<I>Campylobacter Curvus</I>

Clemson University TigerPrints

All Theses Theses

8-2016 An Analysis of the Putative rHURM Pathway in Campylobacter curvus Marco Valera Clemson University, [email protected]

Follow this and additional works at: https://tigerprints.clemson.edu/all_theses

Recommended Citation Valera, Marco, "An Analysis of the Putative rHURM Pathway in Campylobacter curvus" (2016). All Theses. 3039. https://tigerprints.clemson.edu/all_theses/3039

This Thesis is brought to you for free and open access by the Theses at TigerPrints. It has been accepted for inclusion in All Theses by an authorized administrator of TigerPrints. For more information, please contact [email protected]. Campylobacter curvus AN ANALYSIS OF THE PUTATIVE rHURM PATHWAY IN A Thesis Presented to the Graduate School of Clemson University

In Partial Fulfillment of the Requirements for the Degree Master of Science Microbiology

by Marco Valera August 2016

Accepted by: Dr. Barbara Campbell, Committee Chair Dr. Mike Henson Dr. Harry D. Kurtz, Jr. Abstract

Recent genomic studies within the Epsilonproteobacteria have uncovered a potentially novel mechanism for chemotrophic respiration: the reverse Hydroxylamine Ubiquinone Redox

Module (rHURM), a dissimilatory nitrate reduction pathway utilizing a hydroxylamine intermediate. Originally discovered in the chemoautolithotroph Nautilia profundicola, genes indicative of the rHURM pathway have been identified in several species of Campylobacter, including C. curvus. In the absence of classic nitrite reductase genes, a hydroxylamine oxidoreductase (hao) homolog encodes a periplasmic octoheme potentially capable of reducing nitrite, a product of periplasmic nitrate reductase (NapA), to hydroxylamine, which is then converted to ammonium by a putative hydroxylamine reductase hybrid cluster protein (Hcp).

This research assesses the expression of these genes in nitrate amended cultures compared to fumarate amended cultures. Our results suggest that all three core nitrogen metabolic genes were up-regulated in cells grown in the presence of nitrate as opposed to the fumarate, during mid log phase growth. The hao gene exhibited the highest degree of expression of all three genes, 15 fold greater than hcp. However, no significant difference in hao expression was detected at early log phase growth between nitrate and fumarate respiring cells. By performing growth curves with induced reactive nitrogen species (RNS) stress, we observed that nitrate respiring cells were resistant to the toxic effects of exogenous hydroxylamine compared to fumarate respiring cells, yet both cultures exhibited similar resistance to sudden nitrite additions. This evidence suggests that the core genes involved in the putative rHURM pathway are actively expressed in the presence of nitrate, however Hao may have an alternative function

ii or a unique method of regulation compared to nitrate and hydroxylamine reductase. Future research may include analyzing transcriptomes to better characterize expression of associated genes and regulatory pathways involved in nitrogen metabolism.

iii Table of Contents

Page Abstract ...... ii Table of Contents ...... iv Page ...... iv LIST OF TABLES ...... v LIST OF FIGURES ...... v Introduction ...... 1 Materials and Methods ...... 9 Cell Culturing ...... 9 Sampling ...... 10 Cell Counting ...... 10 DNA/RNA Extractions and Quantifications ...... 10 DNase treatment and cDNA synthesis ...... 11 Primers and RT-PCR ...... 11 Chemical assays ...... 12 Results ...... 14 Growth Characteristics of Nitrate and Fumarate Amended Cultures ...... 14 Measurement of cDNA Gene Copy Abundance ...... 18 Growth Characteristics of Chemical Stress Response ...... 21 Discussion ...... 29 Future Research ...... 35 References ...... 36

iv LIST OF TABLES Table Page

1. Survey of potential gene homologs indicative of the rHURM pathway ...... 8 2. Primer...... 12 3. qPCR reaction mixture ...... 12 4. Thermo-cycler protocol ...... 12 5. Standard curve concentrations for chemical analysis ...... 13 6. Growth rate and chemical analysis of nitrate-respiring C. curvus ...... 25 7. Growth rate and chemical analysis of fumarate-respiring C. curvus ...... 26 8. Comparison of observed versus hypothesized change in ammonium ...... 27

LIST OF FIGURES Figures Page

1. Conversion of Inorganic Nitrogen species ...... 3 2. The rHURM pathway in N. profundicola ...... 7 3. Growth of C. curvus utilizing sodium nitrate ...... 14 4. Quantification of Nitrate (blue), Ammonium (green), and Formate (red) ...... 15 5. Abundance of 16S rRNA (A.) and rpoD (B.) cDNAs ...... 17 6. Expression of essential genes related to energy metabolism at early log ...... 19 7. Expression of essential genes related to energy metabolism at mid log ...... 20 8. Growth of C. curvus exposed to varying concentrations of sodium nitrite ...... 22 9. Growth of C. curvus exposed to varying concentrations of hydroxylamine ...... 24

v Introduction

Epsilonproteobacteria is considered to be a relatively small yet robust bacteria class within the Proteobacteria phylum (1). Consisting of the orders Campylobacterales and

Nautiliales, these microbes are found within a variety of unique environments (2, 3). While members of the Nautiliales order are found in extreme environments such as sulfur springs and black smokers, Campylobacterales, which includes the genera Campylobacter, Helicobacter,

Acrobacter and Wolinella, are found mainly in mammalian digestive tracts (4, 5). Many of the species within this order are known pathogens like the well-described Campylobacter jejuni or helicobacter pylori (6–9). Other members, like C. curvus and C. concisus, are less understood; their roles in human health and ecology are only beginning to be defined (10).

As a strictly anaerobic chemoheterotroph, C. curvus has been identified within alveolar abscesses and biofilm communities (11, 12). Campylobacter jejuni obtains carbon solely through organic and amino acid catabolism, and C. curvus may be similarly restricted. Its annotated genome lacks several standard enzymes required for the Entner-Doudoroff, Embden-Meyerhof, and Pentose-phosphate pathways (13). Both species can utilize nitrate and formate for respiration (14). Nitrate reduction within the oral cavity has become an important topic due to its relationship with both the oral cavity microbiome and human health (15). Humans constantly intake nitrate through the consumption of processed meats and vegetables, especially leafy greens (16). These sources plus endogenous nitric oxide production generate nitrite and nitric oxide, which have a clinically proven role in cardiovascular health (15, 17). An

1 estimated 25% of nitrate consumed or generated is secreted back through the saliva glands, where it is reduced by oral bacteria (18). The byproducts of nitrate reduction create a reservoir for vascular nitric oxide concentration, making the oral microbiome a major contributor in human nitric oxide homeostasis (19).

Despite the vast separation between environments, many of these

Epsilonproteobacteria are capable of utilizing the same inorganic compounds for energy metabolism, particularly inorganic nitrogen and sulfur species, as well as a tendency to utilize formate or hydrogen as an electron donor (1). Because of its oxidative potential and natural abundance, nitrate is one of the most commonly utilized electron acceptors in anaerobic chemotrophs like the Epsilonproteobacteria, many of which perform denitrification or ammonification (Fig. 1). All nitrate reducers classified as Epsilonproteobacteria use a highly conserved periplasmic nitrate reductase complex (Nap) (20). The redox product nitrite is further reduced by nitrite reductase enzymes NrfA in ammonifiers like Wolinella, Campylobacter, or

Arcobacter, or by NirS in denitrifying bacteria like Sulfurimonas or Nitratiruptor species.

However, several Campylobacterales like Wolinella succinogenes and Arcobacter butzleri have shown to contain certain denitrification genes like nitric oxide reductase or nitrous oxide reductase despite encoding ammonifying nitrite reductase genes such as nrfA (21).

Campylobacter curvus and Campylobacter concisus genomes also contain nitrous oxide homologs, although neither have any other classic denitrification-related genes.

Figure 1: Conversion of inorganic nitrogen species through prokaryotic metabolic pathways. Red arrows indicate oxidation steps while blue arrows indicate reduction steps. Enzyme subunits which catalyze inorganic nitrogen redox reactions are depicted (NapA - Periplasmic nitrate reductase; NrfA, NirK/S - Nitrite Reductase; NorB – Nitric Oxide Reductase; NosG – Nitrous Oxide reductase; NifDK – Nitrogenase; AmoA – Ammonium monooxygenase; HaoA – Hydroxylamine Oxidoreductase; NxrA – Nitrite Oxidoreductase) (22).

Periplasmic nitrate reductase is a protein complex anchored within the periplasm that catalyzes nitrate reduction for anoxic respiration as well as acts as an electron sink for maintaining redox homeostasis (23). While ubiquitous in all Epsilonproteobacteria capable of dissimilatory nitrate reduction, nap genes are not exclusive to the phylum as a whole (21).

Periplasmic nitrate reductase is also often found in photosynthetic Proteobacteria such as

Rhodobacter and Roseobacter, as well as in anaerobic denitrifiers (24). However, periplasmic nitrate reductases found in other classes of Proteobacteria display contrasting protein complexes (25). Within the Epsilonproteobacteria, Wolinella succinogenes has one of the most well studied anoxic nitrate respiration systems (21, 26–28). Redox energy for nitrate reduction

by NapA stems from the electron flow from NapB to the membrane bound iron-sulfur proteins

NapGH which in turn accepts electrons from the quinol pool (29). Nitrite reductases found within Dissimilatory Nitrate Reduction to Ammonia (DNRA) are primarily encoded by nrf, although novel enzyme mechanisms for nitrite reduction have been discovered, such as the octaheme cytochrome C nitrite reductase discovered from Thioalkalivibrio nitratireducens and the octaheme tetrathionate reductase found in Shewanella oneidensis (30, 31). In classic DNRA,

NrfA complexed with NrfH performs a six electron transfer from the quinol pool to the substrate nitrite (32, 33). This process allows for generation of proton motive force (PMF) by the release of hydrogen ions through the paired formate dehydrogenase complex. Resulting ammonia product may be either assimilated into biomass by glutamine synthetase or removed from the cell by ammonia transporters (34).

All nitrogen transformation steps during denitrification also occur by enzymes within the periplasm (22). Nitrite reductase encoded by nirS which, like NapAB, receives electrons from a series of heme complexes and copper bound proteins by electron exchange within the quinol pool (35). NirS reduces nitrite through a cytochrome d1 active site as part of a cd1 complex, drawing electrons from the quinol pool through intermediary copper bound proteins. This process yields nitric oxide which is then reduced by the nitric oxide reductase NorBC, a membrane bound protein containing a heme b and c complex with an iron center (36). Two nitric oxide molecules are reduced with two hydrogen ions and two electrons to form nitrous oxide and water. Epsilonproteobacteria utilize two forms of the membrane bound Nor enzyme: qNor and cNor (22). The primary difference of these forms is their electron source. A soluble cytochrome c551 donates electrons to cNor while qNor receives electrons directly from the

quinol pool (37). There is no evidence supporting potential PMF generation by cNor, however qNor may potentially be a factor (22). As with DNRA, reduction power is generated by the quinol pool. Unlike other Proteobacteria, such as Paracoccus denitrificans, denitrifying

Epsilonproteobacteria like Wolinella encode the proteins NosGH, iron-sulfur cluster proteins physiologically almost identical to the transmembrane complex NapGH, acting as similar redox partners to their nitrogen transforming counterparts (38). Evidence shows that W. succinogenes and C. fetus proliferate using nitrous oxide as an electron acceptor, while nitrite reducing enzyme Nrf in these organisms produce secondary products such as nitric oxide and nitrous oxide (38, 39). Theoretically, maintaining nitrous oxide reductase in an ammonifying organism may be energetically beneficial.

Campbell et al. (2009) described, through genomic sequencing, the energy and nitrogen metabolic potential of Nautilia profundicola. They found no analog of the DNRA nitrite reductase gene nrfA, or any other classic nitrite reductase, despite evidence that N. profundicola reduces nitrate to ammonia and incorporates the nitrogen into its biomass (40). Instead, a

BLAST search for known inorganic nitrogen enzymes revealed the presence of sequences indicative of a hydroxylamine oxidoreducatase (Hao) gene cluster. The hao gene encodes a cytochrome c protein complex which normally oxidizes hydroxylamine to nitrite within ammonia oxidizing bacteria (AOB) such as Nitrosococcus oceani and Nitrosomonas europaea, as well as methylotrophic bacteria like Methylococcus capsulatus, as part of the Hydroxylamine

Ubiquinone Redox Module (HURM) (29, 41). Previous research has shown that under artificial conditions, Hao in N. europaea was observed to reduce nitrite to ammonia with a hydroxylamine intermediate, although nitrite reduction was far slower catalytically than

hydroxylamine reduction (42, 43). In addition, Hao was shown to reduce nitric oxide to ammonia (44). Along with a hydroxylamine reductase hybrid protein cluster (Hcp) which reduces hydroxylamine to ammonium, Hao is theorized to be part of a rHURM pathway in N. profundicola, reducing nitrate to ammonium by Nap, Hao, and Hcp (Fig. 2) (45). The current putative model of the rHURM pathway within N. profundicola involves the trimeric octaheme

Hao which receives electrons from a quinol oxidizing NapC/NrfH like Cytochrome Cm522 (CycB)

(33, 41, 45). Nitrite is reduced by Hao within the periplasm, where the resulting hydroxylamine is transported into the cytoplasm to be reduced to ammonium by Hcp via an NADH reducing iron-sulfur cluster protein (46). The resulting ammonium can then potentially be incorporated into biomass by the GS-GOGAT ammonium assimilation pathway (45). PMF is generated from the redox cycling of the quinol pool between formate dehydrogenase cytochrome b and NapGH as well as CycB (26, 33, 45).

Figure 2: The rHURM pathway in N. profundicola. Proteins and enzymes essential to the rHURM pathway are numerically labeled (1-NapA, 2-NapGH, 3-HaoA, 4-CycB, 5-Hcp, 6-Iron- sulfer protein). NapA and HaoA are putatively anchored to the periplasmic membrane, allowing electron transfer from the quinol pool. Ammonium produced by the rHURM pathway is either incorporated into the biomass or removed from the cell (adapted from Hanson et al., 41).

A database of rHURM related genes constructed previously were BLAST searched against related organisms within Epsilonproteobacteria, revealing the presence of an hao gene homolog in C. curvus and C. concisus, as well as other class members (Table 1) (45). C. curvus was first described by Tanner et al, 1984 and reclassified from Wolinella curva by Vandamme et al, 1991 (47, 14). C. curvus isolates were taken from human oral abscesses as well as fecal samples (47). The majority of research undertaken to study C. curvus has been for the assessment of its role in gastric illnesses (48–50). Few studies concerning the metabolic activities as well as the ecological significance of C. curvus have been done.

Table 1: Survey of potential gene homologs indicative of the rHURM pathway in Epsilonproteobacteria napA haoA hcp cycB Nautiliales N. profundicola + + + + C. mediatlanticus TB-2 + + + + Campylobacterales C. curvus + + + + C. fetus + + + + C. concicus + + + + C. gracilis + + + + C. jejuni + - - - A. nitrofigilis + + - + H. cetorum + + - + H. pylori + - - - W. succinogenes + - + -

Carly Dameron, an undergraduate working with Dr. Barbara Campbell, observed C. curvus to grow in the presence of nitrate, causing a decrease in nitrate concentrations as well as an increase in ammonia. This result suggested that C. curvus is capable of some form of DNRA, despite lacking genes analogous to nitrite reductase. Furthermore, Dameron performed stable isotope probing to determine cell uptake of ammonia potentially produced by cell metabolism.

Using both regular nitrate and a 20% 15N labeled nitrate enrichment, she observed no change in

15N percentage within the biomass. These data sugested that C. curvus does not utilize nitrate reduction for the uptake of ammonia into biomass. Reverse transcription of RNA isolated from

C. curvus, grown in nitrate and fumarate enriched media, revealed an increased expression of the genes napA, hao, and hcp with cells grown in the presence of nitrate compared to cells grown in the presence of fumarate. While this information provides supporting evidence that C. curvus actively performs nitrate reduction via the rHURM pathway, further research is necessary to better characterize the activity and function of the rHURM pathway.

Materials and Methods

Cell Culturing

C. curvus was stored at -80 oC in a 10 % glycerol solution and revived by streaking onto agar plates. Agar plates consisted of either 6mM sodium nitrate or 0.3 % sodium fumarate enriched Brucella Broth with 15 g/L agar added prior to autoclaving. Streaked plates were incubated in an anaerobic chamber with a 80% N2/10% CO2/10% H2 gas mix, and incubated at 37 oC. Single colonies were passed using an inoculation needle from the plate to media within a Coy

Laboratories anaerobic hood.

Cells grown using Brucella Broth (Remel) were prepared for anaerobic batch cultures according to the provided protocol with 0.3% sodium formate and either 6.0 mM sodium nitrate or 0.3 % sodium fumarate (51). No other oxidized inorganic nitrogen species were present within the Brucella Broth. All media was autoclaved using a liquid cycle before being sufficiently sparged using 80% N2 20% CO2 gas mix. All solutions were sparged using sterile 12 cm needles and rubber stoppers. Media enrichments were made in a Coy Laboratories anaerobic chamber, where dispensed media was anaerobically sealed in either serum bottles or test tubes using a rubber stopper and aluminum crimp. Sealed media batches were stored at 4 oC until further use. Headspace was exchanged with 80% N2/10% CO2/10% H2 gas mix before inoculation.

Batch cultures were grown horizontally at 37 oC on a shaker to ensure mixing of headspace gas with the liquid media. Cultures were incubated until late log/stationary phase growth was observed by decrease in OD580 change.

Sampling

Subsamples were removed from the anaerobic cultures by sterile syringe and transferred to 15 mL conical tubes placed on ice. Samples for cell counting were prepared by transferring 100 µL to a 2 % paraformaldehyde phosphate buffer saline solution, thoroughly vortexed, and placed in 4 oC for up to 2 days. Samples for DNA/RNA extractions or chemical assays were centrifuged at 4 oC, 7280 rpm for 10 minutes. The supernatant was passed through a VWR sterile 0.2 µm syringe filter, and stored at -20 oC for chemical analysis. The remaining cell pellets were resuspended in 2 mL RLT Buffer (1 mL for samples taken at 4 hours), provided by

Qiagen All-Prep Kit and stored at -80 oC for later DNA/RNA extractions.

Cell Counting

Paraformaldehyde fixed cells were vortexed prior to passing the sample through a

Nanopore black nitrocellulose 0.2 µm filter using a 15 psi vacuum, then incubated in 2 µg/mL

4’,6-diamidino-2-phenylindole (DAPI) solution for 5 minutes. Excess liquid was passed through the filter by vacuum. The filter was then adhered to a glass slide with 5 µL high viscosity lens oil, and imaged using a Nikon Eclipse E600 microscope with mercury lamp. Images were modified and cell field area measured by using imageJ software (52).

DNA/RNA Extractions and Quantifications

Cells suspended in RLT buffer were extracted using the Qiagen DNA/RNA All-prep kit.

The provided protocol was followed for DNA/RNA extractions, with optional steps taken to increase yield β-mercaptoethanol was added to frozen samples (4 µL/mL) prior to incubation at

65 oC for 1 min. Samples were then vortexed for 1 min. before applying the sample to the DNA

Column supplied in the Qiagen kit. Final DNA and RNA volumes were 100 µL and 60 µL

respectively. DNA and RNA concentration was determined using a Qubit 2.0 Fluorometer

(Invitrogen) with reagents specific for Qubit dsDNA and RNA high specificity (HS) quantification

(Life Technologies).

DNase treatment and cDNA synthesis

All RNA samples greater than 5 ng/µL were diluted to 5 ng/uL so that 50 ng were treated for contaminating DNA using the Ambion Turbo DNase kit following the manufacturer’s protocol. Samples were incubated in a Biorad C1000 Thermal Cycler at 37 oC for 1 hour, inactivated using 2 µL Ambion inactivator reagent for 5 min, then centrifuged at max setting for

8 minutes before transferring the supernatant to a new test tube. RNA was quantified again using Qubit RNA HS. PCR of DNase treated rRNA gene using 16S C. curvus primers provided evidence of total DNA loss (Table 1). DNase treated RNA was converted to cDNA using Thermo

Fisher Scientific Superscript III or IV RT (See Appendix). All master mixes were prepared in a

AirClean 600 PCR hood, and samples were incubated in a Biorad thermal cycler for all prescribed temperature incubations.

Primers and RT-PCR

All primers (Table 2) were designed using NCBI Primer-BLAST or Geneious Primer3 add- on. Primer optimization was performed using temperature gradient programmed by the C1000 thermal cycler. SYBR Green Universal Sso Advanced mix (Biorad) was used for RT-PCR fluorescent amplification. Table 3 shows PCR conditions for cDNA PCR amplification. The PCR cycle program used is provided in Table 4. Fluorescence was measured during the annealing phase to determine transcript abundance.

Table 2. Primers Gene Forward Reverse Annealing Product Temp (oC) size (bp) 16S GGAACTGAGACACGGTCCAG CCGGTGCTTATTCCTTGGGT 60 165 rRNA rpoD TAAAGCGCCTGGAGTATCGC AGAAACCATCGTCGCCTCAG 60 134 napA GCAAACGCAAACCACTGGAT TCGTAGATCATCGCGGTTGG 54 125 hao CTAGAGCGGKCACGCAAGAG CATGAGACGSTWCCGTGGCA 55 144 hcp CTAAAGGGCAACGTCGGCAAGGC CTAGCGATMGAGTAGCCAAA 58 146 frdA ACGCTATTTGGCAACCCTGA GCGCCGTAAGCGATACAAAG 60 83

Table 3. qPCR reaction mixture Reagent Volume (µL) SYBR Green Sso Advanced Universal 6 10 µM Forward Primer 0.25 10 µM Reverse Primer 0.25 H2O 4.5-5 Sample 0.5-1

Table 4. Thermo-cycler protocol Step Time Temp. oC Initial Denaturation 3:00 min 95 Denaturation Cycle 0:10 sec 95 Annealing Temp 0:10 sec Variable Elongation 0:15 Sec 72 Repeat 2-4 X34 Incubation 5:00 min 72 Melt curve 30 sec per 0.5oC 55-90

Chemical assays

Ammonium concentrations in medium samples were measured with an ammonia gas ion sensitive combination electrode (Beckman & Coulter). The probe was equilibrated in 8 mM

NH4Cl solution. Standards were prepared using 1 M NH4Cl, diluted to 2, 4, 8, 12, 16, and 20 mM concentrations in 4 mL sample batches. Assay solution were comprised of either the necessary

stock volume of NH4Cl or 400 µL C. curvus media sample, with the volume of 0.1 M NaOH solution to achieve a total volume 4 mL in a glass test tube. For testing standards and samples, the probe was immersed into the solution for 1.5 min. before taking readings. Standards were plotted against voltage readings on a natural log curve.

Nitrate and formate concentrations from filter-sterilized Brucella Broth from cell cultures were assayed using ionic chromatography. A Dionex IC-2100 and DX-600 was used for nitrogen species addition growth curves and bottle growth curves respectively (53). An Ion Pac

AS14 column (Dionex) was used in both machines. Standards were prepared according to Table

5. All samples and standards assayed by the IC-2100 were diluted 50X, while 20X dilutions were assayed on the DX-600.

Table 5. Standard curve concentrations for chemical analysis 1- 1 - 1- NO3 (mM) NO2 ( mM) HCOO % (w/v) 2 1 0.1 4 2 0.2 6 4 0.4 8 6 0.6 10 8 0.8

All growth curves were conducted in triplicate. Assays were performed in technical triplicate to ensure reproducible values, however all averages and standard error reported in this project reflects the variation between biological replicates since those errors were greater than the technical replicate errors. Student’s T tests were performed to determine significance

(α < 0.05). Theoretical cell counts were determined by creating linear regression models plotting log phase cell counts against measured OD580 from the nitrate and fumarate amended growth curves.

Results

Growth Characteristics of Nitrate and Fumarate Amended Cultures

Cell growth was compared between C. curvus grown with sodium nitrate versus sodium fumarate as electron acceptors. Cell density was assayed by measuring OD580 every 2 hours, along with cell counts (Fig. 3). Cells were cultured until stationary phase was reached, evident by a peak or plateau of absorbance readings.

Figure 3: Growth of C. curvus with Brucella Broth utilizing either sodium nitrate (blue) or sodium fumarate (red) as an electron acceptor. Growth is measured by optical density (OD) at 580 nm (solid line), or by DAPI cell counting (dotted line).

Cells grown on sodium nitrate entered into exponential phase 2 hr earlier than cells utilizing sodium fumarate as an electron acceptor. During log phase, C. curvus utilizing sodium nitrate grew at a rate of 0.75 hr-1 with a doubling time of 1.4 hours, while C. curvus utilizing fumarate grew at a rate of 0.70 hr-1 with a doubling time of 1.5 hours.

Figure 4: Quantification of Nitrate (blue), Ammonium (green), and Formate (red) concentrations throughout C. curvus growth. A) Chemical assay of nitrate enriched cultures. Nitrate concentrations were below detectable limit after 8 hours. B) Chemical assay of fumarate enriched cultures. Nitrate was not detectable.

Concentrations of nitrate, formate, and ammonium were measured to evaluate the greatest rate of chemical change (Fig. 4). Chemical assays suggested that the greatest metabolic activity was between 6-10 hours for C. curvus cultures respiring nitrate, and 8-12 hours for cultures respiring fumarate. Cultures amended with nitrate had a significant (p < 0.05) decrease of the electron acceptor after 6 hours, decreasing below detectable limits. Paired with the 5.9

µmol ml-1 hr-1 decrease of sodium formate and 2.67 µmol ml-1 hr-1 increase in ammonium, these significant changes in media chemistry suggest samples taken from C. curvus cultures at 8 hours post inoculation have the greatest metabolic activity. The formate decrease in fumarate amended C. curvus cultures suggested that relatively high activity at 8 to 10 hours post inoculation. A small but significant (p < 0.001) increase in ammonium concentration was also observed in fumarate-grown cells.

Figure 5: Abundance of 16S rRNA (A) and rpoD (B) cDNAs between 4 and 10 hours post inoculation in the sodium nitrate (blue) and sodium fumarate (red) amended C. curvus cultures. Raw counts were normalized by cDNA yield (ng). Red stars indicate significance (p < 0.05).

High metabolic activity of C. curvus was further supported by assessing copy numbers of

16S rRNA and rpoD RNA (cDNA) abundance (Fig. 5). No significant difference in expression of the 16S rRNA gene was observed between nitrate and fumarate amended cultures at any time point (Fig. 3a). However, a significant increase (p < 0.05) was detected between 4 and 6 hours for both fumarate and nitrate amended cultures. No other time points were significantly different from one another. We observed high variation in rpoD copy abundance in comparison to 16S rRNA (Fig. 3b). Copy abundance of rpoD cDNA in fumarate grown cells was significantly greater (p < 0.05) than nitrate grown cells at 4 hours post inoculation, despite showing no significant difference in OD or cell density. At 10 hours, rpoD expression in nitrate grown cells dropped substantially (p < 0.001), an indication that that these cultures had reached stationary phase (54, 55). Early log was observed at 6 and 8 hours for nitrate grown cells and fumarate grown cells, respectively, while mid log was observed at 8 and 10 hours, respectively. We determined that the most efficacious method of assessing gene expression under our two conditions was to compare samples of nitrate grown samples taken 2 hours prior to samples of fumarate grown cells, as determined by comparing the expression of 16S rRNA and rpoD genes to the generated growth curve and chemical analysis.

Measurement of cDNA Gene Copy Abundance

We assessed expression of genes which encode essential proteins in the putative rHURM pathway: napA, hao, and hcp (Fig. 4), then normalized them to 16S rRNA copies (Figs. 5 and 6). We also measured the expression of the respiratory fumarate dehydrogenase catalytic subunit (FrdA) to see if frdA expression is similarly regulated.

Figure 6: Expression of essential genes related to energy metabolism at early log phase (6 and 8 hours for nitrate {blue} and fumarate {red} C. curvus cultures). Transcript abundance is normalized per 1000 copies of 16S rRNA. Red stars indicate significance (p < 0.05).

We observed differential expression of napA and hcp between nitrate- and fumarate- respiring cells during early log phase at 6 and 8 hrs respectively (Fig. 6). A 1.8 fold increase in napA expression was observed in nitrate cultures, as well as a 1.5 fold increase in hcp. The ratio of napA to hcp gene expression normalized by 1000X 16S rRNA gene copies was found to be 3.4 and 2.9 between nitrate and fumarate amended cultures, respectively. Expression of frdA was significantly greater than all nitrogen related genes in both nitrate and fumarate respiring cultures (p < 0.05), with no observed significant difference between conditions. Despite hao exhibiting the greatest expression of the nitrogen related genes (p < 0.05), there was no significant difference in hao expression observed between nitrate and fumarate cultures.

Figure 7: Expression of essential genes related to energy metabolism at mid log phase (8 and 10 hours for nitrate (blue) and fumarate (red) respectively). Gene copy abundance is normalized per 1000 copies of 16S rRNA.

Gene expression was also measured at mid log growth, approximately 8 and 10 hours for nitrate and fumarate respiring cells, respectively (Fig. 7). Fumarate reductase expression was lower at mid-log phase versus early log phase for both nitrate and fumarate respiring cultures, but we still observed no significant difference between conditions. Expression of napA, hao, and hcp genes in fumarate respiring cells decreased substantially (p < 0.05) between early and mid-log growth, while nitrate respiring cells showed little change in expression. A 3.4 fold decrease in normalized hao expression was observed in fumarate respiring cells between 10 and

8 hours, while only a 1.1 fold decrease was observed in nitrate cultures between 8 and 6 hours.

Growth Characteristics of Chemical Stress Response

Nitrite and hydroxylamine, the substrate and product of hydroxylamine oxidoreducatase, are both highly toxic nitrogen species that interfere normal biochemical processes. To test if the addition of potentially toxic concentrations of these reactive nitrogen compounds during log phase would disrupt growth patterns, cells were grown in 10 mL batches with the addition of the nitrite or hydroxylamine during high metabolic activity to induce a chemical ‘pulse’ disturbance.

Figure 8: Growth of nitrate respiring (A) and fumarate respiring (B) C. curvus exposed to varying concentrations of sodium nitrite at early log phase. The red arrow indicates the time at which nitrite additions occurred.

Nitrate-respiring cultures with varying concentration of added nitrite experienced a prolonged but abated period of exponential growth (Fig. 8a). We observed increased maximum

OD in batch cultures with added nitrite, particularly with the addition of 5.0 mM NaNO2.

However, growth rates were significantly lower (p < 0.05) than that of the control (Table 3). By comparing exponential phase OD values to cell counts in our original growth curve we calculated theoretical growth rate for our modified growth curves. While the control exhibited a growth rate of 0.65 ± 0.02 hr-1, nitrite modified cultures exhibited growth rates from 0.44 to 0.49 hr-1.

We detected a slightly decreased maximum OD in fumarate respiring cultures after adding various concentrations of nitrite, however there was a significant increase in log phase growth rates observed. (Fig. 8b, Table 5). Interestingly, fumarate respiring cells exhibited a slight increase in OD after the addition of 2.5 mM NaNO2, although the cultures still entered into stationary phase as early if not earlier than cultures with higher nitrite additions.

Figure 9: Growth of nitrate respiring (A) and fumarate respiring (B) C. curvus exposed to varying concentrations of hydroxylamine at early log phase. The red arrow indicates time at which hydroxylamine additions occurred.

Although slightly delayed, all cultures, except for those exposed to 1.5 mM NH2OH, showed similar growth to the control (Fig. 9a). We observed an almost complete halt to growth for fumarate respiring cells exposed to hydroxylamine at 8 hours (Fig. 9b). Cell numbers, as assessed by OD taken 24 hours later showed no significant change (not shown in Fig. 9).

Table 6. Growth rate and chemical analysis of nitrate-respiring C. curvus with added reactive nitrite species Addition Growth Rate nitrate formate ammonium k (hr-1) (ΔmM) (ΔmM) (ΔmM) Control 0.65±0.02 -4.87±0.05 -46.4±1.53 8.97±0.41 1- 2.5 mM NO2 0.48±0.01* -4.84±0.20 -43.3±8.54 12.27±2.1 1- 5.0 mM NO2 0.49±0.01* -4.66±0.09 -45.4±1.67 15.56±0.78* 1- 7.5 mM NO2 0.44±0.02* -4.53±0.06* -54.6±0.52* 14.69±0.91* 0.5 mM NH2OH 0.32±0.01* -5.16±0.06* -55.6±1.75* 9.33±0.28 1.0 mM NH2OH 0.26±0.001* -5.02±0.09 --48.6±3.8 9.60±0.42 1.5 mM NH2OH 0.17±4.4E-6* -5.16±0.01* -57.1±2.79* 8.98±0.23 * denotes significant difference (p < 0.05) when compared to the control.

We added nitrite and hydroxylamine, rHURM pathway intermediates, to compare growth rate and chemical changes, hypothesizing that fumarate respiring cultures would exhibit a significant decrease in growth while nitrate respiring cultures would endure the chemical disturbance. All RNS modified cultures showed a significant decrease (p < 0.05) in growth rate compared to the control, although all cultures exhibited exponential growth (Table 6). Despite the decrease in growth rate, the majority of these cultures showed similar or greater rates of nitrate and formate consumption than the control. Similar nitrate and formate consumption

was observed in cultures modified with 2.5 mM and 5.0 mM of nitrite, as well as 1.0 mM of hydroxylamine. Significantly greater changes (p < 0.05) in nitrate and formate were observed with 0.5 mM and 1.5 mM hydroxylamine addition. A significant increase in ammonium was observed with the 5.0 mM nitrite addition. The only significant decrease (p < 0.001) in ammonium concentration was observed in cultures with 7.5 mM of nitrite added. This was surprising considering that no substantial decrease in growth rate (p > 0.05) was observed when comparing the culture with a 7.5 mM nitrite addition to cultures with lower nitrite concentration modifications. Furthermore, no correlation was found when comparing growth rate or nitrate consumption with ammonium.

Table 7. Growth rate and chemical analysis of fumarate-respiring C. curvus with added reactive nitrite species Addition Growth Rate k formate (ΔmM) ammonium (hr-1) (ΔmM) Control 0.48±0.02 -44.2±5.10 3.12±0.05 1- 2.5 mM NO2 0.60±0.09 -45.1±10.9 6.10±0.10* 1- 5.0 mM NO2 0.61±0.05* -70.4±4.95* 8.97±0.12* 1- 7.5 mM NO2 0.52±0.07 -71.9±3.78* 9.17±0.29* 0.5 mM NH2OH 0.04±0.03* -21.3±0.03 3.18±0.43 1.0 mM NH2OH 0.03±0.01* -25.0± 3.30±0.02* 1.5 mM NH2OH 0.03±0.02* -14.7±* 3.82±0.15* * denotes significant difference (p < 0.05) when compared to the control.

When comparing nitrite enrichments of fumarate respiring cultures to the control, we saw a significantly increased growth rate (p < 0.05) during log phase for cultures modified with

5.0 mM of nitrite, with no significant change for 2.5 mM or 7.5 mM nitrite additions (Table 7).

However we observed an almost complete loss of viability with fumarate cultures modified with any hydroxylamine concentration tested, indicated by a significant decrease in growth rate (p <

0.001), as well as no change in OD (Fig. 9b). A significant increase (p < 0.05) in ammonium production was observed in all nitrite modified cultures, with significantly higher ammonium concentration changes in 5.0 mM and 7.5 mM nitrite additions. This paralleled a significant increase (p < 0.05) in formate consumption. We observed a significant decrease (p < 0.05) in ammonium concentration change in 1.0 mM and 1.5 mM hydroxylamine modified cultures.

Our fumarate respiring culture with a 5.0 mM nitrite addition grew at a rate of 0.61±.05 hr-1, significantly higher (p < 0.05) than all other fumarate cultures with nitrite or hydroxylamine additions, exhibiting similar growth rate to the nitrate control.

Table 8. Comparison of observed versus hypothesized change in ammonium concentration in addition cultures Condition Addition(mM) Theoretical Observation (mM) (mM) Nitrate, 2.5 11.47 12.27±2.12 NO21- 5.0 13.97 15.56±0.78 addition 7.5 16.47 14.69±0.91* Nitrate, 0.5 9.47 9.33±0.29 NH2OH 1.0 9.97 9.60±0.42 addition 1.5 10.47 8.98±0.23* Fumarate, 2.5 5.62 6.10±0.10* NO21- 5.0 8.11 8.97±0.12* addition 7.5 10.62 9.17±0.29* Fumarate 0.5 3.63 3.18±0.43 NH2OH 1.0 4.12 3.30±0.02* addition 1.5 4.62 3.82±0.15* * denotes significant difference (p < 0.05) between observed and theoretical change in ammonium concentration

A discernable difference in the ammonium concentration was observed when comparing nitrate and fumarate cultures modified with RNS. Comparing ammonium in our control cultures to the change in ammonium for each modified culture, we expected to see a difference equivalent to the amount of the inorganic nitrogen added. After comparing our theoretical calculations to our experimental data, only fumarate cultures with 2.5 and 5.0 mM nitrite modifications exhibited a higher and expected increase in ammonium concentration

(Table 8). The same modifications in nitrate cultures yielded no significant difference between the expected and observed change in ammonium concentration. We observed no significant deviations from our predicted calculations for 0.5 mM and 1.0 mM hydroxylamine modified nitrate cultures as well as the 0.5 mM hydroxylamine modified fumarate culture. A significantly less than expected (p < 0.05) change in ammonium concentration was observed in all 7.5 mM nitrite modifications and 1.5 mM hydroxylamine modifications for both nitrate and fumarate cultures. A lower than expected result was also observed in 1.0 mM hydroxylamine modified fumarate culture.

Discussion

Although it is generally known that C. curvus is capable of reducing nitrate, we believe this the first attempt to further analyze the bacterium’s ability to perform DNRA (47, 14, 56). By identifying homologous genes to those in the rHURM pathway described by Campbell et al., we set out to analyze the differential expression and biotic chemical change of C. curvus grown in a nitrate-amended medium versus a fumarate-amended medium (40). We observed the expression of napA, hao, and hcp in nitrate respiring C. curvus at mid log phase, an observation that parallels the increased gene expression of N. profundicola when grown with nitrate as an electron acceptor (45). To further evaluate function, we performed growth curves with nitrite or hydroxylamine modifications, assessing resilience to reactive nitrogen stress.

Expression of the core genes potentially related to the rHURM pathway was found to be greater in cells grown in the presence of nitrate compared to fumarate. These results indicate that C. curvus responds to the presence of nitrate, and that Hao and Hcp production is stimulated in nitrate respiring cells (45, 47) Of the three genes, the hao gene exhibits roughly 4 and 15 times greater transcript abundance than the napA and hcp gene, respectively.

The over-expression of hao compared to napA and hcp is potentially indicative of a metabolic bottleneck within the rHURM pathway. If the reduction of nitrite to hydroxylamine is kinetically a rate-limiting step, C. curvus may compensate by increasing protein production, preventing nitrite accumulation. Testing whether cycB shows similar expression could further support this observation. Hcp exhibits a relatively high enzymatic velocity at optimal conditions compared to Hao, which parallels the disparity in gene expression (57, 58). Our observations

may also indicate that Hao has an alternative function, supported by the higher than expected expression of hao in fumarate respiring cells.

At early log phase of growth, no significant difference in hao gene copy number was measured between nitrate and fumarate C. curvus cultures. We observed a significant decline in hao transcript abundance when comparing early log to mid-log growth of fumarate respiring cells. This itself indicates that there is similar expression of the hao gene for both nitrate and fumarate respiring cells, relative to the expression of the 16S rRNA gene, during initial C. curvus active growth. This may indicate that hao is expressed for an alternative function to dissimilatory nitrite reduction in the rHURM pathway. It is possible that Hao may mitigate nitrosative stress in C. curvus. While many prokaryotes utilize flavohaemoglobin (Hmp) for nitrosative defense, several species including C. curvus lack the hmp gene (59). The classic nitrosative resistance genes observed in Campylobacter jejuni and coli are cgb and nrfA, however both genes are absent from the C. curvus genome (60–62). The decrease in hao transcript abundance from early to mid-log may be an indication of down-regulation due to the absence of RNS; however, there is currently no evidence to support the expression of hao in the absence of nitrite or any RNS. We speculate that hao expression may be silenced by post- transcriptional regulation. Recent transcriptomic work in H. pylori and C. jejuni has shown complex regulatory mechanisms via small non-coding RNA (63). Conserved sRNA sequences have been documented to regulate essential metabolic pathways especially when related to pathogenicity, implicating that an antisense RNA or associated non-coding RNA region could prevent translation (64). This mechanism may allow greater regulatory elasticity in an environment where nitrite concentrations heavily depend on the dietary choices of the host.

To assess the nitrosative resistance of nitrate and fumarate respiring C. curvus cultures, we performed growth curves with varying nitrite or hydroxylamine additions during log phase.

Nitrite or hydroxylamine was injected into batch cultures at 6 and 8 hours for nitrate and fumarate respiring cells respectively. Diminished growth rates were observed in nitrate respiring cells with both nitrite and hydroxylamine; however, extended exponential growth, evident from OD readings, was observed with nitrite additions, potentially signifying that while nitrite may have caused diminished activity, nitrate respiring cells were able to utilize the nitrite for respiration. Previous studies have shown that other Epsilonproteobacteria are capable of reducing nitrite to enhance energy metabolism, and we determined that the genome of C. curvus does encode the formate/nitrite transporter gene foc (33, 61, 65). Growth rate was significantly diminished in nitrate cultures with added hydroxylamine when compared to the control, but active growth was still observed. The up-regulation of hcp can be considered a RNS stress response, and the active expression of the gene may have mitigated the mutagenic effects of hydroxylamine (58, 66–68). Kern et al. observed that NrfA conveys significant hydroxylamine resistance in W. succinogenes, while Hcp plays no significant role in nitrosative stress defense (62). Because of the absence of an NrfA homolog encoded in the C. curvus genome, Hcp may be essential to mediating hydroxylamine related DNA damage, however further research needs to be performed to confirm this.

In contrast to nitrate amended cultures, hydroxylamine additions to fumarate amended cultures caused an almost immediate halt to growth. The absence of cellular activity was supported by the decrease of formate loss and change in ammonium, especially with 1.0 mM and 1.5 mM hydroxylamine additions. The effect hydroxylamine has on fumarate respiring C.

curvus supports the idea that hydroxylamine reduction and stress resistance is linked to hcp expression. Even more surprising is the fumarate respiring cells positive response to nitrite additions. We observed increased growth rate in all fumarate cultures with nitrite additions.

Increases in formate oxidation and ammonium concentrations between inoculation and stationary phase indicate relatively high activity compared to the control. This supports the observation that the hao gene, potentially responsible for nitrite reduction, is significantly expressed in fumarate respiring cells during early growth.

We wished to characterize the putative rHURM pathway from both a genetic and chemical standpoint. We measured ammonium concentrations with the hypothesis that if nitrate and other inorganic nitrogen species added were being utilized by C. curvus for energy metabolism, we would see a change in ammonium concentration relative to the amount of inorganic nitrogen added. All cultures exhibited an increase in ammonium not directly related to the presence of any inorganic nitrogen species. This is most likely due to amino acid catabolism from amino acids present in the Brucella Broth. Campylobacter as well as other

Epsilonproteobacteria like Helicobacter pylori lack the necessary metabolic pathways to utilize carbohydrates, meaning their primary carbon source is from amino acids like aspartate and serine as well as organic acids such as citrate and fumarate (13, 69, 70). Ammonium is released during amino acid breakdown in order to incorporate the carbon into the biomass. Growth of fumarate respiring cells from inoculation to stationary phase exhibited an approximately 3 mM increase in ammonium. This appears to parallel nitrate respiring cells, which exhibited a 9 mM increase. The difference in ammonium concentration is equivalent to the initial nitrate concentration. This supports the hypothesis that all nitrate utilized by C. curvus is reduced to

ammonium. Almost all cultures with RNS additions had changes in ammonium concentrations that matched our predictions. The highest concentration modifications for nitrite and hydroxylamine (7.5 mM and 1.5 mM, respectively) yielded increases less than expected in ammonium, potentially due to C. curvus being affected by the RNS toxicity. Fumarate respiring cultures with 2.5 mM and 5.0 mM nitrite modifications exhibited slightly greater than expected change in ammonium. The increased availability of an electron acceptor may have provided more energy for amino acid catabolism, resulting in a greater production of ammonium. This further supports the idea that the hao gene is being expressed in fumarate respiring cells in the absence of nitrite reduced from NapA.

The evidence provided suggests that the genes napA, hao, and hcp encode proteins involved in nitrate reduction within C. curvus, homologous to the essential genes involved in the putative rHURM pathway within N. profundicola (40, 45). With the absence of all classical nitrite reductases related to DNRA or denitrification, we conjecture that hydroxylamine oxidoreductase reduces nitrite to hydroxylamine, while hydroxylamine reductase encoded by hcp reduces hydroxylamine to ammonium. Chemical assays support this statement, depicting a corresponding decrease and increase of nitrate and ammonium, respectively. However, we observed a relatively similar gene copy abundance of hao in both nitrate and fumarate early log phase growth, compared to the differential expression of napA or hcp between the two conditions. The observed relative increase of ammonium to the corresponding nitrite additions in fumarate cultures further signifies that C. curvus, in the absence of any oxidized inorganic nitrogen species, is capable of surviving a significantly high introduction of exogenous nitrite.

Furthermore, our results indicate that fumarate respiring cells may actively utilize the nitrite

from this simulated nitrosative pulse disturbance for cell respiration. This suggests that Hao may have an alternative function to dissimilatory nitrite reduction. This secondary function may be independent of RNS, since expression was observed in cultures without any form of oxidized inorganic nitrogen. Alternatively, constitutively expressed Hao may convey resistance to nitrite or nitric oxide toxicity arising from irregular pulses of these compounds (42).

Mitigation of nitrosative stress is an important characteristic for the survivability of enteric bacteria, especially in the mammalian oral cavity where nitrite and nitric oxide is constantly secreted to promote antimicrobial activity and maintain vascular nitric oxide homeostasis (15, 17, 19). In the absence of genes cgb and nrfA, the hao gene product may have an ancillary role in sustaining resistance to nitrite or nitric oxide. However, a putative nitric oxide reductase gene norZ is encoded in the C. curvus genome whose gene product may convey nitric oxide resistance. Further research needs to be conducted to better understand the role

Hao plays in C. curvus metabolism. Regardless, these observations show that C. curvus has the capability to play a role in inorganic nitrogen metabolism within our digestive system. Despite being classified over 32 years ago, little research currently exists of C. curvus beyond observed clinical isolations. C. curvus activity may have unknown effects on the susceptibility of gastroenteritis and other digestive illnesses, or may influence the virulence of other related strains (10, 16). These possibilities make C. curvus a future candidate for study. This research also represents one of the initial steps to better understand the truly dynamic role hydroxylamine oxidoreductase plays in bacteria which utilize inorganic nitrogen as part of their metabolism (22).

Future Research

The next step in this research is to assess the changes in core rHURM gene expression under various RNS conditions, as well as identify associated genes related to C. curvus nitrogen metabolism. Our immediate goal is to evaluate the expression of napA, hao, and hcp under the various RNS stresses described earlier. We hypothesize that with the addition of nitrite or hydroxylamine to nitrate respiring C. curvus cultures, we will observe evidence of up-regulation hao and hcp respectively. Future experiments may also include the study of C. curvus gene expression when exposed to nitric oxide, an essential condition to evaluate considering the natural concentrations of nitric oxide C. curvus is exposed to nitric oxide from dietary nitrate reacting with low stomach pH as well as chemotrophic bacterial respiration (16).

Our second immediate goal is to construct transcriptomes of C. curvus utilizing nitrate or fumarate as an electron acceptor. We will use these data to identify genes associated with the rHURM pathway and its regulation by searching for differentially expressed genes between transcriptomes. This next generation sequencing technology will give us the ability to observe un-annotated genes as well as previously unknown associated genes that up-regulate in cells respiring nitrate. Looking for homologs of these genes in other organisms may help establish a more complete evolutionary history of this pathway, as well as identify how this nitrate reduction pathway may be more or less favorable to the classic DNRA pathways for C. curvus and other chemotrophic Epsilonproteobacteria.

References

1. Campbell BJ, Engel AS, Porter ML, Takai K. 2006. The versatile epsilon-proteobacteria: key players in sulphidic habitats. Nat. Rev. Microbiol. 4:458–68.

2. Takai K, Campbell BJ, Cary SC, Suzuki M, Oida H, Nunoura T, Hirayama H, Nakagawa S, Suzuki Y, Inagaki F, Horikoshi K. 2005. Enzymatic and genetic characterization of carbon and energy metabolisms by deep-sea hydrothermal chemolithoautotrophic isolates of Epsilonproteobacteria. Appl. Environ. Microbiol. 71:7310–20.

3. Porter ML, Engel AS. 2008. Diversity of uncultured Epsilonproteobacteria from terrestrial sulfidic caves and springs. Appl. Environ. Microbiol. 74:4973–7.

4. Sievert SM, Scott KM, Klotz MG, Chain PSG, Hauser LJ, Hemp J, Hügler M, Land M, Lapidus A, Larimer FW, Lucas S, Malfatti S a, Meyer F, Paulsen IT, Ren Q, Simon J. 2008. Genome of the epsilonproteobacterial chemolithoautotroph Sulfurimonas denitrificans. Appl. Environ. Microbiol. 74:1145–56.

5. Grote J, Labrenz M, Pfeiffer B, Jost G, Jürgens K. 2007. Quantitative distributions of Epsilonproteobacteria and a Sulfurimonas subgroup in pelagic redoxclines of the central Baltic Sea. Appl. Environ. Microbiol. 73:7155–61.

6. Guccione E, Leon-Kempis MDR, Pearson BM, Hitchin E, Mulholland F, van Diemen PM, Stevens MP, Kelly DJ. 2008. Amino acid-dependent growth of Campylobacter jejuni: key roles for aspartase (AspA) under microaerobic and oxygen-limited conditions and identification of AspB (Cj0762), essential for growth on glutamate. Mol. Microbiol. 69:77– 93.

7. Weingarten R a, Taveirne ME, Olson JW. 2009. The dual-functioning fumarate reductase is the sole succinate:quinone reductase in Campylobacter jejuni and is required for full host colonization. J. Bacteriol. 191:5293–300.

8. Kuhns LG, Benoit SL, Bayyareddy K, Johnson D, Orlando R, Evans AL, Waldrop GL, Maier J. 2016. Carbon Fixation Driven by Molecular Hydrogen Results in Chemolithoautotrophically Enhanced Growth of Helicobacter pylori. J. Bacteriol. 198:1423–1428.

9. Franceschi F, Annalisa T, Teresa DR, Giovanna D, Ianiro G, Franco S, Viviana G, Valentina T, Riccardo LL, Antonio G. 2014. Role of Helicobacter pylori infection on nutrition and metabolism. World J. Gastroenterol. 20:12809–17.

10. Man SM. 2011. The clinical importance of emerging Campylobacter species. Nat. Rev. Gastroenterol. Hepatol. 8:669–685.

11. Stephen LW, Holmes B. 1995. Classification and Identification of Campylobacters, Helicobacters and Allied Taxa by Numerical Analysis of Phenotypic Characters. Syst. Appl. Microbiol. 18:374–390.

12. Gunther NW, Chen C-Y. 2009. The biofilm forming potential of bacterial species in the genus Campylobacter. Food Microbiol. 26:44–51.

13. Weingarten R a, Taveirne ME, Olson JW. 2009. The dual-functioning fumarate reductase is the sole succinate:quinone reductase in Campylobacter jejuni and is required for full host colonization. J. Bacteriol. 191:5293–300.

14. Vandamme P, Falsen E, Rossau R, Hoste B, Segers P, Tytgat R, De Ley J. 1991. Revision of Campylobacter, Helicobater, and Wolinella Taxonomy: Emendation of Generic Descriptions and Proposal of Acrobcter gen. nov. Int. J. Syst. Bacteriol. 41:88–103.

15. Kapil V, Haydar SM a, Pearl V, Lundberg JO, Weitzberg E, Ahluwalia A. 2013. Physiological role for nitrate-reducing oral bacteria in blood pressure control. Free Radic. Biol. Med. 55:93–100.

16. Lundberg JO, Weitzberg E, Cole J a, Benjamin N. 2004. Nitrate, bacteria and human health. Nat. Rev. Microbiol. 2:593–602.

17. Kapil V, Weitzberg E, Lundberg JO, Ahluwalia a. 2014. Clinical evidence demonstrating the utility of inorganic nitrate in cardiovascular health. Nitric Oxide 38:45–57.

18. Sobko T, Marcus C, Govoni M, Kamiya S. 2010. Dietary nitrate in Japanese traditional foods lowers diastolic blood pressure in healthy volunteers. Nitric Oxide 22:136–40.

19. Omar S a, Webb AJ. 2014. Nitrite reduction and cardiovascular protection. J. Mol. Cell. Cardiol. 73:57–69.

20. Sparacino-Watkins C, Stolz JF, Basu P. 2014. Nitrate and periplasmic nitrate reductases. Chem. Soc. Rev. 43:676–706.

21. Kern M, Simon J. 2009. Electron transport chains and bioenergetics of respiratory nitrogen metabolism in Wolinella succinogenes and other Epsilonproteobacteria. Biochim. Biophys. Acta 1787:646–56.

22. Simon J, Klotz MG. 2013. Diversity and evolution of bioenergetic systems involved in microbial nitrogen compound transformations. Biochim. Biophys. Acta 1827:114–35.

23. González PJ, Correia C, Moura I, Brondino CD, Moura JJG. 2006. Bacterial nitrate reductases: Molecular and biological aspects of nitrate reduction. J. Inorg. Biochem. 100:1015–23.

24. Richardson DJ, Berks BC, Russell D a, Spiro S, Taylor CJ. 2001. Functional, biochemical and genetic diversity of prokaryotic nitrate reductases. Cell. Mol. Life Sci. 58:165–78.

25. Simpson PJL, Richardson DJ, Codd R. 2010. The periplasmic nitrate reductase in Shewanella: the resolution, distribution and functional implications of two NAP isoforms, NapEDABC and NapDAGHB. Microbiology 156:302–12.

26. Kern M, Simon J. 2008. Characterization of the NapGH quinol dehydrogenase complex involved in Wolinella succinogenes nitrate respiration. Mol. Microbiol. 69:1137–52.

27. Kern M, Simon J. 2009. Periplasmic nitrate reduction in Wolinella succinogenes: cytoplasmic NapF facilitates NapA maturation and requires the menaquinol dehydrogenase NapH for membrane attachment. Microbiology 155:2784–94.

28. Simon J, Sänger M, Schuster SC, Gross R. 2003. Electron transport to periplasmic nitrate reductase (NapA) of Wolinella succinogenes is independent of a NapC protein. Mol. Microbiol. 49:69–79.

29. Klotz MG, Stein LY. 2008. Nitrifier genomics and evolution of the nitrogen cycle. FEMS Microbiol. Lett. 278:146–56.

30. Polyakov KM, Boyko KM, Tikhonova T V, Slutsky A, Antipov AN, Zvyagilskaya R a, Popov AN, Bourenkov GP, Lamzin VS, Popov VO. 2009. High-resolution structural analysis of a novel octaheme cytochrome c nitrite reductase from the haloalkaliphilic bacterium Thioalkalivibrio nitratireducens. J. Mol. Biol. 389:846–62.

31. Atkinson SJ, Mowat CG, Reid G a, Chapman SK. 2007. An octaheme c-type cytochrome from Shewanella oneidensis can reduce nitrite and hydroxylamine. FEBS Lett. 581:3805– 8.

32. Simon J, Pisa R, Stein T. 2001. The tetraheme cytochrome c NrfH is required to anchor the cytochrome c nitrite reductase (NrfA) in the membrane of Wolinella succinogenes. Eur. J. … 268:5776–5782.

33. Simon J, Gross R, Einsle O. 2000. A NapC/NirT‐type cytochrome c (NrfH) is the mediator between the quinone pool and the cytochrome c nitrite reductase of Wolinella succinogenes. Mol. Microbiol. 35:686–696.

34. Brown CM. 1975. Ammonia Assimilation by Rhizobium Cultures and Bacteroids. J. Gen. Microbiol. 86:39–48.

35. Pearson I, Page M, Spanning RJM, Ferguson SJ. 2003. A mutant of Paracoccus denitrificans with disrupted genes coding for cytochrome c550 and pseudoazurin establishes these two proteins as the in vivo electron donors. J. Bacteriol. 185:6308– 6315.

36. Reimann J, Flock U, Lepp H, Honigmann A, Adelroth P. 2007. A pathway for protons in nitric oxide reductase from Paracoccus denitrificans. Biochim. Biophys. Acta 1767:362– 73.

37. Spiro S. 2012. Nitrous oxide production and consumption: regulation of gene expression by gas-sensitive transcription factors. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 367:1213– 25.

38. Simon J, Einsle O, Kroneck PMH, Zumft WG. 2004. The unprecedented nos gene cluster of Wolinella succinogenes encodes a novel respiratory electron transfer pathway to cytochrome c nitrous oxide reductase. FEBS Lett. 569:7–12.

39. Luckmann M, Mania D, Kern M, Bakken LR, Frostegård A, Simon J. 2014. Production and consumption of nitrous oxide in nitrate-ammonifying Wolinella succinogenes cells. Microbiology 160:1749–59.

40. Campbell BJ, Smith JL, Hanson TE, Klotz MG, Stein LY, Lee CK, Wu D, Robinson JM, Khouri HM, Eisen J a, Cary SC. 2009. Adaptations to submarine hydrothermal environments exemplified by the genome of Nautilia profundicola. PLoS Genet. 5:e1000362.

41. Bergmann DJ, Hooper AB, Klotz MG. 2005. Structure and Sequence Conservation of hao Cluster Genes of Autotrophic Ammonia-Oxidizing Bacteria : Evidence for Their Evolutionary History Structure and Sequence Conservation of hao Cluster Genes of Autotrophic Ammonia-Oxidizing Bacteria : Evidence for. Appl. Environ. Microbiol. 71:5371–5382.

42. Kostera J, McGarry J, Pacheco a A. 2010. Enzymatic interconversion of ammonia and nitrite: the right tool for the job. Biochemistry 49:8546–53.

43. Kern M, Simon J. 2011. Production of recombinant multiheme cytochromes c in Wolinella succinogenes. Methods Enzymol. 486:429–46.

44. Kostera J, Youngblut MD, Slosarczyk JM, Pacheco a A. 2008. Kinetic and product distribution analysis of NO* reductase activity in Nitrosomonas europaea hydroxylamine oxidoreductase. J. Biol. Inorg. Chem. 13:1073–83.

45. Hanson TE, Campbell BJ, Kalis KM, Campbell M a, Klotz MG. 2013. Nitrate ammonification by Nautilia profundicola AmH: experimental evidence consistent with a free hydroxylamine intermediate. Front. Microbiol. 4:180.

46. Cabello P, Pino C, Olmo-Mira MF, Castillo F, Roldán MD, Moreno-Vivián C. 2004. Hydroxylamine assimilation by Rhodobacter capsulatus E1F1. requirement of the hcp gene (hybrid cluster protein) located in the nitrate assimilation nas gene region for hydroxylamine reduction. J. Biol. Chem. 279:45485–94.

47. Tanner ACR, Listgarten MA, Ebersole JL. 1984. Wolinella curva sp. nov.: “Vibrio succinogenes” of Human Origin. Int. J. Syst. Bacteriol. 34:275–282.

48. Koga M, Yuki N, Takahashi M, Saito K, Hirata K. 1999. Are Campylobacter curvus and Campylobacter upsaliensis antecedent infectious agents in Guillain – Barre and Fisher’s syndromes ? J. Neurol. Sci. 163:53–57.

49. Mukhopadhya I, Thomson JM, Hansen R, Berry SH, El-Omar EM, Hold GL. 2011. Detection of Campylobacter concisus and other Campylobacter species in colonic biopsies from adults with ulcerative colitis. PLoS One 6:e21490.

50. Abbott SL, Waddington M, Lindquist D, Ware J, Cheung W, Ely J, Janda JM. 2005. Description of Campylobacter curvus and C . curvus -Like Strains Associated with Sporadic Episodes of Bloody Gastroenteritis and Brainerd ’ s Diarrhea. J. Clin. Microbiol. 43:585–588.

51. Tanner ACR, Badger S, Lai C, Listgarten MAXA, Visconti RA, Socransky SS. 1981. Wolinella gen. nov., Wolinella succinogenes (Vibrio succinogenes Wolin et al.) comb. nov., and Description of Bacteroides gracilis sp. nov., Wolinella recta sp. nov., Campylobacter concisus sp. nov., and Eikenella corrodens from Humans with Periodontal Di. Int. J. Syst. Bacteriol. 31:432–445.

52. Papadopulos F, Spinelli M, Valente S, Foroni L, Orrico C, Alviano F, Pasquinelli G. 2007. Common tasks in microscopic and ultrastructural image analysis using ImageJ. Ultrastruct. Pathol. 31:401–7.

53. Costello DM, Lamberti GA, Costello DM, Lamberti GA. 2008. International Association for Ecology Non-Native Earthworms in Riparian Soils Increase Nitrogen Flux into Adjacent Aquatic Ecosystems Published by : Springer in cooperation with International Association for Ecology Stable URL : http://www.jstor.org/stabl. Ecosyst. Ecol. 158:499–510.

54. Helmann JD, Chamberlin MJ. 1988. Structure and function of bacterial sigma factors. Annu. Rev. Biochem. 57:839–72.

55. Jishage M, Iwata A, Ueda S. 1996. Regulation of RNA Polymerase Sigma Subunit Synthesis in Escherichia coli : Intracellular Levels of Four Species of Sigma Subunit under Various Growth Conditions. Am. Soc. Microbiol. 178:5447–5451.

56. Moreno-Vivián C. 1999. Prokaryotic nitrate reduction: molecular properties and functional distinction among bacterial nitrate reductases. J. Bacteriol. 181:6573–6584.

57. Schalk J, de Vries S, Kuenen JG, Jetten MSM. 2000. Involvement of a Novel Hydroxylamine Oxidoreductase in Anaerobic Ammonium Oxidation †. Biochemistry 39:5405–5412.

58. Wolfe MT, Heo J, Garavelli JS, Ludden PW. 2002. Hydroxylamine Reductase Activity of the Hybrid Cluster Protein from Escherichia coli. J. Bacteriol. 184:5898–5902.

59. Poole RK. 2005. Nitric oxide and nitrosative stress tolerance in bacteria. Biochem. Soc. Trans. 33:176–80.

60. Elvers KT, Wu G, Gilberthorpe NJ, Poole RK, Park SF. 2004. Role of an inducible single- domain hemoglobin in mediating resistance to nitric oxide and nitrosative stress in Campylobacter jejuni and Campylobacter coli. J. Bacteriol. 186:5332–41.

61. Pittman MS, Elvers KT, Lee L, Jones M a, Poole RK, Park SF, Kelly DJ. 2007. Growth of Campylobacter jejuni on nitrate and nitrite: electron transport to NapA and NrfA via NrfH and distinct roles for NrfA and the globin Cgb in protection against nitrosative stress. Mol. Microbiol. 63:575–90.

62. Kern M, Volz J, Simon J. 2011. The oxidative and nitrosative stress defence network of Wolinella succinogenes: cytochrome c nitrite reductase mediates the stress response to nitrite, nitric oxide, hydroxylamine and hydrogen peroxide. Environ. Microbiol. 13:2478– 94.

63. Pernitzsch SR, Sharma CM. 2012. Transcriptome complexity and riboregulation in the human pathogen Helicobacter pylori. Front. Cell. Infect. Microbiol. 2:14.

64. Dugar G, Herbig A, Förstner KU, Heidrich N, Reinhardt R, Nieselt K, Sharma CM. 2013. High-resolution transcriptome maps reveal strain-specific regulatory features of multiple Campylobacter jejuni isolates. PLoS Genet. 9:e1003495.

65. Sellars MJ, Hall SJ, Kelly DJ. 2002. Growth of Campylobacter jejuni Supported by Respiration of Fumarate , Nitrate , Nitrite , Trimethylamine- N -Oxide , or Dimethyl Sulfoxide Requires Oxygen Growth of Campylobacter jejuni Supported by Respiration of Fumarate , Nitrate , Nitrite , Trimethyla. J. Biol. Chem 184:4187–4196.

66. Filenko N, Spiro S, Browning DF, Squire D, Overton TW, Cole J, Constantinidou C. 2007. The NsrR regulon of Escherichia coli K-12 includes genes encoding the hybrid cluster protein and the periplasmic, respiratory nitrite reductase. J. Bacteriol. 189:4410–7.

67. Da Silva SM, Amaral C, Neves SS, Santos C, Pimentel C, Rodrigues-Pousada C. 2015. An HcpR paralog of Desulfovibrio gigas provides protection against nitrosative stress. FEBS Open Bio 5:594–604.

68. Karlinsey JE, Bang I-S, Becker L a, Frawley ER, Porwollik S, Robbins HF, Thomas VC, Urbano R, McClelland M, Fang FC. 2012. The NsrR regulon in nitrosative stress resistance of Salmonella enterica serovar Typhimurium. Mol. Microbiol. 85:1179–93.

69. Parkhill J, Wren B, Mungall K, Ketley J. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403:665–669.

70. Alm R, Ling L, Moir D, King B. 1999. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397.

&lt;I&gt;Campylobacter Curvus&lt;/I&gt;

<I>Campylobacter Curvus</I>