DOCSLIB.ORG

Foxa2 Regulates Polarity and Epithelialization in the Endoderm Germ Layer of the Mouse Embryo Ingo Burtscher and Heiko Lickert*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Foxa2 Regulates Polarity and Epithelialization in the Endoderm Germ Layer of the Mouse Embryo Ingo Burtscher and Heiko Lickert* RESEARCH ARTICLE 1029 Development 136, 1029-1038 (2009) doi:10.1242/dev.028415 Foxa2 regulates polarity and epithelialization in the endoderm germ layer of the mouse embryo Ingo Burtscher and Heiko Lickert* In the mouse, one of the earliest events in the determination of cell fate is the segregation of cells into germ layers during gastrulation; however, the cellular and molecular details are not well defined due to intrauterine development. We were able to visualize a clear sequence of events occurring in the process of germ-layer formation, using immunohistochemistry and time-lapse confocal imaging. The T-box transcription factor brachyury (T) and the Forkhead transcription factor Foxa2 specify mesoderm and endoderm in the posterior epiblast. Fate-specified epiblast cells lose their polarity and undergo epithelial-mesenchymal transition to invade into the primitive streak region, where these cell populations quickly separate and differentiate into morphologically and molecularly distinct Foxa2-positive endoderm and T-positive mesoderm populations. The endoderm cells flatten and acquire apical- basal polarity during intercalation into the outside epithelium in order to establish proper intracellular junctions with pre-existing cells. By contrast, the mesodermal cells become spherical during migration and acquire a mesenchymal fate. Interestingly, axial mesodermal cells are descended from Foxa2-positive epiblast cells that upregulate T protein in the anterior primitive streak region. These cells, as well as Foxa2-positive endoderm cells, are highly polarized and epithelialized, suggesting that Foxa2 promotes an epithelial fate and suppresses a mesenchymal fate. This observation is supported by the fact that Foxa2 mutant endodermal cells fail to maintain polarity and do not establish proper cellular junctions, and are thus unable to functionally integrate into the endoderm epithelium. We propose that Foxa2 regulates a molecular program that induces an epithelial cellular phenotype. KEY WORDS: Foxa2, Brachyury, Epithelial-mesenchymal transition, Mesenchymal-epithelial transition, Morphogenesis, Cell polarity, Cell adhesion, Epithelialization, Gastrulation, Germ-layer formation, Time-lapse imaging INTRODUCTION lineages that are destined for different parts of the body (Kinder et During gastrulation the multilayered body plan of the mouse embryo al., 1999; Kinder et al., 2001). Therefore, allocation of mesoderm is established through differentiation and highly coordinated and endoderm in the embryo takes place in an anteroposterior (AP) morphogenetic events. By the start of gastrulation, at embryonic day manner determined by the timing and order of recruitment through (E) 6.5, the embryonic cup-shaped epiblast is surrounded by a the PS. The majority of definitive endodermal (DE) cells ingress single-layered epithelium of visceral endoderm (VE) that will give through the anterior end of the primitive streak (APS) at the mid- rise to the endodermal component of the yolk sac (Wells and Melton, streak (MS) stage and intercalate into the overlying VE to give rise 1999). Pluripotent epiblast cells constitute the progenitor cells for to the foregut (Kwon et al., 2008); however, a small population of all cell lineages in the embryo proper and differentiate to form the DE cells might directly delaminate into the VE from the epiblast three principal germ layers: endoderm, mesoderm and ectoderm (Tam and Beddington, 1992). Taken together, these studies clearly (Beddington and Robertson, 1999; Tam and Loebel, 2007). Clonal indicate that mesoderm and endoderm are specified in a analysis of epiblast cell fate revealed that in the early-streak embryo spatiotemporal manner during gastrulation; however, it is not clear at E6.5, the proximal one-third of the posterior epiblast contains the if these cells become specified in the epiblast or PS region and when precursors of the extra-embryonic mesoderm and the primordial these cells differentiate into morphological and molecular distinct germ cells. By contrast, the distal region of the epiblast contains the cell populations. precursors of the entire neural ectoderm, and the intermediate The T-box transcription factor brachyury (T) was shown to mark posterior epiblast contains the precursors for the anterior mesoderm progenitor cells for mesoderm and endoderm in ES cell and definitive endoderm (Lawson et al., 1991; Lawson and differentiation cultures, suggesting that these cells originate from a Pedersen, 1992; Tam and Beddington, 1992; Lawson and Hage, common progenitor (Kubo et al., 2004). In the mouse embryo, T 1994). Clonal descendants were not necessarily confined to a single protein is localized in the posterior epiblast at the early-streak stage germ layer, indicating that these lineages are not separated at the and is detected in nascent mesoderm in the PS region during beginning of gastrulation. In support of this notion are embryonic gastrulation, as well as in the node and notochord from the late- stem (ES) cell differentiation experiments (Kubo et al., 2004), as streak (LS) stage onwards (Inman and Downs, 2006). T localization well as conditional gene targeting results, indicating that bipotential in the mesoderm and notochord suggests that abnormalities in these mesendodermal progenitor cell populations exist (Lickert et al., cell populations are responsible for the homozygous mutant 2002) (for a review, see Rodaway and Patient, 2001). At various phenotype (Wilkinson et al., 1990). By contrast, Foxa2 is also stages of gastrulation, the primitive streak (PS) has been shown to expressed in the posterior epiblast from the early stage onwards and contain precursor cells of different mesodermal and endodermal is then confined to anterior definitive endoderm (ADE) and axial mesoderm, which consists of the head process, prechordal plate, Helmholtz Zentrum München, Institute of Stem Cell Research, Ingolstädter notochord and node (Sasaki and Hogan, 1993; Monaghan et al., Landstrasse 1, 85764 Neuherberg, Germany. 1993). Foxa2 is a member of the Forkhead transcription factor family, which includes three related transcription factors: Foxa1, *Author for correspondence (e-mail: [email protected]) Foxa2 and Foxa3, first identified by their ability to regulate liver- Accepted 15 January 2009 specific gene expression (Lai et al., 1990; Lai et al., 1991). A null DEVELOPMENT 1030 RESEARCH ARTICLE Development 136 (6) mutation of the Foxa2 gene leads to absence of ADE and axial GAG; Tomato rev (5Ј-SpeI), 3Ј-NNNACTAGTTTACTTGTACAGC - mesoderm (Ang and Rossant, 1994; Weinstein et al., 1994). Foxa1 TCGTCCATGCCG; YFP fwd, 5Ј-GCGGCCGCATCTAGAATGGTGAG- and Foxa3 are expressed from E7.5 onwards in the definitive CAAGGGCGAGGAGCTGTTC; YFP rev, 3Ј-ACTAGTTTACTTGTAC - endoderm and can compensate for the loss of Foxa2 in the null AGCTCGTCCATGCCGAGAG. NotI/SpeI-digested PCR products were mutants, which allows hindgut, but not fore- and midgut formation cloned into the pBKS vector. (Sasaki and Hogan, 1993; Monaghan et al., 1993; Ang and Rossant, For generation of Lyn-Tomato, an oligonucleotide was subcloned between the NotI and XbaI sites in the pBKS vector in front of the 1994; Weinstein et al., 1994; Dufort et al., 1998). These results td-Tomato: Lyn-Oligo fwd, 5Ј-GGCCGCATAACTTCGTATAGCATA - collectively demonstrate that T and Foxa2 are functionally important CATTATACGAAGTTATGCCACCATGGGATGTATTAAATCAAAAA - for mesoderm and endoderm development; however, it is not clear GGAAAGACGGGGCCCGGTACT; Lyn-Oligo rev, 5Ј-CTAGAGTA - how these transcription factors regulate a molecular and cellular CCGGGCCC CGTCTTT CCTTTTTGATTTAATACATCCCATGGTG G C- program for the differentiation of these cell populations. ATAACTTC GTATAATGTATGCTATACGAAGTTATGCTTATGC. The In addition to cellular differentiation, the gastrulating embryo also NotI/SpeI-digested fluorescent markers were subcloned into the NotI/NheI undergoes dramatic morphological changes to form the three sites of the eukaryotic expression vector pCAGGS (Niwa et al., 1991). principal germ layers and the basic body plan. One of the first Generation of fluorescent reporter ES cell lines morphogenetic events is the formation of the PS when signals and The fluorescent ES cell and mouse lines used in this study were generated factors trigger epithelial-mesenchymal transition (EMT) of epiblast by electroporation of ScaI-linearized pCAGGS vector DNA containing cells to give rise to mesoderm and endoderm (Thiery and Sleeman, dsRed, YFP or Lyn-Tomato into wild-type IDG3.2 ES cells (Hitz et al., 2006). During this process, epiblast cells lose their apical-basal (AB) 2007) or Foxa2–/– R1 ES cells (Ang et al., 1994). Cells were selected with 1 epithelial polarity, downregulate the cell-cell adhesion molecule E- μg/ml puromycin, and resistant clones were screened for uniform and cadherin (cadherin 1 – Mouse Genome Informatics) and break ubiquitous reporter expression in cell culture and in vivo using embryos through the basement membrane (BM) to invade into the PS region. derived from ES cells. The interstitial mesodermal cells acquire a mesenchymal cellular Generation of chimeras and mouse lines fate and migrate over long distances between the endoderm and the Diploid or tetraploid chimeras were generated according to standard ectoderm germ layer before they re-aggregate to form distinct organs protocols (Nagy, 2003). Embryos were collected from dsRed- (Vintersten et such as the heart or kidney. By contrast, cells that are fate-specified al., 2004) and YFP- (Hadjantonakis et
Load more

Recommended publications
  • Recombinant Human FLRT1 Catalog Number: 2794-FL
    Recombinant Human FLRT1 Catalog Number: 2794-FL DESCRIPTION Source Mouse myeloma cell line, NS0­derived human FLRT1 protein Ile21­Pro524, with a C­terminal 6­His tag Accession # Q9NZU1 N­terminal Sequence Ile21 Analysis Predicted Molecular 56.3 kDa Mass SPECIFICATIONS SDS­PAGE 70­80 kDa, reducing conditions Activity Measured by the ability of the immobilized protein to support the adhesion of Neuro­2A mouse neuroblastoma cells. Recombinant Human FLRT1 immobilized at 2.5 μg/mL, 100 μL/well, will meidate > 50% Neuro­2A cell adhesion. Optimal dilutions should be determined by each laboratory for each application. Endotoxin Level <0.10 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS­PAGE under reducing conditions and visualized by silver stain. Formulation Lyophilized from a 0.2 μm filtered solution in PBS. See Certificate of Analysis for details. PREPARATION AND STORAGE Reconstitution Reconstitute at 200 μg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. Stability & Storage Use a manual defrost freezer and avoid repeated freeze­thaw cycles. l 12 months from date of receipt, ­20 to ­70 °C as supplied. l 1 month, 2 to 8 °C under sterile conditions after reconstitution. l 3 months, ­20 to ­70 °C under sterile conditions after reconstitution. BACKGROUND FLRT1 is one of three FLRT (fibronectin, leucine rich repeat, transmembrane) glycoproteins expressed in distinct areas of the developing brain and other tissues (1, 2). The 90 kDa type I transmembrane (TM) human FLRT1 is synthesized as a 646 amino acid (aa) precursor with a 20 aa signal sequence, a 504 aa extracellular domain (ECD), a 21 aa TM segment and a 101 aa cytoplasmic region.
    [Show full text]
  • FOXA2 Is a Sensitive and Specific Marker for Small Cell Neuroendocrine Carcinoma of the Prostate Jung Wook Park1, John K Lee2,3, Owen N Witte1,4,5 and Jiaoti Huang6
    Modern Pathology (2017) 30, 1262–1272 1262 © 2017 USCAP, Inc All rights reserved 0893-3952/17 $32.00 FOXA2 is a sensitive and specific marker for small cell neuroendocrine carcinoma of the prostate Jung Wook Park1, John K Lee2,3, Owen N Witte1,4,5 and Jiaoti Huang6 1Department of Microbiology, Immunology and Molecular Genetics, David Geffen School of Medicine, University of California—Los Angeles, Los Angeles, CA, USA; 2Division of Hematology and Oncology, Department of Medicine, David Geffen School of Medicine, University of California—Los Angeles, Los Angeles, CA, USA; 3Molecular Biology Institute, David Geffen School of Medicine, University of California— Los Angeles, Los Angeles, CA, USA; 4Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, University of California—Los Angeles, Los Angeles, CA, USA; 5Department of Molecular and Medical Pharmacology, David Geffen School of Medicine, University of California—Los Angeles, Los Angeles, CA, USA and 6Department of Pathology, Duke University School of Medicine, Durham, NC, USA The median survival of patients with small cell neuroendocrine carcinoma is significantly shorter than that of patients with classic acinar-type adenocarcinoma. Small cell neuroendocrine carcinoma is traditionally diagnosed based on histologic features because expression of current immunohistochemical markers is inconsistent. This is a challenging diagnosis even for expert pathologists and particularly so for pathologists who do not specialize in prostate cancer. New biomarkers to aid in the diagnosis of small cell neuroendocrine carcinoma are therefore urgently needed. We discovered that FOXA2, a pioneer transcription factor, is frequently and specifically expressed in small cell neuroendocrine carcinoma compared with prostate adenocarcinoma from published mRNA-sequencing data of a wide range of human prostate cancers.
    [Show full text]
  • Charting Brachyury-Mediated Developmental Pathways During Early Mouse Embryogenesis
    Charting Brachyury-mediated developmental pathways during early mouse embryogenesis Macarena Lolasa,b, Pablo D. T. Valenzuelab, Robert Tjiana,c,1, and Zhe Liud,1 dJunior Fellow Program, aJanelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn, VA 20147; bFundación Ciencia para la Vida, Santiago 7780272, Chile; and cLi Ka Shing Center for Biomedical and Health Sciences, California Institute for Regenerative Medicine Center of Excellence, Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720 Contributed by Robert Tjian, February 11, 2014 (sent for review January 14, 2014) To gain insights into coordinated lineage-specification and mor- cells play diverse and indispensable roles in early mouse phogenetic processes during early embryogenesis, here we report development. a systematic identification of transcriptional programs mediated In mouse ES cell-based differentiation systems, Brachyury is by a key developmental regulator—Brachyury. High-resolution widely used as a mesoendoderm marker, and Brachyury-positive chromosomal localization mapping of Brachyury by ChIP sequenc- cells were able to differentiate into mesodermal and definitive ing and ChIP-exonuclease revealed distinct sequence signatures endodermal lineages, such as cardiomyocytes and hepatocytes enriched in Brachyury-bound enhancers. A combination of genome- (8–10). In a previous study, we found that depletion of a core wide in vitro and in vivo perturbation analysis and cross-species promoter factor, the TATA binding protein-associated factor 3, evolutionary comparison unveiled a detailed Brachyury-depen- in ES cells leads to significant up-regulation of Brachyury and dent gene-regulatory network that directly links the function of mesoderm lineages during ES cell differentiation (11). Here, we Brachyury to diverse developmental pathways and cellular house- systematically characterized the molecular function of Brachyury keeping programs.
    [Show full text]
  • Increased Expression of Fibronectin Leucine-Rich Transmembrane Protein 3 in the Dorsal Root Ganglion Induces Neuropathic Pain in Rats
    The Journal of Neuroscience, September 18, 2019 • 39(38):7615–7627 • 7615 Neurobiology of Disease Increased Expression of Fibronectin Leucine-Rich Transmembrane Protein 3 in the Dorsal Root Ganglion Induces Neuropathic Pain in Rats Moe Yamada,1 Yuki Fujita,2,3 Yasufumi Hayano,2 Hideki Hayakawa,4 Kousuke Baba,4 Hideki Mochizuki,4 and X Toshihide Yamashita1,2,3,5 1Department of Molecular Neuroscience, Graduate School of Frontier Biosciences, 2Department of Molecular Neuroscience, Graduate School of Medicine, 3Immunology Frontier Research Center, 4Department of Neurology, Graduate School of Medicine, and 5Department of Neuro-Medical Science, Graduate School of Medicine, Osaka University, Osaka 565-0871, Japan Neuropathic pain is a chronic condition that occurs frequently after nerve injury and induces hypersensitivity or allodynia characterized by aberrant neuronal excitability in the spinal cord dorsal horn. Fibronectin leucine-rich transmembrane protein 3 (FLRT3) is a modu- lator of neurite outgrowth, axon pathfinding, and cell adhesion, which is upregulated in the dorsal horn following peripheral nerve injury. However, the function of FLRT3 in adults remains unknown. Therefore, we aimed to investigate the involvement of spinal FLRT3 in neuropathic pain using rodent models. In the dorsal horns of male rats, FLRT3 protein levels increased at day 4 after peripheral nerve injury. In the DRG, FLRT3 was expressed in activating transcription factor 3-positive, injured sensory neurons. Peripheral nerve injury stimulated Flrt3 transcription in the DRG but not in the spinal cord. Intrathecal administration of FLRT3 protein to naive rats induced mechanical allodynia and GluN2B phosphorylation in the spinal cord. DRG-specific FLRT3 overexpression using adeno-associated virus also produced mechanical allodynia.
    [Show full text]
  • Genetic Ablation of FLRT3 Reveals a Novel Morphogenetic Function for the Anterior Visceral Endoderm in Suppressing Mesoderm Differentiation
    Downloaded from genesdev.cshlp.org on March 12, 2020 - Published by Cold Spring Harbor Laboratory Press Genetic ablation of FLRT3 reveals a novel morphogenetic function for the anterior visceral endoderm in suppressing mesoderm differentiation Joaquim Egea,1,5,8 Christian Erlacher,1,5 Eloi Montanez,2 Ingo Burtscher,3 Satoru Yamagishi,1 Martin Heß,4 Falko Hampel,1 Rodrigo Sanchez,1,6 Maria Teresa Rodriguez-Manzaneque,2 Michael R. Bösl,1 Reinhard Fässler,2 Heiko Lickert,3 and Rüdiger Klein1,7 1Department of Molecular Neurobiology, Max-Planck Institute of Neurobiology, 82152 Martinsried, Germany; 2Department of Molecular Medicine, Max-Planck Institute for Biochemistry, 82152 Martinsried, Germany; 3Institute of Stem Cell Research, Helmholtz Zentrum München, 85764 Neuherberg, Germany; 4Biozentrum der LMU Biology, 82152 Martinsried, Germany During early mouse development, the anterior visceral endoderm (AVE) secretes inhibitor and activator signals that are essential for establishing the anterior–posterior (AP) axis of the embryo and for restricting mesoderm formation to the posterior epiblast in the primitive streak (PS) region. Here we show that AVE cells have an additional morphogenetic function. These cells express the transmembrane protein FLRT3. Genetic ablation of FLRT3 did not affect the signaling functions of the AVE according to the normal expression pattern of Nodal and Wnt and the establishment of a proper AP patterning in the epiblast. However, FLRT3−/− embryos showed a highly disorganized basement membrane (BM) in the AVE region. Subsequently, adjacent anterior epiblast cells displayed an epithelial-to-mesenchymal transition (EMT)-like process characterized by the loss of cell polarity, cell ingression, and the up-regulation of the EMT and the mesodermal marker genes Eomes, Brachyury/T, and FGF8.
    [Show full text]
  • Zfp57 Mutant ES Cell Lines Directly Derived from Blastocysts
    Stem Cell Research 16 (2016) 282–286 Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr Lab Resource: Stem Cell Line Zfp57 mutant ES cell lines directly derived from blastocysts Ho-Tak Lau a, Lizhi Liu a, Xiajun Li a,b,⁎ a Department of Developmental and Regenerative Biology, Black Family Stem Cell Institute, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA b Department of Oncological Sciences, Graduate School of Biological Sciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA article info abstract Article history: Zfp57 is a master regulator of genomic imprinting in mouse embryos. To further test its functions, we have Received 25 November 2015 derived multiple Zfp57 mutant ES clones directly from mouse blastocysts. Indeed, we found DNA methylation im- Received in revised form 30 December 2015 print was lost at most examined imprinting control regions in these Zfp57 mutant ES clones, similar to what was Accepted 31 December 2015 observed in Zfp57 mutant embryos in the previous studies. This result indicates that these blastocyst-derived Available online 6 January 2016 Zfp57 mutant ES clones can be employed for functional analyses of Zfp57 in genomic imprinting. © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Resource table heterozygous female mice and Zfp57−/− homozygous male mice, whereas five Zfp57−/− (M−Z−) ES clones were derived from the cross between Zfp57−/− homozygous female mice and Zfp57−/− homozygous male mice.
    [Show full text]
  • The C20orf133 Gene Is Disrupted in a Patient with Kabuki Syndrome
    562 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.2007.049510 on 23 June 2007. Downloaded from The C20orf133 gene is disrupted in a patient with Kabuki syndrome Nicole M C Maas, Tom Van de Putte, Cindy Melotte, Annick Francis, Constance T R M Schrander-Stumpel, Damien Sanlaville, This paper is freely available online David Genevieve, Stanislas Lyonnet, Boyan Dimitrov, under the BMJ Journals unlocked scheme, Koenraad Devriendt, Jean-Pierre Fryns, Joris R Vermeesch see http://jmg.bmj.com/info/unlocked.dtl ................................................................................................................................... J Med Genet 2007;44:562–569. doi: 10.1136/jmg.2007.049510 See end of article for authors’ affiliations Background: Kabuki syndrome (KS) is a rare, clinically recognisable, congenital mental retardation ........................ syndrome. The aetiology of KS remains unknown. Correspondence to: Methods: Four carefully selected patients with KS were screened for chromosomal imbalances using array J R Vermeesch, Center for comparative genomic hybridisation at 1 Mb resolution. Human Genetics, Herestraat Results: In one patient, a 250 kb de novo microdeletion at 20p12.1 was detected, deleting exon 5 of 49, 3000 Leuven, Belgium; C20orf133. The function of this gene is unknown. In situ hybridisation with the mouse orthologue of joris.vermeesch@med. kuleuven.be C20orf133 showed expression mainly in brain, but also in kidney, eye, inner ear, ganglia of the peripheral nervous system and lung. Received 1 February 2007 Conclusion: The de novo nature of the deletion, the expression data and the fact that C20orf133 carries a Revised 15 May 2007 macro domain, suggesting a role for the gene in chromatin biology, make the gene a likely candidate to Accepted 22 May 2007 Published Online First cause the phenotype in this patient with KS.
    [Show full text]
  • Estrogen Receptor Α AF-2 Mutation Results in Antagonist Reversal and Reveals Tissue Selective Function of Estrogen Receptor Modulators
    Estrogen receptor α AF-2 mutation results in antagonist reversal and reveals tissue selective function of estrogen receptor modulators Yukitomo Araoa, Katherine J. Hamiltona, Manas K. Rayb, Gregory Scottb, Yuji Mishinac, and Kenneth S. Koracha,1 aReceptor Biology Section, Laboratory of Reproductive and Developmental Toxicology and bKnock Out Core, National Institute of Environmental Health Sciences/National Institutes of Health, Research Triangle Park, NC 27709; and cSchool of Dentistry, University of Michigan, Ann Arbor, MI 48109 Edited by David J. Mangelsdorf, University of Texas Southwestern Medical Center, Dallas, TX, and approved July 22, 2011 (received for review June 10, 2011) The estrogen receptor (ER) is a ligand-dependent transcription and that may be related to the cell type specific functionality factor containing two transcriptional activation domains. AF-1 is in of TAM (12). However, it is still not entirely clear how TAM the N terminus of the receptor protein and AF-2 activity is manifests agonist activities through ERα WT in different tissues. dependent on helix 12 of the C-terminal ligand-binding domain. We focused on the L543A and L544A mutations in the ERα Two point mutations of leucines 543 and 544 to alanines (L543A, AF-2 domain (AF2ER) to evaluate the ERα AF-1 and AF-2 L544A) in helix 12 minimized estrogen-dependent transcriptional functions in vivo and the SERM functionality in the tissues. α α activation and reversed the activity of the estrogen antagonists The ER -KO ( ERKO) mouse is an established model for α α ICI182780 (ICI) and tamoxifen (TAM) into agonists in a similar evaluating ER function in vivo.
    [Show full text]
  • Mechanism of Nucleosome Targeting by Pioneer Transcription Factors
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2019 Mechanism Of Nucleosome Targeting By Pioneer Transcription Factors Meilin Mary Fernandez Garcia University of Pennsylvania Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry Commons, and the Biophysics Commons Recommended Citation Fernandez Garcia, Meilin Mary, "Mechanism Of Nucleosome Targeting By Pioneer Transcription Factors" (2019). Publicly Accessible Penn Dissertations. 3624. https://repository.upenn.edu/edissertations/3624 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/3624 For more information, please contact [email protected]. Mechanism Of Nucleosome Targeting By Pioneer Transcription Factors Abstract Transcription factors (TFs) forage the genome to instruct cell plasticity, identity, and differentiation. These developmental processes are elicited through TF engagement with chromatin. Yet, how and which TFs can engage with chromatin and thus, nucleosomes, remains largely unexplored. Pioneer TFs are TF that display a high affinity for nucleosomes. Extensive genetic and biochemical studies on the pioneer TF FOXA, a driver of fibroblast to hepatocyte reprogramming, revealed its nucleosome binding ability and chromatin targeting lead to chromatin accessibility and subsequent cooperative binding of TFs. Similarly, a number of reprogramming TFs have been suggested to have pioneering activity due to their ability to target compact chromatin and increase accessibility and enhancer formation in vivo. But whether these factors directly interact with nucleosomes remains to be assessed. Here we test the nucleosome binding ability of the cell reprogramming TFs, Oct4, Sox2, Klf4 and cMyc, that are required for the generation of induced pluripotent stem cells. In addition, we also test neuronal and macrophage reprogramming TFs.
    [Show full text]
  • Short-Term Western-Style Diet Negatively Impacts Reproductive Outcomes in Primates
    Short-term Western-style diet negatively impacts reproductive outcomes in primates Sweta Ravisankar, … , Shawn L. Chavez, Jon D. Hennebold JCI Insight. 2021;6(4):e138312. https://doi.org/10.1172/jci.insight.138312. Research Article Metabolism Reproductive biology A maternal Western-style diet (WSD) is associated with poor reproductive outcomes, but whether this is from the diet itself or underlying metabolic dysfunction is unknown. Here, we performed a longitudinal study using regularly cycling female rhesus macaques (n = 10) that underwent 2 consecutive in vitro fertilization (IVF) cycles, one while consuming a low-fat diet and another 6–8 months after consuming a high-fat WSD. Metabolic data were collected from the females prior to each IVF cycle. Follicular fluid (FF) and oocytes were assessed for cytokine/steroid levels and IVF potential, respectively. Although transition to a WSD led to weight gain and increased body fat, no difference in insulin levels was observed. A significant decrease in IL-1RA concentration and the ratio of cortisol/cortisone was detected in FF after WSD intake. Despite an increased probability of isolating mature oocytes, a 44% reduction in blastocyst number was observed with WSD consumption, and time-lapse imaging revealed delayed mitotic timing and multipolar divisions. RNA sequencing of blastocysts demonstrated dysregulation of genes involved in RNA binding, protein channel activity, mitochondrial function and pluripotency versus cell differentiation after WSD consumption. Thus, short-term WSD consumption promotes a proinflammatory intrafollicular microenvironment that is associated with impaired preimplantation development in the absence of large-scale metabolic changes. Find the latest version: https://jci.me/138312/pdf RESEARCH ARTICLE Short-term Western-style diet negatively impacts reproductive outcomes in primates Sweta Ravisankar,1,2 Alison Y.
    [Show full text]
  • Genomic Imprinting Defect in Zfp57 Mutant Ips Cell Lines
    Stem Cell Research 16 (2016) 259–263 Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr Lab Resource: Stem Cell Line Genomic imprinting defect in Zfp57 mutant iPS cell lines Carol M. McDonald a, Lizhi Liu a,LijuanXiaoa, Christoph Schaniel a,b, Xiajun Li a,c,⁎ a Black Family Stem Cell Institute, Department of Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA b Department of Pharmacology and Systems Therapeutics, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA c Department of Oncological Sciences, Graduate School of Biological Sciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA article info abstract Article history: ZFP57 maintains genomic imprinting in mouse embryos and ES cells. To test its roles during iPS reprogramming, Received 1 January 2016 we derived iPS clones by utilizing retroviral infection to express reprogramming factors in mouse MEF cells. After Received in revised form 17 January 2016 analyzing four imprinted regions, we found that parentally derived DNA methylation imprint was largely main- Accepted 19 January 2016 tained in the iPS clones with Zfp57 but missing in those without maternal or zygotic Zfp57. Intriguingly, DNA Available online 21 January 2016 methylation imprint was lost at the Peg1 and Peg3 but retained at the Snrpn and Dlk1-Dio3 imprinted regions in the iPS clones without zygotic Zfp57.Thisfinding will be pursued in future studies. © 2016 The Authors.
    [Show full text]
  • Virtual Chip-Seq: Predicting Transcription Factor Binding
    bioRxiv preprint doi: https://doi.org/10.1101/168419; this version posted March 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Virtual ChIP-seq: predicting transcription factor binding 2 by learning from the transcriptome 1,2,3 1,2,3,4,5 3 Mehran Karimzadeh and Michael M. Hoffman 1 4 Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada 2 5 Princess Margaret Cancer Centre, Toronto, ON, Canada 3 6 Vector Institute, Toronto, ON, Canada 4 7 Department of Computer Science, University of Toronto, Toronto, ON, Canada 5 8 Lead contact: michael.hoff[email protected] 9 March 8, 2019 10 Abstract 11 Motivation: 12 Identifying transcription factor binding sites is the first step in pinpointing non-coding mutations 13 that disrupt the regulatory function of transcription factors and promote disease. ChIP-seq is 14 the most common method for identifying binding sites, but performing it on patient samples is 15 hampered by the amount of available biological material and the cost of the experiment. Existing 16 methods for computational prediction of regulatory elements primarily predict binding in genomic 17 regions with sequence similarity to known transcription factor sequence preferences. This has limited 18 efficacy since most binding sites do not resemble known transcription factor sequence motifs, and 19 many transcription factors are not even sequence-specific. 20 Results: 21 We developed Virtual ChIP-seq, which predicts binding of individual transcription factors in new 22 cell types using an artificial neural network that integrates ChIP-seq results from other cell types 23 and chromatin accessibility data in the new cell type.
    [Show full text]