Aquaculture
Biotechnology
Symposium
Proceedings
Edward M. Donaldson
Don D. MacKin lay
9..tellr4tio;W eo~ie;~i ~ g>~ ~ '9~ San FranciscoState Univers;d" Julv 14-18. 1996 Aquaculture, biotechnology: symposium procee)dings. Aquaculture
Biotechnology
Symposium
Proceedings
Edward M. Donaldson
Don D. MacKinlay
! ~ 'J~ ~ a.. de ~ ~7i44e4 San Francisco State University Ju/y 14-18,1996.
DEPARTMENT OP FISHERIES I: OCI!ANS FlSHDIUES MANAGEMENT REGIONAL lIBllA1Y 555 WEST HASTINGS STIEET VANCOuvu. ..Co V6B5G3 Copyright © 1996 Physiology Section, American Fisheries Society All rights reserved
InternatioIllll Standard Book Number (ISBN) 0-9698631-0-4
Notice
This publication is made up of camera-ready, extended abstracts submitted by the authors without peer review or line editing, and therefore the papers in the volume should not be cited as primary literature. Since much of this work has beel1lr will be published in the primary literature, please contact the authors if you are Interested im proper citation for their work.
The quality of the papers printed here, both scientifically and typographically, are the sole responsibility of the authors. The Physiology Section of the American Fisheries Society offers this compilation of papers in the interests of information exchange only, ad makes no claim as to the validity of the conclusions or recommendatioa presented in the papers.
For extra copies of this Symposium, or the nine Symposia in the Congress series, contact:
Don MacKinlay, SEP DFO, 555 West Hastings Sl,Van",uver BC V6B 5G3 Caeada Phone: 604-666-3520 Fax 604-666-6894 E-mail: mackinlayd@mailhost_pac.dfo.ca
Orders;' Make cheques payable to AFS Physiology SectiOD Cost: 1 volume - 25$US; set of 9 volumes - $50
. -'"": . ;.,
:.' PREFACE
Aquaculture now accounts for over 20% of the world production of fish for human co.nsumption. The Consultative Group on International Agricultural Research has recently predicted that "within 15 years fish farming and sea ranching could provide more than 40% of all fish for the human diet and more than half of the value of the global fish catch" (CGIAR 1995). The world is in a state of transition from the hooting and gathering offish to the production offish by aquaculture. A number of factors including the continued inexorable growth in world population and advances in fishing technology have placed unsustainable pressures on wild fish stocks. Recent data from the Food and Agriculture Organi2B.tion of the United Nations provides clear evidence that the global wild fishery reached a maximum level in 1989 and has since declined.
The shift to increased dependence on aquaculture to provide high quality fish for human consumption places an onus on governments, researchers and farmers to develop efficient, economic and sustainable aquaculture production systems for a wide variety of species which are adapted to specific aquatic conditions. It is unlikely that finfish production will ever be narrowed down to the 4 or 5 mammalian or avian species that dominate agricultural production; in fact the number of finfish species under cultivation continues to expand and species - specific research and development is required in each case.
Biotechnology has played an important role in the growth of aquaculture to its present state of development. and we can anticipate that biotechnology has the potential to revolutionize fish culture as we know it over the next decade or so. Biotechnology has two major roles in aquaculture: it can improve the economic efficiency of aquaculture and it can also contribute to the sustainability of aquaculture and the protection of wild stocks. The responsible and appropriate application of biotechnology will enable the development of sustainable aquaculture and facilitate the concurrent maintenance of wild stocks for their commercial, recreational and inherent aesthetic value.
In this Aquaculture Biotechnology Symposiwn of the American Fisheries Society Physiology Section, we have brought together a series of papers from the Americas, Asia and Africa which cover several aspects of current research on aquaculture biotechnology. The papers have been grouped. by topic. The first is the key topic of gamete quality and cryopreservation. Sperm cryopreservation technology is of importance for the development of gene banks both as an insurance policy for the conservation of biodiversity in wild stocks and also as a means of assisting aquaculture by: storage of valuable sperm (e.g. monosex) for future use, transport of sperm. allowing hybridization between species with differing spawning seasons, etc. The second and largest group of papers Covers the topics of sex differentiation, sex control and chromosome set manipulation. It is increasingly recognized that in a given species either one sex or the other offers advantages for aquaculture through such characteristics as increased growth, higher market value, or later sexual maturation. In other species or situations it may be desirable to produce sterile fish through the development of monosex female triploids. This technology will be of particular importance for the reproductive containment of genetically-modified aquatic organisms such as transgenics.
In the section on reproduction and growth, there is a single paper on changes in gonadotropin and
3 somatotropin during reproductive development in a catfish. TIlls is followed by a section on transgenics. Transgenic fish promise to revolutionize both cold water and tropical aquaculture in the early part of the third millenniwu as early progress in sa.l.m.onids is being followed by technology development in species such as tilapia. Another key area both for aquaculture and for the management of wild fish stocks is the development of molecu1ar techniques for stock and species identification and for the tracing of offspring to parents in selection programs.
The volume closes with several papers on molecular biology, including a paper on the DNA based immunization of sahnon and a paper on major histocompatability complex genes in rainbow trout.
We wish to to thank Francesc Piferrer for serving as a cont,act person for the Symposium.
Edward M. Donaldson. F .R.S.C. Don D. MacKinlay Science Branch Salmonid Enhancement Program Fisheries and Oceans Canada Fisheries and Oceans Canada
CONGRESS ACKNOWLEDGEMENTS
This Symposium is part of the International Congress on the Biology of Fishes. whose main sponsors were the Fisheries and Oceans Canada (DFO). the US National BiolOgical Service (NBS) and San Francisco State University (SFSU). The main organizers of the Congress, on behalf of the Physiology Section of the American Fisheries Society, were Alec Maule of NBS (chair), Don MacKinlay ofDFO (program aod proceedings) aod Ralph Larson ofSFSU (local anangements). I would like to extend a sincere 'thank you' to the many contributors who took the time to prepare a written submission for these proceedings. Your efforts are very m~ch appreciated.
Don MacKiolay
4 TABLE OF CONTENTS
Gamete Quality and Cryopresenraton
Use of flow cytometry and molecu1ar probes to assess sperm quality prior to cryopreservation. Cloud, JG and CA Kersten ...... 9 Collection, storage and cryopreservation of sperm from endangered razorback suckers. Figiel, CR. TTiersch, WWayman, OGorman,JWilliamsonandGCarmichaei " ... 13
Sex Differentiation, Sex Control and Chromosome Set Manipulation
Regulation of estrogen receptor gene activity in channel catfish: relation to timing of gonadal sex differentiation., chromosomal sex constitution and exogenous steroid treatment. Patino, R, XZhengfangand KB Davis ...... 19 Growth and body composition of sibling male and female channel catfish with the XY sex genotype. Davis, KB. BA Simco and CA Goudie ...... 21 Sex-linkage of isocitrate dehydrogenase and genetic linkage of mannose phosphate isomerase and glucosephosphate isomerase in ictalurid catfish. Liu, Q, CA Goudie, BA Simco and KB Davis ...... 25 Masculinization of nile Tilapia by short-teITIl immersion in methyldihydrotestosterone. Gale. WL, MS Fitzpatrick and CB Schreck ...... 29 Sex reversal in mud loach by -immersion. Nam, YK; JY Jo, CG Kim and DS Kim ...... 31 The influence of triploidy and heat and hydrostatic pressure shocks on the growth and reproductive development of perch reared to adult size under selected environmental conditions. Malison, JA, JA Held, MAR Garcia-Abiado and LS Procarione ...... 37 Production of all-female diploid and triploid olive flounder. Jeong, CH and DS Kim ...... 49
Reproduction and Growth
The secretion of gonadotropin and growth hOITIlone in the bagrid catfish with different reproductive stages. Lin, HR. DS Wang and HJl' Goos ...... 57
Transgenic Fish
Characterization of a transgenic tilapia line with accelerated growth. Guillen, I, el al...... 63
5 Stock and Species Identification
Use of multi-locus DNA fingerprinting for strain identification in channel catfish. Bosworth. BG and WR Wolters ...... 75 Characterization of channel catfish populations using microsatellite loci. Waldbieser. GC and BG Bosworth ...... 81 Utility of ribosomal DMA ITS2 for deriving shark species-diagnostic identification markers. Shivjl: M, C Tagliaro. L Natanson, N Kohler, so Rogers and M Stanhope ...... 87 Phylogenetic analysis ofhaplochromine cichlid taxa utilizing heteroduplex techniques Duan, W, GC Booton, L Kaufman and PA Fuerst ...... 95 Use of DNA microsatellite loci to identify populations and species of Lake Victoria haplochromine cichlids. Wu, L. GC Booton, L Kaufman. M Chandler and P Fuerst .. 105 Population and stock characterization of Lake Victoria tilapine fishes based on RAPD markers. Mwanja. W. GC Booton. L Kaufman, M Chandler and P Fuerst. . .. 115 Identification of the protein pattern in the resulting hybrid and the pure parental strain of Oreochromis species using lEF. Zaki, Ml, M El-Gharabawy and SG Ghabrial ...... 125 Gene-centromere recombination rates of a1lozyme loci in even-and odd-year pink salmon. Matsuoka. MP, AJGharrelt. RL Wilmot. PA Crandell and WW Smoker... .. 131 Using mitochondrial and nuclear DNA to separate hatchery and wild stocks of rainbow trout. Nielsen. J ...... " ... .. 139
Molecular Biology
Molecular structure of a novel type of rhodopsin gene of the common carp. Tsai. HJ, J Lim andJL Chong ...... 151 protectiOli against Renibacterium salmoninarum infection by DNA-based immunization. Gomez-Chiar,,: M, LL Brown and RP Levine ...... 155 In situ demonstration of type I-Ill intermediate filament expression in the common carp. Groff, JM, DK Naydan. JG Zinki and 81 Osburn ...... 159 Major histocompatibility complex class I genes in rainbow trout. Dixon, B, KE Magar, BP Shum and P Parham ...... 165
6 Gamete Quality and Cryopreservaton
7 8 USE OF FLOW CYTOMETRY AND MOLECULAR PROBES TO ASSESS SPERM
QUALITY PRIOR TO CRYOPRESERVATION
J.G. Cloud Department of Biological Sciences University ofIdaho, Moscow, ID 83844-5031 USA 208·885.{i388!208·885-7905! [email protected]
C.A.K=ten Department of Biological Sciences Uuiversity ofIdaho, Moscow, ID 83844-5031 USA
Introduction
Many fish populations around the world are decreasing in size. At least some of these population declines are due to environmental changes that include the desbuction or degradation of spawning and rearing habitat, degradation in water quality. introduction of new (or non-native) species, introduction of disease organisms, interruption of migratory pathways and over-harvesting. Since many of these changes have been the direct result of human activities, improvements can be implemented but may require extended periods of time. One means to insure that a representation of the original genetic make-up of the population exists at the time of environmental restoration is to establish a germ plasm repository while the population is healthy. The cryopreservation of spermatozoa is the simplest and most economical mechanism by which to meet this endpoint
Semen evaluation is an important component of a sperm cryopreservation program in order to (I) cull poor quality semen samples prior to freezing and (2) to estimate the fertility of the stored sperm post-thaw. The rationale for culling poor quaUty semen is that the cryopreservation process is costly in tenns of personnel time and materials, that space in liquid nitrogen storage tanks is finite and that the eggs to be fertilized by the Cl)'opreserved sperm may be quite valuable (however. there may be times that the value of the genetics represented by the sperm will override these practical considerations).
The plasma membrane of spermatozoa is an imporlBnt component in the maintenance of sperm viability and the initial site of interaction with the egg at fertilization. Therefore an analysis of the integrity of the plasma membrane is one method to assess the damage or the health of sperm. The flow cytometer, an instrument that measures the intensity of fluorescent stains associated with individual cells, has been utilized to evaluate membrane parameters that relate to mammalian sperm quality andlor function. The advantage of this instrumentation over the use of a microscope is that the desiJed infotmation can be obtained for thousands of cells injust a few minutes. For example, Gamer et al. (1986) and Ericsson et al. (1993) have provided evidence that spermatozoan viability can be assessed using dual fluorescent staining and flow cytometric analysis for a wide variety of mammals. Recently, Gamer and Johnson (1995) demonstrated that SYBR-14 (a newly developed nucleic acid stain, Molecular Probes, Eugene, OR) in combination with propridium iodide can be used to quantify the live/dead ratio of mammalian sperm. These investigators clearly demonstrated that the ratio of sperm binding SYBR-14 or PI was highly correlated to the live/dead ratio, to the proportion of sperm that were motile and the fertility of the
9 sperm. Rhodamine 123 (RI23) is another molecular probe; this compound accumulates in mitochondriare\ative to their membrane potential (Chen et aI., 1981). Graham et aL (1990) used this probe to monitor mitochondrial function in mammalian sperm; these investigators demonstrated that the addition of mitochondrial inhibitors to bovine spermatozoa decreased the fluorescenee intensity ofRI23 and concluded that R 123 was able to detect mitochondrial damage in mammalian sperm.
The ovenill objective of these studies was to detennine ifflow cytometry can be used to obtain a valid estimate of the live/dead ratio of salmonid sperm and to est:imBte the usefulness of this informatioo in predieting spenn fertility.
Materials and Methods
Rainbow trout (Oncorhynchus mylciss) gametes were obtained from Mt Lassen Trout Farm, Inc. (Red Bluff, CAl and stored at 40 C under 100% oxygen prior to use. The sperm arrived approximately 24 h after donor fish were stripped. Semen was also obtained from steelhead trout (anadromous rainbow trout) at Dworshak National Fish Hatchet)', Ahsahka, !D, and transported directly back to the laboratory (ninety minutes of travel time). For the various assay incubations, the semen was diluted 1: 100 with modified Cortland's solution (a non-activating solution) or with 120 mM NaCI (a sperm activedng solution). SYBR-14 and propidinm iodide (LIVEIDEAD Sperm Viability Ki~ Molecular Probes, Eugene, OR) and rhodamine 123 (Sigma Chemical Co., Sl Louis, MO) were incubated with the sperm at 40 C in the dark for 15 minutes. A Becton-Dickinson FACSCab"bur flow cytometer was used to quantify the level of fluorescence in the sperm cells; fluorescence detectors Fl.I (515-545 nm) and FL2 (564-606 urn) were utilized in an analyses.
Results
Dot-plot scatter diagrams (10,000 sperm) were produced for each of six males. Control samples consisting of sperm samples in which neither SYBR-14 or PI was added were used to adjust the range of fluoresce to be examined. The population of sperm identified as live by their uptake of SYBR-14 were clearly separate from the population that bind to PI. A representative dot-plot for fresh sperm incubated with SYBR-14 followed by PI is shown in Figure 1. For this male, the proportion of sperm identified as alive was 98.26%; altematively. in a sperm sample from the same male that was heated for 5 minutes at 50°C. the proportion ofspenn that were identified as being alive was 0.52% (Figure 2). Using varying ratios offr1:sh and heat-killed sperm, the live/deed ratio was correctly quantified using this combination of SYBR-14 and PI in conjunction with flow eytometry (dats not shown).
Because prematurely activated salmonid sperm is not nonnaUy fertile. the degree of fluorescence of activated and inactivated sperm following incubation with SYBR-13 and PI was compared (N = 6). Activated spenn were identified as live by SYBR-14; there was no signifieanee difference in the proportion of live/dead sperm in activated and non-activated sperm.
Since R123 is only taken up by mitochondria with a membrane potential and since activated spenn go through a period of active motility aDd are subsequently quiescent, it was anticipated that R123 would bind to mitochondria of inactivated sperm but would not bind to activated sperm. From a COmparisoD of the fluorescence of inactivated and activated spenn following incubation with RI23 (O.I~glm1~ no difference between treatment groups was detected (N = 6).
10 ~o~ ______-=M~T~~9~6~S~Y~BRW~~IL~IV~E~M=3="O~T~5 ______-,
"," ", . " .. ~'. .• :.~-;!'.~.. ,,:. .;,' , "
Figure 1. A dot-plot of fresh sperm incubated with SYBR-14 and PI. The gated region identifies the live cells (98,26%) that are stained with SYBR-14,
~O,-______~~~T~~~96~S~Y~B~W~P~I~D~~~M~T~"O~T~6 ______~~ ,'.
Figure 2. A dot-plot of heat-killed sperm incubated with SYBR-14 and PI. The area outside the gated region identifies dead cells (99.48%) that are SlBined with Pl.
Discussion
SYBR-14 and PI can be used to determine the live/dead ratio of trout sperm, This information is important to gain an initial estimate of the quality of the sperm. Using the live/dead stain, the ratio of live to dead tainbow trout sperm as measured by flow cytometry was not significantly different between inactivated and activated spenn. Therefore, although the activated sperm are Dot capable offertilizing eggs, a live/dead ratio is not an adequate indicator offertility. Alternatively, this test will identify semen samples that contains a high proportion of dead sperm. R123, an indicator of mitochondrial integrity. binds to trout sperm. This probe likewise binds equally to inactivated and activated sperm. This result supports the conclusion that the mitochondria of activated sperm are functional.
11 REFERENCES
Chen, LB, Summerbayes,lC,lobnson, LV, Walsh, ML, Bernal, SD, Lampidis, Tl1981 Probing mitochondria in living cells with Rhodamine 123. COld Spring Harbor Symp. Quart. BioI. 46:141-155.
Ericsson. SA, Gardoer, DL, Thomas, CA, Downing, TW, MmhaU, CE 1993lnterrelationships among fluorometric analyses of spermatozoal function, classical semen quality parameters and the fertility of frozen-thawed bovine spermatozoa. Theriogenology 39: 1009-1024.
Gamer. DL, Pinkel. D. Johnson, LA, Pace, MM 1986 Assessment of spennatozoal function using dual fluorescent staining and flow cytometric analyses. BioI. Reprod. 34: 121-138.
Gamer, DL,lohnson, LA 1995 Vinbility assessment of maunnalian sperm using SYBR-14 and propidium iodide. BioI. Reprod. 53:276-284.
Graham.lK. Kunze, E, Hammemedt, RH 1990 Analysis of sperm viability, acrosomaJ integrity and mitochondrial function using flow cytometry. BioI Reprod 43: 55-64.
12 COLLEcrION, STORAGE AND CRYOPRESERVATION OF SPERM FROM
ENDANGERED RAZORBACK SUCKERS
C. R. Figiel, Jr. School of Forestry, Wildlife, and Fisheries, Louisiana Agricultural Experiment Station, Louisiana State University Agricultural Center, Baton Rouge, Louisiana 70803. (504) 765-2848 (phone); (504) 765-2877 (!ax)
T. R. TIersch*. W. R. Waymau*, O. T. Gormoot• .Y. H. Williamsont. and G. J. Carmichael§. "School of Forestry. WLidlife, and Fisheries, Louisiana Agricultural Experiment Station, Louisiana State University Agricultural Center, Baton Rouge, Louisiana 70803. tU.S. Fish and WLidlife Service, Arizona Fishery Resources Office, P,O. Box 338, Flagstaff, AZ 86002. tUS. Fish and WLidlife Service. Southwestern Fisheries Technology Center, Dexter Unit, P.O. Box 219, Dexter, NM 88230 §U.S. Fish and Wtldlife Service, Southwestern Fisheries Technology Center, Mora Unit, P.O. Box 689, Mora NM 87732
Introduction The razorback sucker Xyrauchen texanus offers a novel opportunity for the application oflaboratory and hatchery-based techniques for fish reproductive physiology in field conditions. An endemic fish of the Colorado River system, the razorback sucker is nearing extinction because of limited juvenile recruitment into the population. Recommendations identified by a multi~agency recovery effort include stocking up to 100,000 fish to replace the aging population. To assist in this effort, we developed methods for the collection, short~tenn storage, and cryopreservation of sperm. Additionally, we developed techniques using food storage bags for the storage, fertilization and incubation of eggs.
Storage and cryopreservation of gametes is an effective management tool for conserving genetic resources of threatened and endangered fishes in that it provides genes from wild popUlations for hatchery broodstock, permits greater control in breeding programs, and provides the capability to keep large number of valuable genes for extended periods. Gamete storage is an effective way of solving hatchery-related problems ofnon~coincident maturation of broodstock by allowing flexibility in spawning time. The objectives of this study were to: 1) develop methods for collection of sperm allowing integration with established sampling programs; 2) characterize spenn motility and duration; 3) develop methods for refrigerated storage of spenn; 4) develop methods for the cryopreservation ofspenn; 5) fertilize eggs using cryopreserved spenn, and 6) investigate methods for incubation of eggs. Our purpose was to improve and integrate gamete collection, storage, and cryopreservation for enhancement of recovery efforts for endangered razorback suckers.
Collection of Gametes We collected fish from a l7.6-1an section of the Colorado ru- between Willow Beach National Fish Hatchery (WBNFH) and Hoover Dam on upper Lake Mohave during the 1994-1996 spawning seasons. We integrated our procedures with standard sampling protocols established by the USFWS: fish were weighed, measured (TL), tagged with a passive integrated transponders and general condition of fish was recorded. Sperm were collected inunediately after USFWS procedures were complete or fish were kept in live-wells and hatchery tanks until collection. Males were held head down with ventral surface up, and were wiped to remove excess water and debris. To collect spenn,
13 the head was raised, and the anal fin was held against the caudal peduncle, exposing the vent. To initiate semen flow, we rotated the ventral surface of the fish downward, and applied gentle pressure behind the pectoral fins. Unless kept undiluted for use in other studies, spenn were diluted with calcium-free Hanks' balanced salt solution (C-F HBSS) (Tiersch et at 1994) and stored. on ice for transport to WBNFH. In the laboratory, we stored refiigerated (4°C) sperm sBmples in loosely capped tubes. Sperm coUection was completed within 1 min. did not require additional personne~ and did not interrupt the established sampling protocols. The application of pressure for semen collection was limited to the area behind the pectoral fins. which minimized handling offish and the contamination of semen with feces and urine often associated with application of pressure posteriorly along the beUy toward the vent.
Characterization or Sperm Motility and Duration For estimation of motility, 2 III of sperm were placed on a microscope slide and diluted. with 20 III ofwater collected from Lake Mohave (21 mOsmollkg). The percentage of sperm swimming actively in a forward direction was estimated using dark-field microscopy at 200X magnification. The duration of motility was divided into 3 periods: (1) time required to reach maximum motility after addition ofwater, (2) duration of maximwn motility, and (3) time until complete cessation of motility.
Spenn became motile and initiated rapid swimming when diluted in water. The time required to reach maximwn motility was 3 s after the addition of water (the minimum time at which accurate estimates of motility could be made was 2 s). Maximwn motility was maintained for 16 ± 8 S, and the time until complete cessation of motility was 70 ± 32 s after the addition of water.
Storage or Sperm We perfonned two experiments on the motility retention of razorback sucker sperm during storage at 4°C. In the first. we compared motility retention of undiluted sperm and spenn diluted with an equal volume ofC-F HBSS. In the second, we compared motility retention of spenn stored in three dilutions of C-F HBSS: 1 part semen to I, 3. or 7 parts C-F HBSS. Spenn were collected as descnoed above, diluted 1:1 in the field, delivered within 1.5 h, and aliquots were diluted beyond 1: 1 at WBNFH. We chose six high quality samples and placed these in loosely-capped 15-m1 tubes and stored them upright at 4°C. We estimated motility immediately after final dilution, and dBily for 3 d until samples were shipped by commercial airline to Louisiana State University, where daily estimates were continued until aU samples became non-motile.
In experiment one, there was a Significant difference in spenn motility within 24 h between spenn diluted (1:1) with C-F HBSS and undiluted spenn (t-test; t - -6.45, P < 0.0001). All undiluted sperm samples became non-motile within 72 h. About half (45%) of the diluted spenn samples retained at least 60% motility for 5 d. In experiment two, dilution of spenn with different proportions of C-F HBSS did not affect sperm motility on day 3 (ANOVA F7.,14 = 1.974, P = 0.1815). or day 8 of the experiment (ANOYA F". - 0.540, P - 0.5958). Overall, mean sperm motility was highest on day 1 (73.0 ± 10.0%) and decreased through time to day 8 (2.1 ± 5.6%). Spenn samples retained on average greater than 15% motility for 6 d, however, nine of the fifteen samples appeared degraded and were non-motile after 3 d.
Cryopreservation of Sperm We examined the effects of six cryoprotectants on spenn motility: dimethyl sulfoxide (DMSO), dimethyl acetamide (DMA). glycerol. methanol (MeOH), propylene glycol, and ethylene glycol. Briefly, cryoprotectants minimize dBmage to spenn cells during the freezing and thawing process (Jamieson 1991), however cryoprotectants can have toxic effects on spenn as weU. In experiment one, we examined the effects of5 aod 10'10 DMSO, 5 and 10'10 MeDII, 5 aod 10% DMA, and 5 and 10010 glycerol on post-thaw spenn motility of four males. Cryoprotectants were dissolved to the appropriate concentration and added to spenn samples. We allowed samples to equilibrate for approximately 90 min at room temperature before placing straws (0.5-m1) into goblets and then into
14 portable shipping dewars for freezing. In experiment two, we examined the effects of 5 and 10% DMSO. 10 and 20% MeOR, 5 and 10% ethylene glyco~ and 5 and 10% propylene glycol on post thaw sperm motility of five males. We followed the same procedures as above except that sperm samples were allowed to equiliblll.te for 8 min and straws (O.S-rnl) were placed directly into dewars. In both experiments, sperm samples had 80-95% initially motility and were frozen for 24 h.
In experiment one, cryoprotectant (and concentration) influenced post-thaw motility (Table 1). Motility ofspenn cryopreserved Vlith 10% MeOH was significantly higher compared to motility of sperm cryopreserved Vlith 5% MeOH, or either concentration of DMSO, DMA, or glycerol. Similarly, in experiment two, motility ofspenn cryopreserved Vlith 10% MeOH was significantly higher (x = 24 ± 2%) compared to motility of sperm cryopreserved Vlith 2OUio MeOH, or either concentration ofDMSO, propylene glycol, or ethylene glycol (Table I).
Source of variation df ss F p
Experiment 1 Cryoprotectant 7 0.5077625 22.658 < 0.0001 Error 52 0.1664751 Total 59
Experiment 2 Cryoprotectant 7 1.8680136 43.376 < 0.0001 Error 71 0.4368124 Total 78
Table 1. Univariate analysis ofvariance for the effects of cryoprotectants on the percent of post-thaw sperm motility. Data were arcsine square-root transformed before analysis.
Fertilization orEggs Using Cryopreserved Sperm We cryopreserved sperm from 3 male razorback suckers using 10% MeOH (pre-freeze motility = 50% for each male). We froze sperm samples by aspirating into straws (O.S-ml) and placing these directly into portable shipping dewars. Two sperm samples from each male were thawed after 24 h and motility estimated. These sperm samples were mixed immediately Vlith 500 to 600 eggs from each of two females so that there were a total of six' fertilization attempts (a O.S-rnl sperm sample from each male fertilizing eggs from each female). Additionally, we fertilized eggs from both females using refrigerated sperm from two males (90 and 95% motility) to serve as controls. After 96 h. we obtained the percent of developing eggs.
The percent of eggs fertilized Vlith refrigerated sperm were 50.3% and 32.7% respectively for females one and two. Using cryopreserved speno, 35.3% of eggs from female one and 18.2% of eggs from female two were fertilized. Mean percent motility of thawed sperm samples were 18.3% (n = 6).
Incubation or Eggs We used polyethylene storage bags for the fertilization of eggs and the incubation and hatching of embryos. We collected eggs and placed 200 to 2000 eggs Vlithin bags. Eggs were fertilized by adding either refrigerated or cryopreserved sperm and 50 rnl of Colorado River water. After 30 s, water volume was increased to 250 rnl for water-hardening of the eggs. Bottled oxygen was used to supplement air in bags. Water (23 C) in bags was exchanged twice daily to maintain water quality, , and fungus control was kept by manual removal of hyphae-infected eggs.
15 Use of these bags enabled us to keep group of eggs separated and allowed us to replicate large number oftrials. This is especially important when examining mUltiple crosses in large experiments. Additionally, these bags provided ease in transportation of embryos and hatchling, and the bag transparency permitted observations on embryo development and treatment effects.
Discussion and Conclusions We were able to combine research on the collection, storage, and cryopreservation of spenn with an already established sampling program for razorback suckers. Our studies demonstrate that collection ofsperrn can be rapid and does not disrupt normal sampling procedures. Collection of sperm could be performed in the sampling boat during routine data collection and tagging, and was quickly mastered by sampling crews. Sperm of razorback suckers became active when diluted in river water and swam vigorously for 20 s, losing all motility at about 70 s after dilution. Given this relatively short time of maximal activity care should be taken to ensure good, early mixing of gametes during artificial spawning of razorback suckers.
Refrigerated storage of sperm is an effective method for management of razorback sucker broodstock in that it allows flexibility in spawning females. Calcium-free Hanks' balanced salt solution allowed refrigerated storage of razorback sucker sperm for at least 7 d. Bacterial contamination may have caused degradation of sperm samples after that time. Potentially, sperm survival could be prolonged by adding antibiotics to inhibit bacterial groVJth (Stoss et a1. 1978; Stoss and Refstie 1983). Methanol appears to be the most effective cryoprotectant for razorback sucker sperm. Sperm mixed with 10% methanol had higher post-thaw motility compared to sperm mixed with other cryoprotectants. Although sperm motility was reduced because of the freezing-thawing process, we were able to use spenn cryopreserved with 10% methanol to fertilize eggs.
Because of the lack of successful natural recruitment in razorback suckers, emphasis on reproductive physiology and arti.6cial propagation is an essential component for the conservation and management of these fish. Cryopreservation methods that augment the transfer of gametes from wild populations to hatchery broodstock should aid in this recovery program and provide for the long-term conservation of gene lie material of razorback suckers.
Literature Cited Stoss, J 1983 Fish gamete preservation and spermatozoan physiology. Pages 305-350 in WS Hoar, OJ Randall, and EM Donaldson, editors. Fish Physiology, Volume 9, pan B. Academic Press, San Diego, California. Stoss, J and T Refstie 1983 Short-term storage and cryopreservation of milt from Atlantic salmon and sea trout. Aquaculture 30:229-236. Tiersch, TR, CA Goudie, and GJ Cannichael 1994 Cryopreservation of channel catfish sperm: storage in cryoprotectants, fertilization trials, and growth of channel q1tfish produced with cryopreserved sperm. Transactions of the American Fisheries Society 123:580-586.
16 Sex Differentiation, Sex Control and
Chromosome Set Manipulation
17 18 REGULATION OF ESTROGEN RECEPTOR GENE ACITVITY IN
CHANNEL CATFISH: RELATION TO TIMING OF GONADAL SEX
DIFFERENTIATION, CHROMOSOMAL SEX CONS1TTIJTION,
AND EXOGENOUS STEROID TREATMENT
Reynaldo Patillo Texas Cooperative Fish & Wtldlife Research Unit, Texas Tech University Lubbock. TX 79409-2120 806-742-2852,806-742-2946 (fux), [email protected]
Xia Zhengfang Department of Biological Sciences, Texas Tech University, Lubbock. TX79409-3131
Kenneth B. Davis Division of Ecology & Organismal Biology, University of Memphis, Memphis, TN 38152
Inb'oduction
There are a considerable number of studies available in the literature that attempt to establish the mechanisms of primary (gonadal) sex detennination and differentiation in vertebrates. Much of the recent research with non-manunalian species has focused on the role of aromatase enzyme, and the available evidence points to a central role of this enzyme in reguJating the differentiation afthe primordial gonad into an ovary by inducing the production of estrogens (estradiol-17J3). However, whether this role is direct or indirect bas not been clarified. Estrogens could bind to estrogen receptors and modify the activity of estrogen-responsive genes that regulate the onset of ovarian differentiation. Conversely, it is also possible that the role of aromatase is merely to remove androgens (aromatase substrate) by converting them into estrogens. In this second scenario, the absence of androgens would result in the passive (defiwlt) formation ofan ovary. To clarify the role of aromatase it will be necessary to examine the presence and interaction of the estrogen receptor (ER) Vlith estrogens at the critical period of gonadal sex differentiation. Developmental studies ofER gene expression in relation to the timing of sex differentiation have not been performed Vlith fishes, and few are available for other non-mammalian species. In this ongoing study, we have characterized reverse transcriptase-po!ymerase chain reaction (RT -PCR) derived ER cDNAs of channel catfish and qualitatively examined the presence ofER mRNA around the critical time of gonadal sex. differentiation. We also determined the presence of aromatase mRNA We examined catfish from an untreated mixed-sex. population (XX females and XY males), a male monosex population (YY males), and a sex-reversed female monosex population (YY females).
Results and Discussion
Using mixed primers designed according to regions of high homology among ER cDNAs from various vertebrates and cDNA template from liver and ovary, RT-PCR yielded one major
19 fragment on agarose gels within the expected size range. 'This fragment was cloned and sequenced and determined to correspond ER eDNA on the basis of sequence homology analysis afthe deduced ligand-binding damain (UlD). The eDNA encoding for the LBD was cleaved with restriction enzymes and used as probe forNorthem blots of hepatic RNA and polyARNA extracts. The results of the Northern blots showed the presence of a major ER mRNA at about 7.8 kb and a relatively minor band at about 3.2 kb.
An oligomlcleotide internal to the PCR primers was synthesized and used for Southern blots of RT -PCR products amplified from liver and ovary eDNA of adult fish and from whole body eDNA of90-day-old fish.. The results showed the presence of a major band corresponding to the fragment identified by agarose gels, and a minor band of lower molecular weight. The smaller fragment was also cloned and sequenced 'This fragment corresponded to a truncated form orER eDNA missing 131 nucleotides within the LBD. The deletion caused a downstream reading frame shift. Therefore, this shorter eDNA fragment may not encode a functional form ofER and may correspond to the minor mRNA species identified by Northern blotting.
Gonadal sex differentiation in channel catfish is evident at 19 days postfertilization with the ooset of ovarian formation in genotypic females and in sex-reversed females (patiiio et al., in press). Thus, in this study we performed ER and aromatase RT-PCR on eDNA template of individual fish from 16 days to 90 days postfertilization followed by Southern blotting. The results suggested that, at the whole body level, ER and aromatase mRNA are present in all individuals regardless of age, sex genotype, or sex phenotype. The finding of aromatase mRNA in presumptive males at the time of gonadal sex differentiation (days 16-19) was unexpected, since the presence of estrogens at this time results in the sex reversal of genotypic males into females. However, these data are only qualitative, and it is possible that quantitative differences do exist among the experimental populations used in this study. It is also possible that qualitative or quantitative differences would be found ifthe analysis is restricted to the gonads rather than the whole body. Finally, translational control of aromatase gene expression is also a possibility. These various possibilities will be examined in ongoing research.
References
Patiiia, R, KB. Davis, I.E. Schaare, C. Uguz, C.A Strilssmann, N.C. Parker, BA Simco, and C.A Goudie. In press. Sex differentiation of channel catfish gonads: normal development and effects of temperature. Jownal of Experimental Zoology.
20 GROWTH AND BODY COMPOSmON OF SmLlNG MALE AND FEMALE
CHANNEL CATFISH WIlli XY SEX GENOTYPE'
K B Davis, Ecologica1 Research Center Division of Ecology and Organismal Biology Department of Biology, The University of Memphis, Memphls, 1N 38152 (901) 678·2594, (901) 327-8001, [email protected]
B A Simco, Ecological Research Center Division of Ecology and Organismal Biology Department of Biology, The University of Memphis, Memphis. 1N 38152 (901) 678·2594, (901) 327-8001, [email protected]
C A Goudie, Catfish Genetics Research Unit US Department of Agriculture, Agricultural Research SelVice PO Box 38, Stoneville, MS 38776 (601) 686·5460, (601) 686-3004, [email protected]
Abstract
MaJe channel catfish grow larger than females in mixed sex culture and size differences due to sex vary with family and age. The relative roles of sex genotype and sex phenotype in regulating sexually-dimorphic growth have not been completely addressed in this species. Sibling male and female channel catfish with XY sex genotype (males were produced by mating YY males with XX females and femaJe siblings were produced by hormonaJ sex reversaJ) were used to evaluate genetic and physiological influences on growth and body composition. In separate experiments, maJes were grown in separate ponds from their sibling femaJes (six families) or maJes and sibling femaJes were grown together in ponds (nine families). NormaJ XY males and XX females were grown together in ponds (three families) as controls. All fish were stocked as large fingerlings (300 fishlO.04 ha) and were maintained until they reached marketable size. Average weight of males was higher than that of females in 16 of the 18 families evaluated, although statistical differences between sexes e,usted only in two ofthree control families, one of six XY genotype families with sexes maintained separately and four of nine XY genotype families with sexes maintained together. Dress-out percentage offemales was equal to or significantly greater than that ofmaJes in 16 of 18 families, and liposomatic index was significantly higher in females in 10 of 18 families. Although an overall weight advantage ofmaJes was evident, differential growth ofmaJes and femaJes was diminished when sexes with the same gemotype were maintained communally, and additional reductions were realized when sexes were maintained separately. Both sex genotype and sex phenotype influenced growth and body composition of channel catfish in this study.
'Supported by funds from USDA (91-37206-6741)
21 Introduction
Male channel catfish grow larger than females in mixed sex culture (Beaver et al., 1966; Simco et al., 1989). Size differences due to sex increase with age and vary among families (Simco et al.,1989). The influence of sex on size is apparent in some families when fingerlings are as small as 3 g (Goudie et aJ., 1993).
Channel catfish females have an XX sex genotype and males have an XY sex genotype (Davis et al., 1990); thus, normal matings produce a sex ratio of 1: I maJe:femaJe progeny. However, all female populations can be produced by dietary administration of exogenous hormones during early development (Goudie et al., 1983), and feminization results from a variety of estrogens and androgens (Davis et aJ., 1990). Male channel catfish with YY sex genotype have been identified by evaluation of progeny sex ratios from a series of hormonal treatments and genetic matings (Davis et aJ., 1995). When YY males are mated with XX females, all maJe offspring with XY sex genotype are produced. Female siblings with an XY genotype can be produced by hormonal sex reversal of some of the progeny.
The relative roles of sex genotype and sex phenotype in regulating sexually-dimorphic growth have not been completely addressed in this important aquaculture species. Growth of hormonaJly sex-reversed females (Simco et al., 1989) and hand-separated male and femaJe monosex populations (Goudie et al., 1994) have been studied. However, fumaJe (XX) and maJe (XV) sex: genotypes were equally represented in sex-reversed female populations, and hand-selected populations represented fish with norma] sex genotype and sex phenotype. In the present study, sibling male and female channel catfish, both with XV sex genotype, were used to evaluate genetic and physiological influences on growth and body composition.
Materials and Methods
All male XV populations were produced by mating previously identified YY males with normal XX females. A portion of each spawn was feminized with 17a-ethynyltestosterone (100 mglkg diet; Davis et al., 1990) during the first 21 days of feeding. Fish were maintained separately by family and hormone treatment and grown to fingerling size. Fish were then stocked into ponds (300 fish/O.04 hectare) and reared until they were marketable size at 15 to 16 months of age. Three experimental designs were used: (I) three families with normal sex genotypes and phenotypes were separated by family and both sexes of a family were grown together in a pond; (2) six families of sibling males and females with XV genotypes were reared separately by family and sex; and (3) rune families of sibling males and females with XY genotypes were reared together separated by family.
At harvest, SO fish from each pond were weighed, measured for standard length, and condition factor (K) calculated. Twenty fish were used to assess body composition. Mesenteric fat was dissected and weighed, and iiposomatic index (LSI) was calculated as mesenteric fat weightlbody weight x 100. Carcasses with head and viscera removed were weighed, and dress-out percentage was calculated as carcass weightlbody weight x 100. Analysis of variance was used to resolve sigruficant differences between sexes within families for each of the three experimental designs.
Results and Discussion
Survival was good in all treatments and was similar between the sex genotypes and phenotypes. The average weight of males was higher than that offemales in 16 of the 18 families evaluated, although statistical differences between sexes existed only in two of three control families, one of six XV genotype families with sexes maintained separately, and four ofnine XV genotype families with sexes maintained together. Length and condition factor differences between sexes followed 22 with sexes maintained together. Length and condition factor differences between sexes followed a similar pattern. Liposomatic index was statistically higher in females in 10 of 18 families, while the LSI of males exceeded that offemales in only One family. Dress-out percentage offemales was significantly higher than males in seven of 18 families and equal to that of males in nine additional families. Male dress-out percentage exceeded that of sibling females in only one family.
In an earlier study, we found that growth characteristics of sex-manipulated channel catfish were typicaJ of the phenotypic sex. rather than the genotypic sex (Simco et al., 1989). In a subsequent study, hand-sexed XX monosex females in a single pond had harvest weights similar to those of maJes cultured in ponds with mixed sexed or monosex male populations (Goudie et aJ., 1994), while two other ponds offemaJes, which contained 1 and 2% males, exhibited the typically observed lower growth offemales. Use of sibling males and females with a common XY sex genotype in the present study appeared to diminish the growth differences usually observed between the sexes, as statistical differences were apparent in only seven of 18 families evaluated. Additionally, similar weights of males and females in five of six families when the sexes were maintained separately suggest that behavioral or physiological (perhaps pheromonal) influences might inhibit the full growth potential offemales in mixed sex culture.
Both sex genotype and sex phenotype influenced gender bias in growth of channel catfish in this study. Removing the influence of sex genotype decreases, but does not eliminate, the difference in size between the sexes. Even though female fish appear to have higher dress-out percentage and mesenteric body fat than males; the quantitative male growth advantage must be considered in selecting strains offish for development of monos ex populations. Factors which limit growth of females in mixed sex culture warrant further investigation.
References
Beaver, JA, KE Sneed, and HK Dupree 1966 The difference in growth of male and female channel catfish in hatchery ponds. Progressive Fish-Culturist 28:47-50.
Davis, KB, BA Simco, CA Goudie, NC Parker, W Cauldwell, and R Snellgrove 1990 Hormonal sex manipulation and evidence for female homogamety in channel catfish. General and Comparative Endocrinology 78:218-223.
Davis, KB, BA Simco, and CA Goudie 1995 Genetic and hormonal control of sex determination in channel catfish. In: Proceedings of the Fourth International Symposium on Reproductive Physiology ofFish. F. Goetz and P. Thomas (Bis.) Fishsymp 95, The University of Texas at Austin, p 244-246.
Goudie, CA. BD Redner, BA Simco, and KB Davis 1983 Feminization of channel catfish by oral administration of steroid sex hormones. Transactions of the American Fisheries Society 112:670-672.
Goudie, CA, BA Simco, KB Davis, and GJ Cannichael 1993 Size grading may aJter sex ratios of fingerling channel catfish. The Progressive Fish-Culturist 55:9-15.
Goudie, CA. BA Simco, KB Davis, and GJ CarmiChael 1994 Growth of channel catfish in mixed sex and monosex pond culture. Aquaculture 128:97-104.
Simco, BA, CA Goudie, GT K1ar, NC Parker, and KB Davis 1989 Influence of sex on growth of channel catfish. Transactions of the American Fisheries Society 118:427-434.
23 2.4 SEX-LINKAGE OF ISOCITRATE DEHYDROGENASE AND GENETIC LINKAGE
OF MANNOSE PHOSPHATE ISOMERASE AND GLUCOSEPHOSPHATE
ISOMERASE IN ICfALURID CATFISH
Q Lin, Ecological Research Center Division of Ecology and Orgarusmal Biology Department of Biology, The University of Memphis, Memphis. TN 38152 (901) 678-2594, (901) 327-8001
C A Goudie, Catfish Genetics Research Unit US Department of Agriculture, Agricultural Research Service PO Box 38, Stoneville, MS 38776 (601) 686-5460, (601) 686-3004, [email protected]
B A Simco, Ecological Research Center Division of Ecology and Orgarusmal Biology Department of Biology, The University ofMemprus, Memphis, TN 38152 (901) 678-2594, (901) 327-8001, [email protected]
K B Davis, Ecological Research Center Division of Ecology and Organismal Biology Department ofBioiogy, The University of Memphis, Memphis, TN 38152 (901) 678-2594, (901) 327-8001, [email protected]
Abstract
Sex-linkage of isocitrate dehydrogenase (IDH-m) and genetic linkage of mannose phosphate isomerase (MPl) and glucosephosphate isomerase-A (GPI-A) were observed in two experimental matings between channel catfish Ictalurus punctatus females and hybrid males (charutel catfish female x blue catfish L jurcatus male) with recombination rates of 13.0% and 5.9%" respectively. EvolUtionary relationships of these gene arrangements were compared among teleost species.
Introduction
The construction of linkage maps has proven to be a powerful tool in genetic studies of animal genomes (M"orizot. 1993). The availability of detailed linkage maps allows identification and location of genes controlling simple and complex traits, and the provides information on the origin and evolution of gene arrangements in a variety of taxa Gene mapping studies have been conducted for a large number ofisozyme loci in salmonid and poeciliid fishes. Comparison of linkage maps revealed numerous cases of probable homologous gene arrangements among these fishes, and several examples of conservation of fish and manunalian linkage arrangements (M"orizot et al., 1991). By contrast, construction of gene maps in icatalurids is in its infancy: linkage of glutathione reductase and phosphoglucomutase (Morizot et al., 1994) and sex-linkage of glucosephosphate isomerase-B (Liu et al., 1996) are the only groups that have been assigned in charutel catfish.
25 The information presented here represents a partial contribution toward assembly of gene maps and sex-linkage in icta1urid catfish. Study of genetic mapping and linkage arrangements provides evidence for testing theoretical models for the conservation of gene arrangement, and has possible implications for improving production in this important aquaculture group.
Materials and Methods
Spenn was obtained from hybrids of channel catfish females and blue catfish L jurcatus males, and was used in two eJq)erimmtai matings to fertilize eggs of channel catfish. Offspring from each cross were maintained in separate aquaria. At 10 month of age, sex was determined by gross examination of gonads, and muscle and liver were dissected for protein electrophoretic analyses. Tissue preparation and horizontal starch gel electrophoresis followed those previously described by Liu et al. (1996).
Genetic distances between loci were reflected in the proportion of recombinant offspring. Theoretically, linked loci would result in greater than 50% parental phenotypes due to the absence of independent assortment. Ioint segregation was examined by the log-likelihood ratio G-test. Enzyme nomenclature ofGPI and IDH were assigned according to Champion and Whitt (1976) and Shaklee et al. (1990), respectively.
Results and Discussion
Analysis of joint segregation of IDH-m and SDG in two experimental matings are presented in Table 1. The progeny consisted of45.6% heterozygous males. 4i.4% homozygous females and 13.0% recombinants. Disproportionate ratios of parental (87.0%) and recombinant (13.0%)
Table 1. Recombination rates (y) and tests for joint segregation of IDH and sex in two matings of channel catfish female x hybrid male (channel catfish x blue catfish).
Parental Prosenx Geno!X:Ee Famil1: Sex Genotype 1001100 100150 1: (%) G' Male 100150 3 21 HBCH95B 13.8 28.41 Female 1001100 29 5
Male 100150 5 56 HBCH95D 11.8 32.38 Female 1001100 41 8
Male 100150 8 77 Overall \3.0 54.67 Female 1001100 70 14
• The value of log-likelihood ratio test to demonstrate joint segregation of parental and recombinant 2 progeny genotypes (Sokal and RoW£: 1981); significant ifG > X {D.O,;d.!...Jl = 7.81.
26 phenotypes indicated that the allele IDH-m·SO was linked with SDG in the heterozygous male hybrids used in this study. In previous studies of charmel catfish and blue catfish. the presence of two loci for IDH was demonstrated in a tissue-specific manner (Carmichael et aI., 1992; Liu et aI., 1992). IDH-m was strongly expressed in muscle, and exhibited a fixed difference between charutel catfish and blue catfish. Because the hybrid males were produced from matings between channel catfish females and blue catfish males, the IDH-m·SO allele originated from a blue catfish. Therefore, IDH-m·SO served as a marker of the Y-chromosome from blue catfish. and represents an initial contribution toward assembly of a sex-linkage map in blue catfish.
Cytosolic IDH and GPI were reported to be in the same syntenic linkage group in salmonid fishes (May and Jolmson, 1990) and Xiphophorus (Morizo! et aI., 1993). In. previous study, GPI-B, • muscle form of GPl, was observed to be sex-linked in channel catfish. However, the genetic relationship of IDH and GPI has not been established for either channel catfish or blue catfish. Although the comparison of linkage maps revea1s few or no instances of gene arrangement divergence in fishes (Monzot et aI., 1993), the tissue-specific expression of IDH and GPI in salmonid and poeciliid fishes indicates a possible differentiation of gene arrangement in ictalurids. Confirmation of this hypothesis awaits further investigation of sex-linkage groups in interspecific crosses ofictalurid catfishes.
Significant deviations from independent assortment expectations were observed for GPI·A and WI (Table 2). Tight linkage ofGPl-A and MPl wns confirmed with a recombination fraction of 5.9%.
Table 2 Recombination rates (y) and tests for joint segregation of GPI-A and ?vIPI in two matings of channel catfish female x hybrid (channel catfish x blue catfish) male.
Progeny Phenotypes Parental AA AN AA AN Phenotypes Family Locus Female Male BB BB' BB' BB y(%) G GP1-A AA AA' HYCH95B 46 53 2 4 0.057 24.31 MP1 BB BB'
GPI-A AA AA' 29 31 2 2 0.063 27.64 HYCH95D MPI BB BB'
OVERAlL 75 84 4 6 0.059 39.50
.. The value of log-likelihood ratio test to demonstrate joint segregation of parental and recombinant progeny genotypes (Sokal and Rohlf, 1981); significant ifG > X1IO.o';d.f."l1 = 7.81.
GPI-A was expressed in most tissues and inherited in an autosomal manner in channel catfish (Lin et aI., 1996). The linkage ofGPI and?vIPI was also demonstrated in Xiphophorus (Morizot et aI., 1993) and salmonids (May and Johnson, 1990). However, the GPI isozyme in the study of X;phophorus was muscle specific, and GPI-3 was the sex-Unked isozyme in salmonids (May et al., 27 1989). Again, the differentiation of genetic association of GPI-A and WI in catfish indicates the divergence of the original linkage group in fishes. Further study on tissue specificity and other properties of isozymes will provide valuable evidence to confinn the conservation of gene ammgements among fishes.
References
Carmichael, GJ, ME· Schmidt and DC Morizot 1992 Genetic markers in channel and blue catfish and identification with electrophoresis of low-risk tissues. Transactions of the American Fisheries Society 121:26-35.
Champion, MJ, and GS Whitt 1976 Synchronous allelic expression at the glucosephosphate isomerase A and B loci in interspecific sunfish hybrids. Biochemical Genetics 14:723-737.
Lillo Q. CA Goudie, BA Simco. KB Davis. and DC Morizot 1992 Gene-centromere mapping of six enzyme loci in gynogenetic channel catfish. Jownal of Heredity 83:245-248.
Liu, Q, CA Goudie, BA Simco, and KB Davis 1996 Sex-linkage of glucosephophate isomerse-B and mapping of the sex-determining gene in channel catfish. Cytogenetics and Cell Genetics (m press).
May, B, KR Johnson, and JE Wright, Jr 1989 Sex linkage in salmonids: evidence from a hybridized genome of brook trout and arctic charr. Biochemical Genetics 27:291-301.
May, B, and KR Johnson 1990 Composite linkage map of salmonid fishes (Salvelinus, Salmo, Oncorhynchus). In Genetic Maps of Complex Genomes Book 4 Nonhuman Vertebrates. SJ O'Brien (ed). Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y.
Morizot, DC, SA Siaugenhaupt, !CD Kallman, and A Chakravarti 1991 Genetic linkage map of fishes of the genus Xiphophorus (Teleostei: Poecillidae). Genetics 127:399-410.
Morizot, DC, J Harless, RS Nairn, KD Kallman, and RB Walter 1993 Linkage maps of non saImonid fishes. In Genetic Maps of Complex Genomes Book 6. SJ O'Brien (ed). Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y.
Morizot, DC. ME Schmidt, and GJ Carmichael 1994 Joint segregation of allozymes in catfish genetic crosses: designation of Ictalurus punctalus linkage group 1 Transactions of the American Fisheries Society 123:22-27.
Shaklee, JB, FW Allendor£: DC Morizot, and GS Whitt 1990 Genetic nomenclature for protein coding loci in fish: proposed guidelines. Transactions of the American Fisheries Society 118:218-227.
Sokal, RR, and FJ Rohlf 1981 Biometry. WH Freeman, San Francisco, California
28 MASCULINIZATION OF NILE TILAPIA BY SHORT·TERM IMMERSION IN METHYLDllfYDROTESTOSTERONE
William 1.. Gale Oregon Cooperative Fishery Research Unit, 104 Nash Hall. Oregon State University, Corvallis OR 97331-3803 Phone: 541·737·\086 (MSF) Fax: 541·737·3590 Email: [email protected]
Martin S. Fitzpatrick, and Carl B. Schreck Oregon Cooperative Fishery Research Unit
The use of all-male populations increases the efficiency of tilapia aquaculture. Dietary treatment with 17a-methyltestosterone (MT) has been shown to be an effective means of producing all-male tilapia populations; however, the treatment requires a minimum of several weeks exposure to the steroid. Development of techniques for masculinization through immersion in 17a methyldihydrotestosterone (MDHI) or more potent androgens will provide aquaculturists with a safe and cost effective alternative to treating fry with feeds that contains Mr, because immersion will require substantially shorter exposure periods and the steroid will be contained for controlled filtration or biodegradation. The objective of this study was to develop a shorHcrm immersion procedure for the masculinization of Nile tilapia (Oreoc/vomiJ niloticus).
Female tilapia were allowed to brood progeny until 10 days post-fertlization (dpO. when the fry were removed from the female and assigned to ex.periemtnal groups (n=I00/group). Each group was maintained in separate 3.8 L glass jars with 3 L offtesh water at 28 ± 2 C. Treabnent consisted of a 3 hr immersion on 10 and 13 in MT or:MOHr at 100 or 500 ~gIL. Control groups included the following: immersion in water and ethanol vehicle. immersion in water alone. and water immersion followed by feeding of Mr-treated diet (60 mglkg) from 10 to 30 dpf. At100 dpf. sex ratios were ~termined by examination of gonads.
Immersion in MDHT at 500 !1g/L resulted in 100 (Trial I) and 94 (Trial 2) percent male popuJatioos. In Trial 1. Mr and :MOHr treatments at 100 1J.g/L resulted in significant skewing of the sex distribution toward males (73 and 72 perce:nt male. respectively). However, the proportion of males in these treabnents for Trial 2 were not significantly different from. controls. Methyltestosterone at 500 Jlg/L had no masculinizing effect in either experiment 1be MT feeding treatment resulted in 92 percent males (Trial 1 only). Therefore. successful masculinization of Nile tilapia occurred through immersion treatment on 10 and 13 dpf with 'MOHr at a concentration of 500 Ilg/L. .
29 30 SEX REVERSAL IN MUD WACH, MlSGURNUS MlZOLEPIS
BY IMMERSION
Yoon Kwon Nam Department of Aquaculture,. National FistIeries University of Pusan. Pusan 608-737, South Korea, Tel: 82-51-620-6136, Fax: 82-51-627-1096
l 2 l Jae-YoonJo • Chul Geun Kim and Dong Soo Kim IDepartment of Aquaculture, National Fisheries University of Pusan, Pusan 608-737, South Korea 'Department of Biology, Hanyang University, Seoul 133-791, South Korea
Introduction
Mud loach, Misgumrls mizolepis. is an important both as a food fish and as a fish that is used in religious ceremonies by Buddhists in Korea (Kim et aI., 1994). About 4,000 tOng of loaches were produced aruluaUy both by capture and culture. Mud loach exhibits sexual dimorphism in that the female grows faster than the male. The ability to produce and culture a monose:< female popuJation wouJd improve yields.
In aquaculture, monosex female populations are traditionally produced either by hormonal treatments of sexually undifferentiated fly or by mating sex reversed males (genetic females but phenotypic maJes) with normal females in species where the female is homogametic (Johnstone et aI., 1979; Tave. i993). However, the sex determination mecharusm of this species has not been understood yet.
The use of hormone-treated feed is the preferred way to produce sex-reversed fish, but it has severa1liabilities: it carmot be used in species which do not accept artificial feed during the labile period; the timing of the treatment is critical; if fish have access to natural food, sex reversal will not be complete; if the feed is not consumed immediately, the hormone can leach from th·e feed. Immersion technology, in which sexually undifferentiated fry are raised in water containing hormones, can· circumvent some of these problems, because the hormone does not have to be conswned to enter the fish, and because the hormone is present in the water, it is present throughout the critical period when each individual undergoes sexual differentiation.
The objective of this study was to evaluate the effectiveness of various concentrations and treatment durations of both estradiol-17p. and 17a.-methyltestosterone on the production of sex reversed mud loach by immersion treatments. The effect of the immersion treatments on survival, growth, gonad histology and morphology, and pectoml fin morphology were also evaluated.
Materials and methods
Gametes were stripped from five male and eight female 3-year-old broodfish. Eggs and sperm were pooled and fertilized as described by Kim et al. (1995). Fertilized eggs were incubated at 25°C. Thirty six hours after hatching, 330 fry were randomly allocated to each of 36 groups for
31 feminizations, also allocated to 48 groups for masculinizations. Each group was stocked in an 80 em x 50 em x 40 em aquarium containing 40 I of well-aerated water. Temperature was 25°C. For feminizations, fry were raised in water containing 0, 50, 100, or 200 ug of estradiol-17PII for either I, 2, or 3 weeks. And for masculinizations, fry were also immersed iri water containing 0, 25, 50, 100, or 200 ug of l1a.-methyltestosterone for either 1, 2, or 3 weeks. There were 3 replicate aql;18ria per each treatment combination. During the immersion treatments, fry were fed Artemia nauplii and 39010 protein carp feed ad libitum.
When each immersion treatment was finished, 33 fish were randomly taken from each of the aquaria in order to determine the individual weight, total length, Standard length, and condition factor. The remaining fish in each aquarium were counted by capture to evaluate the percentage of fish surviving after treatment. After honnone treatment, the :fish from each replicate were randomly assigned to • 90-1 aquarium, and grown as descnbed by Kim et al. (1994) fur 9 months.
When fish were 2 months old. 50 fish were randomly sampled from each replicate, and their gonads were examined histologically as descnbed by Goetz et al. (1979). Gonads containing both oocytes and spermatocytes were classified as intersex.. Morphology of the pectoral fins and gonad morphol.ogy of sex reversed fish were compared to those of normal control fish at 9 months. Differences were assessed by ANOVA andlor Chi-square analysis at the level ofp < 0.05.
Results and discussion
Survival and gTuw/h Table 1. Percent survival 1, 2, mid 3 weeks after estradiol- 1713 (ES) or l7a.-metbyltestosterone (MT) treat SUfVival rates decreased as dose and ments (mean.±s.d.) of mud loach fty durationing treatment increased; in most instances they were significantly lower than Treatmenl S11lVival (%) those of the controls (p < 0.05) (Table 1). gro"P ------Survival of fish treated with the highest 1 week 2 weeks 3 weeks dose (200 ugll of estradiol-17~ or 11,, ES methyltestosterone) were significantly o".n 96.S±!'3" 87.1±l.r 82.O:t2.1" lower than those of all other groups after all 50 ugll 96.2±2.l" 75.J±3.~ 68.3±4.2Y three time periods. 100".n 92.9±2.3" 74.1J±4.S' 67.1±3.4Y z 200 ".n . n.0±3.?" 48.8±5.5~ 37.0±6.0 Mean weights, lengths, and condition fa.cto~ are presented in Table 2. The fish in MT "gil 96.1:t2.6" S8.8±3.4" 82.8;tO.9' the 200 ugll estradiol-17~ treatments o ·2S "gil 95.7±2.r 87.2;tO.9' 78.4:±1.6b revealed significantly inluoiled growth rates, b SO ".n 95.2±1.2" S23±5.6" 14.7±1.6 regardless of treatment duration. However, 100 ".n 94.8±1.4" 73.9±2.2b 67.1±1.2" b d growth offish in all 17a.-methyltestosterone 200 ".n 85.O:t2.1 67.8:t2.3~ 56.7±2.4 treated groups. were unaff'ected~ they were similar to those controls in all three Means within a column supersaipted with different letters detection points. are significandy different (p < 0.05).
Sex reversal and sex ratio
Mean sex ratios of the control groups were approximately 1: 1 for all three time periods. In general, both hormone concentration and treatment duration had a significant effect on sex: reversal. The 50 ug estradiol-17PII treatments for 1 and 2 weeks, and 25 ug 17a.-methyltestosterone did not significantly alter the sex ratios, but all other treatment combinations did. The 200 ug estradiol- 17PII for 2 and 3 weeks were the oruy treatment combinations which produced monosex female
32 Table 2. Weight (W), total length (IL), and condition factor (CF) (mean±s.d) or experimental groups after I, 2, ·and 3 'WCCks estradiol-1711 (ES) or 17a-methyltestosterone (M1) immersion ~tments
Treatment _=-":..-woc",=;k"""'=Im=,,,=',,,, __-",-=2:..-w oc",=k""",=Im=,"=',,,, ___lli.:3-..:W:.:"'=k::...:;_;:;=UU="'::'--,;;;- WTLCF W 1LCF W'ILCF (ugll) "= (mg> (mm) (mg) (mm) (ms) (mm) 1 8 1 1 080 2S±0.~ IS.4±0.( 0.1±0.3 255±0.( 31.S±O.SD. 0.S±0.1 4328±25.f 39.0±02 '3±0.3 8 1 8 8 a SO 14±0:t 163±1.0 0.8±0.11 213±1.3 30.5 ± 1.4 0.S±0.2 460.0±16.9 39.4±0.-t 1.6±0.~ 8 1 8 '00 3.5±0.1 169±0.( O.8±0.1 25.3±1.( 315±02D. 0.8±0.11 498.1±12-t 4O.6±1.3 '5±0.( b b a b b b b 200 1.O±0.l 1O.8±02 O.B±O.l 12.6±0.6> 26.3 ± 1.0 0.1±o.18 212±12 3O.1±0.4 0.8±0.l
x x x MT 0 S.O±1.3i. lS.1±Oj':0.8±0.2 33A±3.9 27.2±2.0" 1.1±0.3 419.1±3S.3l1. 36.8±2.4"9.1±1.2" x x x x 2S S.4±lS 185±0.4 O.9±0.2" 37.3±3.cr26.1±1.3 21±03 S04.3±32SC·385±U 8.9±Ul[ x x x x x SO S.3±12 J8.6±OS 0.8±oil: 393±2.4 21.9±1.-t 1.8±0.3 481.3±29.0 n.7±2.0 92±1.Ox x x x 100 5.0±1.3" 183±0.3" 0.8±0.2 n.9±1.6" 25.7±1.-t 2.3±0.4 YJ6.1±12.9" 382±3.dl: 9.3±l.4 x x x x 200 5.1 +09" 18.1 +OS 0.9±0.2 n2+2.6" 25.6±1.9 2.3+0.4 483A+S3.~ 38.0+42 92+1.11" Mem, within a cofomn supt:iSCiipted with different Iettets (a. b in ·ES; x. y in MI) are significant1y _(p< O.OS). populations. The 100 ug estracliol-17~n for 3 week treatment produced a near monosex population (98.'70/0); the other fish were classified as intersex. All male populations were produced by 200 ug 17a-metbyItestosteronell for 2 and 3 weeks. and 100 ug 17a-methyltestosteronell for 3 weeks WSO produced higher percent males than 99"/0 (Table 3 & 4).
Table 3. Effects of·estradiol-1711 immersion treatments on the sex ratios or mud loach
Dose l-week lreatmen! 2-week treatment 3-week treaImenJ: (ug/l) . Female Male InteISeX Female Male Intersex Female Male Intersex (%) (%) (%) (%) (%) (%) (%) (%) (%) o 49.3±~ 50.7±2S O.O±o.O .54.0±2.811,X 46.0±2.8 O.O±O.O S2.0±3.311,X 48.0±33 o.O±O.O 50 56.7±~ 4O.o±1.63.3±0.9 SS.3±3.811,X 39.3±25 S3±2S 64.1±z5'~'+ 34.0±33 1.3±09 100 66.1±2.5b;x.,+ 28.1±1.9 4.7±0.9 18.1±2Sb,y,+ 2O.0±1.6 13±O.9 98.7±1.9e,%,+ O.O±O.O 1.3±09 2CO 13.3±3.8e,X,+ 26.o±2.8 O.1±0.9 lOO.O±O.Oe.r,+ O.O±O.O O.O±O.O l00.0+0.0c.Y,+ O.O±O.O O.O±O.O Means within a column super.;cripted with different letters (s, b, c) are significantly different (p < O.OS). Means within a toW supeISCripled with different letIeJS (x. y, z) are significantly different (p < 0.05). -+s indicate significant deviations from I : 1 ratio.
Table 4. Effects of 1711-methyltestosterone treatments on the :'leX ratios of mud loach I-week treatment 2-week lreatment 3-week lreatment Dug/l""')_=~:::;':::='=:::;:'= -=::..c..:c=e::::=.""i::==- -==-'-":::';-=':'i:'-;:==- ( Malo Female Intersex Male Female inrersex Male Female Intmiex (%) (%) (%) (%) (%) (%) (%) (%) (%) o 48.0±4.311,X S2.0±4.3 O.O±O.O 49.3±3.411,X SO.7±3.40.0±o.O 51.3±1411,X 48.7±3.40.0±O.O b 2S 51.3±3AII,X 46.7±S.62.0±1.6 66.0±1.6b,y,+ 32.7±1.91.3±O.9 SO.O±2.8 ;r.+ 16.0±1.64.0±1.6 50 ID7±2Sb;x.,+ 38.0±3.3 1.3±O.9 72.0±3.3c3.+ 25.3±2S 2.7±2S 94.0±13e,%,+ 4.1±2S 1.3±09 100 1S.3±2Sc;x.,+ 233±1.9 1.3±O.9 83.3±4.1d,Y.+ 16.0±4.9 O.1±0.9 99.3±0.9cb.~ 0.1±0.9 O.O±O.O 2CO 81.3±2Scb.+ 18.0±1.6 0.1±O.9 l00.0+0.0c.Y,+ O.O±O.O O.O±O.O lOO.O±O.Od,y·+ O.O.±O.O O.O±O.O Means within a column supetSCripted with different 1ettE:ts (a, b, Co d, e) are significantly different (p < 0.05). Means·witlJin a toW superscripted with different letIeJS (x. y. z) arc significantly different (p < 0.05). -IS indicate significant deviations from I : ] ratio. .
33 These data show that estradiol-17P and 17a.-methyltestosterone are effective in sex reversing mud loach. The results also indicate that this species can be effectively sex reversed by immersion and that the honnone does not have to be added to feed. This is similar to that observed in coho salmon and chinook salmon (Goetz et at, 1979; Hunter et al., 1986). These results also show that the optimal immersion dosages of estradiol-17J3 and 17a.-methyltestosterone are 100-200 ugll.
The hormone was administered during the criticaJ period of gonadaJ differentiation (Kim et aJ., 1990), and the results show that the phenotypic development of the undifferentiated gonad could be .directed by an external steroids. The ability to produce a sex-reversed population depends, to a great extent, on the administration of the hormone during this short period of development (Goetz et aI., 1979; Yamazaki, 1983; Hiott and Phelps, 1993).
Further research is needed to determine the optimal treatment combination that can be used to produce 100010 sex-reversed mud loach with minimal adverse effects on growth and survivaJ. Further research is also required to establish the rate at which the administered steroids are cleared from the fish. It would aJso be valuable to detennine the concentration of hormones in nonnal fish and hormone-treated fish at the time of harvest. A recent study of the clearance of isotopically labeled estradiol-17J3 from salmon fry has shown that c1eanmce is very rapid (piferrer and Donaldson, 1994).
Gonad histology
Histological exarn..i.i:J.ation of the gonads from 2-month-old control females showed normal oocytes at various stages of development; those of 2-month-old normal males revealed normal testicular tissue containing spennatocytes and spermatozoa. Gonadal tissue from sex-reversed hormone treated fish was similar histologically to that from nonnal fish. GonadaJ tissue from intersex individuals contained both oocytes and spennatocytes, in various morphologicaJ arrangements and developmental stages (Fig. 1).
Figure 1. Transverse sections of gonads from 2-month-old intersex fish. Bar indicates 100 urn.
Morphology ofgonads and pectoral fins ofsex reversed fish
External morphology of ovaries from 9-month-old control fish revealed a single sac-shaped organ, with weU-developed yolk-laden oocytes. Testes from 9-month-old control maJes were a pair of rod-shaped structures, with milky white sperm. In sex reversed females, the development of oocytes in the ovaries did not extend to the genital pore, which suggests the possibility that sex reversed mud loach might not be able to spawn. On the other hand, the masculinized fish have similar testes morphology compared to nonnal males.
34 The size and shape of the pectoral fins exhibit sexual dimorphism in mud loach. Those in the males are larger and the fins have a distinct lamina circularis Sex reversed fish had pectoral fins that were intennediate in size between those of nonnal males and nonnal females. Furthermore, most, if'not all, laminae circulares in sex reversed fish were vestigial, although the size varied (Fig. 2).
Figure 2. Shape and structure of pectoral fins: nonnal female (a); feminized fish (b) masculiniud fish (c); nonnal male (d). Anow indicates the lamina circularis. Bar indicates 5 mm.
This paper presents for the first time a protocol to ensure 100% feminization and masculjnizatjon in a cyprinid mud loach using steroid immersion technique alone.
References
Goetz, F.W, Donaldson, E.M., Honter, GA and Dye, H.M,1979. Effects ofestradiol-17~ and 17 a-methyltestosterone on gonadal differentiation in the coho salmon, Oncorhynchus kisutch. Aquaculture 17: 267-278.
Hiott. AE. and Phelps. RP., 1993. Effects of initial age and size on sex reversal of OreocJuomis niioticus fly using methyltestosterone. Aquaculture 112: 301-308.
Hunter, G.A, Solar, I.I., Baker, 1.1. and Donaldson, E.M., 1986. Feminization of coho sahnon (Oncorhynchus kislftch) and chinook salmon (Oncorhynclms tshawytscha) by immersion of alevins in a solution ofestradiol-17j3. Aquaculture 53: 295-302.
Kiin, D.S., Lee, K Y. and Lee, T.-Y., 1990. Gonadal sex. differentiation in Misgumus mizo[epis. Kor. J. Ichtbyol. 2: 95-105.
Kim. D.S., 10, I-Y. and Lee, T.-Y., 1994. Induction of triploidy in mud 10ach (Misgumus mizo[epis) and its effect on gonad development and growth. Aquaculture 120: 263-270.
Kim, D.S., Nam, Y.K. and Park, I.-S., 1995. Survival and karyological analysis of reciprocal diploid and triploid bybrids between mud loach (Misgumlls mizo[epis) and cyprinid loach (M anguil/icaudatus). Aquaculture 135: 257-266.
Piferrer, F. and Donaldson, E.M., 1994. Uptake and clearance of exogenous estradiol-17~ and testosterone during the early development of coho sahnon (Oncorhynclms kisutch), including eggs, alevins and fry. Fish Physiol. Biochem. 13: 219-232.
Tave, D., 1993. Genetics for Fish Hatchery Managers, 2nd ed. Van Nostrand Reinhold. New York. 415 pp.
Yamazaki, F., 1983. Sex. control and manipulation in fish. Aquaculture. 33: 329-354.
35 36 THE INFLUENCE OF TRIPLOIDY AND HEAT AND HYDROSTATIC PRESSURE
SHOCKS ON THE GROWTH AND REPRODUCTIVE DEVELOPMENT OF
PERCH (Percaflavescens) REARED TO ADULT SIZE UNDER SELECTED
ENVIRONMENTAL CONDmONS
Jeffrey A. Malison University of Wisconsin Aquaculture Program 123 Babcock Hall, Madison, WI 53706-1565 Phone: (608) 263-1242 Fax: (608) 262-6872 E-mail: [email protected]
James A Held. Mary Ann R Garcia-Abiado. and Lynne S. Procarione University of Wisconsin Aquaculture Program
Abstract
We determined the influence of triploidy and shocks used to alter ploidy on the growth and reproductive development of adult perch reared under ambient and constant (near optimal) environmental conditions. These conditions assimilate pond and recirculation system aquaculture, respectively. Separate groups of perch eggs were treated with heat shocks (28-30 0c) for durations of 10-25 min, beginning at 2-5 min post-fertilization) or hydrostatic pressure shocks (9000 or 11 000 psi for durations of 8 or 12 min, beginning at 5 min post-fertilization) to induce triploidy in 30-70% of the eggs. Mer hatch, perch fry exposed to heat shock, pressure shock, or no shock were stocked and reared in separate ponds until they reached 25-35 mm total length (IL). The perch were harvested from the ponds and habituated to fonnulated feeds in separate tanks. When the fish reached 75-100 mm n, ploidy was determined on individual fish by flow cytometry. Subsequently, the five groups of fish (unshocked diploids, heat-shocked diploids, pressure-shocked diploids, heat-shocked triploids, and pressure-shocked biploids) were stocked separately into two sets of five tanks each. One set of tanks was kept under environmental conditions that are near optimal for perch growth (21°C, 16h lightl8h dark photoperiod), and the other set was kept under ambient conditions. The fish were then reared for 388 days. Because there were no apparent differences between heat-shocked and pressure shocked fish. these groups were pooled for statistical purposes. and for each environmental condition the data were analyzed as a 2 x 3 factorial experiment, with the factors being sex (male or female) and treatment (unshocked diploid, shocked triploid. and shocked diploid). Under both environmental conditions, females grew much faster than males, and the shocks used to alter ploidy had a negative effect on growth that was independent of ploidy status. Under ambient (but not constant) environmental conditions. triploid perch grew faster than shocked diploids, and had higher fiUet yields than either diploid group. Under both conditions, males had greater fillet yields than females. In general, the fillet yields of different groups of perch were inversely proportional to GSIs. Under both environmental conditions. female triploids had lower estradiol-
37 17~ eEl) levels than diploids. Taken together, these findings show that triploidy offers potential improvements in production characteristics of perch only if the negative effects of shocks can be avoided, and only to perch reared under ambient environmental conditions (e.g., pond culture). Our findings also show that the negative effects of shocks applied to newly fertilized eggs are permanent. In addition. the reduced levels of E,. (which promotes perch growth) in triploid female perch may offset any increased growth potential associated with sterility.
Introduction
The yellow perch (Perea jlavescens) is a highly valued food fish with numerous hiological cbaracteristics that make it an excellent candidate for commercial aquaculture (Calbert, 1975). Perch readily accept formulated feeds, show little aggressive or cannibalistic bebavior, and are highly tolerant of intensive culture conditions. Expansion of the perch aquaculture industry, however, has been constrained by several growth and maturational characteristics of this species. First, the overall growth potential of perch is limited by its inherent small size and slow growth rate (Huh, 1975; Malison et al., 1985). Second, a considerable reduction in growth rate occurs well before perch attains a market size of 140-160 g (Huh, 1975; Schott, 1980; Malison et al., 1985). Third. gonadal development can decrease fillet yields (i.e., the percentage of edible flesh) in percb by up to 35% (Le Cren, 1951; Malison et al., 1986).
These three problems may all be associated with sexual maturation and gonadal development, which begin in perch during the first yeM of life (Malison et al., 1985; 1988a). It is widely believed that sexual development acts to channel energy into the production of eggs and spenn. thereby slowing somatic growth (e.g., Purdom, 1976; Utter et al., 1983). Accordingly, the induction of sterility in fish by induction of triploidy may enhance growth and increase the percentage of edible flesh.
We have previously demonstrated that heat and hydrostatic pressure shocks applied to fertilized eggs to induce triploidy exert a negative effect on the growth of juvenile perch that is independent of ploidy status (Malison et al., 1993b). Juvenile heat-shocked triploid perch showed retarded gonadal development in both sexes, and showed faster growth than heat shocked diploids. The effects of similar ploidy manipulations on perch reared to adult size have not yet been reported. This study investigated. such effects on perch reared under ambient and constant environmental conditions to assimilate pond and recirculation system aquaculture, respectively.
Materials and Methods
General Procedures Experiments were conducted at our wet laboratory facilities located. at Lake Mills State Fish Hatchery, Lake Mills, Wl All fish used were the offspring of wild brood fish collected from Lakes Mendota and Cherokee, Dane County, WL Eggs were stripped from ripe females and fertilized using the dry method described by Heidinger and Kayes (1986). Triploidy was induced by exposing eggs to heat shocks of 28-30 °C for a duration of 10-25 min, beginning at 2-5 min post-fertilization, Or hydrostatic pressure shocks of 9000 or 11000 psi for a duration of 8 or 12 min, beginning at 5 min post-fertilization (Malison et al., 1993a). The eggs were then incubated under a gradually increasing temperature regime (± 0.5 °C per day).
38 Experimental Design On day 6 or 7 postfertilization, 10-20 embryos were randomly selected. from each treatment group and their ploidy levels determined by flow cytometry as previously described (Malison et al., 1993a). Batches of embryos containing 30-70% triploids, and respective unshocked controls, were incubated until hatch and stocked into three separate production ponds (one for heal shocked eggs, one for pressure shocked eggs, and one for unshocked eggs) and reared for approximately 40 days (to 25-40 mm total length [TLD. The fingerlings were then harvested and transferred into the laboratory, stocked into separate 750-1 flow-through fiberglass tanks, and habituated to intensive culture conditions (Malison and Held, 1992) and formulated feed (Silver Cup salmon feed, Murray Elevators, Murray, UT or W-16, Glencoe Mills, Glencoe, !vIN').
Prior to the initiation of the growth trial, pit tags were implanted into the body cavity of the individual fish, and 3-6 ml of blood were collected from the pseudobranch artery for ploidy determination by flow cytometry. Shocked triploids were then separated from shocked diploids and the few mosaics detected «1 % of the fish) were eliminated from our studies. Unshocked control perch were treated in a manner identical to that described for shocked fish.
The five groups of fish (unshocked diploids, heal-shocked diploids, pressure-shocked diploids, heal-shocked triploids. and pressure-shocked triploids) were stocked separately into two sets of five 220-1 flow through tanks each. One set of tanks was kept under ambient conditions, and these tanks received 4-6 IIrnin of unheated water that varied in temperature on a seasonal basis from 4-21 °C, and had tank lighting that mimicked natural daylengths. The other set of tanks was kept under constant conditions, and these tanks were supplied with 4-6 Urin of tempered water at 21.0 ± O.5°C, and lighting was set at 16 h light: 8 h dark photoperiod. Fish were hand-fed to satiation (about 2-5% body weight/day) depending on water temperature. Tanks were cleaned to remove excess food and feces once weekly. Fish were individually weighed and measured at the following sampling times: days 0,17,72,140,207,275,338. and 388. Condition factor (K) was calculated according to Carlander (1977): K = [weight (g)!standard length (rom)'] x 10'
At the end of the experiment, five fish were randomly selected from each treatment group, killed with an overdose of MS-222, and blood samples were collected from the Calldal vasculature for analyses of serum Ez and testosterone levels. The hormones were measured using commercially available radioimmunoassay kits validated for use in perch (Diagnostic products, Inc., Los Angeles, CA). The gonads were weighed and gonadosomatic indices (GSIs) were calculated using the formula: GSI = [gonad weight (g)/body weight (g)] x 100. The fish were filleted and fillet yields were similarly expressed as percentage of body weight.
Statistics For both environmental conditions there were no apparent differences between heat-shocked and pressure-shocked fish. Accordingly, these groups were pooled for statistical purposes, and for each environmental condition the data were analyzed as a 2 x 3 factorial experiment, with the factors being sex (male or female) and treatment (unshocked diploid, shocked triplOid, and shocked diploid). The data were analyzed using analysis of variance followed by pre-planned orthogonal contrasts at P=O.05. Data expressed as percentages were evaluated using arcsine transformations as suggested by Sokal and Rohlf, 1995). All results were expressed as mean ± standard error of the mean (SEM).
39 Resnlts
Ambient conditions Data On weight gains showed that (l) females had higher weight gains than males, (2) among females, unshocked diploids had higher weight gains than the shocked groups, and (3) among males, triploids had higher weight gains than shocked diploids (significance of "sex", and "sex x ploidy". see Table 1 and Figure 1).
Data OD length gains showed that (I) females had higher length gains than males, (2) unshocked diploids had higber length gains than the shocked groups, and (3) triploids had higher length gains than shocked diploids (significance of "sex:" and "ploidy", see Table 1 and Figure 1).
Data on condition factors showed that (1) females had higher condition factors than males, and (2) shocked diploids had bigher condition factors than tripioids (significance of "sex" and "ploidy", see Table 1 and Figure 1).
Data on fillet yields sbowed that (1) males had higher fillet yields than females, (2) shocked groups had higher fillet yields than unshocked diploids, and (3) and triploids had higher fillet yields than diploids (significance of "sex" and "ploidy", see Table I and Figure 1).
Table 1. Results of ANOV As for various parameters of fish reared under ambient and constant environmental conditions. Source of Weight Length Condition Fillet OS! T E, Variation Gain Gain Factor Yield (%). (nglm!)' (nglml)' (g) (rnrn 11.)' (K)' (%)3
Ambient Environment Sex P Constant Environment Sex P L11.. _ totallenglhi iK_ (body weight (g)/staDdard length [rom31 x lOS; JFillet yield (fillet weigbt [g]lbody weight [gJ :x loo;40S1 = gonad weight (g)Ibody weight (g):x 100; sT= testosterone; 6er estrodiol-17~; 1 2nSH= shocked diploids, 3n= II'iploids;1 2nUn= unsbocked diploids, Sb= shocked diploids + II'iploids 40 150 1m Males 0 Females :§ 120 .~ to 90 ~ 60 ~ 30 105 ~ 'd' 80 ~ ~ 55 ~ -' 30 "''"-;; 2.2 ""~ 2.1 ~ 2 .s:.i 1.9 ""' ~" 1.8 il0 u 46 ~ 43 :sl .!!l >- 40 ;; 37 ~ 34 Unshocked Shocked Triploids Diploids Diploids Figure 1. Weight gains, length gains. condition factors, and fillet yields in percb reared to adult size under ambient environmental conditions. Data on GSIs showed that (1) females bad higher GSIs than males. and (2) shocked diploids had higher GSIs than trip]oids (significance of "sex" and "ploidy". see Table 1 and Figure 2). Testosterone levels were higher in males than in females. Data on ~ levels showed that (1) females had higher levels than males. and (2) in females. diploids had higher ~ levels than triploids (significance of "sex", "ploidy", and "sex x ploidy", see Table 1 and Figure 2). 41 20 Em Ma1es o Females IS ~ 10 13 5 0 0.8 1l T 1!1' 0.6 .L = 0.' i 0.2 0 • 1l 3 1!1' j 2 ~ 0 Unsbocked Shocked Triploids Diploids Diploids Figure 2. Gonadosomatic indices (GSIs), testosterone, and estradiol Constant Conditions Data on weight gains showed that (1) females had higher weight gains than males, and (2) unshocked diploids bad higher weight gains than the shocked groups (significance of ''sex'' and "ploidy", see Table 1 and Figure 3). Data on length gains showed that (1) females had higher length gains than males, and (2) unshocked diploids bad higher weight gains than the shocked groups (significance of "sex" and "ploidy", see Table 1 and Figure 3). Data on condition factors showed that (I) females had higher condition factors than males, and (2) unshocked diploids had higher conditions factors than the shocked groups (significance of "sex" and ''ploidy'', see Table 1 and Figure 3). Males bad higher fillet yields than females (significance of "sex", see Table 1 and Figure 3). 42 [50 Males Females '@ EI 0 .!l-[20 <> 90 tl. ." 60 '" 30 j105 -!l 80 <> 155 30 ~ ~ ~2.2" ~ 2[ ~. ~ 2 ~ ... 1.9 .§ " 1.8 il0 u 46 *-;; 43 ~ 40 >;; ir! 37 34 Unshocked Shocked Triploids Diploids Diploids Figure 3. Weight gains, length gains, and condition factors in perch reared to adult size under constant environmental conditions. Data on GSIs showed that (1) females had higher GSls than males, (2) sbocked diploids had higher GSIs than triploids. (significance of "sex", "ploidy" and "sex x ploidy"; see Table 1 and Figure 4). There were no significant effects of either "sex" or ''ploidy'' on testosterone levels. Females had higher Ea levels than males, and shocked female diploids had higber E:2 levels than triploid females, (significance of "sex", "ploidy" and "ploidy x sex; see Table 1 and Figure 4). 43 20 EEl Males o Females IS ~ 10 ° Unshocked Shocked Tripioids Diploids Diploids Figure 4. Gonadosomatic indices (GSIs), testosterone, and estradiol-17P in perch reared to adult size under constant environmental conditions. Discussion Our findings show that, for the aquaculture of yellow perch under ambient conditions (Le., in ponds), triploids may have superior production traits than diploids if the negative effects of the shocks used to induce tripioidy can be avoided. Because of the markedly faster growth of females versus males. the use of all-female stocks is a significant advantage for perch culture regardless of whether perch are reared under ambient or constant conditions. Under ambient conditions, however, females can exhibit a significant decline in fillet yield in conjunction with gonadal development. Our fmdings clearly show that triploids exhibit this problem to a far lesser degree than diploids. and may also have the potential to grow somewhat faster than diploids. For perch reared under constant environmental conditions. h1ploidy does not appear to offer any significant benefit. 44 Our findings also show that heat and hydrostatic pressure shocks appJied to newly fertilized eggs exert a negative effect on the growth of perch that is independent of ploidy status, and that this effect continues beyond the juvenile stage until perch reach a market size of 100-150 g. We previously hypothesized that the negative effects of shocks on juvenile growth resulted from the biochemical actions of heat shock proteins (Malison et al., 1993b). HSPs are thought to prevent errors in transcription and translation, and tluough these and other mechanisms may protect organisms from the effects of severe stressors (Nagao et al., 1990). Heat and hydrostatic pressure shocks may also have non-specific actions on microtubules, which in tum could result in various mitotic aberrations including multipolar metaphases and aberrant cleavages (Garcia Abiado, 1995). Supporting this idea are the findings that chum and masu salmon (Oncorhynchus freta and O. masOll, respectively) embryos showed abnonnal embryogenesis associated with chromosomes isolated from the nucleus, chromosome bridges, fragments, gaps, and rings among dividing cells (Yamazaki and Goodier, 1993). Regardless of the mechanism, our findings show that the effects of post-fertilization shocks are essentially permanent. Triploid female perch (reared under ambient or constant conditions) had reduced serum E2levels compared to diploids, a finding that has also been described in several other fish species (e.g., Lincoln and Scott, 1984; Benfey et al., 1989). In normal diploid perch, the stimulatory effects of ovarian estrogens on growth are responsible for much of the difference in growth between the sexes (Malison et al., 1985; Malison et al., 1988b). It is likely that ovarian estrogens also promote growth in triploid perch, and if so the reduced serum ~ levels in triploids may (partially) offset any increased growth potential associated with their sterility. One possible way of producing triploids without using shocks would be to cross fertile tetraploids with diploids. Experiments along this line are currently being conducted in our laboratory. Acknowledgments We would like to thank Thomas Kuczynski and Terence Barry for their assistance. These studies have been supported by the University of Wisconsin-Madison College of Agricultural and Life Sciences and School of Natural Resources; the Wisconsin Department of Natural Resources; the University of Wisconsin Sea Grant College Program, National Oceanic and Atmospheric Administration, US Department of Commerce, and the State of Wisconsin (Federal Grant NA46RG0481, Project No. RlBT-8); and the North Central Regional Aquaculture Center under a grant from the United States Department of Agriculture (Federal Grant 89-38500-4319) to Michigan State University (agreement 71-22521) between Michigan State University and the University of Wisconsin-Madison). References Benfey, TJ, Dye, HM, Solar, n, Donaldson" EM 1989 The growth and reproductive endocrinology of adult triploid Pacific salmonids. Fish Physiol. Biochem., 6: 113-120. Calbert, HE 1975 Purpose of the conference. In: Aquaculture:Raising Perch for the Midwest Market. University of Wisconsin Sea Grant College Advisory Report No. 13, Madison, WI, pp. 7-8. 45 Carlander. KD 1977 Handbook of Freshwater Fishery Biology, Vol. 2. Iowa State University Press, Ames, IA, 431 p. Garcia-Abiado, MAR 1995 Reproductive Biology and Chromosome Manipulation in the Nile Tilapia, Oreoehromis nilotieus Linnaeus. Ph.D. Thesis, University of Wales, Swansea, Wales, U.K., 382 pp. Heidinger, RC and Kayes, TB 1986 Yellow perch. In: RR Stickney (Editor), Culture of Nonsalmonid Freshwater Fishes. CRC Press, Boca Raton, FL, pp 103-113. Huh. lIT 1975 Bioenergetics of Food Conversion and Growth of Yellow Perch (Perea flavescens) and Walleye (Stiz,ostedion vitTewn vitTewn) Using Fonnulated Diets. Ph.D. Thesis. University of Wisconsin-Madison, Madison, 254 pp. Le Cren ED 1951. The length-weight relationShip and seasonal cycle in gonad weight and condition in perch (Percafluviatilis). l. Anim. Bco1.. 20: 201-219. Lincoln, RF and Scott, AP 1984. Sexual maturation in triploid rainbow trout. Salmo gairdneri Richardson. l. Fish BioI., 25: 385-392. Malison lA, Kayes, TB. Held. lA, Barry, TP, and Amundson, CH 1993a Manipulation of ploidy in yellow perch (perea flaveseens) by heat shock, hydrostatic pressure shock, and spermatozoa inactivation. Aquaculture, 110: 229-242. Malison, I.A., 1985. Growth Promotion and the Influence of Sex-Steroids on Sexually Related Dimorphic Growth and Differentiation in Yellow Perch (Perea jlaveseens). Ph.D. Thesis, University of Wisconsin-Madison, 153 pp. Malison, JA and Held, lA 1992 Effect of fish size at harvest. initial stocking density and tank lighting conditions 00 the habituation of pond-reared yellow perch (Perea jlavescens) to intensive culture conditions. Aquaculture, 104: 67-78. Malison, lA. Best, CD, Kayes, TB. Amundson, CH and Wentworth. BC 1985 Hormonal growth promotion and eveidence for a size-related difference in response to estradiol-17P in yellow perch (pereaflavescens). Can. l. Fish Aquat Sci., 42: 1627-1633. Malison, lA, Kayes, TB, Best, CD, Amundson, CH, Wentwoth, BC 1986 Sexual differentiation and use ofhormooes to control sex in yellow perch (Pereajlaveseens). Can. 1. Fish AqUa! Sci., 43: 26-35. Malison, JA, Kayes, TB, Wentworth, BC, Amundson, CH, 1988a. Growth and feeding responses of male Versus female yellow perch (Perea flaveseens) treated with estradiol- 17~. can. J. Fish AqUa!. Sci .. 45: 1942-1948. Malison, lA, Kayes, TB. Wentworth, Be, and Amundson, CH. 1988b Control of sexually related dimorphic growth by gonadal steroids in yellOW perch (Pereaflaveseens). In: DR Idler, LW Crim, JM Walsh (Editors), Proceedings of the Third International Symposium on Reproductive Physiology of Fish. Memorial University of Newfoundland. St. John's, Newfoundland, Canada. p. 206. 46 Malison, lA, Procarione, LS, Held, lA, Kayes, TB, Amundson. CH, 1993b The influence of triploidy and heat and hydrostatic pressure shocks on the growth and reproductive development ofjuveniJe yellow perch (Percaflaveseens). Aquaculture. 116: 121-133. Nagao, RT. Kimpel, lA. and Key JL 1990. Molecular and cellular biology of the heat-shock response. In: JG Scandalios and TRF Wright (Editors), Advances in Genetics, Vol. 28. Academic Press, New York. pp. 235-274. Purdom. CE 1976. Genetic techniques in flatfish culture. 1. Fish. Res. Bd. Can., 33: 1088-1093. Schott, EF 1980. Sexually Dimorphic Growth in Young-of the-Year Yellow Perch (Perea flaveseens) Under Controlled Environmental Conditions. M.Sc. Thesis. University of Wisconsin-Madison, Madison, 222 pp. Sokal, RR, and Fl Rohlf. 1995. Biometry. The Principles and Practice of Statistics in Biological Research. W.H. Freeman and Company, New York. 887 p. Utter. FM. Johnson, OW. Thorgaard, GH and Rabinovitch PS 1983 Measurement and potential applications of induced triploidy in Pacific salmon. Aquaculture, 35: 125-135. Yamazaki, F and Goodier. 1 1993 Cytognetic effects of hydrostatic pressure treatment to suppress frrst cleavage of salmon embryos. AquaCUlture. 110: 51-59. 47 48 PRODUCTION OF ALL-FEMALE DIPWID AND TRIPLOID OlJVE FLOUNDER, PARALICH71fYS OLIVACEUS Chang Hwa Jeong . Department of Aquaculture, National Fisheries University of Pusan, Pusan 608-737. South Korea TeI:82-S1-620-6136, Fax:82-S1-627-1096 Dong Sao Kim Department of Aquaculture, National Fisheries University of Pusan, Pusan 608-737, South Korea' Tel:82-S1-620-6136, Fax:82-S1-627-1096 Introduction Olive flounder (Para!ichJ}rys oJivaceus) is the most important marine food fish in Korea which are produced both by capture and culture. One of major problems in olive flounder culture is sex related dimorphism in growth rate where females grow much faster than males (Kim et aI., 1994). When females reached to 600g of body weight which is near to marketable size, the average size of males is about ha1f of their female progenies. Depands on this, production of all-female population of this species should inprove the yields, and fish farmers much eager to culture the mono-sex, only females. Fortunately, olive flounder has the XX-XY based sex detennination mechanism in which females are homogamety (Tabata, 1991). All female populationS can be produced by crossing phenotypic males (but genetically femaie) with normal females in species whose sex determination mechanism is female homogamety. Reversed phenotypic males can be tranditionally obatained by hormonal sex reversal, however it enevitably requires the intensive labourious steps such as progeny test for selecting the reversed genetic females. Induced gynogenesis in species where female is homogametic. and mascu1inization of these gynogenetic females could exclude this time consuming proceduces because they are all genetically females. In addition, induced gynogenesis has been given nruch attention because of their poteirtial interests such as the rapid establishment of pure inbred lines and accelerated elimination of recessive deleterious genes (Thorgaard, 1983; Quil1et et al., 1991; Kim et al "' 1993). The object of this study is to develop all-female diploid and triploid populations by chromosome set manipulations including induced gynogenesis, and sex control techniques in order to enhance the productivity in olive flounder fiums. 49 Materials and methods The artificial induced and multiple spawning in olive flounder were performed by employing the human chorionic gonadotropin (1-2 ill RCG/g BW) and carp pituitary (10 pg CP/g )()(~<> -- BW). ~,; -,- /nSctivatlons by uv We developed the all-female olive flounder by ev es--.Sperm chromosome set manipulation and sex reversal. _.& Gynogenetic diploid flounders were induced 1 by artificial insemination with UV-irradiated beterospecific sperm from. several species. of ~ SA A-,~ fishes and by applying the cold shocks. {{ ~~~>~ .. 'if ,., Gynog~etic diploid females (XX) were masculinized by physical treatment to phenotyphicaJly male (XX) which can be used for the production of all-fema1e population. Reproductive performances of induced gynogenetic male has been examined by A"~2N cytological evaluations and fertilization trials. All female diploid and triploid populations were produced by crossing the induced gynogenetic diploid male (XX) with normal female (XX). andlor by cold shock treatment Figure 1. Experimental procedure for this study. (Fig. I). Results and discussion Induction ofgynogenesis Table 1. Effects of ultraviolet irmdiatioo for inaCtiVatioD Gynogenetic diploid females were induced of spemtatozolll1 DNA wilh sevenll fish species using server3l UV-irradiated heterospecific Dose HHlching rale Haploidy sperms and ·cold shocks; the optimal UV dose Species (..g/mm') (%) (%) was ranged 3,600 to 4,200 (erg/mm~, and ACt:lntho]XISOO' sch1ege/i 3,900 15.4 100 treatment of 2't for 45 mins, 2 mins after MisgllTJWS mitDlepis 3,600 o o fertilization gave the best results for blocking PtJrtJlidrJlrp oliRzuw" 4,200 243 100 2nd polar body (Table I & 2). Masculinization ofgynogenetic diploidfemales Induced gynogeneric females were masculinized to phenotypic males by sex reversal. Masculinization of gynogenetic females was done by elevation of culture temperature in critical periods and also by other some physical methods without employing any steroids. These masculinization methods were patent pending to our country (93-18132. South Korea). 50 Fertility ojgynogenetic diploid males Reproductive abilities of gynogenetic diploid Table 2. Effects of cold shock (45 mins) on fertilized eggs of olive flOUIlder, Paralichlhys olillQceus males inelu.ding the histological analyses of for the induction of gynogenetic diploid testis, cytological analyses of spermatozoa and fertilization trials with normal eggs were No. of eggs Tomp Survival rate Gynogenetic evaluated along with nonnal diploid males. """,d ("C) of embryos (%) diploidy (%) 1,500 0 59.2 37.7 Gonads of gynogenetic diploid males were 1,500 2 68.8 62.5 histologically normal. and many spermatozoa 1,500 4 70.6 28.7 were observed in their testis. (Fig. 2). Mean number of spermatozoa from the control and gynogenetic diploid males were (2.58 ± 1.17) X 109 and (2.42 ± 0.79) X 109 cells per I ml of. milt, respectively {P>O. OS). Amount of milt per kg body weight from ilIe -gynogenetic diploid male (20.6 ± 12.9 mI) was ~gnificantly higher (P<0.01) than that from the control male (8.3 ± S.4 mil. Size and morphology of spennatozoa from the two experimental groups were not different from the control male (P>O.05). More than 80 % of fertilization rates and hatching rates Figure 2. Transverse sections of control ma1e were observed when the eggs from the control and gynogenetic diploid male Para!icht"hys were fertilized with the gynogenetic diploid O/ivaCetIS gonads: (8) control testis; (b) male sperms (Table 3). gynogenetic diploid male testis Table 3. Resu1ts of artificially fertilized with normal diploid female and gyoogenetic diploid male olive flounder, Paralichlhys olivQCus Amount of milt Floating rale Fertilization rate Halching rate Exp. Group No. of eggs u=I (ml) (%) (%) (%) 120,000 (3) 35.0 (7.) 41.9 84.0 78.5 2 450,000 (3) 33.0 (4) 66.7 94.0 92.0 3 360,000 (3) 19.0 (J.) 40.3 70.3 81.9 4 1,405,000 (9) 23.0 (5) 36.7 70.7 84.0 5 660,000 (4) 14.8 (J.) 50.8 802 892 6 780,000 (9) 14.8 (4) 31.4 88.6 76.4 Mean ± SD 636,000 ± 460,000 23.3 ± 8.1 44.6 ± 11.5 81.3 ± 8.8 83.7 ± 5.5 .. Number of fish used Induction oj all-female diploid and triploid Table 4 showed the sex ralios of progenies produced by crossing the gynogenetic males with normal females. 51 Table 4. Sex mtios of progeny by mating with gynogenetic diploid male and normal female in olive flounder, Paraichllrys olivaceus No. of fish Sex Percentage of Exp. group ob=ved Female Male female Diploid I 60 60 0 100 D 70 70 0 100 Triploid m 60 60 0 100 IV 80 80 0 100 TOIBl VO VO 0 100 a Figure 3. Metaphase spreads of diploid female (a) and artificial triploid female (b) Paralichthys olivaceus. Complete population all-female was successfully obatained, and the all-female triploids were also succussfully produced by cold shocks. The chromosome number of diploids and triploids showed 2048 and 3n=72, respectively, and their karyotypes were copsisted of all acrocentric chromosomes (Fig. 3). The gonads of 4- month -old triploids were sterile histologically (Fig. 4). Ongoing studies are producing the all-femaleHounder populations in a commercial scales, and are evaluating the Figure 4. Transverse sections of diploid and perfonnances of all-female populations and triploid female Paralichlhys olivaceus enhanced yields. gonads: (a) diploid ovary; (b) triploid ovary 52 References Kim, B.-S., Y. B. Moon, C. H. Jeong, D. S. Kim and Y. D. Lee, 1994. Evaluation offertility of artificial induced gynogentic diploid male in Paralichfhys oltvaccJls. Korean 1. Aquacult. 7: 151-158. Kim, D. S~, J. H Kim, J.-Y. 10, Y. B. Moon and K. C. Cho, 1993. Induction of gynogenetic diploid in Paralichthys olivaecJls. Korean J. ~net. 15: 179-186 Quillet, E., P. Garcia and R. Guyomard, 1991. Analysis of the production of all homozygous lines ofrainbow trout by gynogenesis. 1. Exp. Zoo!. 257: 367-374. Tabata, K, 1991. Induction of gynogenetic diploid males and preswnption of sex: determination mechanism in the hirarne Par'alichthys olivaceus. Nippon Suisan Gakkaishi 57: 845-850. Thorgaard, G. H', 1983. Chromosome set manipuJation and sex: ·control in fish. In: Fish Physiology Vol. IX.-B. CW. S. Hoar, D. 1. Randall and E. M. Donaldson,. Editors), Academic Press, New York, pp. 405-434. 53 54 Reproduction and Growth 55 56 THE SECRETION OF GONADOTROPIN (GTH) AND GROWTH HORMONE (GIl) IN THE BAGRID CATFISH, MYSTUS MACROPTERUS WITH DIFFERENT REPRODUCTIVE STAGES H. R. Lin, D. S. Wang Department of Biology. Zhongshan University, Guangzhou, P.R. China H. J. Th. Goo, Research Group for Comparative Endocrinology, Department of Experimental Zoology, University of Utrecht, The Netherlands Introduction Bagrid catfish, Mystus macropterus. has rapidly been gaining popularity as a cultured fish in China recently. In order to understand the neuroendocrine regulation of the reproduction and growth of this species, we measured the concentrations of gonadotropin (GtH) and growth hormone (GH) in pituitary and serum during different stages of the reproductive cycle. Male and female bagrid catfish at different reproductive stages were collected from the Jialingjiang River, a branch of the Yangtze River. GtH concentrations in pituitary and serum samples were measured by radioimmunoassay (RIA) using African catfish GtH as standard and antiserum to African catfish GtH as described by Goos et aI. (1986) with minor modification. GH concentrations in serum samples were determined by RIA specific for common carp GH (Merchant et at, 1989). Serial dilutions of serum of bagrid catfish resulted in displacement curves parallel to the common carp GH standard curve. Duncan's multiple range test was used to determine the differences (p 0.05) in the mean GtH and GH levels. Results A. Gonadotropin (GTH) levels in the pituitary The pituitary GtH levels in bagrid catfish showed significant seasonal changes parallel with its 57 reproductive cycle. Both male (2.62 to 3.26 ug/mg) and female (3.48 to 4.03 ug/mg) pituitary GtH levels peaked during spawning season (from April to July). After breeding, from August to November, pituitary GtH levels decreased gradua1ly, in males, from 1.87 to 1.18 uglmg, and in females, from 2.11 to 1.76 ug/mg. Upon gonadal recrudescence in the spring of the next year, pituitary GtH concentrations increased in males from 1.07 to 1.49 uglmg, and in females from 1.53 to 2.25 uglmg. Pituitary GtH levels were significantly higher in females than in males throughout the reproductive cycle. The average pituitary GtH concen1:r8tion of the whole repro.ductive cycle in males was 1.2S±O.08 uglmg and 2.62±O.19 uglmg in females. B. Gonadotropin (GtH) levels in serum Serum GtH levels in male and female bagrid catfish were correlated with their gonadal-somatic index (GSI) during the reproductive cycle. In males, GtH levels (1.1S:tO.14 nglml) peaked in May at the post-spermatogenic stage (GSI=().5:tO. I %), but slightly decreased in June (0.88:tO.09 nglmI) at the prespawning period. After breeding season, serum GtH still remained at the same levels (0.83 to 1.03 ng/mI) when GSI dropped to 0.22 to 0.34% in July to August. In sexually' regressed male fish in November to January, serum GtH decreased to lower levels (0.61 to 0.66 ng/mI). In females. serum GtH concentrations were elevated gradually (from 0.88 to 1.01 nglml) with ovarian development in March to April. In post-viteUogenic fish (GSI=7.61±1.36%) in May, serum GtH levels are the highest (1.23±O.Ol ng/ml). At the end of vitellogenesis and during the prespawning period in June, OSI reached its highest level (l6.25±1.25%), serum GtH cecreased slightly (1.01:tO.05 ng/mI). After spawning in July, GSI declioed rapidly to O.72:tO.09'Io, serum GtH still remained at. higher level (1.1 I:tO.06 nglmI). During the ovarian regression and resting period, serum GtH level decreased to remain at lower levels (0.59-0.81 ng/ml) until the next spring. Unlike the sexual dimorphism existing in pituitary GtH levels, no difference was found in average serum GtH levels throughout the reproductive cycle between male (0.86+0.05 ng/ml) and female (0.96+0.04 ng/mI) bagrid catfish. C. Effects ojLHRH-A/DOM on serum GtH levels In a previous study on effects ofLHRH-A and domperidone (DOM), a dopamine antagonist on serwn GtH level in bagrid catfish., we showed that LHRH-A alone stimulated an increase in serum GtH levels significantly; DOM alone was ineffective in increasing serum GtH levels, but caused a marked potentiation ofthe GtH release and ovulation response to LHRH-A, indicating that dopamine functions as a gonadotropin release inhibitory factor. The present investigation demonstrated that the responsiveness of serum GtH level to LHRH-A/DOM in bagrid catfish was positively correlated with their GSI and basal serum GtH level at different stages of the reproductive cycle. During sexually regressed and sexual resting periods when the basal GtH level and GSI are low, the stimulating effect ofLHRH-A and the potentiating effect of DOM on LHRH-A in response to GtH release are weak; conversely, during the sexually mature and prespawning stages, when the basal GtH level and GSI are high, the stimulating effect of LHRH-A and the potentiating effect of DOM on LHRH-A in response to GtH release are strong. For example, in sexually regressed females, LHRH-A+DOM injection caused a modest stimulation of GtH secretion, serum GtH level at 6 h post-injeetion is 6.35±1.01 nglml, at 12 h post-injection it is 3.33±1.27 ng/ml. However, in sexually 58 mature females (GSI=18.05±;O.84%), LHRH-A+DOM injection stimulated GtH secretion dramatically. The serum GtH level at6 h post-injection was 12.48±2.65 ng/mI, at 12 h post-inj~tion it was 10.26±2.88 ng/ml, or about a 2-3-fold higher level than in sexually regressed females. D. Growth hormone (GH) levels in the pituilary The pituitary GH levels in bagrid catfish showed. some seasonal variation, but not parallel with its reproductive cycle precisely. Both male (2.58±O.27 fig/ml) and female (2.40±0.35 fig/mI) pituitary GH levels peaked in March. This may be correlated with the rapid body growth and gonadal development during the spawning season. PituitaIy GH levels were not significantly varied in male and female fish at different stages of gonadal maturity (recrudescence, maturing, mature and regressed). The average serum GH levels throughout the reproductive cycle in male (1.76±O.08 ug/mg) and female (1.56;tO.09 ug/mg) bagrid catfish were also not different. E. Growth hormone (GH) levels in the serum Serum GH levels in male and female bagrid catfish were also correlated with the reproductive cycle. The lowest serum GH levels were found during the sexual resting petiod in November (39.79±3.52 ng/ml). During the ovarian recrudescence period from January to May. serum GH levels elevated gradually. Doting the spawning season (June to July), serum GH levels rose rapidly from 60.98±7.43 ng/ml to 227 .19±19.32 ng/ml . These high serum GH levels were maintained in autumn during the sexually regressed period. F. Effects ofLHRH-A on serum GHlevels LHRH-A alone or in combination with DOM did not affect serum GH levels in bagrid catfish at any stage ofthe reproductive cycle. These results indicated that, unlike cyprinids, GnRHs (e.g. LHRH-A) are not involved directly in the regulation of GH release in the bagrid catfish, and consistent with the recent finding that GnRH receptors are restricted to gonadotropes in African catfish (Bosma et aI., 1995). References Bosma, P. T., W. van Dijk. S. van Haren., S. M. Kolk, O. Lescroart, R. N. Schulz, M. Terlou, and H. J. Th. Goos. 1995. GnRH receptor are restricted to gonadotropes in male African catfish. In: "Proceedings of the Fifth International Symposiwn on the Reproductive Physiology of Fish." Published by Fish Symposium 95, Austin, U.S.A. Goos, H. J. Th., De Leeuw, R., Bunawa-Gerard, E., Terlou, M. and Richter, C. J. 1. 1986. Purification of gonadotropic honnone from the pituitai}' of the African catfish, Clarias gariepinus ·(Burehell), and the development of a homologous radioimmunoassay. Gen. Compo Endocrinol., 63:162-1700 Marchant, T. A., Chang, J. P., Nahorniak, C. S. and Peter, R. E. 1989. Evidence that gonadotropin-rel~ing honnone also functions as a growth hormone-releasing factor in the goldfish. Endocrinology, 124:2509-2518. 59 Transgenic Fish 61 62 CARACfERIZATION OF A TRANSGENIC TllAPIA LINE WITH ACCELERATED GROWTH I.Guillen Mammalian Cell Genetics Division. Centro de Ingenieria Genetica y Biotecnologia. P,D.Box 6162. Havana 6, Cuba (fax:53-7-2180701E-mail: [email protected]). R.Martinez, O.Hermindez", M.P.Estrada, RPimente( F.Herrera, AMorales, ARodriguez, V.Sanchez", Z.Abad", Y.Hidalgo, R.L1eonart, ACruz, I.Vazquez"'·. T.Sanchez**, I.Figueroa"''''·. M.Krauskopr"** and 1. de la Fuente. Mammalian CeU Genetics Division. Centro de Ingenieria Genetics y Biotecnologia. P,D.Box 6162. Havana 6, Cuba:Centro de Ingenieria Genetica y Biotecnologia. P.O.Box 387. Camaguey 1, Cuba. ·"'Empresa Nacional de Acuicultura (MIP). Carretera Central Km 20'12, Lorna de Tierra, CatoITo. Havana, Cuba. ***Universidad Austral de Chile, Institute of Biochemistry, Valdivia, Chile. Introduction Recent advances in gene transfer technology have produced a great impact in modern biology and biotechnology. In fish, the transfer of growth honnone (GH) genes has been used to accelerate growth in economically important species with the aim of creating improved strains for aquaculture. Tilapia are economically important species accounting for over 70% of the fresh water fish production in Cuba. These species need around 6 months to get the commercial weight of 250 g (Tave, 1993), thus constituting species of choice to accelerate growth. The possibility of accelerating growth in tilapia was assayed by exogenous administration of recombinant tilapia GH (tiGH). The tiGH eDNA was cloned from hybrid tilapia pituitary glands and expressed in E.coli (Lleonart et al., 1992) and in the yeast P.pastoris (perez et al., 1994). The growth ofjuvenile tilapia (Oreochrom;s sp.) was accelerated (1.4 fold in length and 1.7 fold in body weight after 21 days) when the yeast-derived tiGH was administrated by three intraperitoneal injections at intervals of 7 days. The control group received BSA injections. Recently. we have obtained better results with the injection of correctly folded EcoU-derived tiGH (Guillen et al., manuscript in preparation). These results indicate that it is possible to accelerate growth in tilapia through the exogenous administration of tiGH, thus suggesting that transgenic tilapia with appropriate ectopic tiGH expression levels could grow faster that non-transgenics. Gene transfer in tilapia has been reported by Brem et al. (1988), Rahman and Maclean (1992), Phillips et al. (1992), Martinez et al. (1992; 1996) and de laFuente et al. (1995). The possibility of accelerating growth in til apia was assayed by the transfer of a chimeric construct containing the tiGH eDNA. A transgenic tilapia line was obtained (Martinez et ai., 1996). The characterization of this fast-growing transgenic tilapia line is presented in this report. 63 Materials and Methods. Generation of the transgenic tilapia line. The transgenic tilapia line characterized here was obtained as reported by Martinez et al. (1996). Analyses were conducted with Fl (PI x wt). F2 (Flr/~ x Flr/~ andlor F3 (F2+I. x F2+1-) transgenic and non-transgenic siblings. Transgenics were identified by PCR or dot-blot analysis of fin andlor blood cells DNA (de la Fuente et aI., 1995; Martinez et aI., 1996). Wild type (wt) tilapia were consider those directly obtained from natural ponds and not grown under laboratory conditions. Analysis oftiGH e:lpre'!lsion. The study of RNA expression was carried by in situ hybridization using an oligonucleotide probe encoding a fragment of tiGH eDNA (antisense-probe 5'-CTACAGAGTGCAGTIT GCTTCTGGAGA-3' and sense-probe 5'-TGTCTGGAGGTTTCCTCTCTGAGGAAC-3'). Tissue sections (muscle, gonads, heart, brain, liver) of transgenic tilapia were fixed in 4% paraforma1dehycle in PBS at room temperature for 30 min, washed twice in PBS for 5 min each and after freezing the tissue. serial transversal sections were cut at 10 mm thickness. Several adjacent sections were mounted on a gelatinelO.Ol% KCr(SO~-coated slide for the in situ hybridization and immunohistochemistry staining. Tissue sections for in situ hybridization were post-fixed 5 minutes, washed twice in PBS for 5 minutes each, in 2X SSC for 10 minutes and preincubated for 2 hours with a hybridization buffer (50% foIIDalllide, 10% dextrane sulfate, 5X Denbardrs,2X SSC and 25 mg/ml of yeast tRNA). The probe was labeled with the DNA Tailing Kit (Boerihnger, Germany), using digolrigenin (D1D-II-dUTF). The probe was added diluted (1:200) in hybridization buffer and samples were incubated over night at 37°C in a moist chamber. Then. slides were washed sequentially with 2X SSC for 30 min, with IX SSC for 30 min, with O.5X SSC for 30 min, all at room temperature and with 0.5X SSC for 30 min at 37°C. The sections were then processed for probe detection with Anti-digoxigenin-AP, Fab fragment (Boerihnger. Gennany). Immunohistochemical analysis was carried out according to Inostroza et al. (1990) using as first antibody a rabbit anti-serum to recombinant tiGH. Rabbit antibodies to carp vitellogenin were used as control. The second antibody was a goat Anti-rabbit IgG-FITC or IgG-Rhodamine conjugate (Sigma, USA). Northern blot aoaIysis of RNA from liver, gonads and muscle from FI transgenics was carried out by standard procedures employing as probes tilapia IGF-I and GH eDNAs and human glicemidehyde-3-pbospbate dehydrogenase (GAFDH) to normalize for the amount of RNA loaded. Behaviour studies. Appetite (feeding motivation (FM)): The voluntary intalre of !bod was compared between F2 transgenic and non-transgenic tilapia. Twelve animals from each group were transferred to a separate 500 I aquarium. The feeding procedure was repeated seven times at five hours intervals during 30 min. Each group was fed 50 pellets eveI)' time. We used as pellets a mix of alginate and milled commercial fish food (Cenpalab, Havana, Cuba), encapsulated with 50 mM calcium chloride to avoid the decomposition by the water. This procedure enable the quantification of pellets eaten by the animals dwing the feeding time. Dominance status (DS): We determined dominance using a procedure reported by Johnsson and Bjomsson (1994), 'Where the ability to obtain food is assumed to reflect the competitive ability of an individual. We placed together in 500 I crystal aquarium six animals per group of wt. F2 transgenic and non transgenic tilapia. On five occasions separated by 1 min, a single pellet of food (Cenpalab, Havana, Cuba) was released into the water using a feeding tube located in the middle, 64 over the aquarium. This procedure was repeated five times at 30 minutes intervals. The fishes were observed on site during the experiment and the image was recorded by a video camera for posterior analysis. The same procedure was made to measure the competitive behaviour between transgenic and non-trangenic tilapia by the food. Fifty % of sea water adaptation (SWA): Tilapia (F2 transgenics (N=3) and non-transgenic control siblings (N=3» were subjected to a 6 h 50% sea water challenge test according to the 'procedure described by Johnsson and Bjomsson (1994). Growth assessment. Experiment I was conducted with Fl animals obtained from a mating between a transgenic male designed as "albino" and a non-transgenic Ohornorum x Oaureus female (Martinez et al .• 1996). All the fish were always maintained under similar conditions. Four months old transgenic (N=18) and non-transgenic siblings (N=20) were identified by PCR and placed in separate protected experimental ponds under similar natural conditions in our center in Camaguey in January 1994 (Martinez et al., 1996). Additionally to the naturally existing food supply, fish were fed once a day with a commercially prepared food (Cenpalab, Havana). Each fish was weighed and measured monthly during five months. / Experiment 2 was conducted with F2 tilapia (Fl r +, x F1 rJ+ry. Four months old transgenic (N= 14) and non-transgenic siblings (N=11) were placed in a 200 m3 culture pond in G (Havana Province, Cuba). Additionally to the naturally existing food supply, fish were fed once a day with a commercially prepared food (Cenpalab. Havana). Each fish was weighed and measured monthly during 3 months, when transgenic (f2-I+ and F2+1+) tilapia were identified by dot-blot analysis of blood cells DNA. The analysis of growth performance was conducted after transgenic and non transgenic populations were identified. Results and Discwsion. Generation of a transgenic tilapia line. In experiments assaying different virus-derived regulatory sequences, we found that the human CMV enhancer-promoter was able to direct the expression of tiGH andlor reporter genes in fish cells and embryos (Hernandez et al., 1993 a,b; GaICf. del BIlICO et al., 1994; L1eonart et al., 1994). Transgenic tilapia (probably Oaureus x Ohomorum, although the breeding history is not known) were generated with a construct containing the human CMV 5' regulatory sequences linked to the tiGH eDNA and the polyadenylation site from the SV 40 (CMV>tiGH>CA T>SV 4()) (de I. Fuente et al., 1995; Martinez et al., 1996). The ectopic GH levels required. to accelerate growth in transgenic fish, and particularly in tilapia, are not known. However, considering that hormones generally function at low concentrations, we worked with the hypothesis that low expression levels of the GH-transgene will be sufficient to accelerate growth in tilapia, reducing the possible detrimental effects that have been reported for high GH expression levels in transgenic mammals (see for example Berlanga et al .• 1993 and Ebert et aI. J 1990). This hypothesis has been recently coIIOborated by the assay of transgenic tilapia lines expressing different levels of ectopic tiGH (Hernandez et al., manuscript in preparation). 65 A transgenic male containing I copy of the transgene per cell (FO-3 in Martinez et a1. (1992) and afterwards designated as "albino" because of his more clear pigmentation when compared to the other founders, although without having a genetically defined albino phenotype) was selected to establish a transgenic line (de]8 Fuente et ai., 1995; Martinez et ai., 1996). Fl tilapia were obtained from a mating between the "albino" male and a non-transgenic hybrid female. The transgene was stably transmitted to FI, F2 and F3 generations in a Mendelian fashion (fable 1), thus indicating that the transgene stably integrated into the host genome. Ectopic expression of tiGH in transgemc tilapia. Ectopic, low level expression of tiGH 'WaS detected in gonad and muscle cells of Fl and F2 transgenic tilapia (fable I and Martinez et aI., 1996) by in situ hybridization (Fig. I) and immunohistochemical analysis (Fig. 2) of tissue sections. Circulating tiGH levels, although measured at a single time point in eight months old Fl tilapia, were similar in transgenics and non~transgenic siblings (Martinez et al., 1996). A 8 A B Figure1. In situ hybridization of a transversal Figure2. ImmunohIstOchemistry of transversal muscle tissue section of transgenic F3 tilapla with muscle tissue section of transgenic F3 tilapla dlgoxlgenin-labeled oligo-nucleotide sense (A) developed with an anti-<:arp vilellogenin sera (A) and antisense (8) probe for UGH. and with an anti-tiGH sera (8). In other tissues analysed for ectopic expression of tiGH (brain, liver, spleen) no expression 'WaS detected with the techniques described in this report. Although we employed a human CMV promoter that is active in many cell types (Stinski, 1983), transgene expression 'WaS clearly detected only in gonad and muscle cells. The analyses employed in our experiments were not designed to quantiti11e the tiGH expression levels, and only approximate calculations were made. A likely explanation to the impossibility to detect transgene expression in other tissues is that the expression levels were bellow the sensitivity of the systems employed Another, less likely explanation, is that the transgene integrated into a locus that is transcriptionally active only in certain tissues. Taken these results together, point to the fact that in this transgenic tilapia line the ectopic expression oftiGH occurred. at very low levels. 66 Growth pbenotype of transgenic tilapia. To assay the phenotipic effect of the ectopic expression of tiGH, growth rate was monitored in transgenic FI and F2 tilapia and in comparison with non-transgenic siblings. Fish were mainlained. under similar conditions since hatching. In the first experiment, four months old FI transgenics (n~18) and siblings (n~20) were studied under similar growth conditions (Martinez et aI., 1996). At the beginning of the experiment, transgenics VJere already 125% bigger than non-transgenic siblings (Martinez et aI., 1996). Five months latter, at the end of the experiment, the average weight of transgenic tilapia was 82% that of siblings, maintaining a significant difference (p=O.OOI; Table I). The weight of individual animals at the end of the experiment showed. that 44% (8/18) of transgenic tilapia were larger than the largest control and non was smaller than the smallest control (Martinez et al., 1996). For males, who are normally larger than females in this specie, 75% oftransgenics were larger than the largest control (Martinez et aI., 1996). In the second experiment, under different culture conditions, 4 and 7 month old F2 transgenics (n=14) were 37% and 55% larger than non-transgenic siblings (n=11) at p=O.OI and p=O.009, respectively (Fig. 3 and Table I). These experiments showed a genetic improvement in these animals when compared to the non-transgenics. We have not determined. the heritability (h~ for growth mte in transgenic tilapia However, it has been. reported in tilapia to be within a range that is appropriate for an effective selection program (Oldorf et al., 1989; Sl1nchez et al., 1994), specially when the coefficient of variation (CV) for weight at 240 days in transgenic Fl tilapia (CV=lOO%) predict a good chance of success in a breeding program. 10 A 9 8 me 7 "E 6 c~ 5 .~ ~ 4 ~ 3 2 1 0 1 0 B 9 Figure.3. e 8 Experiment 2: .2l 7 6 Growth E ~ 5 performance of 4 c .!!! 4 months (A) and 7 ~ 3 months (8) old F2 • 1= 2 transgenIc 1 heterozygous 0 (black bars; N=8) a a a a a a a a a a a and non- ~ a N ~ ~ ~ ~ ~ ;! ~ ~ ~ transgeniC (white .. W eigth'" (9)'" '" bars; N=11) tilapla. 67 Table 1. Summary of the clwacterization offast growing transgenic tilapia line. Tdapia Inheritance tiGH IGF tiGH Moan Mean growth % (%) b .C weight±SE difference RNA" protem increase±SD d RNA (g) FI (PI x wt) 47 S 24 10 399.1:!:94.1e SO.4±4.2e 82" F2(FI xFI) SO + nd + 242.I±2SAf 33.8±11.9f SSf n-/+ - + nd + 263.7±31.0f 32.9±10.@ 62f F2+I+ - + nd + 213.3±33.2f 3S±6,Sf 31f F3(F2+/-xF2+I-) 70 + nd + nd nd nd Non-transgenic - 0 11S 0 219.S:l:49.l e 28.5±2.se - controlsg IS6A±64.2f I1.8±S.Sf ~A levels (in arbitrary units) were calculated by summarizing the results of the Northern blot analysis in the liver, gonads and muscle. Signals in the X-my:films v.'ere scanned and normalized against GAPDH. +, denotes presence of tiGH RNA in muscle samples analyzed by in situ hybridization. bRNA levels (in arbitrary units) were calculated as indicated in a. nd, not determined. cTilapia ectopic GH protein levels were calculated by summarizing the exposure time required for photography (employing an Olympus exposure control unit) in gonad, heart and muscle tissue sections after immtmohistochemical analysis with. anti-tiGH-anti rabbit IgG-Rhodamine conjugate. Values v.'ere normalized against the control. +, denotes presence of tiGH protein in non-quantitated tissue sections. d OAVEAAGE~month. Cyalues corresponding to experiment 1 in Materials & Methods for 9 months old tilapia in Jtme 1994 (N'IRANSGENlcs==18; NCOHmOLS ==20). Transgenic progeny were larger than non-transgenic at j>"'O.OO I (t-Test). fvalues corresponding to experiment 2 in Materials & Methods for 7 months old tilapia in -/+ +1+ . -1+ +/+ February 1996 (N"""""",oFI4; N""""'LS-ll; N" -8; N" -6). Transgeruc (F2 + F2 ), I F2- +, and F2 +1+ progeny were larger than non-transgenic at j>"'O.009, j>"'O.005 and j>"'O.07 (t Test), respectively. ~on-transgenic tilapia with similar age and genetic background and grown under similar conditions were employed as controls. 68 Behaviour of transgenic tilapia. . Tmnsgenic F2 tilapia and non-transgenic siblings were compared viith respect to feeding motivation (FM), dominance status (OS) and 50% of sea water adaptation (SWA). Tmnsgenics and non-transgenic siblings did 25 not differ significantly in size at the start of * the appetite and dominance status ~20• experiments (X±SE ~163.7±76 and 163.86±82. respectively; P'" 0.99; I-Test). However, transgenic tilapia showed a higher FM (jFO.03; I-Test) (Fig. 4). Figure 4. Mean number of pellets eaten by transgenic and non-transgenic Ulapia during 96 hours appetite experiments (n=12) Transgenics Noo (*p The competition by the food between wt, transgenics and non-transgenics was vel}' favorable to the wt, who showed an extreme aggressive behaviour in front of the others. Some animals from this group did not move from the place where food fell down, showing a complete dominance in getting the pellets. Wt tilapia showed a higher DS than both transgenic and non-transgenic siblings (p-1.\3 E-12; ANOVA Single Factor Test) (Fig. 5). Figure 5. Mean number of pellets eaten by wt, transgenic and non transgenic tlIapia during 4 hours of feeding competition trials (n=6) (*p c 11 16 • ,. * .." 12 ..~ 10 .. 8 ~ ~ 6 ,E c • Figure 6. Mean number of •c 2 pellets eaten by transgenic and • 0 non-transgenic tlIapia during 4 " Transgenics Non hours of feeding competition T ransgenics trials ( n=6) (·p 69 Plasma sodium levels in transgenic tilapia after exposure to 50% sea water did not change significantly (p==O.I; t~Test). However, in non~transgenic siblings, plasma sodium levels increased after treatment (p=O.03; t-Test). These results suggested that GH could be involved in osmoregulation tilapia. given an advantage for sea water adaptation of transgenic vs. non transgenic tilapia. Safety considerations. In the last few months we have been selecting for transgenic homozygous (+1+) tilapia by dot~blot analysis offin andlor blood cells DNA. These F2c+!+, [FIr!+' x Flr/~ tilapia are now fOnning a stock for reproduction. For production we are planing to use heterozygous (homozygous x wt) tilapia. 1his is why most of the characterization studies have been conducted with heterozygous tilapia Studies under production conditions are now under way. To conduct the studies outside the laboratory, including those reported here, we held an ad hoc committee meeting devoted to the analysis of the conditions to release transgenic tilapia with accelerated. growth in Cuba (de la Fuente et al., 1996). This committee concluded that, under the conditions found in Cuba, little or no effect on natural popuJations will occur as a resuJt of accidental escape of transgenic fish, mainly because these natural popuJations does not exist and most of the fish species we found now in the country have been introduced. Nevertheless, the committee recommended. to follow the final draft of the "Perfonnance Standards for Safely Conducting Research with Genetically Modified. Fish and Shellfish" (documents No. 95~01 and 95-02) prepared and released by The U.S. Department of Agriculture, the Agricultural Biotechnology Research Advisory Committee, and the Working Group on Aquatic Biotechnology and Environmental Safety. These standards, as they state in the ovezview, are accompanied. by flowcharu; that guide the assessment pathway in a way that pemtit to consider and implement the necessary measures to safely conduct the experiments with transgenic :fish to accumuJate the data needed. to fully characterize these new fish strains. Our experiments have been planned and conducted follOwing these recommendations (de la Fuente et aI., 1996). Although transgenic tilapia have been manipuJated to accelerate growth, many characteristics of the parental organism shouJd be maintained. We have not seen any abnormalities in transgenic tilapia, including analysis of homozygous animals. Furthermore, experiments described. comparing the DS of transgenic and wt tilapia suggested that transgenic populations accidentally escaped to natural ecosystems wouJd have less chance to survive (Fig. 5). These preliminary observations addressed some of the concerns discussed by Hallennan and Kapuscinski (1992) for the introduction of transgenic fish into the national aquacuJture programs. Conclusions. The results presented here showed that low level ectopic expression of tiGH resulted in a growth acceleration in this transgenic tilapia line without causing detrimental effects to the animals. This genetically improved tilapia strain could be introduced into Cuba's national aquaculture programs with an impact in the tilapia production in the country. 70 Aclmowledgements. Drs. L.Herrera and F.O.Castro (CIGB) are acknowledged for their advice and support during the course of the experiments. Drs. J.Martial (Liege Univ.), Z. Varon and P.Melamed (Tel-Aviv Univ.) are acknowledged for providing the possibility of determining the circulating tiGH levels by RIA. O.Castellano (Centro Internacional de Restauraci6n Neuro16gica) is acknowledged for technical assistance. lbis work was partially supported by the International Centre for Genetic Engineering and Biotechnology C References. Berlanga, J., Infunte, J., CapO, V., de la Fuente, I., and Castro, F.O. (1993). Characterization of transgenic mice lineages. I. Overexpression of hGH causes the formation of liver intranuclear pseudoinclusion bodies and renal and hepatic injwy. Acta Biotechnol. 13: 361-37l. Brem, G., Brenig, B., H5rstgen-Schwark, G., and Winnack.er, E.L. (1988). Gene transfer in tilapia (Oreochromis niloticus). Aquaculture 68: 209-219. De Is Fuente, ~., Martinez, R, Estrada, M.P., Hernandez, 0., Cabrera, E., Garcia del Barco, D., Lleonart, R., Pimentel. R., Morales, R., Herrera, F., Morales, A., GuiUen, I., Piiia, I.C. (1995). ToVlBrds growth manipulation in tilapia (Oreochromis sp.): generation of transgenic tilapia with chimeric constructs containing the tilapia growth hormone cDNA. Journal of Marine Biotechnology 3: 216-219. De la Fuente, J., Hernm.dez, 0., Martinez, R., Guillen, I., Estrada, M.P., Lleonart, R. (1996). Generation, characterization and risk assessment of transgenic tilapia with accelemted growth. Biotecnoiogfa Aplicada 13 (in press). Ebert, K.M., Smith, T.E., Buonomo, F.C., Overstrorn, E.W., and Low, M. (1990). Pon:ine growth hormone gene expression from viral promoters in transgenic swine. Anim. Biotechnol. 1: 145-159. Garcia del Barco, D., Martinez, R., Hemlndez, 0., Lleonart, R., and de la Fuente, I. (1994). Differences in the transient expression directed by heterologous promoter and enhancer sequences in fish cells and emlnyos. J. of Marine Biotechnology 1: 203-205. HaIlerman,E.M., and Kapuscinski, A.R. (1992). Ecclogical and Regulatory Uncertainties Associated with transgenic fish. In : Transgenic Fish. C.L.Hew and Fletcher (eds.) World Scientific Publishing Co., Singapore. pp: 209-228. Hernm.dez, 0., Theron, M.C., Puissant, c., Bearzotti, M., Altai, I., LeBail, P.Y., Cabrera, E., Lleonart, R.. de la Fuente, 1., and Houdebine. L.M. (I993a). Effect of intervening sequences in the transient expression of tilapia growth honnone in mammalian and fish cells. Biotecnologfa Aplicada 10: 158-161. Hernm.dez, 0., AttaI, J., Theron, M.C., Puissant, C., and Houciebine, L.M. (199Jb). Efficiency of introns from various origins in fish cells. Molecular Marine Biology and Biotechnology 2 (3): 181-188. Inostro"", J., Vera, M.I., Goicoechea, 0., Amthauer, R., and Krauskopf, M. (1990). Apolipoprotein A-I synthesis during the aclimatization of the carp (Cyprinus carpio). 1. expo ZooL 256: 8-15. 71 lobnsson, 1.1., and Bjomsson, B.Th. (1994). Growth hormone increases growth rate, appetite and dominance injuvenile rainbow trout, Oncorhynchus myskiss. Anim. Bebav. 48: 177-186. Lleonart. R, Garcia del Barco, D., Hernandez, 0., and de la Fuente, 1. (1992). Microinjection or DNA into tilapia (Oreochromis aureus) and common carp (Cyprinus carpio) one celled embryos: a novel system for in vivo transient gene expression studies. Advances in Modem Biotechnology I: 18.1. Lleonart. R. Martinez, R, Garcia del Barco, D., HernAndez, 0., Castro, F.O., and de la Fuente, 1. (1994). Reporter genes for in vivo transient gene expression studies in tilapia (Oreochromis azueus) and common carp (Cyprinus carpio) one celled embryos. Theriogenoiogy 41: 240. Martinez, R., GaId. del Barco, D., Hem.!ndez, 0., Lleonart, R., Henera, F., Cabrera, E., and de 10 Fuente, 1. (1992). Generation of transgenic tilapia with a chimeric gene that directs the synthesis of tiGH mRNA in ClIO cells. Miami Short Reports. (Ed. by W-I.Whelan, F.Ahmad, H.Bialy, S.BIack, M.Lou King, M.B.Rabin, L.P.Solomonson, L.lKVasil) 2: 53. Martinez, R, Estrada, M.P., Berlanga, 1., Guillen, I., HernAndez, 0 .• Cabrera, E., Pimentel, R., Morales, R., Henera, F., Morales, A., Piila, J.C., Ahad, Z., Sanchez, V., Melamad, P., Lleonart, R, and de la Fuente, 1. (1996). Growth enhancement in transgenic tilapia by ectopic expression of tilapia growth hormone. Molecular Marine Biology and Biotechnology 5(1): 62- 70. Oldorf, W., Kronert, U., BalaIin, J., Haller, R., Horstgen-Schwark, G., and Langholz, H.I. (1989). Prospect of selecting for late maturity in tilapia (Onilotfcus) ll. Strain comparison under laboratory and field conditions. Aquaculture 77: 123-133. Perez, A., Lleonart, R., Fuentes, P., Hernandez, 0., Morales, R., Cabrera, E., and de I. Fuente, 1. (1994). Characterization of recombinant tilapia growth hormone produced in Pichia pastoris. International Marine Biotechnology Conference. Tromso, Nonvay. p. 126 (Abstr.). Phillips, C.P., Cohler, C.C., and Muhloch, W. (1992). Procedural protocol, survival to hatching and plasmid DNA fate after micropinjection into tilapia zygotes. 1. World Aqua· Soc. 23(2): 98- lB. Rahman, Md.A, and Maclean, N. (1992). Production of transgenic tilapia (Oreochromis niloticus) by one-cell-stage microinjection. Aquaculture 105: 219-232. Sanchez, T., Ponce de l.e6n, R., Aguilar, M., Vazquez, J., and McAndrew, B. (1994). Response to selection and heritability for weight in Oreochromis aureus Steindachner after five genemtions of selection. Fifth International Symposium. on Genetics in Aquaculture, Dalhousie University, Hallfax, Nova Scotia, Canada, p. 126 (Abslr.). Stinski, M.F. (1983). The molecular biology of cytomegaloviruses. In B. Roizman (ed.), The herpersviruses, vol. 2, Plenum. Publishing Corp., New York. Tove, D. (1993). Genetics for fish hatchery managers. Second Edition. Pub. by Van Nostrand Reinhold, New York, p. 70. 72 Stock and Species Identification 73 74 USE OF MULTI-WCUS DNA FINGERPRINTING FOR STRAIN IDENTIFICATION IN CHANNEL CATFISH,lCI'ALURUS PUNCI'ATUS Brian G. Bosworth and William. R Wolters US. Department of Agriculture, Agriculture Research Service Catfish Genetics Research Unit P.O. Box 38 Stoneville, MissiSSippi 38776 Ph. (601)-686-5460/ FAX (601)-686-3044 Introduction Channel catfish culture is the largest aquaculture industry in the United States. More than 430 million pounds of catfish were processed in 1994 with an average price paid to producers of $0.77 per pound (USDA 1996). Deveiopmentand commercial use of improved gecmplasm (e.g. faster growing. disease resistant) have dramatically increased production efficiency in many livestock species and similar production increases should be possible through genetic improvement of catfISh. Therefore, one of the mission objectives of the CatfISh Genetics Research Unit (CGRU), USDA-ARS is to develop genetically improved catfish strains for release to the industry. As part of the CGRU germplasm development program, we are attempting to identify strain-specific molecular markers for strains scheduled for release. Strain specific markers will be useful for maintaining strain integrity and providing proof of strain-type following release offish to the industry. Polymorphisms at isozyme loci can be used to distinguish among blue catfish (I.jurcatus), channel catfish and their hybrids, but levels of polymorphism at these loci are too low within channel catfish to be useful for strain identification (Carmichael et al. 1992). Multi-locus DNA fingerprinting. a technique used to visualize restriction fragments at numerous, highly polymorphic loci, has been used to estimate relationships among populations of other fish species (Dahle 1994, Spruell et al. 1994, Naish et al. 1995) and may be useful for strain identification in catfish. The objectives of this research were to identify restriction enzyme/multi-locus probe combinations useful for DNA fmgerprinting channel catfish and to identify strain-specific DNA fmgerprint patterns in CGRU strains. Methods DNA isolation and fmgerprint preparation were perl'ormed using techniques described for DNA fmgerprinting of pOUltry (Dunnington et al. 1990). Genolliic DNA was isolated from whole blood by phenol:chloroform extraction and ethanol precipitation, 10 ug samples of DNA were digested with 10-20 units of restriction enzyme, and digested DNA was electrophoresed in a 0.8% agarose gel in IX TBE at 35 volts for 60-65 hr. After electrophoresis, DNA was transferred to a nylon membrane (MSI) by capillary action, the membrane was hybridized with alkaline phosphatase conjugated repeat probes (FMC BioProducts or Zeneca) and subjected to stringency washes. Membranes were exposed to X-ray fIlm (Amersham) for 2-4 hours at 37 C. Autoradiograms were scanned (Sharp JX-330) and fmgerprint patterns were analyzed with Advanced Quantifier® I-D software (BioJmage). Band sharing was calculated as: 2(Nab)/(Na + Nb), where Nab = number of bands shared between samples a and b, Na=total number of bands 75 in sample a, and Nb = total number of bands in sample b. Error tolerance (the amount a band can deviate in size and still be considered a match) was set at 1.5 %. Five restriction enzymes: AI. I, Dpn n, Hae ill, Hinf~ Rsa ~ and 13 probes: CAn, GAn, ACGn, CACn, CGCn, CTCn, ACAGn, ATCCn, AGATn, AluiSIi, MYI middle repeat (FMC BioProducts), 33.15 and 33.6 (Zeneca) were tested to identify restriction enzyme/probe combinations useful for DNA fmgerprinting channel catfisb. Fingerprints were produced with DNA isolated from blood of individual fish and from blood pools (mixes of equal amounts of blood from 10 individuals). Three pooled samples (a total oftbirty fish) from each of five CGRU catfIsh strains (albino, Mississippi normal, USDA-I02, USDA-102 select, and USDA- 103) were fmgerprinted and band sharing within and among strains was calculated. Nineteen individuals from each of two strains being developed for release (USDA-I02 select and USDA- 103) were fmgerprinted and within-strain band sharing was calculated. Fingerprints of individual and pooled samples were examined to identify banding patterns unique to USDA-I02 select and to USDA-I03 strains. Nine USDA-t02 selects, 8 USDA-t03s, and 18 fish from three commercial catfish farms were fingerprinted to determine if level of band sharing at diagnostic bands could be used to correctly identify strain-type. Results Useful fmgerprints were produced by digesting DNA with Alu I, Dpn IT, or HinfI and hybridizing with CACn, CGCn, CTCn, ATCCn, and AGATn probes. Probe hybridization and wash conditions are listed in Table 1. The enzyme/probe combinations used typically produced 25-30 scoreable bands (size range 6-23 kb) per sample. Table 1. Hybridization temperature and stringency wash conditions for oligonucleotide probes used to DNA ftngerprint channel catfish Probe Hybridization Temperarore!___ :,S"tnn,,· "'."en"cy"-'W"-""''''h'::'C'''o"n'''d'''iu,,·o .... ns! CAC 47°C Wash 1, 2xfor 10 minutes at 47°C Wash 2, 2x for 10 minutes at 47°C CGC Wash 1, 2x for 10 minutes at 47°C Wash 2, 2xfor 10 minutes at 47°C ere 45°C Wash I, 2x for 10 minutes at 45°C ATCC 4ZOC Wash I, 2x for 10 minutes at 42°C GATA 42°C Wash 1 2x: for to minutes at 42°C I. Hybridization buffer and wash solutions are proprietary products provided by the probe supplier, FMC BioProducts. Alu I produced fmge.tprints with resolvable bands, but the fmge.rprint patterns were too polymorpbic to be useful for strain identification. The remaining restriction enzymes and probes were Dot useful for fmge.tprinting catfish due to presence of too many bands andlor intense backgrouod signal (Hae ~ CAn, GAn, 33.15, and 33.6) or few to no bands (Rsa ~ ACAGn, ACGn, AluiSli and MYI). Band sharing within strains was generally 30-40% bigher than band sharing among strains (Table 2). Band sharing within strains was lowest for abinos (mean for all enzyme/probe combinations = 6(010) and highest for USDA-I02 selects (86%). The USDA-t02 select strain had high band sharing (78%) with its fouoder popnlation, USDA-102. Within-strain band sharing values for the various enzyme/probe combinations used to fmgerprint individual fish ranged from 37-53% forUSDA-102 selects and from 33-44% for USDA-I03s. No strain- 76 specific bands were found in USDA-I02 selects or USDA-l 03s, but several enzyme/probe combinations revealed 2-3 bands present in more than ?5% of individuals from each of these strains and absent or at a low frequency in other CGRU strains. Table 2. Mean band sharing (%) within and among 5 channel catfIsh strains fmgerprinted with 10 restriction/enzyme probe combinations. Strain Albino USDA-103 Mississippi USDA-102 USDA-102 Select select Probe Dpn llHinjIDpn llHinjIDpn llHinjIDpn llHilifIDpn llHinj! CACn 68 61 39 41 62 47 36 41 47 35 CGCn 74 71 41 45 50 55 41 41 46 49 Albino CTCn 53 58 43 39 52 44 42 30 44 34 ATCCn 46 44 40 28 45 30 40 32 36 27 ATAGn 58 69 46 52 51 59 46 48 41 50 CACn 86 74 53 39 44 40 41 30 CGCn 83 78 51 41 48 32 45 38 USDA-I03 CTCn 87 76 52 44 34 41 31 43 ATCCn 73 81 41 29 50 36 43 42 ATAGn 84 71 49 38 56 36 51 42 CACn 84 72 58 42 49 47 CGCn 79 72 54 31 39 39 Mississippi CTCn 76 66 45 41 44 39 Select ATCCn 68 80 58 38 55 42 ATAGn 84 77 59 51 45 43 CACn 96 77 72 71 CGCn 81 82 82 74 USDA-102 CTCn 92 87 88 79 ATCCn 94 79 86 68 ATAGn 98 80 81 75 CACn 86 78 CGCn 88 83 USDA-I02 CTCn 91 86 Select ATCCn 89 75 ATAGn 96 84 Level of band sharing at diagnostic bands visualized with HinfIlATAGn and HinfIlATCCn resulted in correct strain assignment for all 9 USDA-I02 selects tested (based on 2:.500/0 band sharing at 6 diagnostic bands) and correct assignment of? of 8 USDA-I03s e.40% sharing at 5 diagnostic bands). One of the 18 fish from the commercial fanns was incorrectly assigned to the USDA-I03 strain. 77 Discussion DNA fingerprints were produced in channel catfish using two restriction enzymes (Bin! I and Dpn II) and five probes (CACo, CGCo, CTCo, ATCCn and ATAGn). Within-strain band sharing of individual USDA-I02 select (37-53%) and USDA-I03 catfish (33-44%) were similar to band sharing values reported in other fishes (Harris et al. 1991, Bosworth et al. 1994, Spruell et al. 1994). The high levels of band sharing among DNA pools within strains and between USDA-I02 selects and their founder strain, USDA-I02, indicate that band sharing among groups was reflective of their genetic similarity. Multi-locus fingerprinting also has been used to accurately estimate genetic similarities among tilapia strains (Naish et al. 1995), inbred poultry lines (plotsky et aI. 1995), and cattle (Mannen et aI. 1993). The relatively low within-strain band sharing in alinos was surprising because it was thought that this strain was founded by a limited number offish from a single strain. The apparent low genetic similarity in the alino strain may be the result of the founder population being a mix of two or more strains. Our preliminary data indicate that multi-locus fingerprinting can be useful for catfish strain identification. Although the sample size was small (35 fISh), the ability to correctly identify strain-type in 16 of 17 fish based on level of band sharing at 'diagnostic' bands was encolllBging. However, additional work is needed to clearly defme levels of similarity at diagnostic bands needed for accurate determination of strain classification. In particular, a large number of fish from different commercial farms should be screened to ensure that bands identified as diagnostic for a strain are not present at high frequencies in existing commercial stocks. Multi-locus DNA fmgerprinting with non-radioactive probes can be conducted in labs with minimal equipment and allows simultaneous screening of numerous polymorphic loci. However, disadvantages of multi-locus fingerprinting include the time needed to produce results (5-6 days), amount of DNA required (5-10 ug per sample), and variation in banding patterns due to slight differences in transfer efficiency or hybridization and wash conditions (O'Reilly and Wright 1995). Therefore, we are also examini.ng the ability to identify catfish strains based on polymorphisms at microsatellite loci. Although initial costs for developing primers for a large number of microsatellite loci are high, peR amplification of microsatellites requires small amounts of DNA and will allow rapid and consistent genotyping of large numbers of fIsh. Regardless of the techniques used to visualize polymorphisms, the use of highly variable DNA markers appears to have potential for strain identification in catfISh. Use of strain-specific markers will allow producers who propagate and distribute released strains, to maintain genetic integrity of their stocks and provide proof of strain integrity to individuals interested in purchasing a particular strain. Acknowledgments The authors thank Dr. Geoffrey Waldbieser for manuscript review and we also thank the Mississippi Agriculture and Forestry Experiment Station, Lando Fratesi and Leigh Holland for providing fish used in this research. Mention of a trade name, proprietary product, or specific equipment does not constitute a guarantee or warranty by the U.S. Department of Agriculture and does not imply approval to exclusion of other products that may be suitable. 78 References Bosworth, RO., E.A. Dunnington, O.S. Libey, and L.C. Stallard (1994). Restriction enzyme/multi-locus probe combinations useful for DNA fingerprinting of the striped bass, white bass and their Fl hybrid. Aquaculture 123:205-215. Carmichael, G.J., M.E. Shcmidt and D.C. Morizot (1992). Electrophoretic identification of genetic markers in channel catftsh and blue catfish by use of low-risk tissues. Transactions of the American Fisheries Society 121:26-35. Dahle, O. (1994). Minisatellite DNA fIngerprints of Atlantic cod (Gadus morhua). Journal of Fish Biology 44: I 089-1 092. Dunnington, E.A., O. Gal, Y. Plotsky, A. Haberfeld, T. Kirk, A. Golberg, U. Lavi, A. Cahaner, P.B. Siegel, and 1. Hillel (1990). DNA fIngerprints of chickeos selected for high and low body weight for 31 generations. Animal Genetics 21 :247-257. Harris, A.S., S. Bieger, R. W. Doyle, and 1.M. Wright (1991). DNA fIngerprinting oftilapia, Oreochromis niloticus. and its application to aquaculture genetics. Aquaculture 92: 157-163. Manoen, H., S. Tsuji, F. Mukai, N. Gote, and S. Ohtagaki (1993). Geoetic similarity using DNA fingerprinting in cattle to determine relationship coefficient Journal of Heredity 84:166- 169. Naish, K.A., M Warren, F. Bardakc~ D.O.F. Skibins~ OR Carvaibo and O.C. Mair (1995). Multilocus DNA fingerprinting and RAPD reveal similar genetic relationships between strains of Oreochromis nUoticus (pisces: Cichlidae). Molecular Ecology 4:271-274. O'Reilly, P. and J.M. Wright (1995). The evolving tecbnology of DNA fIngerprinting and its application to fisheries and aquaculture. Journal ofFish Biology 47:29-55. Plotsky, Y., M.O. Kaiser, and S.J. Lamont (1995). Geoetic characterization ofhighiy inbred chicken lines by two DNA methods: DNA fingerprinting and polymerase chain reaction using arbitruy primers. Animal Genetics 26:163-170. Spruell, P, S.A. Cummings, Y. Kim and O.H. Thorgaard (1994). Comparisonoftluee anadromous rainbow trout (Oncorhynchus mykiss) populations using DNA fingerprinting and mixed DNA samples. Canadian Journal of Fisheries and Aquatic Sciences 51: 252-257. USDA (U.S. Department of Agriculture) (1996). Farm Raised CatfIsh Processor Report National Agricultural Statistics Service, Agricultural Statistic Board, USDA, AQ-l, January 1996. 79 80 CHARACTERIZATION OF CHANNEL CATFISH, ICTALURUS PUNCTATUS, POPULATIONS USING MICROSATELLITE LOCI Geoffrey C. Waidbieser U.S. Department of Agricuitme, Agricultural Research Service Catfish Genetics Research Unit P.O. Box 38 Stoneville, Mississippi 38776 Ph. (601)-686-5460 I FAX (601)-686-3044 Brian G. Bosworth U.S. Department of Agriculture, Agricultural Research Service Catfish Genetics Research Unit Introduction Commercial production of channel catfish, Ietalums puncfatus, exceeds that of other cultured food fish in the U.S. Over 445 million pounds offish were processed in 1995 (USDA, 1996). Increased commercial production has heen accomplished mainly by increased pond acreage and improved pond management Few, if any, production gains due to selective breeding programs have been realized by the industry. The USDA-ARS selective breeding program utilizes selection of families with superior performance in economically important traits such as growth rate, disease resistance, carcass yield, and spawning success. Identification of individual or related fIsh is necessary for efficient selective breeding and broodstock management, and for measuring traits such as individual spawning success, but the physical characteristics of channel catfish hinder identification. Catfish genetic selection will benefit from the development of genetic markers useful for identification and marker assisted selection. Microsatellites are a class of genetic markers in vertebrates that consist of short tandem repeat sequences flanked by unique DNA sequence (Weber, 1990; Hearne et al., 1992). Microsatellite loci are distributed widely throughout the genome, display high levels of allelic polymorphism, and the co-dominant alleles are easily and rapidly analyzed using the polymerase chain reaction and gel electrophoresis. Polymorphic microsatellite loci can be used for identification of individuals and for development of genetic maps to identify markers linked to loci affecting economically important traits. Microsatellite loci have been identified in several fish species (Goff et ai., 1992; Estoup et ai., 1993; Slettan et ai., 1993; Brooker et ai., 1994; Garcia de Leon et ai, 1995). Genome maps based on microsatellites are being developed for use in marker assisted selection of domestic animals for agricultural production (Bishop et al., 1994; Rohrer et ai., 1994; Cheog etai., 1995). The present research was designed to characterize microsatellite loci in channel catfish. Microsatellite loci were identified in clones of channel catfish genomic DNA, oligonucleotide primers were designed to amplify each locus using PCR, and length polymorphism of amplified alleles was detected by eleclIophoretic analysis. Ten loci were characterized in popuJations of 81 wild and domestic catfish, and 7 polymorphic loci were used to determine parentage of 6 spawns from a communally stocked pond. These sequence-defined loci will be useful for identification of individuals and families, development of catfisb genome maps, and for selection of genetically superior broodstock. Methods Short tandem repeat (microsatellite) loci were identified in plasmid clones containing channel catftsh genomic DNA. Recombinant clones were enriched for catfISh sequences containing tandem repeats using hybridization/selection with 5' -biotinylated AT~, GATA" CTG6, or AT~ oligonucleotides (Kijas et aI., 1994 ; Waldbieser, 1995). Selected clones were sequenced using an ALF DNA sequencer (pharmacia), and oligonucleotide primers were selected from sequence flanking the short tandem repeat region for PCR amplification of fragments ranging from 80-350 bp. Tissue samples were obtained from three populations of cbannel catfish. For population studies, a reference population ofwild channel catfish from the Mississippi River was obtained from commercial sources (Magnolia Fish Market and Fisherman's Wharf, Greenville, MS). Samples of domestic, fann-raised catfiSh were obtained as pre-hatching eggs from 5 commercial operations. For parentage determination, spawns were collected at the Catfish ~etics Researcb Unit from a 0.1 acre pond stocked with 17 females and 10 males of the USDA 103 strain. The spawns were collected in May 1995 and offspring were maintained in separate aquaria. Surviving broodstock (16 females, 8 males) were sampled in December 1995, and the offspring were sampled in February 1996. Three families of known parentage, produced by manual spawning of USDA 102 broodstock, were also used to assess Mendelian transmission of alleles. Pre-hatching embryos and barbel samples from adult fISh were processed for use in PCR reactions (Cui et aI., 1989) and stored at _20°C. Oligonucleotide primers from selected clones were used in polymerase chain reactions to screen the reference population for allelic polymorphism. After verification of positive PCR amplification of the locus by agarose gel electrophoresis, one of the oligonucleotide primers was resynthesized with a 5' fluorescent label (fluorescein or Cy5). Amplified DNA fragments were detected by automated laser fluorescence on an ALF® or ALFexpress® machine (pharmacia Biotech, Inc., Piscataway. NJ). After characterization of the range of allele size in each locus, multiplex loading of two or three loci was performed on some gels. Each electrophoresis run contained 1 or 2 standard allele wells for comparisons between gels. The allelic fragments obtained from PCR reactions of the reference population were analyzed for each microsa1ellite locus using Fragment Manager® software (pharmacia). Allele frequencies of ten loci were recorded for >50 wild fISh. Mendelian inheritance was analyzed in several families produced by experimental spawning of known parents. Heterozygosity was calculated from the allele frequencies in the wild popUlation (Hearne et aI., 1992)' Results Genomic clones containing tandem repeating nucleotide motifs were identified in the catfish genome. Fifty CIODes were identified by sequence analysis, 36 contained sufficient flanking DNA to synthesize oligonucleotide primers for PCR amplification. Twenty five clones produced PCR fragments of the expected size as visualized by agarose gel electrophoresis, and annealing 82 temperature for peR amplification was estimated by computer analysis and optimized empirically. One of the primers in the pair was resynthesized with a S' fluorescent label (fluorescein or Cy5) and the primer sets were used to genotype wild and domestic fish. Ten loci were selected for screening of populations of wild and domestic catfish for allelic polymorphism. Table 1. Microsatellite alleles in channel catfish Locus Repeat type No. alleles Allele sizes No. repeats Het No. fish IpOOI tri 13 206-213 7 -20 0.860 54 Ip002 tri 10 214-244 II - 22 0.847 53 Ip003 tetra 8 181-209 7 - 14 0.8ll 54 Ip004 tetra 9 132_156' 18 - 24 0.691 54 Ip005 tetra 7 105-133 8 - 16 0.6ll 54 Ip006 tetra 3 266-274 6 - 8 0.573 55 Ip007 tetra 9 299-339 7 - 17 0.850 53 Ip008 tetra 13 122-178 II - 25 0.868 57 Ip009 tetra 7 125-149 14 - 20 0.624 53 IDOI0 !Ii 8 204-2l9' 15 - 20 0.786 54 n .. Heterozygosity = 1 - ( L p/), where n = the total number of alleles and Pi is the i=l population frequency of the itb allele. b Other alleles at 194 and 198 bp. C Other alleles at 257 and 287 bp. Analysis of 50 individuals demonstrated loci that contained 3 to 13 alleles (Table 1). Two loci, Jp004 and JpO 10, contained alleles that lay outside the major allelic series. Locus Jp004 contained a continual series of7 alleles from 132 to 156 bp, and two outlying alleles at 194 and 198 bp. Locus JpO 10 contained a continual series of 6 alleles from 204 to 219 bp. and two outlying alleles at 257 and 287 bp. Six loci exhibited high levels of polymorphism (heterozygosity> 0.75), and 4 loci exhibited moderate levels (heterozygosity> 0.5) in the wild and farm populations. The farm populations appeared to contain as much heterozygosity as the wild populations (Table 2). Analysis of the two most polymorphic loci demonstrated the selected strain, USDA 103, maintained a high degree of heterozygosity with fewer alleles than the wild population (Table 2). Table 2. Heterozygosity of catfish populations for selected micro satellite loci. Miss.River, Farms" USDA 103 Locus Alleles Het. No. Fish ABeles Het No. Fish Alleles Het No. Fi§h Ip001 12 .860 54 13 .888 55 8 .888 98 Ip002 10 .847 53 10 .788 55 Ip003 8 .8ll 54 8 .842 56 Ip004 9 .691 54 7 .607 56 Ip005 7 .612 54 7 .629 56 Ip006 3 .573 55 3 .564 56 le008 13 .868 57 8 .779 104 .. One fish per spawn., avg. 9 spawns per farm. b Heterozygosity 83 Three USDA 102 famille!> with known parentage demonstrated Mendelian-inheritance patterns of allele!> from loci IpOOl-IpOlO. Mendelian inheritance of the microsatellite loci was used to determine parentage of several spawns taken from a communal pond. Barbel samples were obtained from fmgerlings of six spawns in pond A4. All surviving broodstock and eight offspring per family from pond A4 were genotyped using the three most polymorphic loc~ IpOOl, -007, and -OOS. Offspring from spawns 6 and 7 had been mixed in one aquaria after hatching. Genotypes of spawns 6 and 7 were differentiated after genotype analysis with IpOOS. Parents were identified for spawns 7 and 8 after analysis with Ip008 and IpOOl, and for all spawns after analysis with Jp008, JpOOI, and Jp007 (Table 3). Fwther screening with Jp002, -003, -009, and - 010 confumed the parental genotypes. The two deceased males from pond A4 were assumed to be the parents of spawns 4 and 5 because none of the sampled males fit the deduced paternal genotype. Allelic variation in loci IpOOl, -002, -003, -007, and -008 from deduced maternal genotypes of the 6 spawns provided 90,000 potential genotypes in the population offemale broodflSh. Therefore, it is unlikely the female missing from pond A4 had the same genotype as one of the detected parents. Genotype analysis demonstrated multiple parentage by one male in the pond, and his two spawns were collected 7 days apart. A fish with a genotype corresponding to spawn 3 was found in the sample of spawn 4, presumably due to the fish jumping between adjacent aquaria during rearing in the hatchery. Table 3. Number ofbroodstock: included as possible parents of 1995 spawns from pond A4 after sequential screening with Ip008, Ip001, and Ip007. Jp008 JpOOI Jp007 4locil. Spawn F M F M F M F M 3 6 3 6 I I I I 4 7 I I 0 I 0 0 5 3 2 3 I I 0 0 6 6 2 I 2 I I 7 I 2 I I I 8 3 3 I Allelesb 7 8 4 I. Offspring pools and parents were screened with Ip002, 3, 9, 10 for verification. b Number of alleles per locus in 9 dams and 15 sires from pond A4. Discussion Microsatellite loci were identified in the channel catflSh genome and used to characterize levels of allelic heterozygosity in catfish populations and determine spawn parentage in a communal pond. Tri- and tetranucleotide repeat loci were chosen rather than dinucleotide repeat loci, due to better resolution of alleles and lack of sbltter bands in the electrophoretic analysis (Hearne et al., 1992). Tissue biopsy and sample preparation were simple and rapid. Outbred and selected catfish populations demonstrated high levels of allelic heterozygosity at several loci. Microsatellite-based genotypes provided characterization of alleles from individual loci that were defmed by unique DNA sequence. 84 The present research demonstrated the utility of the microsatellite markers for determination of spawn parentage in a communal pond. Parentage of spawns within a select population of fish, with presumed narrowing of DNA sequence diversity, was determined by a maximum of three loci and verified with several more. Many spawns were determined with only two loci, and this technique provides a rapid, efficient method for determining parentage and scoring individual fish for spawning success. This analysis demonstrated multiple spawning by a male and also that one or two spawning males did not dominate the pond, thus narrowing the genetic diversity of the population. The microsatellite-based genotype assay demonstrated much higher levels of allelic polymorphism than isozyme loci in channel catfish (Cannichael et al., 1992). Unlike isozyme characterization, which is limited to gene coding sequences which make up a small proportion of animal genomes, microsatellite genotyping detects DNA sequence variation throughout the genome. The micro satellite assay is rapid, and can be performed with minimal, non-invasive tissue sampling. High levels of micro satellite allelic variation allow rapid identification of individual fish. For example, using only six loci (IpOOl,-002,-003,-007,-008, and -010) to screen spawns 3 and 6 of pond A4, we could identify 2,916 and 5,832 potential composite genotypes within each full sib family, respectively. While loci with the most polymorphic alleles were used to identify fish within a strain, loci with less polymorphism may be more useful for identification of fish between strains. Use of microsatellite loci will be fundamental in efforts to identify and select genetically superior catfish in selective breeding programs, and in efforts to identify and manage genetically improved stocks released to commercial producers. High levels of microsate1lite allele heterozygosity in catfish populations will assist efforts toward the establishment of linkage and physical maps of the channel catfish genome. These maps will assist researchers in the identification of quantitative trait loci that affect economically important traits, especially traits that are difficult, costly, or time consuming to measure. Acknowledgements The authors thank: Dr. William Wolters for helpful discussions and manuscript review, and Marjorie Jennings for technical assistance. We also thank Charles Horton ofMagoolia Market and Alan Ford of Fisherman's Wharf for access to wild catfish. Mention of a trade name, proprietary product, or specific equipment does not constibJte a guarantee or warranty by the US. Department of Agriculture and does not imply approval to the exclusion of other products that may be suitable. References Bishop, MD and 10 co-authon 1994 A genetic linkage map for cattle. Genetics 136:619-639. Brooker, AL, D Cook, P Bentzen, 1M Wright, and RW Doyle 1994 Organization of microsatelJites differs between mammals and cold-water teleost fishes. Canadian Jownal of Fisheries and Aquatic Sciences 51:1959-1966. Carmichael, GJ, ME Schmidt, and DC Monzot 1992 Electrophoretic identification of genetic marken in channel catfish and blue catfish by use of low-risk tissues. Transactions of the American Fisheries Society 121:26-35. 85 Cheng, HH and 6 co-authors 1995 Develop of a genetic map of the chicken with markers of high utility. Poultry Science 74:1855-1874. Cui, X and 6 co-authors 1989 Single sperm. typing: Determination of genetic distance between the Gg-globin and parathyroid hormone loci by using the polymerase chain reaction and allele specific oligomers. Proceedings of the National Academy of Science, USA 86:9389-9393. Estoup, A, P Pres., F Krieg, D Vaiman, and R Guyomard 1993 (CT), and (GT), microsatellites: a new class of genetic markers for Salmo frutta L. (Brown trout). Heredity 71 :488-496. Garcia de Leon., FJ and 5 co-authors 1995 Development and use of micro satellite markers in sea bass, Dicentrarchw labrax (Linnaeus, 1758)(perciformes: Semmdidae). MolecularMarine Biology and Biotechnology 4:62-68. Goff, DJ and 5 co-authors 1992 Identification of polymorphic simple sequence repeats in the genome of the zebraftsh. Genomics 14:200-202. Hearne, eM, S Ghosh, and JA Todd 1992 Microsatellites for linkage analysis of genetic traits. Trends in Genetics 8:288-294. Kijas, Th1H, JCS Fowler, CA Garbett. and MR Thomas 1994 Enrichment of micro satellites from the citrus genome using biotinylated oligonucleotide Sequences bound to streptavidin coated magnetic particles. BioTechniques 16:656-662. Rohrer, GA, LJ Alexander, JW Keele, TP Smith, and CW Beattie 1994 A microsatellite linkage map of the porcine genome. Genetics 136:231-245. SIettan, A, I Olsaker, and 0 Lie 1993 Isolation and characterization of (GT)1l repetitive sequences from Atlantic salmon., Salmo saJar L. Animal Genetics. 24: 195-197. USDA (U.S. Department of Agriculture) 1996 Farm Raised Catfish Processor Report. National AgriculbJral Statistics Service, AgriculbJral Statistics Board, USDA, AQ-I, January 1996. Waldbieser, GC 1995 peR-based identification of AT-rich tri- and tetranucleotide repeat loci in an enriched plasmid library. BioTechniques 19:742-744. Weber, JL 1990 Informativeness of human (dC-dA)n.(dG-d1)npolymorphisms. Genomics 7:524-530. 86 UTILITY OF RIBOSOMAL DNA ITS2 FOR DERIVING SHARK SPECIES-DIAGNOSTIC IDENTIFICATION MARKERS M. Sbivji Nova Southeastern Univmity, Oceanographic Center, 8000 N. Ocean Drive, Dania, FL 33004, USA Phone:954-920-1909; Fax:305 947-8559;email:[email protected] . I 2 2 3 I C. Tagliaro • L. Natanson • N. Kohler. 8.0. Rogers. M. Stanhope lQueen's University. N. Ireland. UK; ~ational Marine Fisheries Service, 3 NOAA, Nanagansett,RI; SUNY, ESF, Syracuse, NY; Introduction The commercial and recreational shark fishery in the United States has increased sharply since 1979. This increased fishing pressure, the large shark bycatcb in some other fisheries. and apparently declining shark populations bas prompted much concern about the sustainable health of shark. resources (Musick et aI .• 1993; NMFS, 1993). In response to such concerns, the National Marine Fisheries Service (NMFS) bas developed the Atlantic Shark FISheries Management Plan (NMFS. 1993) which proposes to manage shark resources on the basis of three species assessment groups. Delineation of these assessment groups (i.e., large coastal sharks, small coastal sharks, and pelagic sharks) is based in large measure on the type of fishery conducted, and has little population ecology relevance. 1bis management scheme has been forced by the lack of appropriate fisheries data on which to base formulation of species or population-specific management measures. A major factor contributing to the lack of appropriate data is the difficulty of accwately identifying landed sharks to species level. lbis difficulty arises from the morphological similarity of many commercial species, and the necessity of dressing the sharks immediately after capture to preserve the quality of the flesh and use the least amount of on-board storage space (Castro, 1993). Dressing the sharks usually involves removal of the head, guts and fins, leaving carcasses called "logs" for transport to port. 'This practice results in removal of the most useful species-diagnostic morphological characters (head, teeth, fins), making specific identification of the "logs" difficult for port-side fishery observers (Castro, 1993). For example, most sb.arks landed in the commercial fisbery are misclassified or recorded as "unidentified sharks", resulting in large errors in the species-specific landings and population abundance data (NMFS, 1993). Collection of species-specific catch data is pivotal to development of effective shark management plans. Toward this end. and in view of the identification problems outlined above, we are investigating the development of nuclear DNA-based markers that might be used for the accurate and relatively rapid, species-level identification of shark carcasses and tissues. We report here our initial findings on the utility of the nuclear ribosomal repeat internal transcribed spacer (ITS2) fur deriving species-diagnostic markers. Our data indica1e that the ITS2 locus has low intraspecific sequence variation, but sufficient interspecific polymorphisms to yield robust diagnostic markers, even for closely related shark taxa. , 87 Materials and methods We examined six species (CarcluJrhinus leucQS-{)ne individual, C. ObscunlS-{)oe individual, C. plumbeus-{)ne individual, C.jakijormis-{)ne individual, C. brevipinna-{)ne individual, and Prionace glauca-four individuals) in this srudy. The sbarks were collected. by a combinaJion of long-line fishing along the length of the U.S. east coast and Gulf of Mexico. and from recreational shark fishing tournaments held in the northeastern U.S. All sharks were identified by NMFS scientists. Genomic DNAs were extracted from liver tissue stored in SED buffer (saturated NaCl, 250mM EDTA pH 7.5, 20% DMSO) using standald methods. The ribosomal repeal ITS210cus (Figure I) was amplified using the polymerase chain reaction (PCR) and primers obtained from Phillips et aI., (1994). Amplification followed standard protocols and a thermal profile of 94°C fur 1 minute, 5SOC for 1 minute. and nOc for 2 minutes. Amplified ITS2 products were directly sequenced using dye deoxy terminator cycle sequencing and loaded onto an Applied Biosystems 373A automated sequencer following the manufactwer's recommendations. Additional internal sequencing primers were designed as necessary. To confirm the sequences, we sequenced both strands at least twice. The ITS2 sequences were aligned by eye using the ESEE sequence editor of Cabot and Beckenbach (1989). Restriction site analysis was pedormed using the computer program DNASIS version 2.0 (Hitachi Software Engineering America. Ltd). Species-specific PCR primers were derived by examining the sequence alignment for regions of nucleotide polymorphisms, including insertions and deletions unique to eacb shark species. 188 5.88 288 IT81 IT82 Figure 1. Organization of ribosomal DNA showing location of the ITS2 region. Arrows indicate region sequenced. Results The ITS2 region in the six carcharhinid sharks is large, ranging in size from 1320 to 1380 base pairs (bp). To our knowledge, this size range is the largest reported for any organism. The shark ITS2 sequences were easily aligned since there is a bigh degree of sequence conservation among the taxa, with the most frequent polymorphisms consisting if insertions and deletions. To gain an initiaI measure of intraspecific sequence variation, we obtained ITS2 sequences from four P. glauca individuals, all collected from shark. tournaments in the northeastern U.S. The four P. glauca sequences were nearly identical over the approximately 1340 bp, with the exception of a few, single nucleotide insertions or deletions, generally in regions of repeated nucleotides. The program DNASIS revealed that the shark ITS2 regions have species-specific restriction endonuclease recognition sites. Restriction maps of the ITS2 for three diagnostic, commonly available, inex.pensive enzymes were derived directly from analysis of the DNA sequences (figures 2 and 3). The restriction fragment sizes that would be produced by digestion of the amplified ITS2 PCR product are given in Table 1. Each enzyme produces species-diagnostic, restriction fragment length polymorphism (RFLP) profiles for each of the six taxa 88 AT II P. glauca 1 'P P. glauca 2 'P P. glauca 3 'P P. glauca 4 'P C. faucas " " " " C.obecurUB " " " C. plumbeus ~1 ______~ " ______-3~ " ______~~~~ " " C. falclformls ~1 ______.3II~ - ______-3~~L.. " " ______--I C. brevlplnna ~I ______~'P ____~ " ______-'"--"~ " 'P ______--I Gtoi y y P. glauca , I " " P. glauca 2 'P " " y P. glauca 3 Y 'P 'P " P. glauca 4 " " " " Y C. faucss .' " " y y y C.obscurus •• " C. plumbeue .' 'P Y 'P 'P 'P C. falclformls .- Y " " " C. bravlplnna .- " " Figure 2. Restriction sHe maps of shark nuclear IT52 regions. The restriction endonucleases used are given above the map. Triangles represent cut sites in the IT52 of each species. 89 Rsal P. glauca 1 ...... P. glaucB 2 ...... P. glauca 3 ... y P. glauca 4 y y y y C.lsueas ... y y C.obscunJS 1------...::!!:-----3I:IE--I.. - C. plumbeus 11------yZ-----y:L::Iy'--I C. falcl10TTnIs 1.. ______-'yL::IyE--I C. bravlplnna 1..______-'yL ______...Z-.::I ...E--I Figure 3. Restriction site maps of shark nuclear IT82 regions produced by the restriction endonuclease Rsal. Triangles represent cut sites in the IT82 of each species. Table 1. Sizes of restriction fragments prOOuced by digestion of peR amplified rrS2. Balded fragment sizes are exact, as detennined from the DNA sequence. Fragment sizes Dot balded are approximate, and make up the ends of the ITS2 PCR product. Species IUaI Cfo! AfII P. glaJlca 960,228,160 563,444, 140,108,95 800,550 C.leucas 500,409,236,142, 63, 561,289,281,125,75,22 550,270,160,241,128 C. ObSCUTUS 920, 311, 90, 28 578, Z39, 227, lOS, 100, 75, 535, 388, 270, 157 22 C.plwnbeus 920, 240, 63, !30 579, 207, 186, 107, 105, 75, 537,359,280,91,85 70,22 C.falciformis 1150. 135, 64 471, 351, 211, 110,109,75,22 507, 44D, 280, 113, 16 C. brevipinna 648, 500, 135. 6S 575,564,110,75,24 440,369,270,160,110 90 To allow a second and perhaps simpler approach to species identification, we examined the sequence alignment for regions containing insertions and deletions unique to each species. These regions were used to design oligonucleotide species-specific, internal PCR primers that should produce an amplification product only if DNA from a specific target species is present For example, at high annealing temperatures, the P. glauca primer will only amplify DNA from P. glauca, and not the other species, producing an approximately 350bp peR fragment. The primer sequences and approximate PCR fragment size produced are given in Table 2. We have designed each primer such t.har: the nucleotides unique to each species are positioned primarily at the 3' end of each primer, the region most critical for proper primer annealing and successful amplification. Using this strategy, we were able to design species-specific primers for all six species. The closest "competitor" sequence, i.e., the most similar sequence in that region of the ITS2 from another species, is also given for comparison in Table 2. Table 2. Internal primers specific for each species. Blank spaces beneath each primer in the competitor sequence indicate identical sequence to the one above it Species Internal primer sequence approximate PCR fral!lllent size P.glauca S'GCAcrcCITGGCfCAGTCCfAG3' 3S0bp closest "comoetitor" seauence GAG A GTC Cleucas S'TCCATCCCCCfGGG TGCfGGAA3' 700bp closest "comnetitor" seauence T G T T GTGCfTGC C obscurus 5'CCCACCfTTTGGCGCGAGTAC3' 400bp closest "comnetitor" ~uence T G T A ACC TG C.plumbeus S·TGGGTGCTTGCAGTCfCGCCf3' 700bp closest "comnetitor" ~uence A TGC C.falcifonnis S'GGCCAGGGTCGAATCfCTTGT3' !030bp closest "comoetitor" seauence T TTCCCfTCGG TGG C C brevipinna S'TCGTTCCCITGGGTGCfGCG3' 700bp closest "comnetitor" seauence C A C G TGCfG AA Discussion The large ITS2 locus in sharks has sufficient variability in DNA sequence to provide robust. species-diagnostic markers, even for the closely related species examined in this study. Our preliminary estimate of intraspecific variation at this locus in four P. glauca individuals indicates that this locus may be higbly conserved within a species, and therefore may not pose a problem for deriving species-diagnostic markers. We note. however, that the four P. glauca individuals were all coUectecl from north eastern U.S. waters, within a three month sampling period. It is possible that more sequence variation might be observed in individuals collected from putatively different populations. We are continuing to explore this issue of intraspecific variation in P. glauca and other sharlc species collected from different geographic areas. The evidence so far, however, suggests that intraspecific genetic variation in sharks is generally low (Smith, 1986; MacDonald, 1988; Martin, 1993). 91 There are several advantages to using DNA sequence data for deriving species-diagnostic markers. The availability of sequences allows the development of multiple approaches for species discrimination, two of wroch are addressed in this paper: The analysis ofRH..P profiles is technically straightfOIward, requiring isolation of genomic DNA from the unidentified sha.rk, PCR amplification of the ITS2 locus, and digestion of the ITS2 PCR product using restriction endonucleases that produce species-diagnostic RFPL profiles. The RFLP profiles produced can be compared to a catalog of RH..P profiles for each species, enabling identification of the unknown sample. An alternative approach to species identification involves using the species-specific PCR primers (fable 2) in • technique known as multiplex PCR (Edwanls and Gibbs. 1994). This approach requires genomic DNA isolation from the unidentified shark. followed by PCR amplification using three primers simultaneously in a single reaction: i.e., the two "universal" external primers used to amplify the entire ITS2 region, plus one species-specific, internal primer (Fell, 1993). With this approach. the absence of a specific target DNA will result in amplification of just the large ITS2 region. In contrast, in the presence of specific target DNA, a smaller fragment primed by the species-specific internal primer and one external primer will be amplified (Fell, 1993). This multiplex PCR approach eliminates the additional step of restriction endonucl~ digestion required by the RFlP approach. The external primers also serve as a positive control for the integrity of the amplification reaction components; i.e., absence of both the large ITS2 and smaller, species-specific amplified product would signal that the reaction components needed to be checked. In addition to the two approaches discussed here, the aVailability of sequence data also allows the design of species-specific oligonucleotide hybridization probes (Levesque et al., 1994), and phylogenetic approaches (Yan et aI., 1995) for species identification. Genetic approaches to difficult species identification problems are becoming widespread in the medical and agriculOJral arenas, and should be directly applicable to fisheries and marine ecological studies. We are cwrently expanding our database of DNA sequences from additional fish taxa to facilitate the design of species-diagnostic markers and application of genetic approaches to long-standing problems in the identification of fisbes. References Cabot, EL., and Beckenbach, AT. 1989 Simultaneous editing of multiple nucleic acid and protein sequences with ESFE. Compo Applic. BioSci. 5:233-234. Castro, n. 1993 A field guide to the sharks commonly caught in commercial fisheries of the soulheastern United States. NOAA Technical Memorandum NMFS-SEFSC-338. Edwards, MC., and Gibbs, RA. 1994 Multiplex PCR: Advantages, development, and applications. PCR Methods Applic. 3:565-575. Fell, IW. 1993 Rapid identification of yeast species using three primers in a polymerase chain reaction. Mol. Mar. BioI. Biotech. 2(3): 174-180. Levesque, CA., Vrain, TC., and De Boer, SH 1994 Development of a species-specific probe for Pyrhium ultimwn using amplified ribosomal DNA. Phytopathology 84:474478. MacDonald, CM. 1988 Genetic variation, breeding structure and taxonomic status of the gummy sbark Mustelus antarcticus in southern Australian waters. Aust J. Mar. Freshwater Res. 39:641-648. 92 Martin. AP 1993 Application of mitochondrial DNA sequence analysis to the problem of species identification of sharks. In: Conservation Biology of Elasmobranchs. S. Branstetter (ed.). NOAA Technical Report NMFS 115. Pgs. 53-59. Musick. IA.. Branstetter. S .• and Colvocoresses, IA 1993 Trends in shark abundance from 1974 to 1991 for the Chesapeake Bight Region of the u.s. Mid-Atlantic coast. In: Conservation Biology of EIasmobranchs. S. Branstetter (ed.). NOAA Technical Report NMFS 115. Pgs. 1-18. NMFS, 1993 Fishery Management Plan for Sharks of the Atlantic Ocean. Prepared by the NMFS, NOAA. u.s. Department of Commerce. pp 168+appendices. Phillips, RB .• Manley, SA, and Daniels, TI. 1994 Systematics of the salmonid genus Salvelinus inferred from ribosomal DNA sequences. Can. J. Fish. Aqua!. Sci. 51(Suppl.l):198-204. Smith. Pl. 1986 Low genetic variation in sharks (Chondricthyes). Copeia 1:202-207. Yan. ZH .• Rogers, SO., and Wang, CJK.. 1995 Assessment of PhiaJoplwra species based on ribosomal DNA internal transcribed spacers and morphology. Mycologia 87:72-83. 93 94 PHYLOGENETIC ANALYSIS OF HAPLOCHROMINE CICHLID TAXA UTILIZING HETERODUPLEXTE~QUES WenruiDuan Depl of Zoology The Ohio State University, Columbus, OH. (614)292-4570 [email protected] IGregory C. Booton. q.es Kaufmam, 'Paul A. Fuerst IDept. of Molecular Genetics, The Ohio State University, Columbus, OH. ZOept ofBioiogy, Boston University, Boston MA. INTRODUCTION The cicblid species flocks of the Great Lakes of Africa represent some of the most remarkable events of explosive speciation ever docwnented in vertebrates (Mayr 1984, Stiassny 1991). The endemic hapiochromine species flock of Lake Victoria, shows extraordinary morphological and ecological diversity (Greenwood, 19842, 1984b and refs therein) despite a monophyletic origin postulated as being not older than 225,000 years BPE (Meyer et. aI. 1990, by mtDNA clock), and possibly less tlum 14,500 years old, ifthe lake in filet dried out completely as is currently suspected (Stager et ai., 1986). The detailed nature of the evolutionary relationships among the hundreds of recently divergent species, as well as the evolutionary position of the group with respect to other species of Cichlidae, is an area of active investigation. The short evolutionary time period for the group makes molecular analysis difficult, since only the most rapidly evolving sequences will provide phylogenetic information. The determination of a robust phylogeny for the endemic taxa of Lake Victoria is the last major obstacle to its use as a powerful inmument to study the mechanics of vertebrate evolution. For Lake Victoria Region (LVR) cichlids, morphological, behavioral, and paleontological data have been used to estimate phylogenetic relationships (Van Couvering. 1982, Dominey. 1984, Greenwood, 1991, Lippitsch, 1993). More recently, protein and nucleic acid sequences have been combined with morphological data to investigate cichlid relationships in the African Great Lakes (Sage et ai., 1984; Meyer et ai., 1990; Sturmbauer and Meyer, 1992, 1993; Ono et ai., 1993). These studies have shown the difficulty of identifying sequences of use for discrimination among the recently divergent taxa of Lake Victoria. The choice ofa genomic region fur molecular analysis depends strongly on the suspected time since divergence of the groups being studied. In the case of the Lake Victoria fish faWl8 critical time windows are likely to include: 5000 years or less for recent speciation events (peripheral satellite lake differentiation). around 12000 years for events following reflooding of the lake basin following the most recent desiccation event, and up to several hundred thousand years for initiation of the regional fauna and origination of the major component clades (Meyer et al. 1990, Kaufman ms.). To be useful, a genetic region must accwnulate changes to yield measurable genetic differentiation with sensitivity geared toward such critical time windows, which can only be guessed in advance. Mitochondrial DNA sequences have been used extensively for studies of fish at both intraspecific and interspecific levels because of the rapid evolution of the mitochondrial genome (Brown 1985). 95 However, within Lake Victoria, the analysis of mtDNA sequences, though informative as to the very early divergence of this fauna from the ancestm1 stock, failed to provide insight into the phylogenetic patterns among taxa that subsequently evolved within the species flock (Meyer et al., 1990). Several mpidly evolving nuclear gene markers exist, but each has potential drawbacks for phylogenetic studies. Hypervariable VNTRloci and microsatellite STR (short tandem repeat) loci can acquire variation primarily by recombination or replication slippage, rather than by point mutations (Jeffreys, et a1., 1985). They could actually evolve too mpidly to be useful for phylogenetic studies, even among species as closely related as the ones considered here. For classical point mutation processes, identification of traditional nuclear restriction fragment length polymorpbisms (RFLP) is laborious, and polymorphisms are often too rare or species-specific to be useful (Aviso, 1994). Comparison of the rates of nucleotide substitution for various gene segments (Li, et al., 1985, Gillespie, 1986) suggests that sequences such as introns, with reduced coding constraints, may accumulate changes rapidly enough to warrant study. These sequences are among the most rapidly evolving regions of nuclear genomic DNA, thus having the potential to accumulate changes in sequence very soon after populations diverge. Included by analogy in the class of noncoding sequences are the internal transcribed spacer (ITS) sequences located between the ribosomal RNA genes. The target of this study is the first internal transcribed spacer (ITS 1) of the ribosomal gene cluster. The ribosomal gene cluster consists ofrepeat units, each containing one 18S, 5.8S, and 28S rRNA gene. Between these genes lie internal transcribed spacers: ITS 1 between the 18S and 5.8S genes, and ITS 2 between the 5.8S and 28S genes. The entire block of genes and spacers is transcribed as one unit, after which the spacers are removed in RNA processing. Adjacent cluster repeats are separated by non-transcribed (NTS) spacer regions. The ITS 1 sequence occurs in a conserved location within adjacent genes, flanked. by relatively conservative rRNA gene sequences, thus it is possible to develop primers for PCR This provides a technlque to rapidly identify, amplify and analyze the spacer from a large number of individuals from different genera and species. This approach has already proven useful in a variety of organisms ([orres, et al., 1990, Baldwin, 1992, Cordese, et aI., 1993; Soltis and Kuzoff, 1993; Volge, and DeSaIle, 1994). The ITS I has recently been used in the study of close species relationships in salmonid taxa (pleyte, et al., 1992). In earlier studies we amplified and sequenced fifteen species of East African cichlid fishes at the ITS 1 locus (Booton. 1995). While informative, the levels of variation were low in the ITS 1 in LVR taxa, with some species containing identical ITS 1 sequences. To mpidly screen a larger sample of species (up to 600+ species are hypothesized to be located in the LVR. LK., in prep) we are now utilizing heteroduplex screening prior to full sequence analysis of this region (Sorrentino et al., 1991). Here we present initial results of the examination of the ITS 1 sequences by heteroduplex screening of this region in other LVR taxa Results using this method are presented. This methodology alIo'WS us to rapidly screen greater numbers of taxa for possible variation at the ITS 1 locus prior to sequence analysis. MEmODS AND MATERIALS Taxa: The species included in the first round of ITS 1 sequence analysis included two tilapiines: Oreochromis niloticus (a widespread species) and Oreocluomis esculentus (an endemic to the Lake Victoria basin). Also included were the widely distributed Pseudocrenalabrus multicolor (we examined the LVR subspecies, P. m. victoriae); Astatoreochromis alluaudi (as the LVR representative of a genus that extends south to the Lake Tanganyika Basin); As/atolilapia burtoni (a representative riverine haplocbromine from the Lake Tanganyika Basin); and Asla/otilapia nubi/a, a widespread, generalized LVR taxon. Finally, we examined a series of LVR lacustrine endemics: Lipochromis taurinus a paedophage from Lake Edward; (Harpagochromis) "kachira deep", Yssicluomls fusiformis and Y. laparogramma , zooplanktivores from Lake Victoria; 96 Neocluomis nigricans and the undescribed (Neocluomis) nkruising", epilithic algal scrapers from Lake Victoria; Ptyocluomis xenognathus , an oral sheller from Lake Victoria; Xysticluomis phytophagous, B macrophyte eater from Lake Victoria (our specimens drawn from the refugiwn in Lake Kanyaboli, Kenya); and the undescribed (Paralabidocluomis ) "rock kribensis", an invertebrate eater from Lake Victoria. Additional taxa which were used the initial heteroduplex analysis included: (psammocluomis) "consteUation", Haplocluomis ''baned pygmy", Garuocluomis angustifrons, and Pyxichromis orthostoma. Genera for the undescribed forms are listed parenthetically because their placement is a proposal pending further investigation (Kaufinan, in prep.); they will be referred to in this paper using their proposed generic classification, with temporary species names. All material was collected through the efforts of the Lake Victoria Research Team, involving the authors and researchers of several other institutions. Identifications are by LK through comparison with other voucher specimens All wild caught specimens of East African cichlids from which DNA was obtained were deposited as voucher samples in the fishes collection of the Muzeum of Comparative Zoology, HaIVaro University. DNA Preparation, PCR Amplification and DNA Sequencing. Field collected material was preserved in 9S% EtOH. changed after one hour, until DNA could be extracted in the laboratory. DNA was extracted from muscle tissue which was excised from the right epaxial musculature of each specimen. To prepare for DNA extraction, tissue was sheared by razor blade in the presence of ABI lysis buffer (Applied Biosystems Inc., 0.1 M Tris, 4M Urea, 0.2M NaCI, 0.01 M CDTA, and O.S% n-Iaurelsarcosioe). Chopped tissue was placed in a I.S ml centrifuge tube to total volume of Iml, and lOll] ofa 20mglml solution of proteinase K was added. Samples were incubated overnight at SOD C. Following digestion, DNA was extracted by two phenoVchloroform, and one chloroform extraction. DNA was precipitated by addition of2 volumes of 9S% EtOH, followed by a 70% EtOH wash. DNA was quantified by spectroscopy and quantifications were confirmed by electrophoresis on a 1% agarose gel. The location of the ITSI sequence within the rRNA gene region, as well as primer locations used for amplification, heteroduplex, and sequencing are shown in Figure I. Primers used in the study of ITS 1 are summarized in Table 1. Ribosomal RNA ITS 1 amplifications were performed as follows: 100 ng of genomic template DNA was added to each reaction mixture (final volume 100111) which contained 10pM of each amplification primer, 2.SmM MgC12, I.SmM dNTP's, and 1-2.SU Taq DNA Polymerase (proMega Corp.). A number of combinations offorward and reverse primers were used for complete ITS 1 amplification, although the greatest success was obtained using primer combination 1712C and ITS2, Primer pair 236C-1TS and ITS2-Cln was used to amplify the 3' half of ITS 1 for the initial heteroduplex analysis. The PCR reactions were carried out as follows: denaturation at 94° C for lmin., annealing at SO-S2°C for 1.S min., and extension 8172 'C for 3 min., 3S cycles. Reactions were performed in a Perkin Elmer Cetus PCI thermocycler. 10lll of PCR products were electrophoresed on a 1% agarose gel to determine size and approximate quantity before sequencing. Separate PCR reactions from the same individual. which produced bands of the expected size were pooled. The PCR product pools were either used directly for sequencing or cloned by TIA cloning using B commercially available T/A cloning kit following manufacturers instructions (Invitrogen, Inc.; Marchuk, Mitchell, and Collins. 1991). Sequencing was performed using the dsDNA Cycle Sequencing System (BRL Inc.). Sequencing gels were scored. manually. 97 Table 1. Internal Transcribed Spacer One Amplification and Sequencing Primers. Primer sequence 5'->3' Forward Melting Point °C !Reverse 1262C gtggtgcatggccgttctta Forward 55.7 1262C-CID gcggatccgtggtgcatggccgttctta Forward 73.7 1712C agcgccgagaagacgatcaaa Forward 58.6 Iff cacaccgcccgtcg Forward 49.3 SSU2C gtgaacctgcggaaggatca Forward 54.8 236C-ITS ggaccgtggctcgttgg Forward 54.3 538RE-ITS ttgccacattcgtagacggg Reverse 55.8 ITS2 gctgcgttcttcatcgacgc Reverse 58.1 ITS2-CIn cgaagcttgtcgacgctgcgttcttcatcgacgc Reverse 78.1 Gel preparaton. Agarose Gels: Agarose gels of2.5% were used for preliminary agarose heteroduplex analysis. Gels were 1Scm x ITS2, 15cm. Electrophoresis was carried out at ITS2-CID 180 Volts for 3.5 hours. Gels were 538RE-ITS stained in an Ethidium Bromide solution 18S rONA (3mgIL) for 15 minutes prior to ITSI·517b photography. I SSU2C 236C'ITS 5.8S rDNA Iff 17I2C Heteroduplex gels: Gel plates were I'1262C assembled according to manufacturer's Fig. 1. ITS I instructions. Sequagel:MD (National ITS I sequencing and amplification primers. Diagnostics, Inc.) solution was supplied Primers below are forward primers, those above as a 2X liquid concentrate. A 40cm x are reverse primers. eln designation on primer 30cm x Imm gel requires approximately is a cloning primer. Spacer size is given for a 150mls ofa IX gel solution. A 19 cm x represenative taxa, Astatoreochromis alluaudi. 16 cm x Imm gel requires approximately 36 mls. We recommend the use of 19 em x 16 cm gel if PCR products are approximately 300 bp. Beteroduplex and homoduplex preparation For heteroduplex production, two different PCR products were mixed by combining 4 ml of each PCRproduct into a 0.75 m1 microcentrifuge tube with 7111 of deionized water, and overlayed with a drop of mineral oil. DNA was then denatured and renatured as follows: 96 0 C for 5 min, 550 C for 10 min, 450 C for 10 min, 370 C for 10 min, 260 C for 15 minutes or more. Next, 3 ill of loading buffer was added. As controls, two homoduplexes were used in these experiments: 1) a mixture of 98 two peR products from the same individual that was processed through the melting and re-annealing cycles and 2) a reaction that contained the same mix but '\NBS not processed through the melting and reannealing cycles. Electrophoresis 1 I.d of gel loading buffer '\NBS added for eacb 5 III of reaction mixture. Finally, for a 40 em x 30 cm gel, 6 III of the heterolhomo duplex mixture was loaded into the wells. When using a 19 cm x 16 cm gel, 31Jl of the mixture '\NBS loaded. One lane Vf8S loaded with 5 I.ll (for 40 cm x 30 cm gel), or 1.51.d (for 19 cm x 16 cm gel) of the positive control (AT Biochem product), and one lane with a 1 kb DNA marker (Life Technologies Inc.). For a 40 cm x 30 cm gel: Pre-running Vf8S for 30 min at 800 V. Samples were then electrophoresed for 16hoUIS. Fora 19 crnx16 cmgel: Pre-running was for 30 min at 360 V, followed by loading and running for 4 hours. The gel was stained in 0.6 x TBE, 3mgIL ethidium bromide for 10 minutes, and the gel was then exposed to UV light to visualize the DNA banding pattern. The gel was photographed using a video imaging system. Phylogenetic Data Analysis: The primary sequences from the taxa in this study were aligned using the sequence alignment program Eyeball Sequence Editor (ESEE) for the PC (Cabot and Beckenbach, 1989). This alignment was used to produce data sets which were suitable for analysis is PAUP and MEGA (Swofford, 1990, Sudbir, et al., 1993). Phylogenetic analyses which used distance methods were done using the computer program MEGA. Within MEGA the conected proportion of nucleotide substitutions were estimated using the Kimura two parameter model. Distances derived by this method were then used to produce a pbylogenetic tree by the neighbor joining algorithm. Maximum parsimony analysis was also performed. on the data using the cladistic analysis program PAUP. as well as using the maximum parsimony option in MEGA. Bootstrapping of the data '\NBS performed in MEGA and PAUP to examine the consistency of the data. RESULTS Full sequences onTS 1 were obtained for two tiiapiine and thirteen haplochromine cicblid species. The aligned ITS region spans 553 bases, although most taxa have an ITS 1 between 509-512 nucleotides in length. Variation in overall size was due to multiple insertion/deletion (indels) events. In initial ITS 1 sequencing no differences were observed between the two species of Oreochromis, or between Xystichromis and Pryochromis. This alignment was used to calculate the corrected proportion of nucleotide substitutions using the Kimura two parameter model. Distances were also calculated considering only the transition and transversion changes in data. Trees produced from these different data sets had the same gross topology as that shown but were less well resolved due to data truncation. The calculated distances were used to produce a phylogenetic tree using the neighbor-joining (NJ) algorithm in MEGA, with 1000 bootstraps (Saitou and Nei, 1981). As representatives of the subfumily Tilapiinae within the African Group ofStiassny's cichlid phylogeny, (Stiassny 1991), the two Oreochromis species were defined as the outgroup for an analysis of the other taxa P. multicolor showed the most divergence from the main group of Lake Victoria haplochromine species, due to the accumulation of nine unique nucleotide substitutions compared to all other taxa. Although the level of resolution Vf8S low using distance methods, the numerous indel events can be treated as additional informative sites using maximum parsimony (MP) analysis. Phylogenetic trees using maximum parsimony methods were produced in r-AEGA and PAUP. The initial consensus ITS 1 trees obtained from maximum parsimony and neighbor-joining methods is shown in Figure 2. 99 The trees indicate that the haplochromine taxa of Lake Victoria represent a monophyletic group. Resolution of absolute branching order is resolved for some, but not all L VR lacustrine taxa The riverine Asla/otilapia, A. burtoni , represents a sister group to the Lake Victoria endemics, which include the marginal lacustrine Anubilis. Clustering of Yssichromis and Lipochromis conforms to a group predicted by the analysis ofLipittsch (1993). TheXysNchromis and Ptyochromis exhibited identical ITS sequences, again confirming a group consistent with Lippitsch (1993) .. The only difference between the two trees is in the clustering of As/aloreochromis with the riverine Aslalonlapia (bur/onf) in the NJ and MP tree of MEGA while Aslaloreochromis groups with Pseudocrenalabrus in the MP anlaysis ofPAUP. After primary determination of an ITS 1 gene tree, a larger sample of LVR haplochromines was initiated using a heteroduplex analysis. This procedure takes advantage of the altered mobility of DNA hybrids which differ by as few as one nucleotide substitution. Briefly, PCR products from different taxa are denatured and allowed to reanneal together with a control r---A.alluaudi (driver) PCR products whose sequence is I knOWD. Ifmultiple bands are observed on ------~I:;F;p·multicolor the heteroduplex gel matrix, there is an A.burtoni assumed difference between the two H.hchira r ..r-1-':N"Iaul'ing te&ted peR products. If. single band is N.niE%"ican observed on the heteroduplex gel, the ...... X.pllytophagous p.. ~~~~~~~~s PCR products are believed to be identical A.nubila (Sorrentino ~t al.• 1991. White et al., ta in 1992,). This method has been used to _.y', ur us detect single nucleotide substitutions for - . =puogmmm eli . (Hi .th, 1993) Thi -l.fuslformis sease screerung gsrm . s L ______--l0.niloticus method works optimally on DNA strands ·O.esculentus of less than 400 base pairs. This, Figure 2. Initial conseDSUS ITS 1 gene tree from 13 taxa. combined with the fact that most of the observed variation in the ITS 1 was in the 3' end of the spacer, led us to initially use the primer pair 236C-ITS/ ITS 2-Cln for heteroduplex analysis. Heteroduplex screening was done using a multiple step process in our experiments. The first step in this procedure 'WaS to screen taxa in an agarose heteroduplex method which is methodologically identical to standard heteroduplex analysis except that the heteroduplex products are electrophoresed on an 2.5% agarose gel. Initially. we used PCR products from those taxa that 'We had previously determined the lTS I sequences. By this method, it 'WaS empirically determined that ITS 1 sequences which differ by a few indel events, or as few as five nucleotide substitutions, could be visualized as multiple banding patterns by the agarose method. In this initial, less expensive. agarose screening those taxa which produced multiple bands were slated for later sequence analysis. Those taxa which appeared identical in the agarose heteroduplex screening were then analyzed by the more traditional heteroduplex analysis using a proprietary polyacrylamide matrix (Sequagel MO). Those taxa which produced mulitple bands in this heteroduplex analysis were also slated for sequence analysis. Those taxa which did not produce multiple bands were asswned to be identical to the driver DNA ITS 1 product. A heteroduplex result is shO'WD in Figure 3. In these experiments, we used Yssichromis fusiformis as the driver DNA. For heteroduplex analysis. PCRproduct from Y. fusiformis was mixed with ASlatoreochromis alluaudi (lane A), Hap/ochromis ba"ed pygmy (lane B), Pyxichromis orthosloma (lane C). and Gaurochromis augustifrona (lane D and E; two individuals). 100 M +I+IIAIBICID lEI homo M was lkb IIllIrker (Life Tec:hne)lol:ies product) and lane H homoduplex of Y. jusijormis products. Multiple banding were observed (indicating hetf:rode,plexes) in A, B, C, D, and expected from oUJe e,.li,,, ITS 1 sequencing work. of variation (number of nuc:leotide substitutions) indicateHaplochromis) "'barred pygmy".One taxa, (Hap/ochromis) Fig 3. Sequagel MD Heteroduplex Gel "barred pygmy" differed by two nucleotide substitutions from the driver peR product Gaurocluomis angustifrona differed by one nucleotide substitution from the driver. One apparent homodupJex, (Psammocluomis) "constellation" (heterodupJex gel not shown) was also sequenced to determine if assumed homoduplexes were in fact identical. No differences were found between this (Psammocluomis) "constellation" sequence and the driver peR sequence. DISCUSSION Sequence divergence among the first fifteen taxa involved in this study was low at ITSl, but nonetheless informative. The low level of variation is not unexpected, given that the entire species flock is monophyletic (Lippitsch ] 993), with an age geologically constrained by the formation of the Lake Victoria basin (co. 750,000 BPE), and estimated at ca. 225,000 years by ntitochondrial clock (Meyer et aI. 1990). Despite the low degrees of variation, structwe was discerned and it 'NBS informative. A large number of insertion and deletion events were found in ITS 1. These were most prevalent in comparisons between haplochromines and tilapiines, and to a lesser extent in the comparisons involving Pseudocrenilabrus relative to other taxa This is similar to other studies which have ob5eIVed numerous indels in species ranging from salmon to beetles (pleyte, et aI., 1992; Vogler and DeSalle, 1994). Analysis of phylogenetic gene trees produced nearly identical branching patterns using both distance and parsimony methods (as well as other methods not shown), although bootstrap values were low for many branches. This is due to the small number of phylogenetically info.llllB1ive sites. Although this indicates that the data should be interpreted cautiously, it does yield some interesting findings. The ITS I sequences, though very closely related, confirmed independently derived basal phylogenies. and also provided useful information from within the Victoria region superflock. The ITS I-based phylogeny is generally consistent, where comparison is possible, with cladograms derived independently from morphological characters, and from mtDNA (Stiassny 1991, Lippitsch 1993, Meyer et al. 1990). Pseudocrenilabrus arose early, close to the divergence event that separated the tilapiine and haplochromioe tribes of the "African Group" of the family Cichlidae, and thus appears to be the most primitive extant haplochromine clade. Astatoreocluomis alluaudi was the sister group to the riverine Astatotilapia burtoni, which was in tum the sister group to a monophyletic assemblage including both Lake Victoria and Lake Edward taxa. The ITSI phylogeny placed L. taurinus as a sister group to two species of Yssicluomis , an association that would not 101 seem likely on the grounds of superficial morphology, but which is well supported by lepidological characters (Lippitsch (993). Also in agreement with Lippitsch is the grouping of the lacustrine AslaJotiapia nubila with other LVR haplochomines. In contrast. placement of Neochromis in close proximity to Harpagochromis sp. is sharply at variance with the weight of morphological evidence, which would place Neochromis withXystichromis plus Haplochromis (Greenwood 1981, Lippitsch 1993, pers. com.). It is particularlY noteworthy that taxa drawn from Lake Edward/George rather than Victoria nonetheless fell amongst the Victorian taxa. lhis supports Greenwood's contention that the Lake Victoria radiation is one part of a larger Lake Victoria-Edward/George- Kyoga-Kivu regional fauna and further supports the notion that Meyer et al.'s evidence for monophyly of the Lake Victoria haplochromines applies to the regional haplochromine fauna as a whole. The limited degree of variation that we observed had the ancillary benefit of permitting alignment with little ambiguity along the entire ITS 1 among the taxa studied. The calculated distances in most comparisons are small, with no differences found between the two Oreochromis species that we examined (0. esculentus and O. ni/oticus), or within certain smaller groups of Lake Victoria haplochromines. The largest distances are found between Pseudocrenilabros and other taxa, ranging from 4.97% to 7.370/0. The genetic distances between Astatoreochromis alluaudi and the other haplochromine genera range from 4.90% for Pseudocrenilabrus , to 0.99% for Aslalotilapia burtoni, its sister genus. The average distances between A. alluaudi and the remaining haplochromines is approximately 1.4%. Expansion of the ITS 1 analysis using heteroduplex analysis appears to be useful for these closely related species. We have shown that differences as little as one nucleotide substitution can be determined by heteroduplex analysis, and identical sequences can be excluded from further analysis. Using this method we will be able to rapidly screen large numbers of taxa at this locus prior to sequencing, and to incorporate those results into future phylogenetic analyses. In summary, while the ITS 1 contains low levels of variation, it is able to discriminate between a hypothesized sister taxon of the Lake Victoria flock and genera within the flock. It also provides evidence of structure within the flock; some of this structure is consistent with data from other sources, but in one instance (Neochromis) it is not The ITS I sequence is very likely, bowever, to help in testing the validity of haplochromine genera erected by Greenwood, as well as monophlyly of these genera across lakes: i.e., the structure and history of the radiation. Since Lake Victoria may have been dry between 14,500 and 12,400 BPE, the modem assemblage must have derived from reinvasion by the products of earlier cladogenesis events. Thus, although the regional superflock is monophyletic, the haplochromines of Lake Victoria itself did not evolve in situ from a single ancestor. Rapid addition ofamuch larger sample of Lake Victoria cichlid taxa using heteroduplex screening analysis to the ITS 1 database is now possible. This information, as well as examination of other regions of the genome will be needed to more robustly establish the relationships among Lake Victoria Region cichlids. ACKNOWLEDGMENTS Thanks to Doug Wannolts and the curators of the Johnson Aquatic Complex of the Columbus Zoo. Work was partially supported by National Science Foundation grants DEB-9300065 (to P.A.F. and LX) and 00-9308276 (to LK, L. Chapman and C. Chapman); grants from the Columbus Zoo (to P.A.F.), an Ohio State University Graduate School Alumni Research Award (to G.B.), and a Pew Scholars for Conservation and the Environment award (to LK) (pew Charitable Trusts). We thank the staff of the Ugandan Freshwater Fisheries Research Organization at Jinja for their assistance with this work, and National Diagnostics for the use of Sequagel MD heteroduplex matrix for these analyses. REFERENCES 102 Avise, J. 1994. Molecular Markers, Natural History, and Evolution. Chapman and Hall. N.Y. Baldwin, B. G., i992. Pbylogenetic Utility of the internal Transcribed Spacers of Nuciear Ribosomal DNA in Plants: An Example from the Compositae. Molecular Phylogenetics and Evolution i(i): 3-i6. Booton, G., 1995. Molecular Genetic Analysis of the Phylogenetic Relationships of Lake Victoria Cichlid Fish. Ph.D. thesis. The Ohio State University. Brown, W. M., i985. The mitocbondrial genome of animals, pp. 95-i30.In R. Macintyre (ed.), Molecular Evolutionary Genetics. Plenum, New York. Cabot:. E. L. and A T. Beckenbach. 1989. Simultaneous editing of multiple nucleic acid and protein sequences with ESEE. Computational and Applied Bioscience, 5: 233-234 Cordese, F., R Cooke, D. Tremousaygue, F. Grellet, and M. Delseny 1993. Fine Structure and Evolution of the rDNA Intergenic Spacer in Rice and Other Cereals. J. Mol. Eva!., 36: 369- 379. Dominey, w. J. 1984. Effects of Sexual Selection and Life History on Speciation: Species Flocks in African Cichlids and Hawaiian Drosophila, 231-250. In A A Echelle and I. Kornfield (eds.), Evolution ofFish Species Flocks, University of Maine Press, Orono. Gillespie, J.H., 1986. Rates of Molecular Evolution. Annual Reviews ofEcologicaI Systematics. Annual Reviews inc., i7: 637-665. Greenwood, P. H. 1984a. African Cichlids and Evolutionary Theories, 141-154. In Anthony A Echelle and 1. Komfield (eds.), EvoiuJion ofFish Species Flocks, University of Maine Press, Orono. Greenwood, P. H.i984b. WhatIs • Species Fiock?, 13-i9. In Anthony A. Ecbelle and I. Kornfield (eds.), Evolution ofFish Species Flocks. University of Maine Press, Orono. Greenwood, P. H. 1991. Speciation. Keenlyside, Miles H.ed. Cichlid Fishes: Behaviour, ecology, and evolution. First London Chapman and Hall 86-102 Fish and Fisheries Series 2. Higsmith, Jr., W.E. 1993. Carrier screening for cystic fibrosis. Clinical Chemistry 39:706-707. Jeffreys, A J., V. Wilson, & S. L. Thein 1985. Individual-specific 'fingerprints' of human DNA Nature, 3i6, 76-79. Li, W-H., C. C. Luo, and C.1. Wu i985. Evoiution ofDNA Sequences. pp. i-94.in R. J. Macintyre (ed.). Molecular Evolutionary Genetics. Plenum, N.Y. Lippitsch, E., 1993. A phyletic study on lacustrine haplochromine fishes (perciformes, Cichlidae) of East Africa, based on scale and squamation characters. J. Fish Bio!., 42: 903-946. Marchuk, D., AS. Mitchell, and F.S. Collins, 1991. Construction ofT-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acid Research, 19:1154. Mayr, E. 1984. Evolution ofFish Species Flocks: A Conunentary. 3-11. In Anthony A Echelle and I. Komfield (eds.), Evolution OfFish Species Flocks, University of Maine Press, Orono. 103 Meyer, A., T. D. Kocher, P. Basasibwaki and A. C. Wilson. 1990. Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature, 347, 550-553. Ono, H.• C. O'hUigin, V. Vincek, and J. Klein, 1993. Exon-Intron Organization of fish major histocompatability complex II B genes. Immunogenetics 38(3): 223-234. PIeyte. K. A., S. Duncan, and R. Phillips, 1992. Evolutionary Relationships of the Salmonid Fish Genus Salvelinus Inferred from DNA Sequences of the First Internal Transcribed Spacer (ITS 1) of Ribosomal DNA. Molec. Piry. Evol. 1(3): 223-230. Sage, RD., P. V. Loiselle, P. Basasibwaki and A. C. Wilson 1984. Molecular Versus Morphological Change Among Cichlid Fishes of Lake Victoria., 185-202. In A. A. Echelle and I. Komfield (eds.), Evolution ofFish Species Flocks, University of Maine Press. Orono. SaitOll, N .• and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Bioi. Eval. 4(4): 406-425 Soltis. P., and R Kuzoff, 1993. ITS Sequence Variation within and among Populations of Lomatium grayi and L.1aevigatum (Umbelliferae). Mol. Piry. Evol.2(2):166-170. Sorrentino, R, C. lannicola, S. Costanzi, A. Chersi, and R Tosi. 1991. Detection of complex alleles dy direct analysis of DNA heteroduplexes. Immunogenetics. 33:118:123. Stager, J. C., P. N. Reinthal, aod D. A. Livingstone, 1986. A 25,000-year history for Lake Victoria, EastAfrica, and some comments on its significance for the evolution of cichlid fishes. Fresh. BioI. 16: 15-19. Stiassny, M. L. 1. 1991. Phylogenetic intrareiationships of the family Cichlidae: an oveIView, 1- 35. In Miles H. A. Keenlyside (ed.), Cichlid Fishes: Behaviour. ecology. and evolution, Chapman and Hall, London. Sturmbauer, C. and A. Meyer 1992. Genetic divergence. speciation and morphological stasis in a lineage of African cichlid fish. Nature, 358: 578-581. Sturmbauer, C, and A. Meyer, 1993. Mitochondrial phylogeny of the endemic mouthbrooding lineages of cichlid fishes from Lake Tanganyika in eastern Africa. Mol. BioI. Evol. 10(9): 751-768. Swofford, D. L. 1990. PAUP- Phylogenetic Analysis Using Parsimony (Version 3.0) Computer program distributed by the Illinois Natwal History Survey, Champaign, Illinois. Torres. R A., M. Ganal, and V. Hemleben, 1990. GC balance in the internal transcribed spacers ITS 1 and ITS 2 of nuclear ribosomal RNA genes. J Mol. Evol. 30: 170-181. Van Couvering, 1982. Fossil cich1id fishes of Africa. Special papers in Paleontology. Paleontological Ass. Lond. 29: 1-103.2 Vogler, A. P., and R DeSalle, 1994. Evolution and Phylogenetic Infonnation Content of the ITS-l Region in the Tiger Beetle Cicindela dorsalis. Moi. Bioi. Evol. 11(3): 393-405. White, M. B .• M. Carvalho, D. Derse, S.l O'Brien, and M. Dean. 1992. Detecting single base 104 USE OF DNA MICROSATELLITE LOCI TO IDENTIFY POPULATIONS AND SPECIES OF LAKE VICTORIA llAPWCllROMINE CICHLIDS LizhaoWu Departtnent of Molecular Genetics, The Ohio Slate University 484 W. 12th Avenue, Columbu~ OH 43210, USA Tel.: 614-2924570; Fax: 614-2924466 email: [email protected] Gregory C. Bootonl , Les Kaufman2, Mark Chandler3, and Paul A. Fuerstl lDeparttnent of Molecular Genetics, The Ohio State University, Columbus, OH 43210 2Department of Biology. Boston University, Boston, MA 02215 3New England Aquarium. Boston, MA 02110 INTRODUCTION Cichlid fish species in the three Eastern Mrican Great Lakes, Lake Victoria, Lake Malawi, and Lake Tanganyika, form a remarkable and fascinating vertebrate species flocks, representing a unique example of vertebrate explosive speciation and adaptive radiation (Fryer & Des, 1972). Each of the three lakes harbors hundreds of cichlid species (together with many fewer non-cichlid species). More interestingly, almost all of the cichlids (>99%) are endemic to a particular lake (Greenwood. 1991). This contrasts with the nearby river systems, which harbor fewer cichlid species and much lower lever of endemism, and to coexisting non-cichlids, which also show lower endemism (Greenwood, 1991). Most of the Eastern African cichlids, though apparently reproductively isolated under their nature conditions, share many morphological features, an attribute making morphological classification difficult Moreover, phenotypic plasticity, which is common for some morphological characters in cichlids, can further confound the morphological classification. Therefore, to obtain a more dependable cichlid phylogeny, which is essential for underslanding the fundamental prinCiples underlying the spectacular speciation events of cichlid flock, one requires alternative, possibly more reliable, cbaracters than are provided by the current morphological characters which bave been used for classification. 105 In the past 20 years, hiologists around the world have tried to apply genetic approaches to attack evolutionary and systematic questions of cicblid relationships. Unfortunately, such efforts have been severely hampered by the frequent fmding that many of the conventional biochemical and molecular genetic markers revealed very low levels of intraspecific and interspecific variation in the Eastern African cicblids, especially in the haplocbromine cicblids in Lake Victoria region (Sage et al., 1984; Meyer et al., 1990; Booton, 1995). In our lab we have used several approaches to develop highly variable genetic markers for population genetic studies of cicblids (Fuerst et al., 1995; Booton, 1995; Black et aI., 1995). One such approach involves the development of a series of marker loci, referred to as microsatellite loci, from an Eastern African cicblid species, Astatoreochromis alluaudi CWu et aI., 1996). Microsatellite loci consist of simple short tandemly repeated DNA sequences. Repeat units range . from 1 to 5 base pairs (bp) (Beckmann and Weber, 1992). Such loci are often higbly polymorphic, characterized by multiple alleles and very high heterozygosity. It is generally believed thaI allelic variation at these loci is primarily due to different numbers of the di-, tri- or tetranuc1eotide repeat units, whereas DNA sequences flanking the microsatellite repeats are generally conserved. 'This facilitates cross species application of typing for these markers. As bigbly polymorphic genetic markers, microsatellite loci have recently been used in genome mapping, linkage analysis, paternity exclusion, and forensic studies (O'Reilly and Wright, 1995; Quelleret ai., 1993). They have also been increasingly applied to a variety of population genetic studies (Brooker et aI., 1994; MeConnell el al., 1995; Paetkau and Strobeck, 1994; Roy et al., 1994). Of particular nOle, microsatellite markers have been successfully used to show a high level of polymorphism in a species where the conventional genetic markers revealed very little amount of variation (Hughes and QueUer, 1993). It is reasonable to expect that this new type of genetic marker might be very useful for phylogenetic studies of recently diverged species, such as the haplocbromine cichIids. The goals of the present project are: (i) to study the patterns of intraspecific and interspecific variation at the microsalellite loci that we developed in A. alluaudi, (ii) to detennine whether they are useful in differentiating A. alIuaudi populations, and (ill) to detennine whether they are informative in studies of the phylogenetics of the Lake Victoria haplochromioe cicblids. MATERIALS AND METHODS Tissue Samples: All cicblid samples used in this study were collected in the Lake Victoria region between 1992 and 1995. Species sampled include: (i) A. aJluaIJdi. (3 populations: Jinja, northern Lake Victoria n =14; Lake Kacbira, n =22; Lake Kyoga, n = 22), (ii) AslaJotilopia velifer (2 populations: Lake Nabugabo, n = 41; Lake Kayugi, n = 29), (iii) Paralabidoclvomis "rock kribensis", (1 population: Jinja, n = 31), (iv) Paralabidochromis sp., (l population: Lake Victoria, n = 16), Yssichromis loparogramma, (1 population: Lake Victoria, n = 10), and Y. fusiformis, (1 population: Lake Victoria, n = 30). White muscle tissue samples were collected in the field and stored in 95% ethanol until DNA extraction. After tissue collection, the entire fish were fonnalin 106 preserved, and was transported to the laboratories of L. K. in Boston for later morphological identification, or was photographed intact for identification and then discarded. DNA extraction and microsatelUte analysis: DNA was either phenol-cbloroform extracted (Kocheret aI., 1989), or NaOH extracted (Zhang and Tiersch, 1994) from the ethanol-preserved muscle tissue. Nine microsatellite loci developed from a partiaI A. alluaudi genomic library (WU et aI., 1996) have been chosen for the current study. All PCR primers were designed using the program Oligo. MicrosaleJlite PCR amplifications were performed in 5 or 10 J.Il of a mixture containing 25-30 ng of DNA template, 3 pmole of each primer, 1 nmole of dNTPs, 12.5 nmole of MgCh. and 0.5 to 1 unit of BRL Taq DNA polymerase. One of each pair of the primers was 5' end labeled with -y32p-dATP. PCR products were resolved in 6% or 8% polyacrylamide sequencing gel using the known sequence of the M13 bacteriophage as a size marker. Table 1 shows the core repeat sequence, the primer sequences, and the PCR conditions for the nine marker loci. Table 1. Microsatellite core sequences. primer sequences and PCR conditions* locus core seguence Erirners~uences Tm(~ c;xcles OSU09d (fG120(CGDl' CCTCTGTAGTGATGTTTAATCTCTGT 60 28 TGACACTGCACTTACTTGGCT OSUl2t (NGC)13 TCAAACACCCACAGCCTTCA 60 22 CGGTGATTGCTGTTGATACTGA OSU13d (GTl2s TAAGCTGATAGGAACCCAAC 58 30 ACTCCTATTTTGTTATTTITGTGA OSUl6d (GDIO GGCGAATGGTGGGTCAAG 58 32 ATGTTGCTTGCCGCTGC OSU19d (GT)'7 CAGTGCTTTGGTGGTGCT 55 30 CATGACGTCTTTCAATAAGGAT OSUl9t (CA)1l(ANC)'2 TGAAGGACAAAGCAGGACTG 60 28 TGCCCGAACCTITITATTTA OSU2Od (GT)'7 GAATGTGGATTTGCAGCTTG 60 30 CATGCTTACAAAGAACAGGGTTAC OSU21d (GT)6GC(GD. GCCGCTCAGAGTTTGGTG 60 22 AGGCATGTGTCAGTTCATCCT OSU22d (GD., TGAAATCAAATACTAGAGCAAATA 55 32 GGAGTTTAAAAATGATGCGT "'PCR conditions are defined by PCR cycle numbers and annealing temperature (Tm). 107 RESULTS AND DISCUSSION Genetic varIability of microsatellite markers among A. alluaudi populations: Of the nine microsatellite ma.rlrers analyzed, only one (OSU12t) was found to be monomorphic, in regard to the repeat motif. The remaining eight markers are polymorphic. The average observed number of alleles at polymorphic loci ranged from 7.9 (Lake Kacbira population) to 12.3 (Lake Kyoga population), and the average observed heterozygosity from 0.42 (Lake Kachira population) to 0.60 (Jinja population) (Table 2). Loci OSUI6d and OSU2Id, whicb consist of sborter repeal motifs than the other six polymorphic loci, have a smaller number of observed alleles and lower observed heterozygosity. This is consistent with suggestions that the longer the average repeat motif. the more variable the locus will be (Weber. 1990). The Lake Kachira population. characterized by a smaller number of observed alleles and lower level of observed heterozygosity, appears to be less heterogeneous than the other two populations. An extreme example is seen allocus OSU09d, for which the Lake Kacbira population has only three observed alleles and a very low level of heterozygosity (0.27), while the observed numbers of alleles for the Jinja and Lake Kyoga samples are 14 and 16, and heterozygosities are 0.83 and 0.91, respectively. These data are in concert with results from RAPD (randomly amplified polymorphiC DNA) markers collected in our lab, which indicate that A. alJuaudi individuals from the Lake Kacbira population are more similar to one another than are individuals either from Jinja or from Lake Kyoga (Black et al., 1995). Table 2. Observed number of alleles eN) and observed heterozygosity (Ho) at the eight polymorphiC loci among A. alluaudi populations locus Jinja Kachira Kxoa:a averate N Ho N Ho N Ho N Ho OSU09d 14 0.83 3 0.27 16 0.91 11.0 0.67 OSUl3d 15 0.79 13 0.73 20 0.77 16.0 0.76 OSUl6d 5 0.29 1 0.00 4 0.18 3.3 0.16 OSUl9d \0 0.57 6 0.57 19 0.77 11.7 0.64 OSUl9t 6 0.86 3 0.45 6 0.68 5.0 0.66 OSU20d 16 0.69 21 0.57 13 0.43 16.7 0.56 OSU21d 2 0.07 2 0.09 1 0.00 \.7 0.05 OSU22d 15 0.71 14 0.68 19 0.59 16.0 0.66 averas:e 10.4 0.60 7.9 0.42 12.3 0.54 10.2 0.52 108 Several observations about the microsatellite data also indicate that the three A. aUuaudi populations are genetically differentiated from one another. First. each of the three populations has a high percentage of unique alleles. ranging from 24.1% (Jinja) to 44.4% (Lake Kachira) (Table 3). Overall, about 113 (801244 or 32.8%) of the observed alleles are unique to a particular population, strongly suggesting that the three populations are genetically differentiated. Second, although most of the observed alleles are shared by at least two of the three populations, the different populations usually have different allele frequencies for the shared alleles. Figure 1 shows such differences for locus OSU09d, at which allele No.6, which is predominant in the Lake Kachi.ra population, is absent in the Jinja population and bas very low frequency in the Lake Kyoga population, whereas allele No. 10, which is the predominant allele in Lake Kyoga, is less frequent in the Jinja population and absent in Lake Kachira Table 3. Observed number (N) and percentage (%) of unique alleles at the eight polymorphic loci among A. alluaudi populations locus Jinja Kachira KxoSa N % N % N % OSU09d 6 42.9 0 0.0 7 43.8 OSUl3d I 6.7 3 23.1 4 20.0 OSUl6d 2 40.0 0 0.0 25.0 OSUl9d I 10.0 2 33.3 7 36.8 OSUI9t I 16.7 0 0.0 2 33.3 OSU20d 5 31.3 14 66.7 5 38.5 OSU21d 0 0.0 1 50.0 0 0.0 OSU22d 4 26.7 8 57.1 6 31.6 averas;e* 2.5 24.1 3.5 44.4 4 32.7 *average % of unique alleles = (total number of unique alleles) I (total number of observed alleles) Genetic variability of microsatellite markers among other Lake Victoria haplochromine cicblids: Seven of the nine markers (all except OSU13d and OSU22d) were found to amplify a microsatellite locus in every haplochromine cicblid species tested. Our preliminary studies on five species which are members of the central species flock of Lake Victoria haplochromine cichlids indicate several general findings. First, most of the microsatellite markers revealed a high level of intraspecific variability within each of the five species, characterized by multiple alleles at each locus. Table 4 shows the number of observed alleles and the number of unique alleles for the seven loci. As was seen in A alluaudi. each of the other five haplochromine cichlids exhibited low variability at loci OSUl6d and OSU21d. Locus OSU12t. which is monomorphic in A. alluaudi. is polymorpbic in all the other five haplochroIOine cichlids. but has only a few observed alleles. Second, in conttast to the high levels of inttaspecific variability. interspecific differentiation among the five species appears to be quite limited, based on the overall low percentage (0.9/12.4 or 7.3%) of unique alleles (Table 4). lbis supports the notion that the 109 1.0 Jinja 0.8 •I1iI Kachira .. III Kyoga =•" g. 0.6 .::• • :ll :< 0.' 0.2 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Alleles Figure 1. Histogram of allele frequencies at locus OSU09d in the three A aUuaudi populations Table 4. Observed number of alleles (and the number of unique alleles) at seven microsatellite loci among five species of Lake Victoria basin haplochromine cichlids locus AstaroriJapia Paralabidochromis P. 'p. Yssichromis. Y. Jusiformis velif!r "rock kribensis" /aparoJ 110 haplochromine flock within the Lake Victoria basin diverged very recently. Third, when measuring interspecific differences by using either Nei's unbiased genetic distance (Nei, 1978), or the [)elm mu genetic distance for microsatellite loci (Goldstein el aI., 1995), we found that the populations of A alluaudi are more distantly relaled to any of the other haplochromine forms than the latter are separated. from one another. lbis finding is consistent with both allozyme data (Sage et al., 1984) and m1DNA data (Meyer et al., 1990), both of which place A. a1Iuaudi into an outgroup separated from other Lake Vicloria. haplochromine cichlids. Fourth, although microsatellite markers appear to be potentially infonnative for phylogenetic studies of haplochromine cichlids, a reliable haplochromine phylogeny based. on microsatellite data may not be accurately inferred unless many more taxa are included and additional microsatellite loci are used. The original observations of Nei (1978) concerning the great importance of including in a study the largest number of loci possible lO improve the accuracy of the estimated. genetic distances are especially relevant lo future studies of these recently evolved species. ACKNOWLEDGMENTS We would like to thank Wilson Mwanja and our African colleagues from the Ugandan Fisheries Research Institute at Jinja, especially Richard Oguto-Ohwayo for assisting in the collection of some of the samples used in this studies. This research was funded by grants from the National Science Foundation (DEB-9300065 to P.A.F. and L.K and JNT-9308276 to L.K., L. Chapman and C. Chapman), a grant from The Columbus Zoo (to P.A.F.), and a Pew Scholars for Conservation and the Environment Award (to L.K.) by the Pew Charitable Trusts. REFERENCES Beckmann, I. S. and I. L. Weber, 1992. SllIVey of human and rat microsatellites. Genomics, 12: 627-631. Black., M., G. Booton, M. Cbandler, L. Kaufman, P.A. Fuerst. 1995. Use of randomly amplified polymorphic DNA (RAFD) [0 sOJdy population differentiation in the African cichlid fish Astatoreochromis alluaudi.. Ohio I. Sci. 95 (2): A-II. Booton, G., 1995. Molecular genetic analysis of the phylogenetic relationships of lake Victoria cicblid fish. Ph.D. thesis. The Obio State University. Brooker, A. L., D. Cook, P. Bentzen, I. M. Wright, and R. W. Doyle, 1994. Organization of microsatellites differs between mammals and cold-water teleost fishes. Can. J. Fish. Aqual. Sci., 51: 1959-1966. Fryer, G. and T. D. nes, 1972. The CicblidFishes of the Great Lakes of Africa. Boyd, Edinburgh. 111 Fuerst, P.A. W. Mwanja, G. Booton. M. Black, M. Chandler and L Kaufman. 1995. RAPD's as nuclear gene markers of population structure and hybridization in lake Victoria cichlids. J. Cellular Biochem. 19B: 339. Goldstein, D. B., A R. Linares. L. L. Cavalli-Sforza, and M. W. Feldman. 1995. Genetic absolute dating hased on microsatellites and the origin of modem humans. Proc. Natl. Acad. Sci. USA, 92: 6723-6727. Greenwood, P. H.. 1991. Speciation. In: "Cichlid Fishes Behaviour, Ecology and Evolution" (M. H. A. Keenleyside, ed.). Chapman & Hall, London. pp. 86-102. Hughes. C. R. and D. C. Queller.1993. Detection of highly polymorphic microsatellite loci in a species with little allozyme pOlymorphism. Mol. Eco1., 2: 131-137. Kocher. T. D., W. K. Thomas. A Meyer. S. V. Edwards, S. Paabo, F. X. Villablanca, and A. C. Wilson, 1989. Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA, 86: 6196-6120. McConnell, S. K., L. Hamilton, J. Wright, and P. Bentzen, 1994. Polymorphic microsatellite loci from Atlantic salmon (SaImo salar): genetic differentiation of North American and European populations. Can. J. Fish. Aquat. Sci.. 52: 1863-1872. Meyer, A, T. D. Kocher, P. Basasibwake. and A. C. Wilson, 1990. Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature, 347: 550-553. Nei. M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89: 583-590. O'Reilly, P. and 1. M. Wright, 1995. The evolving technology of DNA fingerprinting and its application to fisheries and aquaculture. J. Fish BioI., 47 (Suppl. A): 29-55. Paetkau, D. and C. Strebeck, 1994. Microsatellite analysis of genetic variation in black bear populations. Mol. Bcol., 3; 489-495. Queller, D. C., J. E. Strassmann, and C. R. Hughes, 1993. MicrosateIlites and kinShip. 1REE, 8: 285-288. Roy, M. S., E. Geffen. D. Smith, E. A. Ostrander, and R. K. Wayne. 1994. Patterns of differentiation and hybridization in North American wolflike canids, revealed by analysis of microsateIlite loci. Mol BioI. Evo!., 11: 553-557. 112 Sage, R. D., Paul V. Loiselle, P. Basasibwaki, and A. C. Wilson, 1984. Molecular versus morphological change among cichlid fishes of Lake Victoria. In: "Evolution ofFish Species Flocks" (A. A. Echelle and 1. Kornfield, eds.). University of Maine at Orono Press, Orono, Maine. pp. 185-201. Weber, J. L., 1990. Informativeness of human (dC-dA)n.(dG-dnn polymorphism. Genomics, 7: 524-530. Wu, L., L. Kaufman, M. Chandler, and P. A. Fuerst. 1996. Mic[osatellites in Eastern African cichlid Astatoreochromis alluaudi: cloning, characterization, and application to population genetic analysis. (in preparation). Zhang, Q. and T. R Tiersch, 1994. Rapid isolation of DNA for genetic screening of catfishes by polymerase chain reaction. Trans. Am. Fish. Soc., 123: 997-1001. 113 " 114 POPULATION AND STOCK CHARACTERIZATION OF LAKE VICTORIA TILAPINE FISHES BASED ON RAPD MARKERS Wilson Mwanja Department of Zoology. The Ohio State University 1735 Neil Avenue, Columbus, OR 43210 USA 614-292-4570/ fax 614-292-4466 / email: 3 G.C. Booton\ L. Kaufman , M. Chandler", and P. Fuerstl.l I Department of Molecular Genetics and 1J>epartment of Zoology, The Ohio State University, Columbus, OR 43210, 3Department of BioJogy, Boston University, Boston, MA and Two sister groups of cichlids, the Tilapiines and the Haplochromines. have historically comprised the majority of the ichtbyfauna of the Lake Victoria basin of eastern Africa Tilapias are exclusively African and Levantine in their natural range and are thought to have diverged from a complex ancestral mixture, which also included the ancestors of the baplochromines. more than 10 million years ago (Fryer and Des. 1972~ Trewavas 1983). The tilapias, particularly members of the genus Oreochromis. have been extensively introduced allover the world, and are now among the most economically important species in global aquaculture. The tilapias offer a fertile field for study of complex ecology, behavior, and evolutionary attributes as a result of their rich evolutionary history and relationship to the Haplochromines, a sister group that is even more ecologically complex and diverse (Trewavas, 1983). Tilapias belong to the tribe Tilapiini (subfamily: Tilapiinae) of the family Cichlidae in the order Labroideaofthe Perciformes (Nelson. 1994). Trewavas (1983) describes ten genera within the Tilapiini, including three major genera, Ti/apia, Oreochromis and Saratherodon, represented in dle Lake Victoria basin. Species of Tilapia are substrate spawners; both parents guard the young. Oreochromis species are maternal mouthbrooders, only females carry eggs and young in their mouths. Saralherodon are biparental mouthbrooders, both female and male parents carry eggs and young in their mouths, and . Species classification has been largely based on variation in dentition. bone structure, pigmentation, squamation characteristics and general body morphology (Fryer and Des, 1972; Komfield et al., 1979; Stiassny, 1991, 1992; Trewavas. 1982). However, most or all of these characters overlap and may fail to unambiguously identify species owing to interpopulation variation and small differences among species. Molecular techniques have been employed in an attempt to characterize and identify Tilapiioe species (Seyoum and Komfield, 1992; Frank et al., 1992). Bardakci and Skibinski (1994) used protein electrophoresis to discriminate tilapia species and their hybrids. Mitochondrial DNA markers have been used by Capili (1990) and by Seyoum and Komfie1d (1992) to identify subspecies of Oreochromis niloticus. Only a few studies (Frank et al., 1992, Bardakci and Skibinski, 1994) attempted to analyze nuclear DNA markers, and no study has been reported concerning variation within and between natural populations. The aquatic ecosystem of Lake Victoria has been greatly modified by overfishing, increased human activity in the drainage basin, and the introduction of exotic species. The Nile perch, Lates ni/oticus, a voracious predator, and several non·native Tilapiine species (including the ecologically versatile Nile tilapia. Oreochromis niloticus) were deliberately introduced between 115 1930 and 1965. These exotic species rapidly displaced many of the indigenous Haplochromine cicblids from the lake, perhaps driving over 50% of the species to extinction. In addition to the Haplocbromine cicb1ids, two endemic Tilapiine species, Oreochromis l'ariabilis and O. esculentus, were extirpated from Lake Victoria, and their only remaining natural refugia are satellite lakes near Lakes Victoria and Kyoga (Ogutu-Ohwayo, 1990,1992, Balirwa, 1992). In a majority of the satellite lakes, the remaining populations of the endemic Lake Victoria Tilapiines are threatened due to the occurrence of exotic Tilapiines. We have explored the extent of genetic variation and of gene introgression between several species of tilapia found in the Lake Victoria region. The markers developed can be used in the identification of wild stocks and species, and in the monitoring of wild or managed stocks to apply appropriate fisheries management techniques. They also can be applied in aquaculture, to identify individuals, families, species and to label brood stocks (Hadrys et al., 1992). The markers can also provide taxonomic insight. Random gene markers often discriminate among species and subspecies of tilapias with better resolution than morphometric traits. Genetic diversity is the ultimate basis for the evolutionaI}' ability of a species to respond to genetic and environmental changes. Our work ultimately seeks to determine whether the ecological versatility and resilience of exotic tilapia, especially O. niloticus. as exemplified by its dominance within the Lake Victoria region, is related to higher genetic variability of these species. Higher variability may be related in part to hybridization within the species assemblage of the Lake Victoria basin. To characterize population and species differences, we bave used the Randomly Amplified Polymorphic DNA (RAPD) technique to assess geuetically based differentiation within and between populations and among species of the Tilapiine taxa in the Lake Victoria region. We also attempted to identify speCies-specific genetic (RAPD) markers. fur use in the assessment of levels of hybridization and introgression among the Lake Victoria Tilapiine species. Of special interest in this report is the question of introgression between introduced populations of 0. niloticus and the endemic species O. esculentus. Methods and Materials SAMPLES: The study was conducted using material collected from the Lake Victoria Basin in East Africa. Fish from five species (Oreochromis niloticus, O. esculentus, and O. leucostictus, and Tilapia zilli and Saratherodon galilaeus) were collected from northern Lake Victoria (in the region around Jinja, Uganda, near the outlet to the Victoria Nile), from Lakes Albert and Edward, and from several satellite lakes of Lake Victoria Satellite lakes are minor water bodies surrounding Lake Victoria, funned as backwaters derived through a series of drying and refilling which has characterized the geologic histoI)' of Lake Victoria (Kaufman, 1992). Samples were collected from eight satellite lakes: four (Lake Nabugabo, Lake Kayugi, Lake Kayanja, and Lake Manywa) make up parts of the Lake Nabugabo region at the northwest comer of Lake Victoria, south of the Katonga River, three (Lake Kijanebalola, Lake Kachira, and Lake Mburo) are located in the Koki lakes/marsh region between Lake Victoria and Lake Edward, south of the Katonga River, while a single satellite lake (Lake Kanyaboli) is part of the Yala River system. located on the east side of Lake Victoria, in Kenya between Mwanza Gulf and the Nzoia River. None of the satellite lakes are known to contain populations of Nile perch. with the exception of Lake Nabugabo, the closest of the satellite lakes to Lake Victoria. Each of the satellite lakes contained O. esculentus (Ngege), either as the only Tilapiine species or sympatric with 0. niloticus, again with the exception of Lake Nabugabo, where o. esculentus had. been extirpated Lake Victoria's Tilapiine fauna no longer includes 0. esculentus. while the species was never part of the fauna of Lakes Edward or Albert 0. niloticus was collected from the large lakes (Victoria, Albert and Edward) and from three satellite lakes (Mburo. KRehira and Nabugabo). O. leucostictus was obtained from Lakes Victoria, Nabugabo, Mburo and Kacbira. Samples of the other two genera were more restricted; Saratherodon galilaeus was sampled only from Lake Albert and T. zilli only from Lakes Victoria and Nabugabo. 116 Fish were collected using small sized gill-nets and seine nets, or minnow traps for swampy and overgrown shorelines. In the field. muscle tissue was removed from individual specimens immediately after capture. All samples used in this study were from individuals that were readily classified in the field Immature andlor uncertain morphs were avoided About 0.5 em3 of muscle was removed from an individual and placed in 95% ethanol. After one hoW', the tissue were transferred to a second vial with fresh ethanol (95%), where it remained until DNA was extracted Population analysis was undertaken only if sample sizes for a species was ten individuals or more. Ten individuals from each locality were included in this analysis. MOLECULAR METHODS: Tho RAPD (Random amplified folymorpbic IDIA marke,,) technique dete~ DNA polymorphism by use of the Polymerase Chain Reaction (PCR). The techniques achieves PCR amplification of genetic regions which are flanked by small inverted copies of an arbitrary single primer sequence. In a vertebrate genome. a number of such flanked sequences will OCCW', randomly scattered through various chromosomes. A DNA fingerprint will be produced which can be used to compare individuals. The RAPD technique has increasingly been used in molecular ecology because it is relatively inexpensive and is adequately robust compared to other molecular techniques (Hadrys, 1992; Russell et aI .• 1992; Dawson et aI., 1992). No prior DNA sequence information about the organisms is required Distribution of amplification sites is assumed to be random. The RAPD technique, however, has some drawbacks. The technique is sensitive to reaction conditions and slight changes may lead to non reproducibility of amplification produ~, requiring care in standardizing the reaction conditions. Use of duplicate reactions can control for reproducibility of the bands. In this study, like the case ofHadrys et aI. (1992) and Williams et aI. (1990), duplication ofRAPD amplifications produced markers that could be judged as clearly reproducible and scorable. The technique also produces dominant markers. in contrast to other DNA markers such as the RFLP markers. which are codominant This causes some problems in the interpretation of levels of variability. Even though not as sensitive as codominant DNA markers, use of RAPDs does allow estimation of allele frequency for population genetic analysis, and estimation of introgression. DNA extraction amplification and gel electropboresis. DNA was extracted from muscle using a standard phenoUchloroform extraction procedW'e. PCR reaction mixtures of 25 uI final volume contained about 50 ng of genomic DNA, 25 uM final concentration of each of the foW' nucleotides (dATP, d'ITP, dCIP and dGTP), 1 ul of200 Nm primer, reaction buffer and 0.1 unit of 5 uM Taq polymerase. A series of twenty different decamer (10 bp) oligonucleotide primers were obtained from Operon Technologies, Alameda, California (designated series M, according to G+C content) and evaluated for the production of scorable patterns in tilapia species. Eight of these primers were chosen for use in the study. Those used included primers OPM2, OPM7, OPMI1, OPM12, OPMI4, OPM1S, OPMI7, and OPMI9. PCR amplifications were performed in a Perkin-Elmer automated therm.ocycler, with the following amplification conditions: 2 min at 94°C as the initial step; 45 cycles of 30 seconds at 92°C, 1 min at 35°C, and 2 min at 75°C with a 5 min delay at 72°C at the end of the 45 cycles. Amplification products were separated by electrophoresis in 1.6% SYNERGEL agarose gels, stained with ethidium bromide, and viewed under ultraviolet light Each set of PCR amplifications included positive and blank controls to ensW'e that the observed banding patterns were reproducible, repeatable, and uncontaminated before scoring. RAPD bands were scored against a series of standard DNA size markers. the 123 base pair ladder size standards. Given the size and position of an amplified band relative to the marker DNA, bands in different individuals were scored as '1' for present or '0' absent for each amplification product across all the 10 individuals sampled from each population. Data analysis.' The estimations and calculations of genetic variation followed the approach of Lynch and Milligan (1994), which provides estimates of gene diversity and the analysis of genetic structure, correcting for the bias due to dominance in RAPD data. Estimates of 117 hybridization and introgression were obtained by identifying allelic markers that were "species specific", as defined by high relative allelic frequency differences (>0.8 between species samples from localities in which hybridization in unlikely). Frequencies of RAPD alleles characteristic of either "pure" O. niJoticus from Lake Albert, or "pure" O. esculentus from Lake KanyaboJi were identified for all the locations, and proportions of alleles of one species which appear in a congener was estimated RESULTS The eight primers generated a total of 167 scorable loci (bands) within the various populations of the five Tilapiine species. RAPD fragment patterns were examined for the presence of species specific bands, bands that occurred among individuals of only one of the species. O. esculentus was found to contain the largest number of unique bands (13 of 140 total bands), followed by O. nilolicus (11 of 115), T. zilli (7 of 52), and O. leucosdetus (4 of 47). SUI]lrisingly, S. galilaeus had no bands that occurred exclusively among the individuals sampled. In a similar manner, the three species of Oreochromis were examined for the presence of population-specific bands, those occurring exclusively among individuals of a particular population, and not shared between populations. O. Jeucostictus had the largest proportion of population specific bands (24.1 % on average), followed by O. ni/oticus (average of 16.8% per population) and O. escuJentus with the fewest (10.7% per population). Polymorphism: Levels of variability were estimated in two ways. First. the proportion of polymorphic bands within a population was estimated (Table 1). Among the Oreochromis species. O. leucostictus was most variable, having an average of 66.5% of its bands poiymoIphic in a population" followed by O. niloticus (59.0% of bands polymoIphic per population), with O. esculentus being least variable (only 54.4% of bands per population being poiymoIphic). Populations of Saratherodon galilaeus and TiJapia rilli were found to be quite variable, showing 70.0% and 65.0% of bands polymoIphic per population. There was considerable variation in the levels of polymoIphism seen in different populations of O. niloticus, ranging from a high of &1% in the Lake Kachira population to a low of only 36% in the Lake Albert sample. However, the highest levels of variation were seen in Lake Kachira and Lake Nabugabo (75% polymoIphic loci), two populations invaded by the Nile tilapia and in which it has become dominant. severely impacting the endemic O. esculentus populations. In contrast, a native habitat for the Nile tilapia, Lake Albert, has the lowest levels of polymoIphism, and may represent relatively unhybridized stocks of 0. ni/oacus. In the endemic species 0. esculentus, results were also heterogeneous. with a high of 7&% polymoIphic loci in Lake Mburo down to a low of only 33% in Lake Kijanebalola Relatively lower levels ofpolymoIphism occurred in o. escu/entuspopulations that were geographically more isolated from other tilapiine species. especially the Lake Kayanja sample (43%), or in places in which O. esculentus continues to be the predominant species when compared to the exotic O. niloticus, as in Lakes Kanyaboli (400/0) and Kijanebalola (33%). Populations from other lakes in which other tilapiines are more dominant showed more polymoIphism (average 67%). In general, O. leucostictus populations were more homogeneous than other Oreochromis species, ranging from 7&% in Lake Kachira to 54% in Lake Nabugabo. Gene diversity (Heterozygosity): Gene diversity estimates showed patterns generally similar to those exhibited by levels of band polymoIphism. O. escu/entus had the lowest average gene diversity, significantly lower than that seen in the other species (Table 2). The other spec:ies were not significantly different from each other. Considering population gene diversity within a species, the populations of O. niloticus from Lake Kachira (H = 0.27) and Lake Nabugabo (H = 0.29) had the highest levels of gene diversity. In. O. niloticus, the Lake Edward population had the lowest diversity (II ~ 0.14). Populations of the Nile tilapia from Lakes Albert (II ~ 0.17) and Victoria (H = 0.20) had intermediate levels. Lake Kachira held the most variable population of o. leucosnetus (II ~ 0.25), followed by Lake Victoria (II ~ 0.22) and Lake Nabugabo (II ~ 0.18). The Lake Mburo population (H - 0.15) was lowest of the four populations compared As with 118 polymorphism. populations of O. esculentus that appear to have interacted less with O. niloncus (Kayanja; H = 0.11), or where O. esculentus has continued to be dominant when they co-exit. such as in Lake Kanyaboli (II = 0.09), had lower gene diversity levels compared to populations from lakes where O. niloticus is dominant such as Lake Mburo (II = 0.22). Lakes Kachira, Kayugi and Manywa have gene diversity levels of 0.16.0.17 and 0.17, respectively. Populations of T. zilli were nearly equal in gene diversity levels (Nabugabo: H = 0.21; Lake Victoria: H = 0.23), relatively high compared to most populations in the other species. The Lake Albert sample of S. galilaeus had a heterozygosity (II = 0.20) close to that of o. niloticus. Table 1: Total number of bands (T), number of polymoIphic bands (P), and proportion of p~lymorphic bands (pm), in populations of five Tilapiine species. species! O. llilot.icus O. 6saulentas O.Ieacost1ctus S. gaIlIaeus 'J!.zlII1 Lake • P Pm • P Pm • P Pm • P Pm • P Pm I Victoria I 40 24 .60 50 35 .70 44 24 .55 Nahugabo I 44 33 .75 50 27 .54 52 3. .75 _aId I 51 26 .51 Albert I 11 4 .36 50 35 .70 Kburo I 43 21 .4. 73 57 .7. 3. 25 .64 Kachira I 53 43 .• 1 57 3. .67 55 43 .7 • Kayugi I 62 37 .60 Manywa I 37 22 .60 Kayanja I 44 1. .43 Kanyaholi I 60 24 .40 Kijanebalola 4. 1" .33 I Table 2. Average values of gene diversity (IIj) in populations of the five Lake Victoria region tilapiine species. species average # loci H, o. niloticus 41.7 0.213 0. leucosnctus 48.5 0.202 O. esculentus 54.4 0.143 S. galilaeus 50.0 0.196 T. zilli 40.5 0.222 Partitioning of genetic. diversity within and between populatioDs: Since four of the species, had been sampled for more than one population, it was possible to evaluate how total gene diversity is partitioned into within- and between-population components. This is the application of the F9T analysis first expounded by Sewall Wright (l9S 1). F9T represents the proportion of the total gene diversity (heterozygosity) in the sample which is contributed by differences in allele frequency between populations. For the Oreochromis 9pBc;es, this proportion is very large, indicating that the species ishighly structured and populations differentiated, probably exchanging few migrants with respect to RAPD markers. All Oreochromis species were highly subdivided 119 as measured by F ST• with values ofFST= 0.69.0.74 and 0.80 for O. niloticus, O. leucostictus and O. esculentus, respectively. Thus, although O. esculentus populations had lower variability, on average, the species was more subdivided than the other two species of the genus Oreochromis. Estimation of gene flow between tilapia spec:ies of tile Lake Victoria basin: The extent of introgression between the introduced Nile tilapia and the endemic form O. esculentus was estimated using specific diagnostic marker alleles. We define diagnostic alleles as bands observed to have a high frequency difference between 'pure' populations of a pair of species. These pure populations are ones that had not been in contact with, or which were much less likely to have been in contact with, or that were geographically isolated from HIl exotic species. 'Fixed' alleles were alleles that had frequency 95% or greater in a particular population. In addition, populations that could be regarded as a possible source of the exotic species, or which was found to be basal to the other populations of the same species in a phylogenetic analysis, were used to assess the extent of gene flow among congeners. Among the O. niloticus populations, alleles in both the Lake Edward and Lake Albert populations that were fixed and specific to O. niloticus were used to estimate the extent of gene introgression of O. niloticus alleles into O. esculentus. Lake Edward and Lake Albert O. niloticus populations are considered as a likely indigenous source of the Nile tilapia in the Lake Victoria basin. To examine gene flow in the direction from O. esculentus into O. niioticus, the O. esculentus population from Lake Kanyaboli was used. Lake Kanyaboli population 'fixed alleles' were used to estimate O. esculentus alleles represented in O. niloticus populations. In Lake Kanyaboli, O. esculentus is the most dominant species, although it is likely that here O. esculentus coexists with some O. niloticus. The estimates of introgression give a qualitative picture of possible hybridization in these lakes. Results are presented in Tables 3 and 4. Populations of a species from lakes that had mixed species showed relatively higher levels of alleles that were specific to the 'pure' populations of the congeneric species, than populations of species that were not co existing or were most dominant. O. niloticus populations had a comparably lower proportion of O. esculentus alleles than the proportion of O. niloticus alleles contained in O. esculentus. Among the O. esculentus populations, Lake Mburo population had the highest percentage of O. niloticus diagnostic alleles and Lake Kanyaboli population had the smallest (Table 3). Among the O. niloticus popuJations. the Lake Nabugabo population. from which 0. esculentus has been extirpated, had the highest share of O. esculentus bands, suggesting substantial hybridization in this restricted habitat, while Lake Victoria had only a very small proportion of O. esculentus specific alleles, suggesting that 0. niloticus was able to out compete 0. esculentus without substantial hybridization and backcrossing to the Nile tilapia invaders. Table 3. Proportion of O. niloticus diagnostic bands which appear in particular populations of O. esculentus. LOCATION % O.n. genes present Lake Mburo 35.27 Lake Kayugi 14.39 Lake Kachira 14.11 Lake Manywa 13.73 Lake Kayanja 12.94 Lake Kanyaboli 6.72 120 Table 4. Proportion of o. esculentus diagnostic bands which appear in particular populations of O. esculentus. LOCATION % O.e. genes present Lake Nabugabo 21.10 Lake Kachira 8.20 Lake Mburo 6.67 Lake Victoria 0.91 DISCUSSION RAPD population analysis: The RAPD technique was reliable and simple to apply. proving to be cost effective and appropriate for population genetic structure analysis. Using eight arbitrary peR primers, 167 random markers were generated for 20 populations. It was useful in studying large numbern populations as well as individuals. The technique revealed substantial nuclear genomic variation, which has been a difficulty in some previous work with Tilapiines. Most variation obtained with other techniques was sufficient only to discriminate among species (Komfield et al., 1979; McAndrew and Majumdar, 1983; Abban. 1988). Capili (1990) and Seyoum and Kornfield (1992) discriminated subspecies of Nile tilapia, o. niloticus, using mitochondrial DNA markers. Franck et al. (1992) used satellite DNA which revealed genetic variability among Tilapiine species. The RAPD technique was used by Bardakci and Skibinski (1994) to differentiate species and subspecies of the Nile tilapia and three other species of the genus Oreochromis in aquaculture. This study represents the first application of RAPD technique to the assessment of variation within and between naturaJly occuning Tilapiine populations and species. Polymorpbism: The significant differences in polymorphism among both O. niloticus populations and o. esculentus populations appears to be due in part to hybridization when populations of these two species co-exist and exotics dominate. Where the species co-exist, populations were more polymorphic than populations that did not overlap. Low polymorphism exhibited by o. niloticus populations from the endemic geographic origins of this species, Lake Albert and Lake Edward, probably indicates the absence of significant gene exchange among Tilapiine species of these lakes. The low levels of heterozygosity exhibited by o. esculentus populations correlate with its highly specialized mode of ecology. This and its relegation to minor isolated water bodies, and severely reduced population sizes in lakes where other TiiapiiDe species were introduced, puts o. esculentus in danger of extinction. This may also account for the higher population subdivision of o. esculentus compared to o. niloticus and 0. leucostictus. However. the latter two still show substantial subdivision. possibly because of small stock sizes that characterized introductions of these exotics into parts of the Lake Victoria region (Balirwa. 1992). There is an imbalance in the proportion of o. esculentus alleles compared to O. niloticus alleles which have f01.md their way into their congener. One explanation is that hybridization may be much greater into O. esculentus from 0. niloticus, with only a small gene flow in the reverse direction. Males of O. niloticus probably hybridize freely with O. esculentus females, while stronger isolating mechanisms prevent o. esculentus males from hybridizing with 0. niloticus females. This could occur by the dominance of O. niloticus both in number and behavior. A 121 " much larger proportion of "0. esculentusn mOIphotypes would have some O. niloticus genetic ancestry. no. niloticus" morphotypes with O. esculentus genes occur only when hybrid females backcrossed to 0. niloticus males. It is possible that hybrid males would still be at a disadvantage to O. niloticus males, but might be acceptable to O. esculentus females. causing more hybrid gene flow into O. esculentus. Greater population sizes associated with O. niloticus would also skew the allele frequencies toward more o. niloticus introgression into o. esculentus than the converse. ACKNOWLEDGMENfS We wish to thank all our colleagues from the Ugandan Fisheries Research Institute for assisting in the collection of some of the samples used in this study. This research was funded by grants from the National Science Foundation (DEB-930006S toPAF and IX and rnT-9308276 to LX.. L. Chapman and C. Chapman). a grant from the Columbus Zoo (to PAF) and a Pew Scholars for Conservation and the Environment Award (to IX) by the Pew Charitable Trusts. REFERENCES Abban, E.K. 1988. Taxonomy and biochemical genetics ofsome African freshwater fish species. Ph.D. Thesis, University of Wales, Wales, UK. Balirwa, I.S. 1992. The evolution of the fishery of Oreochromis niloticus (pisces: Cichlidae) in Lake Victoria Hydrobiologia 232, 8S-89. Bardakci, F., Skibinski, D.O.F. 1994. Application of RAPD technique in tilapia fish: species and subspecies identification. Heredity 73, 117-123. Capili, 1.B. 1990. Isozyme and Mitochondrial DNA Restriction Endonuclease Analysis of Three Strains of 0. ni/oticus. Dissertation, University of Wales. Wales, UK. Dawson, I.K, Chambers, K1.. Waugh, R, Powell, W. 1993. Detection of genetic variation in Hordeum spontaneum population in Israel using RAPD markers. Molecu1ar Ecology 2, 151-159 Franck, 1.P.G, Wright, 1.M, McAndrew, B.I. 1992. Genetic variability in a family of satellite DNAs from tilapia (pisces: Cichlidae). Genome 35,719-72S. Franck, H.C., Komfield, I., Wrigh~ J.M 1994. The utility of SATA DNA sequences for infening phylogenetic relationships among the 1hree major genera of Tilapiine cichlid fishes. J. Mo!. Evo!. 3, 10-16. Fryer, G., Des, T.D. (ed.) 1972. The Cichlid fishes of The Great Lakes of Africa:: their biology and evolution. Oliver and Boyd, Edinburgh. Komfield, I., Ritte, u., Richler, C., Wahnnan, I. 1979. Biochemical and cytological differentiation among fishes of the sea of Galilee. Evolution 33, 1-14. HadIys, H., Balick, M, Schierwater, B. 1992. Application of random amplified DNA (RAPD) in molecular ecology. Molecular Ecology I, SS-63. Kaufman, L.S. 1992. Catastrophic change in species rich freshwater ecosystems: the lessons of Lake Victoria Bioscience 42, 846. Lynch, M, :M:illigan, B.G. 1994. Analysis of population genetic structure with RAPD markers. 122 Molecular Ecology 3, 91-99. McAndrew, B.I, Majumdar. KC. 1984. Evolutionary relationships within three tilapiioe genera (pisces: Cichlidae). Zool. J. Linn. Soc. 80, 421-435. Nelson. I.S. (ed.) 1994. Fishes of the World (3rd Ed). 1. Wiley, New York. Ogutu-Ohwayo, R 1990. The decline of native fishes of Lakes Victoria and Kyoga (E. Africa) and the impact oftbe introduced species especially the Nile perch. Lales niloticus L., and the Nile tilapia. Oreochromis niloticus L. Environmental biology of Fishes 27,81-96. Ogutu-Obwayo. R 1993. The effects of Nile perch. Lates niloticus L, on the fish of Lake Nabugabo, Vr'ith suggestions for conservation of endangered endemic tilapias. Conservation 7. 701-711. RusselI,J.R, Hosein., P .• Waugh, R.Powell,J. 1993. Genetic differentiation cocoa (Theobroma cacoa L.) populations revealed by RAPD analysis. Molecular Ecology 2, 89-97. Seyoum, S .• Komifield, 1. 1992. Identification of the subspecies of Oreochromis niloticus (pisces: Cichlidae) using endonulease analysis ofmitonchondrial DNA. Aquaculture 102. 2942. Stiassny, ML.I 1991. Phylogenetic intrarelationships of the family Cichlidae: an overview. In (Ed,) MH.A, Keeoleyside. Cichlid fishes: behavior. ecology, and evolution.. Chapman and Hall. New York. pp. 1-35. Stiassny, ML.J. 1992. Phylogenetic analysis and the role of systematics in the biodiversity crisis. In (Ed,) N. Eldrege. Systematics, ecology, and biodiversity crisis, Columbia University Press. New York. Trewavas, E. 1982. Generic groupings of tilapini used in aqUaculture. Aquaculture 27,79-81. Trewavas, E. (ed) 1983. Tilapiine fishes of the Genera Sarotherodon, Oreochromis, and Danakilla. Britisb Museum (Natural HistOIY), London No. 878. Williams, lE., Kubelik, A., Kivak, K., Rajalski, I., Tingey, S. 1990. DNA polymorphism amplified by arbitraIy primers are useful as genetic markers. Nucleic Acids Research 18, 6531-6535. Wright, S. 1951. The genetic structure of populations. Annals of Eugenics 15, 323-354. 123 " 124 IDENTIFICATION OF THE PROTEIN PATI'ERN IN THE RESULTING HYBRID AND THE PURE PARENTAL STRAIN OF OREOCHROMIS SPECIES USING IEF. ZaId, M.1. Professor of Aquaculture National Institute of Oceanography and Fisheries, Alexandria Tel. (03) 422-19591 Fax. (03) 545-7611 EI-Gharabawy, M. Assistant Professor of Aquaculture National Institute of Oceanography and Fisheries, Alexandria. Tel. (03) 422-87231 Fax. (03) 545-7611 Ghabrial, S. G. Researcher National Institute of Oceanography and Fisheries, Alexandria. Tel. (03) 854-3471 Fax. (03) 545-7611 Abstract The IEF technique is used as a tool for identification of Oreochromis spp. And its hybrid by the comparative analysis of their protein pattern and separating macro molecules differing in iso-electric points (PI). The similarities of differences of protein pattern between the pure parental species and their hybrid were investigated. This is done by using the genetic markers to distinguish the hybrid from its parents in order to control and identify the brood stock. Introduction: The precise identification offish species is of a prime imponance to c1ariii; the taxonomic position of such species in Egypt as a pre-step for rearing, artificial spawning and hybridization which is required for fish farm. Electrophoresis is the main method for the analysis of the biochemical systematics in various texa. In most cases species were examined for sufficient number of proteins by means of high resolution gradient gel electrophoresis or polyacrylamide gel isoelectric focusing, species-specific protein patterns were found (EI-Gharabawy & ZaId, 1990 and EI-Gharabawy et al., 1995). There are relatively few biochemical studies on fish soluble muscle tissue proteins and knowledge in tbisregard isstill fragmentaIy (O'Maoileidigh etal., 1988 and Basaglia, et al., 1991). Identification of Oreochromis spp. which are used in the aquaculture techniques according to their morphological differences is not completely satisfactory. The present study aims to test the possibility ., 125 of using isoe1ectric focusing technique as a tool for identifying the species under consideration and its hybrid by the comparative analysis of their soluble protein of muscle and gill. Materials and Methods: A sample of muscle was taken from both Oreochromis niloticus and Oreochromis aureus and their hybrid after 12 and 30 days. Also, the same weight was obtained from the gill of both species and their hybrid (0.5 gm), each was homogenized with 5 mI Tris-HCi buffer (PH 8.(0). The homogeoates were centrifuged at 6000 rpm for 10 minutes. The clear supernatant was pipetted and kept frozen. Silver staining technique method ofHeukeshoven and Demick (1985) was applied. Technical procedure for sample application and isoelectric points (PI's) of protein were perlbnned as described by Pharmacia LKBC (1987). Results and discussion: According to the pH gradient from 3 to 9, twenty seven protein fractions were separated in Oreochromis niloticus muscle and exhibited a distinct electrophoretic pattern which could be clearly identified at PI's 4.3 and 8.5 . Twenty eight protein fractions were separated in Oreochromis aureus muscle and may be identified by its bands at PI's 9.25 from a total of twenty eight protein fractions. As shown in Fig. (1), each of the examined tissue exhibited a distinct electrophoretic pattern and could be clearly differentiated. Twenty seven protein bands were isolated from the gill ofo. niloticus which could be identified by the specific boods at PI's 00.83, 5.30, 6.43, 7.75, 9.10 ood 9.20 . Also O. auTeuS had twenty seven gill protein fractions with a specific bands at PI's of 5.25, 6.90, 7.53 and 8.25 . However, twenty nine protein fractions were separated from the gill of the hybrid. From Fig. (la & b) and Fig. (2), it appears that there are definite variations between electrophoretic patterns of both muscles and gills of the different species of Oreochromis and their hybrid. Twenty protein fractions were separated from 0. niloticus fly and exhibited a distinct electrophoretic pattern and identified at PI's of 5.85 and 8.30 . Hybrid after 12 days had twenty protein fractions and Moited • distinct bood at PI's 5.60, 6.50 ood 6.60 . However, the hybrid of age 30 days had twenty two protein fractions and exhibited a distinct band at PI's 3.73, 4.20, 4.78, 5.15 and 6.60. O. niloticus and O. aureus were found to be the most suitable species fur aquaculture in Egypt. Crossing male 0. aureus with female 0. niloticus Results in a hybrid of at least 80% males which are characterized by having higher growth rate than their parents. Wohlfarth et al., 1983 showed that the hybrid ofO. ni/oticus and O. aureus. posses the best combination of production traits among a number of inter specific hybrid under condition ofIsmeli aquaculture. The use of biochemical methods such as isozyme and protein electrophoresis techniques as measures fur species identification have been widely applied in fish (El-Deeb, 1983; Basagtia 1992 and El Garabawy et aL,1995). Nieder and Bussse, (1992) studied the blood sera of9 species ofBlenniidae. They found that band patterns in electeopherograms are constant in each species and differ characteristically between species. The number of protein bands for the fry of 0. niloticus, hybrid of age 12 days and the hybrid of age 30 days, could be identified at certain PI values regardless of the total number of bands. 126 -t 3.50 (Amyloglucosidase) --t 5.85 (Bovine carbonic) anhydrase p --t 6.55 (Human carbonic) --t 6.85 (Horse myoglobin-acidic) --t 7.35 (Horse myoglobin-basic) --t 8.50 (Lentil lectin-acidic) ... 8.45 (Lentil lectin-middle) ... 8.65 CLentil.lectin-basic) --t 9.30 (Trypsmogen) ab cdsterst Figure l(a).1EF ofphast gel (IEF 3-9) of protein in Oreochromis species.a., c and e (flesh of hybrid, O. niioticus and 0. aureus). b. d and f(gills of hybrid. O. niloticus and O. aureus) respectively, St (standard protein from 3-10). Figure 1(b). IEF ofphast gel (IEF 3-9) of protein pattern in muscle ofOreochromis species. a (0. nI/oticus adult), b (0. aureus adult), c & d (0. ni/oticus fry), e & f(hybrid after 12 & 30 days) and St (standard protein). 127 Fig. (2): The electrophoretograms and densitograms of flesh and gills of Oreocluomis species: a, b, c, d, e and f (muscles of O. niloticus, O. aureus, hybrid after 3 months, O. niloticus Fry, hybrid after 12 days and hybrid after 30 days), g, h and i (gills of O. niloticus, O. aureus and hybrid). (a) (b) (c) (d) (e) (f) I r ,,~ " r 1 128 We would like to notify that the resulting hybrid has specific bands, which are biased to the female gamete, a similar result obtained by Ghabrial, (1990) on the developmental criteria of embryological stages of the same species. Fig.(2) continued. References: BBsBglia, F. & Marchetti, M. G., (1991). Study of the soluble white muscle tissue proteins from fifteen Sparidae species. Journal ofFish Biology, 38:763-77]2. Basaglia, F., (1992). Comparative examination of soluble red muscle proteins of fifteen Sparidae species. Journal ofFish Biology; 40: 557-566. EI-Deeb, S. L, (1983). Genetical studies on Tilapia spp. PH.D. Thesis Faculty of Agriculture, Alexandria University 180 pp. El-GbarabBWY, M. M. & Zaki, M. L, (1990). Comparative study of protein pattern in gonads and pituitary gland ofMugil capito in relation to maturation stage using phast system isoelectric focusing. Assiut Journal of Agricultural Sciences: 21(3): 283-299. El-Gharabawy, M. M.; Zaki, M. I; Salem, S. B.; El-Sborbagy, L K. and El-Boray, K. F., (1995). Changes in electropharetic patterns of gonad and plasma proteins during maturation stages in MugU seheli in Suez Bay. Assiut Journal of Agricultural Sciences, 26(2): 153-\70. Ghabrial, S. G., (1990). "Induced Spawning and developmental criteria of two Oreochromis spp. and their hybrid". M.Sc. Thesis submitted to the Faculty of Science, Alexandria University 101 pp. Heukeshoven, J. & Demick, R., (1985). Simplifies method for silver staining of proteins in polyacrylamide gels and the mechanism of silver stainging. Electrophoresis; 6: 103-112. Nieder, J & Bwse,. (1992). Remarks on the systematic of the tribe Parablenniini based on blood Serum Electrophoresis (pisces: Blenniidae). Z. zoo!. Syst. Evolut.-forsch. 30 (1992) 123-128. O'Maileidigh, N.; Cawdery, S.; Bracken, J. J. and FergwlOD, A., (1988). Morphometric, meristic character and electrophorectic analysis of two Irish populations of twaite shad, Alosa fallax (Lacepede). Journal ofFish Biology; 32: 355-366. Pharmacia, L. K. B., (1987). Phast system Ovmer's manual Biotechnology Inc. Piscatawy, N.Y. 08855. Uppsala Sweden. Wohlfarth, G.; Hulata, G.; Rothbard, S.; Joseph, Land Amir, R, (1983). Comparisons between Interspecific Tilapia hybrids for some production traits. International Symposium on YLiapia in Aquaculture Proceedings, May 8-13,1983. In Israel. 129 130 GENE-CENTROMERE RECOMBINATION RATES OF ALLOZYME LOCI IN EVEN AND ODD YEAR PINK SALMON Makoto P Matsuoka Juneau Center, School of Fisheries and Ocean Sciences, University of Alaska Fairbanks 11120 Glacier Highway, Juneau, AK 99801, U.S.A. Tel (907) 465-63261 Fax (907) 465-6447IE-mail [email protected] l Anthony J. Gharrettll, Richard L. Wiimoe), Patricia A Crandell]), William W. Smoker ) I) Juneau Center, School of Fisheries and Ocean Sciences. University of Alaska Fairbanks 11120 Glacier Highway. Juneau, AK 99801, U.S.A. Tel (907) 465-63261 Fax (907) 465-6447 2) Auke Bay Laboratory, Alaska Fisheries Science Center, National Marine Fisheries Service National Oceanographic and Atmospheric Administration 11130 Glacier Highway, Juneau AK 9980]-8626, U.S.A. Introduction Gene-centromere recombination rates can be estimated in gynogenetic diploid progeny in which the second polar body of the oocyte is retained by heat-shock or hydro-static pressure treatment. In analyzing these data, it is assumed that at firsl meiosis (1) separation occurs always between homologous chromatids, (2) crossovers occur only between homologous chromatids, and (3) only one crossover occurs on one chromosomal arm (Volpe, 1970). As a result, the genotype of a pallicular locus of a gynogenetic diploid progeny from a heterozygous maternal parent is a homozygous if there is no recombination between the locus and the centromere, but heterozygous if there is recombination. The rate of appearance of heterozygous progeny reflects the rate of recombination. In addition, if recombination occurs at any site on a chromosome with equal probability, the rate of recombination reflects the relative distance between the locus and the centromere. Earlier work for gene-centromere mapping using gynogenesis in vertebrates were conducted in the leopard frog, Rana pipiens, with mutant alleles (Nace et al., 1970; Volpe 1970). As far as we know, 28 studies in more than 15 fish species have been reported using not only aUozyme loci but also mutant alleles and microsatellite loci. In previous studies, recombination rates at some loci were estimated as close as 1. This result suggests that exactly one crossover takes place between the gene and the centromere on the chromosome arms carrying these loci. The phenomenon is commOn in fish bur unusual in other animals and plants (Thorgaard et ai., 1983). The result has been explained by a high level of chiasma interference, in which the first chiasma interferes with the formation of the next chiasma, because the size of fish chromosome is relatively small (Thorgaard et aI., 1983). 131 In this study, we estimated gene·centromere recombination rates of aUozyme loci in even and odd year pink salmon, Oncorhynchus gorbuscha. using gynogenetic progeny. We compared the estimates between families within a locus and between years within a locus. MateriRls and Methods Gametes and tissue sample collections: All materials for this project were obtained from the Gastineau Hatchery, Douglas Island Pink and Chum, Inc. (DIPAC), Juneau, Alaska. Production of families was conducted for two consecutive years, 1992 and 1993. In each year, eggs from 80 females and sperm of chinook salmon, 0. tshawytscha. were used for gynogenesis. Tissues of muscle. heart. liver, and eye were taken for electrophoresis then stored at -80aC. Production of gynogenetic progeny families: The procedure for production of gynogenetic diploid famllies was according to Smoker et aJ. (1995). In total, eighty gynogenetic diploid families were produced each year. Ten eggs of each female were not treated for the retention of the second polar body and were incubated as haploid control groups. Sampling: Samples of alevins and fry for electrophoresis were stored at -800C until analysis. Electrophoresis: Horizontal starch gel electrophoresis and histochemical stain techniques (Utter et aJ. 1986) were employed. Frozen samples from parental fish for 61 loci of 32 enzymes were analyzed first (Table 1). From these data, the most useful families for analysis were chosen. For gene-centromere analysis. at least three families (when possible) were examined for each locus. Table I. Protein-coding loci for enzymes resolved in this study and the tissues and buffers in which they were resolved. Enzyme name E.C. Locus Tissues Buffer Variability Number 0) OJ (3) Acid phosphatase 3.1.3.2 ACP' L TG n Aconitate hydratase 4.2.1.3 mAH-I* H CAME7.2 E mAH-2· H CAME7.2 n mAH-3* M,H CAME7.2 0 mAH-4· M,H CAME7.2 B sAH'" L CA6.8 E Adenosine deaminase 2.7.4.3 ADA-J· M,H CA6.1 n ADA-2· M,H CA6.1 B Alanine aminotransferase 2.6.1.2 ALAI" M MF 0 Aspartate aminotransferase 2.6. J.I mAA T-I * M,H CA6.1 E mAAT-2' M,H CA6.1 E sAAT-I,2' M,H CA6.1 n .s:AAT-3* E TC B sAAT-4* H,L CAME7.4 B Creatine kinase 2.7.3.2 CK-AI' M R n CK-A2' M R n CK-S' E R n CK-CJ' E R E CK-C2' E R n 132 Table.l (continued} Enzyme name E.C. Locus Tissues Buffer Variability Number u, 0' ~, Diaphorase 1.8.1.4 DlA-J' E CAME7.2 B DIA-2* E CAME7.2 E Fumarate hydratase 4.2.1.2 FH' M TC n Formaldehyde dehydrogenase 1.2.1.1 FDHG' M,H R 0 ~-Galactosidase 3.2.1.23 {3GAU' E TG n Glutathione reductase 1.6.4.2 GR' E TC-4 n GlyceraJdehyde-3-phosphate 1.2.1.12 GAPDH-J' H,E CAME7.2 n dehydrogenase GAPDH-]' H,E CAME7.2 n Glucose-6-phosphate isomerase 5.3.1.9 GPi-A' M,H,E R E GPi-BJ,]' M,H,E R B Glycerol-3-phosphate 1. 1. 1.8 G3PDH-J' M CA6.! B dehydrogenase Guanine deaminase 3.5.4.3 GDA'" L CAME7.4 B L-Idotol dehydrogenase 1.1.1.14 lDDH' L R B lsocitrate dehydrogenase 1.1.1.42 mlDHP-l'" M CA6.1 n mIDHP-2* M CA6.1 n sIDHP-l,2'" E,L TC B L-Lactate dehydrogenase 1.1.1.27 WH-AJ' M R E WH-A2'" M R n WH-BJ' H R n LDH-B], L R E LDH-C' E R n Malate dehydrogenase 1.1.1.37 mMDH-l'" M CA6.1 n sMDH-Al,2'" M,H,E CAME7.2 E sMDH-BJ,] , M,H CAME7.2 B Malic enzyme 1.1.1.40 sMEP-l'" M,H CAME7.2 B Mannose-6-phosphate isomerase 5.3.1.8 MPI'" H,E MF B a-Mannosidase 3.2.1.24 a-MAN'" H TC-4 n Peptidase 3.4. "'. '" Glycyl-leucine PEP-A' M MF 0 Leucyl-glycyl-glycine PEP-B' M MF B Phenylalanyl-proline PEP-DJ' M MF n PEP-Dl' M MF B Leucyl-Iyrosine PEP-LT' M MF B Phosphoglucomutase 5.4.2.2 PGM-]' M CA6.1 B Phosphoglycerate kinase 2.7.2.3 PGK' E,L TG n Phosphogluconate dehydrogenase 1.1.1.44 PGDH' M,L CA5.7 B Pyruvate kinase 2.7.1.40 PK-J' E TC n PK-]' E TC 0 Superoxide dismutase 1.15.1.1 sSOD'" M,H MF n Triose-phosphate isomerase 5.3.1.1 TPI-l'" E TG n TPI-2'" E TG n TPI-3'" E TG n TPl-4' E TG B 133 (1) M = muscle, H = heart, L = liver, E = eye. (2) R (Ridgway et al. 1970), MF (Markert and Faulhaber 1965), TG (0.04M Tn" 0.12M Glycine), CA5.7, 6.1 and 6.8 (Clayton and Tretiak 1972), CAME7.2 and 7.4 (Aebersold et al. 1987), TC (Shaw and Prasad 1970), TC-4 (Schaal and Anderson 1974). (3) E = even year only, 0 = odd year only, B = both even and odd year, n = no variation. Statistical analysis: First, whether the ratio of the number of two types of homozygotes is 1:1 among progeny was tested using the x2-test. Any family with a different ratio was removed from the further analysis. Second, heterogeneity between families within a locus was analyzed using x2-test for n x 3 (n is the number of families) contingency table. Finally, heterogeneity between years within a locus was compared using x2-test for 2 x 3 contingency table. Results and Discussious The recombination rates were estimated for 29 loci in the even year and 24 loci in the odd year and 34 loci (53 loci groups) in combined years (Table 1). One family out of 111 families examined in the even year and 11 families out of 120 families in the odd year were removed from the further analyses because of departure from 1:1 ratio of the two types of homozygous progeny. The recombination rates at each locus of the pooled data ranged from 0.5% at MPJ* in the odd year to 99.6% at ADA-l* in the even year (Table 2). Average recombination rate was 60.5% in the even year, 67.8% in the odd year and 63.8% in combined years. Fourteen loci groups out of 53 groups had a recombination rate above 90%. The appearance of loci with a high recombination rate is a common phenomenon in previous studies offish. Test for heterogeneity between families was conducted in 36 loci groups, and in 20 loci groups heterogeneity was observed (Table 3). Out of 20 loci groups which showed heterogeneity, 16 groups were homogeneous after one outlier family was removed and one group was homogeneous after two families were removed. At sMDH-l,2* and sMDH-3,4* in the even year, the families were divided into roughly two groups by the recombination rates (Table 4 and 5). However, at sMDH-3,4* in the odd year, the recombination rates ranged between 91.1 and 100.0%. (no statistical test was conducted because of the small expected values; Table 5). Because these loci are isoloci (duplicated loci), one possible explanation for the differences is that the variation occurred on different loci of the duplicated loci. At mAH-3* in the odd year, the recombination rates were from 11.0% to 72.8% (Table 6). The differences between families were similar to those reported in rainbow trout and could result from differences in the rate of recombination, differences in the amount of interference, chromosomal rearrangements, differential survival of genotypes, or statistical chance (AJlendorf et al 1986). In pink salmon, variation between even and odd year in chromosome number and rearrangements have been reported (Phillips, R.B. and A.R. Kapuscinski 1987 and 1988). The variation at this locus might result trom chromosomal rearrangement. 134 Heterogeneity between strains has been tested in rainbow trout. but the results were not consistent (Guyomard 1984; Thompson and Scott 1984; Allendorfet aI., 1986). To clarifY the nature of the differences between year groups (or strains), continuous studies over generations with multiple strains would be necessary. Table 2. Summary of gene-centromere recombination rates and heterogeneity between fam'ilies within a locus in even and odd xear E:ink salmon. Even z:ear Odd lear # of family # offamily Locus examined n G-C rate examined n G-C rate AAT-3* 5 589 67.9 4 588 68.9 AAT-4* 2 99 87.9 4 299 91.6 mAAT-i* 2 374 63.6 mAAT-2* I 230 80.9 ADA-2* 5 686 99.6 5 285 97.5 mAH-l* 62 81.9 mAH-3* 4 456 46.7 mAH-4* 5 492 95.9 3 180 87.2 sAH-l* I 127 81.9 ALAT' 2 186 89.8 CK-4' 231 39.4 DIA-J* 43 27.9 7 584 77.4 DIA-2· 2 182 98.4 FDHG' 5 428 78.3 GDA' 7 513 37.4 3 284 40.5 G3PDH-J' 10 1279 95.1 4 432 92.8 GPf-I,2* 223 93.7 GPI-3' 225 91.6 2 270 94.4 iDDH' I 15 53.3 I 90 67.8 sIDHP-J,2* 9 892 67.3 II 957 71.5 LDH-AJ' 2 268 1.9 LDH-B2' 127 5.5 sMDH-I,2' 5 552 14.9 sMDH-3,4* 6 528 85.4 II 1064 96.9 sMEP-I* 9 739 96.5 3 315 94.3 MPI· 3 408 11.0 I 183 0.5 PEP-A· I 168 75.0 PEP-BI· 3 254 6.3 3 270 21.5 PEP-D2· 13 879 91.9 12 829 88.7 PEP-L)' 7 557 42.9 6 530 45.7 PGDH' 4 350 68.3 9 959 72.0 PGM-2' I 229 40.6 6 544 19.1 PK-2' 273 46.5 TPI-4* 228 26.8 179 62.6 " 135 Table 3. Summary of the statistical tests for heterogeneity between families within locus and between ~ears. Between families Between :tears Locus Even~ Odd rear AAT-3'" + AAT-4· + mAAT-l* + mAAT-r # ADA-2' +++ mAH-l'" # mAR-3'" +++ mAH-4"" + +++ +++ sAH-J' # ALAT' CK-4* # DIA-I· # + +++ D1A-2* FDHG'" GDA' +++ G3PDH-I' ++ +++ GPJ-I,2' # GPI-3' # IDDH' # # sIDHP-l,2'" LDH-AI' WH-H2' # sMDH-l.r +++ sMDH-3,4'" +++ $ + sMEP-l* ++ MP/· + # +++ PEP-A' # PEP-BI' +++ PEP-m' + + PEP-LT' +++ PGDH" + ++ PCM-]'" # +++ PK-]· # TPl-4' # # +++ Blank: homogeneous; +: heterogeneous at O.005 136 Table 4. Recombination rates at sMDH-l.r in even year pink swmon. Family number Number of progeny Recombination rate examined (%) 33 86 0.0 34 76 2.6 70 88 13.6 19 88 21.6 50 214 22.9 Table 5. Recombination rates at s'MDH-3,4· in even and odd ~ear pink: salmon. Even rear Odd rear Family Number of Recombination Family Number of Recombination number progeny rate (%) number progeny rate (%) examined examined E-72 88 61.4 0-21 90 91.1 E-62 88 67.0 0-10 168 91.7 E-40 88 85.2 0-16 90 94.4 E-47 88 98.9 0-20 131 97.7 E-21 88 100.0 0-31 90 98.9 E-66 88 100.0 0-49 90 98.9 0-71 90 98.9 0-9 90 100.0 0-26 45 100.0 0-50 135 100.0 0-80 45 100.0 Table 6. Recombination rates at mAR-3· in odd year pink: swmon. Family number Number of progeny Recombination rate examined (%) 73 liS 11.0 8" 179 14.5 6 90 44.4 9 90 50.0 44 158 72.8 •• In this family, a ratio of the number of two homozygotes was not 1:1. 137 References Aebersold, PB, GA Winans, DJ Teel, GB Milner, and FM Utter 1987 Manual for starch gel electrophoresis: A method for the detection of genetic variation. NOAA technical report NW"S No. 61. US Depanment of Commerce, National technical infonnation service, Springfield, Virginia, 19p. Allendorf, FW, 1£ Seeb, KL Knudsen, GH Thorgaard, and RF Leary 1986 Gene·centromere mapping of25 loci in rainbow trout. J. Hered. 77:307-312. Clayton, JW and DN Tretiak 1972 Amine-citrate buffers for pH control in starch gel electrophoresis. 1. Fish. Res. Board Can. 29: 1169-1172. Guyomard, R 1986 Gene segregation in gynogenetic brown trout (Salma trutlaL.): systematically high frequencies of post-reduction. Genet. SeL Evol. 18(4):385-392. Marken, CL and T Faulhauber 1965 Lactate dehydrogenase isozyme patterns offish. J. Exp. Zool. 159:319-332. Nace, GW, CM Richards, and JH Asher, Jr. 1970 Parthenogenesis and genetic variability. I. Linkage and inbreeding estimations in the frog, Rana pipiens. Genetics 66:349-368. Phillips, RB and AR Kapuscinski 1987 A Robensonian polymorphism in pink salmon (Oncorhynchus gorbuscha) involving the nucleolar organizer region. Cytogenet. Cell Gent. 44:148-152. Phillips, RB and AR Kapuscinski 1988 High frequency of translocation heterozygotes in odd year populations of pink salmon (Oncorhynchus gorbuscha). Cytogenet. Cell Genet. 48:178-182. Ridgway, GJ, SW Sherburne and RD Lewis 1970 Polymorphisms in the serum esterases of Atlantic herring. Trans. Am. Fish. Soc. 99:147-151. Schaal, BA and WW Anderson 1974 An outline of techniques for starch gel electrophoresis of enzymes from the American oyster Crassostrea virginica Gmelin. Georgia Mar. Sci. Cent. Tech. Rep. 74-3. Shaw CR and R Prasad 1970 Starch gel electrophoresis of enzymes: A compilation of recipes. Biochemi. Genet. 4:297-320. Smoker, WW, PA Crandell, and M Matsuoka 1995 Second polar body retention and gynogenesis induced by thermal shock in pink salmon, Oncorhynchus gorbuscha (Walbaum). Aquaculture and fisheries management. 26:213-219. Thorgaard, GH, FW Allendorf, and KL Knudsen 1983 Gene-centromere mapping in rainbow trout: high interference over long map distances. Genetics 103 :771-783. Thompson 0, CE Purdom, and BW Jones 198} Genetic analysis of spontaneous gynogenetic diploids in the plaice Plellronecles plalessa. Heredity 47(2):269-274. Utter, FM, PB Aebersold, and GA Winans 1986 Interpreting genetic variation detected by electrophoresis. In: Population genetics and fishery management (N. Ryman and F. Utter, eds.). University of Washington Press, Seattle, WA, pp.21-45. Volpe, EP 1970 Chromosome mapping in the leopard frog. Genetics 64:11-21. 138 USING MrfOCHONDRIAL AND NUCLEAR DNA TO SEPARATE HATCHERY AND WILD STOCKS OF RAINBOW TROUT Jennifer L. Nielsen USDA Forest Service and Stanford University Hopkins Marine Station Pacific Grove, CA 93950 (408) 655-6233 FAX (408) 375-0793 [email protected] Abstract Highly polymorphic nuclear microsatellites and control region mitochondrial DNA (mtDNA) sequence were used to differentiate hatchery and wild stocks of rainbow trout (Oncorhynchus mykiss) throughout California and in Baja. While mtDNA sequence divergence demonstrated significant biogeographic distributions of wild trout throughout California and Mexico, hatchery stocks were shown to carry mtDNA haplotypes identical to the wild trout in their area of origin. Nuclear DNA surveyed as microsatellite repeat polymorphisms did, however, provide significant rigor in the separation of geographically proximate populations of hatchery and wild trout in the upper Sacramento River, coastal populations of trout in southern California, Kern River basin rainbow trout, and trout from Baja California. Introduction Genetic studies have demonstrated mixed results for shifts in genetic diversity between wild and hatchery trout. Some allozyme studies have suggested no loss of genetic variation due to artificial propagation of trout in hatcheries (Busack et al., 1979; Gall 1993). Whereas, other studies demonstrated significant losses of genetic variability in hatchery stocks (Allendorf and Ryman 1987 and references therein). More recently, mtDNA studies have shown significant genetic differences between sympatric populations of hatchery and wild stocks of coastal steelhead (Nielsen et al. 1994a), brown trout (Hansen et al. 1995), and Atlantic salmon (Hindar et al. 139 1991}. The genetic consequences of hatchery broodstock programs appear to be directly related to differences between selective regimes in the captive and natural environments (Waples and Do 1994; Ryman 1994). In this study we investigate differences in genetic diversity between sympatric populations of hatchery and wild trout in California and Baja using mtDNA and nuclear microsatellite loci. Material and Methods Wild rainbow trout populations were sampled non-invasively by collecting small (2 mm2) segments of fin tissue from live fish. Fin-clips from hatchery trout were sent to our laboratory by managers from the representative hatcheries. Hatchery samples included representatives from different rainbow trout stocks used in production at each facility. DNA extraction and amplification followed protocols published in Nielsen et al. 1994a (mtDNA), and in Nielsen et al. 1994b (microsatellites). Microsatellite repeats used in this study were characterized in Nielsen 1996 and Nielsen et al. 1996. Statistical analyses of allelic frequencies were performed using a Markov chain adaptation of the Fisher's exact procedure (Raymond and Rousset 1995). This test gives the probability of rejecting the null hypothesis: the allelic distribution is independent across populations. Results We found 16 unique mtDNA haplotypes in California and Baja rainbow trout populations (Table I). Comparisons between sympatric hatchery and wild stocks of rainbow trout gave different results from those reported earlier for anadromous steelhead from similar localities (Nielsen et al., 1994a). Unlike our steelhead results mitochondrial haplotype diversity was found to be higher in most wild trout populations than in geographically proximate hatchery stocks (Table 2). Hatchery rainbow trout stocks that were consistently dominated by only two mtDNA haplotypes (MYSI and MYS3). The dominant mtDNA haplotype in most California hatchery stocks proved to be identical to the wild-trout haplotype found today in the McCloud River near the location where rainbow trout hatchery stocks originated in California at the turn of the century, Baird Station (Busack and Gall 19BO; Figure I). The apparent lack of recent mtDNA divergence in either hatchery or wild rainbow trout made haplotype diversity a poor discriminating tool for discerning trout origins in mixed populations. 140 Table 1. Mitochondrial DNA control region variable sites and nucleotide changes in California and Baja trout. Variable nucleotides are given in bold. base pair no. 65 86 94 96 130 148 149 151 154 194 196 JLN '94 mtDNA 1021 1044105010521086110311041106110911471149 Digby ~ '92 MY51 T G T T T A G A G G C Baja T G T T T A G A G G C MY52 C G T T T A G A G G C MY53 T G T T T A G A A G C MY54 T G T T C G G A G G C MY55 T G T T C G G C G A C MY56 T G C T C G G C G A C MY57 T G T T C A G A G A C MY58 T G T T C A G C G A C MY59 T G T T T A G A G A C MY510 T G T C T A G A A G C MY511 T A T T T A G A G G C MY512 T G T T C A G C G G C MY513 T G T T C G G C G G C MY514 C G T T T A G A A G C MY515 T G T T T A A A A G C MY516 T G T T T A G A G A T Table 2. The number of Oncorhynchus mykiss mtDNA haplotypes found in wild and hatchery populations of anadromous and resident trout collected north and south of San Francisco Bay, and in resident trout from Baja CA. Number of unique haplotypes Anadromous trout Resident trout wild hatchery wild hatchery Location only onl:z:: only ani:! Northern California 1 5 4 1 Southern California 1 5 6 1 Mexico no no na All trout populations 2 10 11 2 141 1 • McCloud wild 0.9 trout O.B 0.7 o hatchery trout u .,'"c 0.6 0.5 .,'"cr ... 0.4 .... 0.3 0.2 0.1 0 3 9 10 12 mtDNA haplotype Figure 1. Mitochondrial DNA haplotype frequencies in McCloud River wild trout (N=73) and 3 common rainbow trout stocks (Mt. Shasta, Hot Creek, and Whitney strains) produced at the Mount Shasta Hatchery (N=96). Trout were sampled at both locations 1993-1995. Table 3. The number of Oncorhynchus mykiss microsatellite alleles found only in wild or hatchery trout populations north and south of San Francisco Bay, and from Baja California for three to five microsatellite loci. Number of unique alleles Microsatellite Locus OrrTj77 OrrTj2 OrrTj27 wild hatchery wild hatchery wild hatchery Location only only only only only only Northern California 3 3 12 0 2 1 Southern California 7 1 14 3 na na Mexico 1 12 na na na na An trout populations 1 1 13 2 2 Mlcrosatellite Locus OrrTj207 Ssa2B9 wild hatchery wild hatchery Location only only only only Northern California 3 0 2 0 Southern California 1 2 6 2 1 Mexico 2 10 1 4 All trout populations 1 3 2 142 Omy207 Locus • Kern River rainbow 0.3 N·54 San Joaquin Hatchery 0.25 o N.82 0.2 :n 0.05 o ON~N~mOV~ON~mN~~O~ mmm~~~OOO ____ NNN~~ allele size (bp) Figure 2. Allelic frequency distribution for microsatellite locus Omy20? in Kern River rainbow trout and trout stocks from the San Joaquin Hatchery. Microsatellite analyses of the same rainbow trout used in our mtDNA study gave similar results for hatchery and wild rainbow trout, with the greatest genetic diversity found mostly in wild populations (Table 3). Fisher's exact comparisons of geographically sympatric hatchery and wild trout populations gave highly significant support for population independence (Table 4). This trend in wild trout allelic diversity was due to two separate factors that varied among our comparisons for the five microsatellite loci. The most common difference between hatchery and wild allelic distributions was due to a significant number of larger sized alleles that were found at low frequencies in wild trout but not in hatchery stocks for several microsatellite loci (Omy2, Omy??, and Omy20?; Figure 2). The second factor contributing to microsatellite allelic 143 Locus = Omy77 0.7 • Baja rainbow trout 0.6 o Shasta Hatchel)' • Filmore Hatchery 0.5 Ii] San Joaquin Hatchery => ~ 0.4 ".,. ...E 0.3 0.2 0.1 o allele size (bp) Figure 3. Microsatellite allelic frequency distribution for Baja trout and 3 rainbow trout hatchery populations for locus Omy77. Table 4. Fisher's exact paired comparisons of allelic frequency between hatchery and wild populations of trout for three microsatellite loci combined (Omy77, Omy207, and Ssa2B9). Population pair fisher's p ') Sacramento River trout and Shasta Hatchel)' <0.001 2) South coastal trout and Filmore Hatchery <0.001 3) Kern River trout and San Joaquin Hatchery <0.001 4) Baja trout and Shasta Hatchery <0.001 and Filmore Hatchery <0.001 and San Joaquin Hatchery <0.001 5) All wild trout <0.001 and all hatchery trout 144 frequency differences was the dominance of one or more unique alleles, found in wild populations but not at all in hatchery trout (Omy2?, Omy20?, and Ssa289). One notable exception of this trend in wild trout microsatellite allelic diversity was found in Baja California. Trout from Baja have long been considered a separate sub-species, Oncorhynchus mykiss nelsoni (after Behnke 1992). These molecular genetic analyses showed that the Baja trout shared a mtDNA haplotype with the most abundant coastal steelhead found in northern California and the haplotype fixed in the Mount Shasta Hatchery rainbow trout strain (MYS 1; see Nielsen et al. 1994b for steelhead haplotypes). Microsatellite allelic distributions for Baja trout were not highly polymorphic, with very few alleles found at every microsatellite locus we examined, suggesting a highly bottlenecked population. Microsatellite alleles that dominated the Baja populations were frequently unique to this population, however, supporting their sub-species status (Figure 3). Conclusions Mitochondrial DNA and nuclear microsatellites show differences in the level of genetic diversity found between hatchery and wild populations of salmon ids. In anadromous steelhead stocks mtDNA was more diverse in hatchery populations, probably due to the introduction of geographically divergent haplotypes during fish transfers from hatchery to hatchery. For resident rainbow trout in California, the reverse was found to be true, with increased genetic diversity for both mtDNA and microsatellite alleles found in most wild trout populations when they were compared to geographically proximate hatchery stocks. The McCloud River rainbow trout stand out as an exception to this rule. Wild trout microsatellite allelic diversity proved to be the result of two separate factors: an increase in the number of rare large-sized alleles found in wild stocks for several microsatellite loci; and the OCCurrence at high frequencies of unique alleles found only in wild stocks for other microsatellite loci. Baja trout shared a mtDNA haplotype with the most common steelhead trout in northern California, the McCloud River wild trout, and all of the trout in the Mount Shasta Hatchery strain. Baja trout were, however, unique in their microsatellite allelic diversity, with several alleles dominating this population that were never found in hatchery stocks or in other wild population of California rainbow trout. 145 These results support the need to examine multiple loci and several independent genes or nucleotide segments from both mtDNA and the nuclear genome before reaching conclusions about genetic differences between hatchery and wild stocks of rainbow trout. References Allendorf, F. W. and N. Ryman. 1987. Genetic management of hatchery stocks. Pages 141-159 in N. Ryman and F. Utter (eds.) Population Genetics and Fishery Management Univ. Washington Press, Seattle, WA. 8ehnke, R. J. 1992. Native Trout of Western North America. American Fisheries Society Monograph 6. 275 pp. 8usack C. A., R. Halliburton and G. A. E. Gall. 1979. Electrophoretic variation and differentiation in four strains of domestic rainbow trout (Salmo gairdnen). Can. J. Genet. Cytol. 21 :81-94. 8usack, C. A. and G. A. E. Gall. 1980. Ancestry of artificially propagated California rainbow trout. Calif. Fish and Game 66(1 ):17-24. Digby T. J., Gray, M. W., and Lazier, C. 8. 1992. Rainbow trout mitochondrial DNA: sequence and structural characteristics of the non-coding region and flanking tRNA genes. Gene 118:197-204. Gall, G. A. E. 1993. Genetic changes in hatchery populations. Pages 81-91 in J. G. Cloud and G. H. Thorgaard (eds.) Genetic Conservation of Salmonid Fishes. Plenum Press, New York. Hansen M. M., R. A. Hynes, V. Loeschcke, and G. Rasussen. 1995. Assessment of the stocked or wild origins of anadromous brown trout (Salmo trutta L.) in a Danish river system, using mitochondrial DNA RFLP analysis. Mol. Ecol. 4:189-198. Hindar K., N. Ryman, F. M. Utter. 1991. Genetic effects of cultured fish on natural fish populations. Can. J. Fish. Aquat. Sci. 48:945- 957. Nielsen, J. L. 1996. Molecular genetiCS and the conservation of salmonids biodiversity: Oncorhynchus at the edge of their range. 146 In T. B. Smith and R. K. Wayne (eds.) Molecular Genetics in Conservation. Oxford Press (in press). Nielsen, J. L., C. Gan, and W. K. Thomas. 1994a. Differences in genetic diversity for mitochondrial DNA between hatchery and wild populations of Oncorhynchus. Can. J. Fish. Aquat. Sci. S1 (Suppl. 1 ):290-297. Nielsen, J. L. C. A. Gan, J. M. Wright, D. B. Morris, and W. K. Thomas. 1994b. Biogeographic distributions of mitochondrial and nuclear markers for southern steelhead. Mol. Marine Bio. Biotech. 3:281- 293. Nielsen, J. L. M. C. Fountain, and J. M. Wright. 1996. Biogeographic analysis of Pacific trout (Oncorhynchus mykiss) in California and Mexico based on mtDNA and nuclear microsatellites. In T. Kocher and C. Stepien (eds.) Molecular Systematics of Fishes. Academic Press (in press). Raymond, M. and F. Rousset. 1995. An exact test for population differences. Evolution 49: 1280- 1283. Ryman, N. 1994. Supportive breeding and effective population size: differences between inbreeding and variance effective numbers. Cons. BioI. 8:888-890. Waples, R. S. and C. Do. 1994. Genetic risk associated with supplementation of Pacific salmonids: captive broodstock programs. Can. J. Fish. Aquat. Sci. Sl(Suppl.1):310-329. " 147 148 Molecular Biology 149 ,. 150 MOLECULAR STRUCfURE OF A NOVEL TYPE OF RHODOPSIN GENE OF THE COMMON CARP (Cyprinus carpio) Huai-Jen Tsai Institute of Fisheries Science, National Taiwan University, Taipei, Taiwan 106 Fax: 886-2-3638483 Jarmay Lim ~d Jean-Leon Chong The undeIWater environment limits both the intensity and the spectral bandwidth of ambient light for vision and aquatic survival (Lythgoe, 1980); yet retina anatomy and photoreceptor proteins (opsins) show structural similarities between land and aquatic vertebrates (Yokote. 1982; Nathans et al "J 1986). In order to further understand the comparative aquatic visual physiology we initiated a study on the opsins of the common carp (Cyprinus carpio), an important aquacultured species that occupies a more bottom habitat. Total retinal RNA of carp was prepared by using the acid/phenol method described by Chomczynski and Sacchi (1987), with an additional gel filtration through a PD- \0 column (pharmacia) to remove melanin. The poly(At RNA was then isolated and the retinal eDNA library was constructed in a lambda gtlO (promega) using Escherichia coli VC257 as the host cells. Plaque hybridization methods were used for screening recombinant phages containing the putative rhodopsin eDNA when goldfish rhodopsin eDNA (Johnson et al., 1993), kindly provided by Dr. Kathy Grant of the Department of Chemistry, Columbia University, was served as a probe. Results showed that a recombinant pbage clone containing a 1,584 nucleotides (including 52 polyadenines) rhodopsin eDNA encoding a 354 amino acid polypeptide, was obtained (fsai et el., 1994). We named it as the type I rhodopsin (Rh I) eDNA. In this communication, we reported a recombinant phage clone containing a 1,660 nucleotides (iru:ludiog 30 polyadenines) insert encodiog another type (type II) of carp rhodopsin (Rh II) eDNA. Polynucleotaides ofRh I and Rh II shared 97.2% identity after the nucleotide sequences of cloned rhodopsin eDNA was determined by following the dideoxynucleotide chain-termination method (Sanger et al., 1976) with a Sequenase kit (US Biochentinal COlp., Cleveland). Similar to Rh I eDNA, Rh II eDNA consisted of a single open reading frame of I ,062 nueleotides at positions 72 to 1,133. However, Rh II cDNA had fourpolyadenylation signals (AATAAA or AATIAAA) at the 3' end untranslated region 'Whereas Rh I eDNA had only one signal. Moreover, Rh II cDNA was 99 base pairs (bp) longer than that ofRh I. This DNA segment located at the end of3' was specific for 151 Rh II cDNA of carp. The deduced amino acid sequence of the carp Rh n differed from that observed for Rh I in only 5 out of354 residues. The identity of deduced amino acid sequence between type I and type n of carp rhodopsin was 98.6%. Similar to Rh I, Rh II contained all the common residues that were sha:red with rhodopsin of other species, such as human (Nathans and Hogness, 1984), mouse (Al-Ubaidi et aI., 1990), chicken (Takao et aI., 1988), lamprey (Hisatomi et aI., 1991), goldfish (Johnson et aI., 1993) and sand goby (Archer et aI., 1992). The pa1mitoylation site essential to membrane anchoring (Cys-322 and Cys-323), glycosylation (A,n-2 and Asn-15), disulfide bond formation (between Cy,-IIO and Cy,-187), Schiffbase connterion (between Glu-l13 and Ly,-296), interaction with the O-protein transducin (Glu-134 and Arg-135), control site of the equilibrium between photo-activated metarhodopsin I and metarbodopsin II (His-21l) and phosphorylation sites (Sec and Thr at C-terminus) were all conserved. However, 5 amino acid residues ofRh II were different from Rh 1. Two of them were non-homologous alternation: Val-169 and His-315 ofRh I were replaced by 01u-169 and Asn-315 of Rh II, respectively. Three of the 5 were homologous replacements for residues having similar properties: Val-I 9 - Ile-19; Ile-54 - Val-54 and Ile-l08 - Val-I08. Rhodopsin is a GTP binding protein and belongs to the family of seven-membrane-span receptors (Ferretti et al., 1986; Khorana, 1992). The binding of rhodopsin with either retinaldehyde or the transducin is affected by the tertiary structures and the helix-helix interactions. Hydropathicity profiles of rhodopsin amino acid sequences from various species were analyzed according to Kyte and Doolittle (1982). The similarities observed in the hydropathy plots of carp and bovine rhodopsin suggest similarities in the transmembrane segmentation, i.e., repeating segment of 19-27 residues (Helix 1-Vll). as well as in high proline and aromatic amino acid contents. The secondary structure of rhodopsins among known species, the most common length of the fourth helix is 20-21 amino acids: 21 residues for human (Nathans and Hogness, 1984), mouse (Al-Ubaidi et al., 1990), bovine (Nathans and Hogness, 1983), chicken (Takao et aI., 1988) and carp Rh I (Tsai et aI. , 1994); and 20 residues for lamprey (Hisatomi et al., 1991) and fruit fly (Zuker et al., 1985). However, the length of the fourth helix of carp.Rh II was 16 amino acids, which was five residues shorter than those of Rh I and most species' rhodopsins. The special fonnation of the 4th helix structure of carp Rh II may be because the Glu~169 of Rh I~ was a charged residue while the Val-169 of carp Rh I and other species' rhodopsins were a hydrophobic residue. A study to understand the physiological fimctions of this novel type of rhodopsin (carp Rh II) is underway. Acknowledgement- This work was supported by a grant from the National Science Council, Republic of China (NSC-85-2611-B-002-003). References AI-Ubaidi M. R., Pittter S. J., Champagne M. S., Triantafyllo, J. T., McGinnis J. F. and Baehr W. (1990) Mouse opsin: gene structure and molecular basis of multiple transcripts. 1. Bio. Chern. 265, 20563-20569. Archer S. S., Lythgoe J. N. and HallL. (1992) Rod opsin cDNA sequences from the sand goby (Pomatoschistus minutus) compared with those of other vertebrates. Proc. Royal Soc. Lond., BioI. Sci. B. 248,19-25. 152 Chomazynski P. and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidiniwn thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159. Ferretti L.. Kamik S. S. and Khorana H. G. (1986) Total synthesis ofa gene for bovine rhodopsin. Proc. Natl. Acad. Sci. U.S.A 83, 599-603. Hisatomi 0., Iwasa T., Tokunaga F. and Yasui A (1991) Isolation and characterization of lamprey rhodopsin cDNA Biochem. Biophys. Res. Commun. 174. 1125-1132. JohnsonR. L.. GrantK. B., Zankel T. C., Boehm M. F., Merbs S. L., Nathans J. and Nakanishi K. (1993) ClOning and expression ofgoldtish opsin sequences. B. ochem. 32, 208-214. Khorana H. G. (1992) Rhodopsin, photoreceptor of the rod cell. J. Bio!. Chern. 267, 1-4. Kyte J. and Doolittle R F. (1982) A simple model for displaying the hydropathic character ofa protein. J. Mol. BioI. 157, 105132. Lythgoe 1. N. (1980) Vision in fishes. In Environmental Physiology of Fishes (Edited by Ali M. A). Plenum Press, New York. 431-445 p. Nathans 1. and Hogness D. S. (1983) Isolation, Sequence analysis, and intron-exon arrangement of the gene encoding bovine rhodopsin. Cell 84, 807-814. Nathans J. and Hogness D. S. (1984) Isolation and nucleotide sequence of the gene encoding human rhodopsin. Proc. Natl. Acad. Sci. U.S.A 81,4851-4855. Nathans J., Thomas D. and Hogness D. S. (1986) Molecular genetics of human color vision: the genes encoding blue, green and red pigments. Science 232, 193-202. Sanger F., Nicklen S. and Coulson A. R (1977) DNA sequencing with chain terminating inhibitors. Proc. Nat!. Acad. Sci. U.S.A 74, 5463-5467. Takao M., Yasui A. and Tokunaga F. (1988) Isolation and sequence determination of the chicken rhodopsin gene. Vision Res. 28, 471-480. Tsai H. J., Shih S. R, Kuo C. M. and Li L. K. (1994) Molecularclooing of the common carp (Cyprinus carpio) rhodopsin cDNA. Comp. Biochem. Physiol.l09B, 81-88. Yokote M. (1982) Sensory 0IllW1S: Eye. In An A1tas ofFish Histology (Edited by Hibiya T.). Gustav Fischer Verlag, Stuttgart and New York 42-47 p. Zuker C., Cowman A F. and Rubin G. M. (1985) Isolation and structure ofa rhodopsin gene from D. melanogaster. Cell 40, 851-858. 153 154 PROTECI10N AGAINST Renj/JQCteri.m salinonin.",m INFECI10N BY DNA-BASED IMMUNlZATION Marta GOmez-Chism Hopkins Marine Station, Stanford University, Pacific G1"ove, CA 93950, USA Phone: (408) 655 6210 FAX: (408) 375 0793 e-mail: [email protected] Laura L. Brown. National Research Council of Canada., Halifax, NS, Canada. Robert Paul Levine. Hopkins Marine Station, Stanford University. Pacific Grove, CA 93950 Abstract We report here the results of an experiment in which protection against challenge with Renibacterium salmoninarum was conferred by SADI (single antigen DNA-immunization) and ELI (expression library immunization). This is the first report of the potential of DNA-based immunization as an effective method offish vaccination against bacterial kidney disease. Introduction DNA-based immunization refers to the introduction of DNA encoding an antigen into the tissue of an animal in order to elicit an immune response (Tang et aI., 1992). DNA-based immunization has some of the advantages oflive. attenuated pathogens or live recombinant vaccines without the risk of infection (reviewed in Davis and Whalen, 1995). It has been shown in manunals that immunization with either DNA coding for a single antigen (single antigen DNA-based immunization or SADI) or a eukaryotic expression library of pathogen DNA (expression library immunization or ELl) provides protection against infection by viral, parasitic, or intracellular bacterial pathogens (Davis and Whalen, 1995; Barry et al., 1995). The intracellular gram-positive pathogen Renibaclerium salmoninarom is the causative agent of bacterial kidney disease (BKD), a disease that seriously affects wild and fanned stocks of salmonid fishes. Despite many attempts. development of effective vaccines for the prevention of BKD has not been achieved (Newman, 1993). We show here the results of a small scale experiment in which protection against challenge with R salmoninarum was conferred by SADI and ELI. This is the first report of the potential of DNA-based immunization as an effective method offish vaccination against BKD. Methods The vector for the SAD! experiment (pGFPpS7) was constructed by subcloning the gene coding for the protein pS7 from R salmoninannn (Chien et al., 1992) into the expression vector pGFP C2 (Clontech). The expression libraries for the ELl experiment were constructed by subcloning SOO bp average size fragments of genomic DNA from R salmoninarum and Aeromonas 155 salmonicida into pGFP-C2. These libraries were named RsGFP and AsGFP respectively. Plasmid DNA from pGFPp57, pGFP-C2 and a1iquots of the RsGFP and the AsGFP libraries containing approximately 3000 -_ ... _ ... clones each was isolated and '00 purified using Qiagen columns (Qiagen). • Rainbow trout (7-10 em long) were placed in a recirculating freshwater system and acclimated for two weeks at a temperature of 10°C. Trout were immunized by T intnunuscular mJection of 50 I'glfish of either pGFPp57 or o... ____~~~~~~~~~~~ ~_M.aM. ___ ._". RsGFP DNA Negative control Days post challenge fish received DNA from pGFP-C2 or the AsGFP library. Ten days Figure 1: Cumulative percent mortalities of fish immunized after immunization, trout received with DNA from pGFPC2 (control, open circles) or another injection of 50 ~6sh of pGFPp57 (unmunized, closed circles) and then challenged the respective plasmid DNA as a with R salmoninarum. '" indicates p Results and discussion '00 Rainbow trout injected in the muscle with expression vectors containing the DNA coding for p57 (Figure 1) or a random mix. of fragments from the Renibacterium salmoninarum genome (Figure 2) showed decreased mortality when 20 challenged with R salmoninannn o~~~~~~~~~~~~ over that of trout injected with ____ ._M .....__ ._M. expression vectors that lacked R Days post challenge salmoninarum DNA (pGFP-C2 and AsGFP). Protection by the R Figure 2: Cumulative percent mortalities offish immunized saimoninarum librBI)' was with DNA from the libraries AsGFP (contro~ closed pathogen-specific, since no triangles) or RsGFP (immunized, open triangles) and then protection was provided by the A. challenged with R salmoninarum. '" indicates p The levels of protection against BKD achieved by these DNA-based vaccines are striking considering the drastic challenge that was used here. We decided to use challenge by i.p. injection of R salmoninarum because it has the advantage of causing rapid mortalities in contrast to challenge by cohabitation. The protective results that we report here may be an underestimation of the efficacy of these DNA-based vaccines because the infective dose used and the observed rate of infection were more severe than would likely be seen in a natural infection (Murray et al., 1992; 156 Ellis, 1988). Moreover, i.p. challenge bypasses the natur81 skin and mucous barriers of the fish that may contribute to protection in a natural infection (Ellis, 1988). In summary. we have demonstrated here that two different DNA-based vaccines can provide protection against BKD in rainbow trout. Further experiments are underway using larger numbers of fish and challenges by either i.p. injection of the pathogen or by the more natural method of cohabitation (Murray et 81., 1992). The protection offered by the R sabnoninarum library suggests the presence of genes coding for protective antigens. These genes can be isolated from the library and tested as individu81 DNA-based vaccines. SADl and ELI may provide cost and time-effective vaccines against BKO and other fish diseases. References Barry MA, Lai CL, Johnston SA (1995). Protection against mycoplasma infection using expression-library immunization. Science 377: 632- 635 Chien MS, Gilbert T, Huang C, Landolt ML, O'Hara PI, Wmton RJ (1992). Molecular clOning and sequence analysis of the gene coding for the 57-kDa major soluble antigen of the salmonid fish pathogen Renibacterium salmoninarum. FEMS Microbiol Lett 96: 259-266 Davis H L., Whalen R G (1995). DNA-based immunization. In, Molecular and Cell Biology of Human Gene Therapeutics. (Ed. G. Dickson), Chapman and Hall, London Ellis A E (1988). General principles offish vaccination. In: Fish Vaccination. Ellis A E, editor. Academic Press, Berkeley. Murray C B, Evelyo T P T, Beacham T D, Barner L W, Ketcheson I E, Prosperi-Porta L (1992). Experimental induction of bacteri81 kidney disease in Chinook salmon by immersion and cohabitation ch81lenges. Dis aquat Org 12:91-96 Newman S G (1993). Bacterial vaccines for fish. Annual Rev Fish Diseases 3:145-185 Tang D-C, De Vit M, Johnston S A (1992). Genetic immunization is a simple method for eliciting an immune response. Nature 356: 152-154 157 158 IN SITU DEMONSTRATION OF TYPE 1·111 INTERMEDIATE FILAMENT EXPRESSION IN THE COMMON CARP Joseph M. Groff; Department of Pathology, Microbiology and Immunology, School of Veterinary Medicine. University of California. Davis. CA 95616; Phone (916)752·7483; Fax (916)752·3349 Diane K. Naydan, Joseph G. Zinkl and Bennie I. Osburn; Deparunem of Pathology, Microbiology and Immunology. School of Veterinary Medicine, University ofCalifomia, Davis. CA 95616 Introduction The mammalian intermediate filaments (IF) are a multigenic family of 10 om cytoskeletal polypeptides that are generally classified into five major types according to their amino acid-sequence homologies, isoelecmc points and tissue expression patterns (Franke el a1., 1982; Lazarides, 1982; Franke, 1987; Steinert and Roap, 1988). Among these IF types, the cYlOkeratins are a heterogeneous group encoded by a set of closely related genes and classified according to their biochemical similarities (Moll et al., 1982). According 10 this classification scheme. the type I and type IT IF are composed of the acidic. low molecular weight (CK 9-19) and the basic. high molecular weight (CK 1-8) cytokeratins. respectively (Moll et al .• 1982; Quinlan et al.. 1985). The type III IF include vimentin, des min. glial fibrillary acidic protein and peripherin that are expressed in mesenchymal, muscle, astroglial and neuronal cells, respectively (Traub, 1985). Vimentin and desmin are structurally similar yet immunologically distinct IF that are each encoded by a single gene (Quax et al., 1984) although mRNA variants with differential tissue expression patterns have previously been dernonstraled (Dodemont et al., 1982; Zehner and Paterson, 1983). At the cellular level of organization. the mammaJian IF are differentially expressed in various combinations dependent on the origin of the cell and the state of cellular differentiation (Franke et al., 1982). Accordingly. the cytokeratins are generally expressed in epithelial celllypes (Moll et al., 1982; Fuchs et al., 1987) whereas vimentin and desmin are expressed in mesenchymal and muscle ceUs. respectively (fraub, 1985). Furthennore, the cytokeratins can be subclassified according to their expression in simple versus complex epithelium (Sun eL a1.. 1984; O'Guin et ai., 1987). Recognition of these differentia] expression patterns has been explOited as an adjunct diagnostic LOoi in the differentiation of epithelial and non-epithelial cell types in developmental and pathological processes (Osborn and Weber. 1983; Moll, 1989). Previous nucleic acid sequencing and hybridization studies have shown that the IF have been highly conserved during vertebrate evolution (Fuchs et al., 1981; Fuchs and Marchuk, 1983; Quax et al., 1984). Presumably. this phylogenetic persistence would infer the expression of shared structural similarities among the vertebrate IF recognizable by heterologous antibodies. In this context, Ihe common carp (Cyprinus carpio) was selected as a teleost model in the present study to evaluate the immunological cross-reactivity and tissue distribution patterns of vimentin, desmin and the cytokeratins using heterologous antibodies as deteCtion reagents. Materials and Methods Tissues from sexually mature, ornamental (koi) common carp with a length of 25-38 cm and a weight of 1-2 kg were fixed in 10% neutral-buffered formalin, 100% ethanol and methacarn. Histologic sections of all tissues were cut to 4 J.1ffi prior to sEaining. Six heterologous antibodies were evaluated using a streptavidin-biotin-peroxidase complex (ABC) detection system. AnLi-cytokeratin antibodies included the murine monoclonal antibodies AEI and AE3 (BioGenex Laboratories, San 159'. Ramon. CA) specific for human type I (CK 10, 14-16 and 19) and type II (CK 1~8) cytokeratins. Anti~mammalian vimentin antibodies included the rabbit polyclonal antibody 68~121 (ICN Biomedicals, Inc., Costa Mesa. CAl and the murine monoclonal antibodies Vim 3B4 (Dako Laboratories, Carpinteria. CA) and V9 (BioGenex Laboratories). Desmin cross-reactivity was evaluated using the mammalian anti-desmin murine monoclonal antibody 33 (BioGenex Laboratories). The dilutions used were as follows: 68-121 (1:400). Vim 3B4 (1:200), V9 (1:50) and 33 (1:100. 1:200). The antibodies AEI and AE3 were used undiluted as provided by the manufacturer. Results Results for the common carp tissues fixed in 100% ethanol and methacarn were similar. Specifically, the AE3 antibody generally provided a discrete and intense signal against a variety of epithelial tissues including the epithelium of the integument, gill, oropharynx. esophagus. imestine, bile and pancreatic ducts, bile canaliculi. swim bladder and renal tubules. The AE3 antibody also stained the arterial and venous endothelium. ependymal cells including the choroid plexus epitheliwn and the specialized lens-fiber epithelium. Cytokeratin detection using AE3 was not restricted to epithelial tissue but also included a variety of non-epithelial tissue including the fibrous connective tissue, chondrocyl.es. testicular interstitial myoid cells. renal interstitial stromal cells, mesangial cells, meninx. glial cells of the optic nerve. chromalOphores. cuboidal spermatogonia lining the seminiferous tubules and the the oogonia. The AEI antibody resulted in a staining pattern similar to that achieved with AE3 with a few notable exceptions. There was a weak and variable staining of the vascular endothelium. the bile canaliculi and the glomerular epithelial and mesangial cells and a generalized less intense staining of all tissues relative to AE3. However. the skeletal muscle and myocardium stained with the AEI antibody. Vimentin localization using the 68-121 polyclonal antibody generally resulted in a discrete staining of a variety of epithelial and non-epithelial tissues. The fonner included the epithelium of the integument, gills. oropharynx. esophagus. intestine, swim bladder. biliary and pancreatic ducts. exocrine pancreas. renal tubules, ependyma, choroid plexus. lens fibers and the retinal pigment layer. As expected, the 68-121 antibody stained a variety of non-epithelial tissues including fibrous connective tissue, various muscle fiber types. chondrocyteS, lymphohematopoietic cells. mesangial cells, chromatophores, pillar cells and the meninx. Staining of the glial cells of the optic nerve and neurons of the brain was weak or absent There was also a diffuse. weak staining of the various retinal layers associated with a diffuse. intense staining of the cells and fibers of the retinal ganglion layer. Staining with the V9 monoclonal antibody was restricted in comparison to the 68-121 antibody. This restricted staining included an intense staining of the cells and fibers of the retinal ganglion layer and a diffuse, weak to moderate staining of the lens epithelium. There was also an intense staining of the choroid plexus epithelium and a variable weak staining of the meninx. The basal lamina of the integument also displayed a fme. discrete. moderate to intense staining. In contrast, staining with the Vim 3B4 monoclonal antibody was uniformly negative. Desmin cross-reactivity using the 33 monoclonal antibody was negative except for the restricted., diffuse. intense staining of the lens epithelium. Formalin fixation resulled in a less intense staining or absence of staining that was oflen associated with considerable background staining. Therefore. fonnalin was considered the least desirable fixative. Discussion Results of the present study demonstrate that helerologous antibodies to mammalian type L II and m IF recognize homologous proteins in the common carp. This immunological cross-reactivity of the IF between taxonomically distant species is consistent with previous studies that have demonslrated the conservation of IF genes during vertebrate evolution (Fuchs et al.. 1981; Fuchs and Marchuk. 1983; Quax et al., 1984). The phylogenetic persistence of genetic and structural homologies among the vertebrate IF in association with the demonstrated immunological cross-reactivity using heterologous antibodies (Franke et aI., 1979; Nelson and Traub. 1982) suggests thatlhe IF genes have been derived from a common ancestral gene (Fuchs and Marchuk, 1983; Quax et al .• 1983; 160 Marchuk et al .• 1984) that may have coincided with the origination of the chordates or deuterostomes (Fuchs and Marchuk. 1983; Weber et al .• 1988. 1989; Riemer eL aI., 1992). Despite the phylogenetic persistence of IF during vertebrate evolution, previous investigations of teleost IF have indicated that the biochemical properties and tissue expression patterns in these species may be fundamentally different than mammals. The present fmdings were consistent with the cytokeratin expression pattern demonstrated in the rainbow trout (Mark! and Franke. 1988; Mark! et aI., 1989) and goldfish (Giordano et aI .• 1990). In contrast. studies in the northern pike using heterologous anti-cytokeratin antibodies described a restricted epithelial staining pattern (1bompson et ai. 1987) similar to the results reported for striped bass and medaka tissues (Bunton, 1993). An immunohistochemical staining pattern using heterologous anti-virnentin antibodies has been reported for various mesenchymallissues in teleosts including fibrous connective tissue and muscle in the northern pike (Thompson et al., 1987) and medaka (Bunton 1995) similar to the pattern in mammals. However, vimentin cross-reactivity using the 68-121 antibody in the present study was not limited to mesenchymal tissues but also included epithelial tissues. The restricted expression of a vimentin homolog in the integument, lens and whole blood of the rainbow trout suggested that vimentin may be a minor and bighly restricted cytoskeletal component in teleosts with funher speculation that a cytokerarinlvimentin shift may have occurred during vertebrate evolution (Markl et al., 1989; Markl, 1991). Findings of vimentin variants with a differential tissue expression pattern in the goldfish further indicate that vimentin may be a minor and highly resuicted cytoskeletal component in teleosts (Glasgow et al. 1994). This variation in results among teleost species may be attributed to distinct species characteristics or to differences in the specifiCity of the primary antibody. In this context, the relatively diverse tissue distribution pattern observed using the 68-121 polycional antibody versus the V9 monoclonal antibody would be expected due to the inherent polyspecificity of polyc1onal antibodies versus the characteristic monospecificity of monoclonal antibodies. This explanation is also consistenL with findings in the rainbow trout that several complex epithelial cytokeratins express both common and unique epitopes (Markl et al., 1989). Regardless, this phenomenon is most likely a manifestation of the IF subunit-peptide structure that is comprised of central domains with similar amino-acid homologies and non-homologous head and tail domains that flank. the central domains and confer the antigenic and functional specificities among the individual IF proteins (Parry. 1990; Steven. 1990). Therefore, the del.ection of IF in teleosts using heterologous antibodies only demonstrates the conservation of common epitopes during vertebrate evolution but does not permit the inference that the recognized polypeptides are equivalent or similar in such taxonomically distant species. However, differences in technique do not adequately explain the variability among the teleoslS using common antibodies that may ultimately be due to species differences. Funher research is therefore necessary to determine the extent of differences in IF expression among teleost species within and between taxa and to detennine the phylogenetic branch poinlS for these differences. The results of the present sLUdy indicate that the cytokeratin and vimentin IF in the common carp exhibit a diverse epithelial and non-epithelial tissue distribution pattern. These fmdings are consistent with those reported in other teleosLS but fundamentally conflict with the IF expression patterns in mammals. These resulLS suggest caution in the indiscriminate use of heterologous antibodies as a method for the determination of cell histogenesis in teleosts. Interpretation of results using particular heterologous antibodies in teleosts should be based on prior normal tissue distribution sLUdies in these species and not on the palterns known to occur in mammals. References Bunton, T. E. 1993. The immunocytochemistry of cyLokeratin in fish tissues. Veterinary Pathology 30:418-425 Dodemont, H. J., and seven coauthors. 1982. The genes coding for the cytoskeletal proteins actin and vimentin in wann-blooded vertebrates. EMBO Joumall:167-171 Franke. W. W., E. Schmid, S. Winter, M. Osborn, and K.. Weber. 1979. Widespread occurrence of intermediate-sized ftlaments of the vimentin-type in cultured cells from diverse venebrates. Experimental Cell Research 123: 25-46 161 Franke, W. W. 1987. Nuclear lamins and cytoplasmic intermediate filament proteins: a growing mUhigene family. Cell 48:3-4 (: Franke, W. W., and eight coauthors. 1982. Differentiated~related patterns of expression of proteins of intermediate~siz.ed filaments in tissues and cultured cells. Cold Spring Harbor Symposium 46:431-453 Fuchs, E. V., and D. Marchuk.. 1983. Type I and type n keratins have evolved from lower eukaryoleS to form the epidermal intermediate fLlaments in mammalian skin. Proceedings of the National Academy of Science USA 80:5857~5861 Fuchs, E. V., S. M. Coppock, H. Green, and D. W. Cleveland. 1981. Two distinct classes of keratin genes and their evolutionary significance. Cell 27:75·84 Fuchs, E., A. L. Tyner, G. J. Giudice, D. Marchuk, A. Raychaudhury, and M. Rosenberg. 1987. The human keratin genes and their differential expression. Current Topics in DevelopmemaJ Biology 22:5-34 Giordano, S., C. Hall, W. Quitschke, E. Glasgow, and N. Schechter. 1990. Keratin 8 of simple epithelia is expressed in glia of the goldfish nervous system. Differentiation 44: 163·172 Glasgow, E., R. K. Druger, C. Fuchs, E. M. Levine, S. Giordano, and N. Schechter. 1994. Cloning of multiple forms of goldfish vimentin: differential expression in CNS. JournaJ of Neurochemistry 470-481 Lazarides, E. 1982.lntermediate filaments: a chemically heterogeneous developmentally regulated class of proteins. Annual Review of Biochemistry 51 :219-250 Marchuk, D., S. McCrohon, and E. Fuchs. 1984. Remarkable conservation of structure among intermediate fLlament genes. Cell 39:491-498 Markl,1. 1991. Cytokeratins in mesenchymal cells: impact on funcLionaJ concepts of the diversity of intermediate fIlament proteins. Journal of Cell Science 98:261·264- Markl, J., and W. W. Franke. 1988. Localization of cytokeratins in tissues of the rainhow trout: fundamentaJ differences in expression pattern between the fish and higher venebrates. Differentiation 39:97·122 Markl. 1., S. Winter, and W. W. Franke. 1989. The cataJog and the expression complexity of cytokeratins in a lower vertebrate: biochemical identification of cytokeratins in a teleost fish, the rainbow trout European Journal of Cell Biology 50: 1·16 Moll, R. 1989. Cytoskeletal markers in the classification of carcinomas and their metastases. Pages 139·150 in M. Osborn and K. Weber, editors. Cytoskeletal proteins in tumOr diagnosis. Current communications in molecular biology, Cold Spring Harbor Laboratory. Cold Spring Harbor. New York. Moll, R.. W. W. Franke. D. L. Schiller. B. Geiger, and R. Krepler. 1982. The catalog of human cytokeratins: pattern of expression in normal epithelia. tumors, and cultured cells. Cell 31 : 11·24 Nelson, W. 1., and P. Traub. 1982 Intermediate (IOnm) fLlament proteins and the Ca2+-activated proteinase specific for vimentin and desmin in the cells from fISh to man: an example of evolutionary conservation. Journal of Cell Science 57:25·49 O'Guin. W. M., S. Galvin. A. Schermer, and T. T. Sun. 1987. Patterns of keratin expression define distinct pathways of epithelial development and differentiation. Current Topics in l)evelopmentaJ Biology 22:97-125 Osborn. M .• and K. Weber. 1983. Tumor diagnosis by intermediate filament typing: a novel tool for surgical pathology. Laboratory Investigation 48:372·394 162 Parry. D. A. D. 1990. Primary and secondary structure of IF protein chains and modes of aggregation. Pages 175·204 in R. D. Goldman and P. M. Steinert, editors. Cellular and molecular biology of the intermediate fLiamems. Plenum Press. New York. Quax. W.• W. V. Egberts. W. Hendricks, Y. Quax·Ieuken, and H. Bloemendal. 1983. The structure of the vimentin gene. Ce1l35:215·223 Quax. W.• R. van den Heuvel. W. V. Egberts. Y. Quax-Jeuken, and H. Bloemendal. 1984. Intermediate fllament cDNAs from BHK·21 cells: demonstration of distinct genes for desmin and vimentin in all vertebrate classes. Proceedings of the National Academy of Science USA 81 :5970- 5974 Quinlan, R, and seven coauthors. 1985. PatLems of expression and organization of cytokeratin intermediate fllaments. Annals of the New York Academy of Science 455:282-306 Riemer. D.• H. Dodemont, and K.. Weber. 1992. Analysis of the eDNA and gene encoding a cytoplasmic intennediate filament (IF) protein from the cephalochordate Branchiosloma lanceolalwn; implications for the evolution of the IF protein family. European Journal of Cell Biology 58: 128-135 Steinert, P. M., and D. R Roap. 1988. Molecular and cellular biology ofintermediaLe fLiaments. Annual Review of Biochemistry 57:593·625 Steven. A. C. 1990. Intermediate filament structure: diversity. polymorphism, and analogy to myosin. Pages 233·263 in R D. GOldman and P. M. Steinert, editors. The cellular and molecular biology of intermediate flIaments. Plenum Press, New York. Sun. T. T., R Eichner, A. Schermer, D. Cooper, W. G. Nelson, and R A. Weiss. 1984. Classification, expression. and possible mechanisms of evolution of mammalian epithelial keratins: a unifying model. Pages 169-176 in A. Levine. W. Topp. G. van de Woude. and J. D. Watson. editors. The Cancer cell. volume 1. Cold Spring Harbor Laboratory. Cold Spring Harbor, New York. Thompson. J. S .• I. Virtanen. and V. P. Lehto. 1987. Intermediate filaments in normal tissues and lymphomas of northern pike. Esox lucius L., from the Aland islands of Finland. Journal of Comparative Pathology 97:257-266 Traub, P. 1985. Intermediate filaments. Springer Verlag. Berlin Weber, K.., U. Plessman, H. Dodemonl, and K. Kossmagk.-Stephan. 1988. Amino acid sequences and homopolymer-forming ability of the intermediate fLiament proteins from an invertebrate epithelium. EMBO Jouma17:2995-3001 Weber, K.• U. Plessman, and W. Ulrich. 1989. Cytoplasmic intermediate filamem proteins of invertebrates are closer to nuclear lamins than are vertebrate intermediate fLlament proteins; sequence characterization of two muscle proteins of a nematode. EMBO Ioumal8:3221-3227 Zehner, Z. E., and B. M. Paterson. 1983. Characterization of the chicken vimentin gene: single copy gene producing multiple mRNAs. Proceedings of the National Academy of Science USA 80:911-915 163 164 MAJOR H1STOCOMPATffiILITY COMPLEX CLASS I GENES IN RAINBOW TROUT (Oncorhynchus mykiss). Brian Dixon Department of Structural Biology Fairchild Center Stanford University Scbool of Medicine Stanford, California. 94305 U. s. A. Phone: (415)-723-7456 Fax: (415)-723-8464 e·mail: [email protected] Katherine E. Mager, Benny P. Shum and Peter Parbam Departtnent of Structural Biology Fairchild Center Stanford University School of Medicine Stanford. California, 94305 U. s. A. Phone: (415)·723-7456 Fax: (415)-723-8464 Introduction The Major Histocompatibility Complex (MHC) is a group of genes located together on a single chromosome in mammals which encode highly polymorphic proteins (Klein 1986). These proteins are translocated to the cell surface carrying foreign antigens which they present to T-cells, initiating immune responses. There are two classes of MHC molecules. Class I MHC is a heterodimer expressed on the surface of most cells, consisting of a Mr 45,000 alpha chain and a Mr 12,000 beta chain. referred to as p2-microgiobulin. Class I MHC antigens present intracellular antigens to cytotoxic T -cells (Klein 1986). Class n MHC molecules are aJso heterodimers composed of an aJpba and beta cbain, both of which are approximately Mr 30,000. Class II MHC proteins are expressed by specialised antigen presenting cells (APe) and these present extracellular antigens to helper T -cells, which initiate humoral immune responses (Klein 1986). MHC genes have been reported present in all classes of vertebrate, with the exception of the most primitive, the jaw less fishes (Kaufman, SaJomonsen et aJ. 1994; Dixon, van Erp et aJ. 1995; Trowsdale 1995). Our objective is to study all aspects of teleost class I MHC genes and proteins, using the rainbow trout (Onchorhynchus mykiss) as a model system. Teleost MHC genes The study of MHC genes in teleost fish has, to elate, focused on isolating and characterising genomic and cDNA sequences from many species (Dixon, van Erp et a1. 1995). MHC sequences have been obtained from nearly 30 species of fish since their flISt isolation in 1990 (Hashimoto, Nakanishi et aJ. 1990). Unfortunately, these are usuaJly only fragments of genes, obtained by polymerase chain reaction. Full length clones of MHC genes encoding all 165 the chains of both class I and class IT MHC antigens have been found for only a few species. Rainbow trout:MHC genes are quite well studied. with sequences available for:MHC class IT beta (Glamann 1995), ~2-microglobulin (Shum, Azumi et aI. 1996) and four MHC class I alpha sequences, which may correspond to different loci (Shum. Azumi et aI. 1996, Shum et aI .• unpublished data), at least one of which thought to be equivalent to a mammalian "classical" c1ass I gene. Teleost MHC gene studies have revealed that while the genes and proteins are structurally similar to their mammalian counterparts. they possess many unique features. as well. ~2- microglobulin in mammals is encoded by a single copy gene, located outside the:MHc. Due to similarities in sequence and structure, it is thought that ~2-microglobulin shares an evolutionary origin with the other MHC genes, but was translocated out of the :MHC at some point in evolution. Initial studies reporting the cloning of P2-microglobulin from tilapia, carp (Dixon, Stet et al. 1993) and zebrafish (Ono, Figueroa et al. 1993) indicated that it was also a single copy gene. This was not true for rainbow trout, however. Shum et al. (Shurn, Azumi et al. 1996) observed multiple bands on Southern blots and cloned 12 distinct cDNAs from a single individual. While the existence of multiple copies of genes may be explained by the tetraploid state of rainbow trout, this cannot explain all of the polymorphism. One possible explanation for this increased polymorphism may be that rainbow trout possess an ancestral :MHC organisation in which the P2-microglobulin gene is still located within the :MHC. Our laboratory is attempting to answer this question by screening a genomic library selected for large fragments (>20 kb) and examining the linkage patterns of the resultant clones. We are currently analysing 12 P2-microglobulin genomic clones and 57 class I genomic clones. We also hope to answer this question using Fluorescence In Situ Hybridisation (FISH). Teleost Oass I:MHC genes have evolved in a unique manner. In mammals, class I genes from different species which have diverged up to 70 million years ago are so different that they cannot be grouped into lineages. Teleost:MHC class I genes, however, can be grouped into lineages which are well over 150 million years old, and may be up to 350 million years old. Genes from at least three such lineages can be found in the carp, while homologous sequences are present in distantly related species, such as salmon and the coelacanth (van Erp, Egberts et al. 1996). Our laboratory is currently searching for new class I :MHC sequences from the rainbow trout in order to fully investigate the novel nature of class I:MHC evolution in teleosts. MHC gene expression in teleosts Most knowledge of :MHC gene expression patterns is derived from Northern blotting or isolation of cDNA sequences, which does not guarantee that:MHC antigens are expressed and functional in the cells or tissues examined (Dixon, van Erp et al. 1995). The use of bacterial expression systems to produce recombinant proteins from cDNA clones has allowed the production of polyclonal antisera. These have been used in initial studies of:MHC antigen expression in the carp (Rodrigues, Dixon et al. 1996; van Erp, Dixon et al. 1996), but these studies are far from complete. In general, mRNAs from teleost MHC genes are present in tissues with immunological functions and cells of lymphoid lineage. Both class I and class IT mRNAs are present in liver, but are not detectable in other non-lymphoid organs, such as heart, or brain. No:MHC class I transcripts are detectable in the muscle or gonad of t~leosts, despite the fact that some class. I has been detected in human gonads, and mammalIan muscles express class I :MHC. This may, however, only reflect the nature of the :MHC genes examined so far in teleosts, since only a small number of genes have been studied, and the classi~al or !lon-classical na~ of class I genes can only be inferred from sequence data. The studies usmg polyclonal antiSera raised against recombinant proteins tend to support the Northern blot and cDNA data. The main differences in :MHC expression between teleosts and other vertebrate ~ups seem to occur in two types of blood cells; thrombocytes, the lower vertebrate equlvalent of platelets. and erythrocytes. Thrombocytes do not show any cell ~urface class I or ~2- microglobulin in carp (Rodrigues, Dixon et aI. 1996; van Erp, DIxon et al. 1996), yet 166 chicken thrombocytes and mammalian platelets both express class I antigen. Mammalian erythrocytes do not ex.press :MHC class n on their cell surface, but do express class I. Erythrocytes in lower vertebrates are nucleated and chicken, reptiles, and ampbibians all express :MHC class I. Axolotl erythrocytes even express :MHC class n. Teleost erythrocytes, which are nucleated but transcriptionally silent, do not express any :MHC antigens on their cell surface. This may, however, merely reflect the fact that:MHC loci or alleles which have not been isolated yet are expressed there. Mammalian class I MHC and ~2-microglobulin cDNAs have been used to produce recombinant proteins in a variety of systems, including mouse cells (Mage, Lee et aI. 1992), Drosophila cells (Jackson, Song et aI. 1992; Matsumura. Saito et al. 1992; Stura, Matsumura et al. 1992) and E. coli. (parker and Wiley 1989; Garboczi, Hung et al. 1992; Parker. Carreno et a1. 1992; Parker, Silver et al. 1992; Pedersen, Stfyhn et aI. 1995). In the latter reports, investigators were able to combine recombinant class I heavy chain, ~2- microglobulin and peptides in denatured states, then renature them to produce a complete, correctly folded class I complex. 1bis system has been opti.m.ised for immunoglobulin family members by adding reduced and oxidised low molecular weight thiol compounds and labilizing agents such as L-arginine to the reconstitution buffer in order to promote the formation of the correct disulphide bonds (Buchner and Rudolph 1991; Garboczi, Hung et al. 1992). This system can he used to renature up to 40% of the added proteins. We are currently producing recombinant class I MHC and ~2-microglobulin, which will be refolded as above and used to produce bigh quality monoclonal antibodies. We hope to use these antibodies to further investigate :MHC expression and function in teleosts. References Buchner, J. and R. Rudolph (1991). "Renaturation, purification, and characterization of recombinant Fab-mgments produced in Escherichia coli." BioUechnology 9: 157-162. Dixon, B., R. J. M. Stet, et al. (1993). "Characterization of ~2-microglobulin transcripts from two teleost species." Immunogenetics 38(1): 27-34. Dixon, B., S. H. M. van Erp, et al. (1995). "Fish major histocompatibility complex genes: an expansion." DeveJQrunental And Comparntive Immunology 19(2): 109-133. Garboczi, D. N., D. T. Hung, et al. (1992). "Jll.A-A2-peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptide,." Pmc Natl Acad Sci !J S A 89(8): 3429-33. Glamann, J. (1995). "Complete coding sequence of rainbow trout mbc n beta chain." Scandinavian Journal Of ImmUDOIQgy 41(4): 365-372. Hashimoto, K., T. Nakanishi, et al. (1990). ''Isolation of carp genes encoding major histocompatibility complex antigens." Proc NatI Acad Sci USA 87: 6863-6867. Jackson, M. R., E. S. Song, et al. (1992). "Empty and peptide-containing conformers of class I major histocompatibility complex molecules expressed in Drosophila melanogaster cells." fmc Natl Acad Sci USA 89(24): 12117~21. Kaufman. J., J. Salomonsen, et al. (1994). "Evolutionary consenration of:MHC class I and class n molecules-different yet the same." Seminars in Immunology 6: 411-424. Klein, J. (1986). The DamrN rustmy' of the major histocompatibility complex. New York, John Wiley, 775p. Mage, M. G., L. Lee, et al. (1992). "A recombinant, solUble, single-chain class ~ major histocompatibility complex molecule with biological activity." Proc Natl Acad SCI USA 89(22): 10658-62. 167 Matsumura, M., Y. Saito, et aI. (1992). "In vitro peptide binding to soluble empty class I major histocompatibility complex molecules isolated from transfected Drosophila melanogaster cells." I Bioi Chern 267(33): 23589-95. Ono, H., F. Figueroa, et aI. (1993). "Cloning of the ~2-microglobulin gene in the zebrafish." Immunogenetics: 38(1): 1-10. Parker, K. C., B. M. Carreno, et aI. (1992). "Peptide binding to HLA-A2 and IILA-B27 isolated from Escherichia coli. Reconstitution of HLA-A2 and lll..A-B27 heavy cha:inJbeta 2- microglobulin complexes requires specific peptides." J BioI Chern 267(8): 5451-9. Parker, K. C., M. L. Silver, et aI. (1992). "Ao IILA-A2Ibeta 2-microglobuJinlpeptide complex assembled from subunits expressed separately in Escherichia coli." Mol Immunol 29(3): 371-8. Parker, K. C. and D. Wiley (1989). "Overexpression of native human 1l2-microglobulin in Escherichia coli and its purification." ~ 83: 117-124. Pedersen, L. 0., A. Stryhn, et aI. (1995). "The interaction of beta 2-microglobulin (beta 2m) with mouse class I major histocompatibility antigens and its ability to support peptide binding. A comparison of human and mouse beta 2m." Eur J ImmnDol 25(6): 1609-16. Rodrigues, P. N. S., B. Dixon, et aI. (996). "Expression and temperature dependent regulation of the a2-microglobulin (Cyca-B2m) gene in a cold blooded vertebrate, the common carp (Cyprinus carpio L.)." Deyelcmmental Immunology In Press: Shum. B. P., K. Azumi, et aI. (1996). ''Unexpected 1l2-microglobulin sequence diversity in individual rainbow trout." Proc. Nat Acad. Sci. USA 93: 2779-2784. Stura, E. A., M. Matsumura, et aI. (1992). "Crystallization of murine major histocompatibility complex class I H-2Kb with single peptides." J Mol BioI 228(3): 975-82. Trowsdale, J. (1995). ""Both man & bird & beast"; comparative organization ofMHC genes."lromunogenetics 41: 1-17. van &p, S. H. M., B. Dixon, et al. (1996). "Identification and characterization of a novel MHC class I gene from carp (Cyprinus carpio L)." Immunogenetics In Press: van Erp, S. H. M., E. Egberts, et aI. (1996). "Evidence for multiple distinct major histocompatibility complex class I lineages in teleostean fish." Eu~ Iouma1 of Immunogenetics In Press: 168