protected] (L.A.); [email protected] (L.P.N.); [email protected] (S.F.); [email protected] (R.B.) 2 Department of Neurosurgery, CHU of Liège, 4000 Liège, Belgium 3 Department of Neurology, CHU of Liège, 4000 Liège, Belgium * Correspondence: [email protected] Received: 18 October 2019; Accepted: 26 November 2019; Published: 29 November 2019 Abstract: Cancer cells are continually exposed to environmental stressors forcing them to adapt their protein production to survive. The translational machinery can be recruited by malignant cells to synthesize proteins required to promote their survival, even in times of high physiological and pathological stress. This phenomenon has been described in several cancers including in gliomas. Abnormal regulation of translation has encouraged the development of new therapeutics targeting the protein synthesis pathway. This approach could be meaningful for glioma given the fact that the median survival following diagnosis of the highest grade of glioma remains short despite current therapy. The identification of new targets for the development of novel therapeutics is therefore needed in order to improve this devastating overall survival rate. This review discusses current literature on translation in gliomas with a focus on the initiation step covering both the cap-dependent and cap-independent modes of initiation.
    [Show full text]
  • The Mtorc1-4E-BP-Eif4e Axis Controls De Novo Bcl6 Protein Synthesis in T Cells and Systemic Autoimmunity
    ARTICLE DOI: 10.1038/s41467-017-00348-3 OPEN The mTORC1-4E-BP-eIF4E axis controls de novo Bcl6 protein synthesis in T cells and systemic autoimmunity Woelsung Yi1, Sanjay Gupta1, Edd Ricker2, Michela Manni1, Rolf Jessberger3, Yurii Chinenov4,5, Henrik Molina6 & Alessandra B. Pernis1,2,7 Post-transcriptional modifications can control protein abundance, but the extent to which these alterations contribute to the expression of T helper (TH) lineage-defining factors is unknown. Tight regulation of Bcl6 expression, an essential transcription factor for T follicular helper (TFH) cells, is critical as aberrant TFH cell expansion is associated with autoimmune diseases, such as systemic lupus erythematosus (SLE). Here we show that lack of the SLE risk variant Def6 results in deregulation of Bcl6 protein synthesis in T cells as a result of enhanced activation of the mTORC1–4E-BP–eIF4E axis, secondary to aberrant assembly of a raptor–p62–TRAF6 complex. Proteomic analysis reveals that this pathway selectively controls the abundance of a subset of proteins. Rapamycin or raptor deletion ameliorates the aberrant TFH cell expansion in mice lacking Def6. Thus deregulation of mTORC1-dependent pathways controlling protein synthesis can result in T-cell dysfunction, indicating a mechanism by which mTORC1 can promote autoimmunity. 1 Autoimmunity and Inflammation Program, Hospital for Special Surgery, 535 East 70th Street, New York, New York 10021 USA. 2 Graduate Program in Immunology and Microbial Pathogenesis, Weill Cornell Graduate School of Medical Sciences, 1300 York Avenue, Box 65, New York, New York 10021 USA. 3 Institute of Physiological Chemistry, Technische Universität Dresden, Fiedlerstrasse 42, MTZ, 01307 Dresden, Germany.
    [Show full text]
  • Distinct Interactions of Eif4a and Eif4e with RNA Helicase Ded1 Stimulate Translation in Vivo Suna Gulay, Neha Gupta, Jon R Lorsch, Alan G Hinnebusch*
    RESEARCH ARTICLE Distinct interactions of eIF4A and eIF4E with RNA helicase Ded1 stimulate translation in vivo Suna Gulay, Neha Gupta, Jon R Lorsch, Alan G Hinnebusch* Division of Molecular and Cellular Biology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, United States Abstract Yeast DEAD-box helicase Ded1 stimulates translation initiation, particularly of mRNAs with structured 5’UTRs. Interactions of the Ded1 N-terminal domain (NTD) with eIF4A, and Ded1- CTD with eIF4G, subunits of eIF4F, enhance Ded1 unwinding activity and stimulation of preinitiation complex (PIC) assembly in vitro. However, the importance of these interactions, and of Ded1-eIF4E association, in vivo were poorly understood. We identified separate amino acid clusters in the Ded1-NTD required for binding to eIF4A or eIF4E in vitro. Disrupting each cluster selectively impairs native Ded1 association with eIF4A or eIF4E, and reduces cell growth, polysome assembly, and translation of reporter mRNAs with structured 5’UTRs. It also impairs Ded1 stimulation of PIC assembly on a structured mRNA in vitro. Ablating Ded1 interactions with eIF4A/eIF4E unveiled a requirement for the Ded1-CTD for robust initiation. Thus, Ded1 function in vivo is stimulated by independent interactions of its NTD with eIF4E and eIF4A, and its CTD with eIF4G. Introduction Eukaryotic translation initiation is an intricate process that ensures accurate selection and decoding *For correspondence: of the mRNA start codon. Initiation
    [Show full text]
  • Protein Synthesis
    Protein Synthesis Objectives: I. Background A. Identify the roles of DNA, rRNA, mRNA, and tRNA in the synthesis of proteins. B. Explain the overall process of translation. II. The Genetic Code A. Describe the essential elements of the genetic code 1. Develop a feel for its simplicity and elegance. B. Define the terms: 1. Codon a) Explain the role of codons in protein synthesis. 2. Degenerate 3. Punctuationless 4. Non Overlapping 5. Universal 6. Synonymous Codons 7. Termination or Nonsense Codons 8. Initiation Codon 9. Reading Frames 10. Silent mutation 11. Missense mutation 12. Nonsense mutation 13. Frameshift mutation C. Be able to read and translate the genetic code from an appropriate table. III. Structure and Function of tRNA A. Describe the 2 dimensional and 3 dimensional shape(s) of the molecule. B. Describe the characteristic features of each of the arms. C. Define the anticodon and explain the role of the anticodon in the translation process. 1. What is Conformational Flexibility or Wobble in the anticodon? 2. What bases in the anticodon strictly base pair with the codon? 3. What bases in the anticodon wobble with the codon? D. What is tRNA Charging? 1. What enzymes catalyze the charging reactions? 2. Describe the differences and similarities between the two classes of enzymes. E. What is the Initiating tRNA? 1. Describe the differences and similarities between bacteria and eukaryotes with respect to the initiating tRNA. IV. Ribosomes A. Describe the structure of ribosomes. B. Describe the component parts of the small subunit and large subunit of the bacterial ribosome. C.
    [Show full text]
  • UNDERSTANDING the ROLE of EIF4A in GENE REGULATION in HEALTH and DISEASE THOMAS EDWARD WEBB B.Sc
    UNDERSTANDING THE ROLE OF EIF4A IN GENE REGULATION IN HEALTH AND DISEASE THOMAS EDWARD WEBB B.Sc. (Hons, Warwick) M.Sc. (Oxon) Thesis submitted to The University of Nottingham for the degree of Doctor of Philosophy (July 2012) 1 Abstract eIF4A Eukaryotic initiation factor 4A (eIF4A) is an ATP-dependent RNA helicase responsible for unwinding the secondary structure of mRNAs. In humans, eIF4A exists as three separate paralogs: eIF4AI and eIF4AII possess a high degree of homology while eIF4AIII is distinct. Knockdown of eIF4AII had no effect on the expression of a reporter construct containing a structured RNA hairpin. Knockdown of eIF4AI and treatment with hippuristanol (an eIF4A inhibitor) caused a dramatic reduction in the hairpin-mediated gene. This reporter system was developed as part of this project to act as a screen for eIF4A activity along with an in vitro screening approach. PDCD4 The activity of eIF4A is suppressed in vivo by the tumour suppressor PDCD4. The fact that loss of PDCD4 function increases the severity of DNA damage is probably attributable its eIF4A-suppressive activity. Alzheimer's Disease Based on previous microarray data, it was supposed that eIF4A inhibition may be therapeutically beneficial in the treatment of Alzheimer's disease. As part of this project, it was demonstrated that eIF4A suppression significantly reduced the expression of reporter genes preceded by the 5’ UTRs of genes predicted to play harmful roles in Alzheimer’s disease. The expression of reporter genes preceded by the 5’ UTR sequences of genes predicted to be beneficial in Alzheimer's were not affected by this suppression.
    [Show full text]
  • Yeast Eif4a Enhances Recruitment of Mrnas Regardless of Their Structural Complexity
    1 Yeast eIF4A enhances recruitment of mRNAs regardless of their structural complexity 2 3 Paul Yourik1, Colin Echeverría Aitken1,3, Fujun Zhou1, Neha Gupta1,2, Alan G. Hinnebusch2,4, Jon R. Lorsch1,4 4 5 1Laboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child 6 Health and Human Development, National Institutes of Health, Bethesda, MD 20892 7 2Laboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and 8 Human Development, National Institutes of Health, Bethesda, MD 20892, USA 9 3Current address: Biology Department, Vassar College, Poughkeepsie, New York 12604, USA 10 4Corresponding Author 11 12 ABSTRACT 13 eIF4A is a DEAD-box RNA-dependent ATPase thought to unwind RNA secondary structure in the 5'-untranslated 14 regions (UTRs) of mRNAs to promote their recruitment to the eukaryotic translation pre-initiation complex (PIC). We 15 show that eIF4A’s ATPase activity is markedly stimulated in the presence of the PIC, independently of eIF4E•eIF4G, 16 but dependent on subunits i and g of the heteromeric eIF3 complex. Surprisingly, eIF4A accelerated the rate of 17 recruitment of all mRNAs tested, regardless of their degree of structural complexity. Structures in the 5'-UTR and 3' of 18 the start codon synergistically inhibit mRNA recruitment in a manner relieved by eIF4A, indicating that the factor does 19 not act solely to melt hairpins in 5'-UTRs. Our findings that eIF4A functionally interacts with the PIC and plays 20 important roles beyond unwinding 5'-UTR structure is consistent with a recent proposal that eIF4A modulates the 21 conformation of the 40S ribosomal subunit to promote mRNA recruitment.
    [Show full text]