Enhancing monocyte effector functions in antibody therapy against cancer
Dissertation
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy
in the Graduate School of The Ohio State University
By
Kavin Fatehchand, B.S.
Biomedical Sciences Graduate Program
The Ohio State University
2018
Dissertation Committee:
Susheela Tridandapani, Ph.D., Advisor
John C. Byrd, M.D.
Larry Schlesinger, M.D.
Tatiana Oberyszyn, Ph.D.
Copyrighted by
Kavin Fatehchand
2018
Abstract
The immune system plays an important role in the clearance of pathogens and tumor cells. However, tumor cells can develop the ability to evade immune destruction, making the interaction between the immune system and the tumor an important area of research. The overall goal in my graduate studies, therefore, was to find different ways to enhance the innate immune response against cancer cells.
First, I focused on monoclonal antibody therapy with reference to the role of monocytes/macrophages as immune effectors. Tumor-specific antibodies bind to cancer cells and create immune-complexes that are recognized by IgG receptors (FcγR) on these immune effector cells. FcγRIIb is the sole inhibitory FcγR that negatively regulates monocyte/macrophage effector responses. In the first part of this study, I examined the ability of the TLR4 agonist, LPS, to enhance macrophage FcγR function. I found that
TLR4 activation led to the down-regulation of FcγRIIb through the activation of the
March3 ubiquitin ligase.
Although monocytes play an important role in tumor clearance, tumor cells can develop immune evasion. Acute Myeloid Leukemia (AML) is a hematologic malignancy caused by the proliferation of immature myeloid cells, which accumulate in the bone marrow, peripheral blood, and other tissues. The progression of AML is partially dependent on immune cell evasion by AML blasts. Since AML cells are of myeloid origin, I next focused on shifting this blast phenotype from an immunosuppressive to
i effector-like phenotype. IFNγ is known to polarize macrophages to an anti-tumor M1-like state. Since AML cells are of myeloid origin, we hypothesized that IFNγ would be able to shift the phenotype of AML cells to more of an effector state. In these studies, I found that AML blasts can indeed be shifted into a more anti-tumor/M1 by IFNγ. Importantly,
IFNγ was also able to up-regulate FcγRI and the antibody target CD38. When AML blasts were treated with the combination of IFNγ and the anti-CD38 antibody, daratumumab, there were significant increases in cytotoxicity, suggesting that these cells were killing each other, which we term daratumumab-mediated fratricide.
Extending these observations, I examined whether Type 1 IFNs, much like IFN!, could initiate daratumumab-mediated fratricide in AML. Type 1 IFNs have been used in
AML clinical trials before, however, they lose their effect in patients due to their short serum half-life. In order to overcome this problem, I explored the possibility of increasing endogenous Type 1 IFNs by targeting plasmacytoid Dendritic Cells (pDCs) through TLR 7/8 stimulation. Consistent with this notion, R848-treated pDCs had increased markers of pDC activation and an enhanced Type 1 IFN response. IFNβ was also able to shift AML cells to an M1-like phenotype, increase the antibody target CD38, and enhance daratumumab-mediated toxicity. These findings suggest that it is possible to overturn the tolerogenic phenotype of pDCs in AML, and also demonstrate a possible means of enhancing endogenous Type 1 IFN production for the purpose of inducing daratumumab-mediated fratricide of AML blasts.
In the final part of this dissertation, I explored the utility of natural products in
AML therapy. To this end, I examined the effect of the natural product, Active Hexose
ii
Correlated Compound (AHCC) on AML. I found that AHCC induced extrinsically- mediated apoptosis in AML cells. When tested in a murine engraftment model of AML,
AHCC led to significantly increased survival time and decreased blast counts. These results lend support for the further investigation of AHCC as a potential adjuvant for the treatment of AML.
Taken together, these studies have uncovered multiple ways to target the innate immune system, the immunosuppressive tumor cell, or both in order to fight cancer. In
Chapter 2, I focused on enhancing monocyte FcγR-mediated effects against cancer. In
Chapters 3 and 4, I demonstrated a novel way to shift cancer cells themselves to a more effector-like state in the context of antibody therapy against AML. Finally, in Chapter 5, I used a natural product that was able to target both monocytes and AML cells in opposite ways.
iii
Dedication
This dissertation is dedicated to my family and friends.
iv
Acknowledgments
First and foremost, I would like to thank the most supporting, kind, and brilliant advisor, Dr. Susheela Tridandapani for her continual guidance and support throughout my pre-doctoral training. Dr. Tridandapani has been there for every step of my graduate career and I cannot thank her enough for her leadership and direction.
Additionally, I would like to thank the members of my committee including Dr.
John C. Byrd, Dr. Larry Schlesinger and Dr. Tatiana Oberyszyn who have helped me throughout my training. Dr. Byrd, I want to thank you for teaching me so much about
AML and the research process. Dr. Schlesinger, I cannot thank you enough for being such an advocate for my career and Dr. Oberyszyn, I appreciate all your help on such short notice. I cannot wait to continue to work with all three of you during the rest of my career.
I would also like to thank all past and present members of the Tridandapani laboratory. My journey in the lab started as an undergraduate at Emory University in
2009. Firstly, I would like to thank both Payal Mehta and Prexy Shah for training me during my initial few months in the lab. You inspired me to seek a career in science, and for that I am forever grateful. I would also like to thank past members, Devyn Gillette,
Saranya Elavazhagan, Li Ren, and Shalini Gautam for their moral support during my graduate career. You have all become friends throughout my time here and my time with you all has been invaluable. For my fellow graduate students, Nate Buteyn and Giovanna
v
Merchand-Reyes, thank you for being there during times of stress and times of success these past few years. Additionally, I would like to give thanks to all the undergraduate students that I have been able to mentor including Brenda Shen, Hafza Inshaar, Ericka
Erickson, and Reema Navalurkar. Finally, I have to thank Jon Butchar who has been in the lab with me since the beginning, guiding me. He has been instrumental in my success as a graduate student and I am forever thankful.
I must also acknowledge the faculty and staff at both the Biomedical Sciences
Graduate Program and Medical Scientist Training program. Specifically, I would like to thank Dr. Larry Schlesinger, Dr. Larry Kirschner, and Ashley Bertran for their guidance in the MSTP program.
Most importantly, I have to thank Amma, Thathi, Akku, the rest of my family, friends, partner Joey and his family, and Gerber & Daisy for their continued support. The strong women in my life including my Amma, Akku, Aththa, Chootzi, Loku Amma,
Shani Nanda, Lakna and all my other cousins have truly taught me how to be independent, caring, and passionate in everything I do. Thank you so much for rooting for me throughout my life and making me realize the importance of the little things. I love you all so much.
vi
Vita
May 24, 1992………………..Born – Chennai, India
2009-2013………………...... B.S. Biology, Emory University
2013-present………………...Medical Scientist Training Program, The Ohio State
University
Publications
Cremer, T. J., Fatehchand, K., Shah, P., Gillette, D., Patel, H., Marsh, R. L., Besecker, B. Y., Rajaram, M. V., Cormet-Boyaka, E., Kanneganti, T. D., Schlesinger, L. S., Butchar, J. P., and Tridandapani, S. (2012) MiR-155 induction by microbes/microbial ligands requires NF-kappaB-dependent de novo protein synthesis. Front Cell Infect Microbiol 2, 73
Shah, P., Fatehchand, K., Patel, H., Fang, H., Justiniano, S. E., Mo, X., Jarjoura, D., Tridandapani, S., and Butchar, J. P. (2013) Toll-like receptor 2 ligands regulate monocyte Fcgamma receptor expression and function. J Biol Chem 288, 12345-12352
Justiniano, S. E., Elavazhagan, S., Fatehchand, K., Shah, P., Mehta, P., Roda, J. M., Mo, X., Cheney, C., Hertlein, E., Eubank, T. D., Marsh, C., Muthusamy, N., Butchar, J. P., Byrd, J. C., and Tridandapani, S. (2013) Fcgamma receptor-induced soluble vascular endothelial growth factor receptor-1 (VEGFR-1) production inhibits angiogenesis and enhances efficacy of anti-tumor antibodies. J Biol Chem 288, 26800-26809
Gillette, D. D., Curry, H. M., Cremer, T., Ravneberg, D., Fatehchand, K., Shah, P. A., Wewers, M. D., Schlesinger, L. S., Butchar, J. P., Tridandapani, S., and Gavrilin, M. A. (2014) Virulent Type A Francisella tularensis actively suppresses cytokine responses in human monocytes. Front Cell Infect Microbiol 4, 45
Elavazhagan, S., Fatehchand, K., Santhanam, V., Fang, H., Ren, L., Gautam, S., Reader, B., Mo, X., Cheney, C., Briercheck, E., Vasilakos, J. P., Dietsch, G. N., Hershberg, R. M., Caligiuri, M., Byrd, J. C., Butchar, J. P., and Tridandapani, S. (2015) Granzyme B expression is enhanced in human monocytes by TLR8 agonists and contributes to antibody-dependent cellular cytotoxicity. J Immunol 194, 2786-2795
vii
Ren, L., Campbell, A., Fang, H., Gautam, S., Elavazhagan, S., Fatehchand, K., Mehta, P., Stiff, A., Reader, B. F., Mo, X., Byrd, J. C., Carson, W. E., 3rd, Butchar, J. P., and Tridandapani, S. (2015) Analysis of the effects of the Btk inhibitor ibrutinib on monocyte FcgammaR function. J Biol Chem
Fatehchand, K., Ren, L., Elavazhagan, S., Fang, H., Mo, X., Vasilakos, J. P., Dietsch, G. N., Hershberg, R. M., Tridandapani, S., and Butchar, J. P. (2015) Toll-like receptor 4 ligands down-regulate FcgammaRIIb via MARCH3-mediated ubiquitination. J Biol Chem
Gautam S, Fatehchand K, Elavazhagan S, Reader BF, Ren L, Mo X, Byrd JC, Tridandapani S, Butchar JP. (2016) Reprogramming Nurse-like Cells with Interferon γ to Interrupt Chronic Lymphocytic Leukemia Cell Survival. J Biol Chem
Fatehchand K, McMichael EL, Reader BF, Fang H, Santhanam R, Elavazhagan S, Mehta P, Buteyn NJ, Merchand-Reyes G, Vasu S, Mo X, Benson DM Jr, Blachly JS, Carson WE 3rd, Byrd JC, Butchar JP, Tridandapani S. (2016) Interferon-γ promotes antibody-mediated fratricide of Acute Myeloid Leukemia cells. J. Biol. Chem.
Fatehchand K, Santhanam R, Shen B, Erickson EL, Gautam S, Elavazhagan S, Mo X, Belay T, Tridandapani S, Butchar JP. (2017). Active hexose-correlated compound enhances extrinsic-pathway-mediated apoptosis of Acute Myeloid Leukemic cells. PLoS One
Fields of Study
Major Field: Biomedical Sciences Graduate Program
viii
Table of Contents
Abstract ...... i
Dedication ...... iv
Acknowledgments ...... v
Vita ...... vii
List of Tables...... xii
List of Figures ...... xiii
List of Abbreviations: ...... xv
Chapter 1. Introduction ...... 1
1.1. Antibody Therapy, Overview ...... 1 1.1.1. Role of macrophages in antibody therapy ...... 1 1.1.2. FcγRs in antibody therapy ...... 3 1.1.3. Augmenting responses in antibody therapy: ...... 4 1.2. Acute Myeloid Leukemia, Overview: ...... 5 1.2.1. Classification of AML...... 6 1.2.2. Immunosuppression in AML: ...... 6 1.2.3. Differentiating AML blasts into effector cells: ...... 8 1.3. Acute Myeloid Leukemia, Therapeutics: ...... 9 1.3.1. Interferons in AML ...... 10 1.3.2. Natural Products, Overview ...... 12 1.3.3. Natural Products in the context of AML ...... 13 1.4. Conclusion and Significance ...... 14
ix
Chapter 2. Toll-like Receptor 4 Ligands Down-regulate Fcγ Receptor IIb (FcγRIIb)
via MARCH3 Protein-mediated Ubiquitination ...... 16
2.1. Abstract ...... 16 2.2. Introduction ...... 17 2.3. Materials and Methods ...... 19 2.4. Results ...... 23 2.5. Discussion ...... 29 Chapter 3. Interferon-γ Promotes Antibody-mediated Fratricide of Acute Myeloid
Leukemia Cells ...... 43
3.1. Abstract: ...... 43 3.2. Introduction: ...... 44 3.3. Materials and Methods: ...... 46 3.4. Results: ...... 52 3.5. Discussion ...... 58 Chapter 4. Shifting the plasmacytoid dendritic cell phenotype in Acute Myeloid
Leukemia to enhance daratumumab-mediated fratricide...... 71
4.1. Abstract ...... 71 4.2. Introduction: ...... 72 4.3. Materials and Methods: ...... 74 4.4. Results: ...... 79 4.5. Discussion: ...... 85 Chapter 5. Active hexose-correlated compound enhances extrinsic-pathway-mediated
apoptosis of Acute Myeloid Leukemic Cells ...... 99
5.1. Abstract ...... 99 5.2. Introduction ...... 100 5.3. Materials and Methods ...... 101 5.4. Results ...... 106 5.5. Discussion ...... 111 x
Chapter 6. Summary and Future Perspectives ...... 126
Bibliography ...... 138
xi
List of Tables
Table 3.1: Changes in phagocytic ability and FcγRI expression in primary AML cells following IFNγ treatment...... 70
Table 5.1: Mutational status of AML patients ...... 125
xii
List of Figures
Figure 1.1: FcγRs on monocytes/macrophages ...... 15!
Figure 2.1: Ligands for TLR4 and TLR8 down-regulate FcγRIIb...... 34!
Figure 2.2: Concentration and time course responses of FcγRIIb to LPS...... 36!
Figure 2.3: Concentration and time course responses of FcγRIIa to LPS ...... 37!
Figure 2.4: LPS treatment leads to FcγRIIb ubiquitination ...... 38!
Figure 2.5: MARCH3 is required for LPS-induced FcγRIIb down-regulation ...... 40!
Figure 2.6: LPS treatment enhances FcγR function ...... 42!
Figure 3.1: IFNγ promotes an M1-related phenotype in AML cells...... 62!
Figure 3.2: IFNγ increases FcγRI expression and phagocytic ability in AML cells...... 63!
Figure 3.3: IFNγ increases CD38 expression in AML cells...... 65!
Figure 3.4: IFNγ-mediated CD38 up-regulation requires p38, NF-κB, and JAK/STAT .. 66!
Figure 3.5: IFNγ enhances antibody-mediated fratricide in AML cells ...... 67!
Figure 3.6: IFNγ enhances anti-CD38 therapy in vivo...... 69!
Figure 4.1: TLR 7/8 agonists reverse the tolerogenic phenotype of pDCs in AML ...... 90!
Figure 4.2: R848 induces functional changes in AML pDCs ...... 92!
Figure 4.3: IFNβ mediated up-regulation of CD38 and CD86 is IRF9 dependent...... 93!
Figure 4.4: pDC-dependent IFNβ production enhances CD38 expression on AML cells 95!
xiii
Figure 4.5: IFNβ-induced AML cytotoxicity is enhanced with anti-CD38 antibody daratumumab...... 96!
Figure 4.6: IFNβ increases CD38 expression on Leukemic Stem-like cells ...... 98!
Figure 5.1: AHCC decreases survival of AML cells...... 116!
Figure 5.2: AHCC increases apoptosis in most AML cell lines...... 117!
Figure 5.3: AHCC decreases AML-cell proliferation...... 118!
Figure 5.4: AHCC-induced cell death is Caspase-3-dependent...... 119!
Figure 5.5: Caspase-3 cleavage is required for AHCC-induced apoptosis of AML cells.
...... 120!
Figure 5.6: AHCC induces Caspase-8 cleavage and upregulation of Fas and TRAIL. .. 122!
Figure 5.7: AHCC is not toxic toward healthy monocytes...... 123!
Figure 5.8: AHCC increases survival in vivo...... 124!
xiv
List of Abbreviations:
ADC Antibody drug conjugate
ADCC Antibody-dependent cellular cytotoxicity
ADCP Antibody-dependent cellular phagocytosis
AHCC Active-hexose correlated compound
AML Acute Myeloid Leukemia
APAF-1 Apoptotic peptidase activating factor 1
APL Acute promyelocytic leukemia
ATRA All-trans retinoic acid
AZA Azacitidine
BiTE Bi-specific T-cell engaging antibody
CAR T-cells Chimeric antigen receptor T-cells
CDC Complement-dependent cytotoxicity
CLL Chronic Lymphocytic Leukemia
CR Complete remission
CRM1 Chromosome maintenance 1
CRS Cytokine release syndrome
DC Dendritic cell
DHODH Dihydroorate dehydrogenase
EGFR Epidermal Growth Factor Receptor
xv
ERK Extracellular signal-related kinases
FAB French-American-British
Fc Fragment cyrstallizable region
FcγR Fcγ Receptor
FcγRs Fc gamma receptor
FLT3 Fms-like tyrosine kinase
GAS Gamma-interferon activation sites
GEF Guanine nucleotide exchange factors
GO Gemtuzumab Ozagomicin
GvH Graft-versus-host haNK High-affinity natural killer
HD Healthy donor
HER2 Human Epidermal Growth Factor Receptor 2
HSCT Hematopoietic stem-cell transplant
IDH 1/2 Isocitrate dehydrogenase 1/2
IDO Indoleamine 2,3-dioxygenase
IFN Interferon
IFNAR 1 Interferon-alpha/beta receptor chain 1
IFNAR 2 Interferon-alpha/beta receptor chain 2
IFNα Interferon-alpha
IFNβ Interferon-beta
IFNγ Interferon-gamma
xvi
IFNω Interferon-omega
IgG Immunoglobulin G
IL-10 Interleukin-10
IL-4 Interleukin-4
IRF9 Interferon regulatory factor 9
ISGF3 Interferon-stimulated gene factor 3
ISRE Interferon-sensitive response element
ITAM Immunoreceptor tyrosine-based activating motif
ITIM Immunoreceptor tyrosine-based inhibitory motif
JAK1 Janus kinase 1
JAK2 Janus Kinase 2
LDH Lactate dehydrogenase
LPS Lipopolysaccharide
LSC Leukemic stem cell mAB Monoclonal Antibody
MAPK Mitogen-activated protein kinase
March 3 Membrane associated ring-CH-type finger 3
March 9 Membrane associated ring-CH-type finger 9
MDSC Myeloid-derived suppressor cell
MM Multiple Myeloma
NK Natural killer
NSG NOD/SCID gamma mice
xvii
PARP Poly (ADP-ribose) polymerase
PBD Pyrrolobenzodiazapine
PD-1 Programmed cell death protein 1
PD-L1 Programmed death-ligand 1
PI3K Phosphoinositide 3-kinase
RA Retinoic acid
RA Rheumatoid Arthritis
ROS Reactive Oxidative species
ScFv Single-chain variable fragment
SNP Single nucleotide polymorphism
SRBC Sheep red blood cell
STAT 3 Signal transducer and activator of transcription 3
STAT1 Signal transducer and activator of transcription 1
STAT2 Signal transducer and activator of transcription 2
T-reg Regulatory T-cells taNK Target activated natural killer
TLR Toll-like receptor
TPOR Thrombopoietin receptor
TRAIL (TNF)-related apoptosis inducing ligand
TRAILR (TNF)-related apoptosis inducing ligand receptor
TRUCK T-cell redirected for universal cytokine-mediated killing
TYK2 Tyrosine kinase 2
xviii
URD Unrelated donor
WHO World Health Organization
WT Wil
xix
Chapter 1. !Introduction
This dissertation examines two ways to approach cancer therapy, focusing on the innate immune system as well as the cancer itself. The following chapter will introduce important concepts involving the role of macrophages/monocytes in antibody therapy against cancer as well as give background on Acute Myeloid Leukemia (AML).
1.1.!Antibody Therapy, Overview
The use of monoclonal antibodies (mABs) as a treatment for cancer has been progressing rapidly in the last 15 years.1 In fact, there are more than 550 antibody drugs in clinical development making them the fastest growing class of drugs.2 These therapeutic antibodies are able to recognize antigens on tumor cells and function in a multitude of ways. They can exert their effects by blocking growth signals, inhibiting angiogenesis, delivering toxic compounds to cancer cells, as well as indirectly inducing immune-mediated tumor cell killing.3 However, despite showing significant effects, the low rates of complete remission combined with the relatively high relapse rate suggest strongly that there is much room for improvement.4–6
1.1.1.!Role of macrophages in antibody therapy
Monocytes and macrophages play an important role in the innate immune response by phagocytosing IgG-opsonized infectious particles and are major mediators in the destruction of tumor cells.7–10 Indeed, the importance of monocytes in clearing antibody- targeted tumor cells has been well established.11–13 In fact, it has been shown that IFNγ
1 treated macrophages have been able to phagocytose Rituximab-coated primary chronic lymphocytic leukemia (CLL) cells demonstrating their role as effector cells in antibody therapy.14 Additionally, macrophages have demonstrated antibody-dependent phagocytic potential in both anti-epidermal growth factor positive (EGFR+) colon cancer and anti- human epidermal growth factor receptor positive (HER2+) breast cancer.15,16
Furthermore, Overdijk et al. illustrated the importance of macrophages in anti-CD38
(daratumumab) therapy against both lymphoma and multiple myeloma (MM) cells.17
Here, the group performed live cell imaging to visualize daratumumab-mediated phagocytosis of Burkitt Lymphoma cells by mouse macrophages. They were able to quantify phagocytic events through a flow cytometry assay by labeling the effector mouse macrophages and target lymphoma cells with different fluorescent dyes and measuring double positive events. Additionally, they were able to demonstrate daratumumab-mediated phagocytosis in 11 out of 12 primary MM patient samples. These results show the importance of macrophages/monocytes in antibody therapies against cancer.17 Finally, Uchida et al. emphasized the importance of macrophages in clearing anti-CD20 antibody labeled circulating and tissue B-cells. Here, macrophages were depleted in either wild-type (WT) mice or mice with genetic deficiencies in leuckocyte subpopulations. Subsequently, mice were treated with an anti-CD20 antibody and B-cell numbers were quantified. Interestingly, there was no significant B-cell depletion in macrophage-deficient mice treated with the anti-CD20 antibody. However, there was significant B-cell depletion in both T-cell deficient athymic nude and NK cell defective
2
Perforin -/- mice. These findings again illustrate the importance of macrophages in antibody therapy.8
1.1.2.!FcγRs in antibody therapy
IgG monoclonal antibodies are composed of both a variable F(ab’)2 portion and a constant fragment cyrstallizable (Fc) region which binds to FcγR on immune cells.18
FcγRs on immune cells play a critical role in antibody-mediated tumor cell clearance.
The activation of FcγR signaling is initiated by the binding of the Fc portion of IgG to
FcγRs. FcγR-mediated effector functions including antibody-dependent phagocytosis
(ADCP), cytokine release, reactive oxidative species (ROS) release, and antibody- dependent cellular cytotoxicity (ADCC) resulting in clearance of the tumor cells.19
In humans, there have been three classes of FcγRs recognized, FcγRI (CD64), FcγRII
(CD32), and FcγRIII (CD16). Each class of FcγR has different affinity towards the Fc- portion of antibodies, with FcγRI being the high affinity receptor. FcγRII consists of the activatory receptors FcγRIIa and FcγRIIc and the sole inhibitory FcγR, FcγRIIb. FcγRIII consists of both FcγRIIIa and FcγRIIIb. Monocytes and macrophages express both activating and inhibitory FcγRs (Figure 1.1). The activating FcγRs: FcγRI, FcγRIIa,
FcγRIIIa enhance FcγR-mediated functions upon immune complex engagement, whereas the inhibitory FcγRIIb suppresses FcγR-mediated responses. The activating receptors are either associated directly or indirectly with an immunoreceptor tyrosine-based activation motif (ITAM).20
In monocytes and macrophages, the activating receptors FcγRI and FcγRIIIa are both associated with the ITAM containing common γ-chain adaptor. On the other hand,
3
FcγRIIa is able to function independently because it has an ITAM present within its own cytoplasmic tail.21 FcγRIIb, contains an immunoreceptor tyrosine-based inhibitor (ITIM) motif within its cytoplasmic tail.
1.1.3.!Augmenting responses in antibody therapy:
The efficacy of many monoclonal antibodies depends on the ability of the antibody to bind both the antigen target and Fc receptors on effector cells to initiate
FcγR-mediated effects such as ADCC and ADCP. One mechanism of enhancing antibody-mediated responses is by modifying the Fc portion of therapeutic antibodies.22
CSL362, an anti-CD123 antibody, is an example of an Fc-engineered antibody that has shown considerable success in vitro and in vivo. Fc engineering of this antibody consisted of two amino-acid point mutations (S239D and I332E). These mutations caused increases in the binding affinity of FcγRIIIa on natural killer (NK) cells to the anti-CD123 antibody with subsequent increases in cytotoxicity.23 BI 836858 is another example of an anti-CD33 Fc engineered antibody that has shown promise against AML. Fc engineering consisted of 2 amino acid substitutions in the CH2 domain of the IgG1 anti-CD33 antibody.24
Additionally, modulating the glycan structure of IgG at the CH2 domain can increase Fc-FcγR affinity. Engineering antibodies with altered glycosylation patterns
(reducing fucose groups or increasing the amounts of bisecting N-acetylglucosamine) increases ADCC activity.25 Another way to enhance the efficacy of monoclonal antibodies is to increase their serum half-lives. Since the serum half-life of IgG antibodies depends on the binding affinity to FcRn, antibodies with higher affinities to FcRn will
4 have longer serum half-lives. In fact, Hinton et.al demonstrated that IgG1 mutants with higher affinity to human FcRn have significantly higher serum half-lives when compared to wild-type antibodies.26,27
Another way of enhancing antibody therapy is by focusing on the FcγRs themselves. In fact, certain FcγR polymorphisms increase IgG binding affinity. Single- nucleotide polymorphisms (SNPs) in FcγRIIa (H131R) and FcγRIIIa (V158F) appear to have higher affinity to certain IgG subtypes and correlate with better responses to therapeutic antibodies.3 Modulating the ratio of activating versus inhibitor FcγRs on immune effector cells is another important determinant of FcγR-mediated responses.
Our lab has identified the role of different toll-like receptor (TLR) ligands as modulators of FcγR expression on monocytes. For example, the TLR 7/8 agonist,
R848, has been shown to up-regulate the activating FcγRs, FcγRIIa as well as the
FcγRI and FcγRIIIa associated γ-chain subunit. R848 was also able to down-regulate the inhibitory FcγRIIb. Functionally, R848 was able to enhance ADCC of cetuximab- coated MDA-MB-468 cells. In vivo, R848 was able to significantly reduce tumor volume in an anti-Her2 CT26-Her2/neu mouse subcutaneous mouse model.28
Additionally, Shah et al demonstrated enhanced FcγR-mediated responses in monocytes after TLR2 ligand treatment. Upon further investigation, they found that
TLR2 is able to up-regulate both FcγRIIa and the common γ-chain subunit contributing to enhanced FcγR-mediated responses.
1.2.!Acute Myeloid Leukemia, Overview:
AML is a devastating hematologic malignancy caused by the clonal expansion of
5 myeloid precursors in the bone marrow, peripheral blood, and tissues. Although, 35-40% of patients under the age of 60 go into remission, the disease still remains quite fatal to those over 60 years.29 Allogeneic hematopoietic stem-cell transplantation (HSCT) can be curative for certain patients with AML; however, very few patients are candidates for this procedure. This procedure is also extremely expensive and requires a lengthy hospital stay. Additionally, there are barriers that may limit Unrelated Donor (URD) availability that include age, sex, socioeconomic status, donor registry and center funding, as well as insurance restrictions that all provide barriers for access to HCT.30 Development of new ways, that have fewer barriers than HCT, to treat AML, such as immune therapy, would benefit greater AML patients.
1.2.1.!Classification of AML
Originally, AML was classified based on the French-American-British (Fab) classification scheme, which defined AML subtypes based on morphologic and phenotypic data (M0 to M7). Later, the World Health Organization (WHO) developed a new classification scheme, which focused on genetic and cytogenetic abnormalities in
AML. In this system, AML can be organized into seven subtypes: AML with recurrent genetic abnormalities, AML with myelodysplasia-related features, therapy-related AML and MDS, AML (not other specified), myeloid sarcoma, myeloid proliferations related to
Down syndrome, and blastic plasmacytoid dendritic cell neoplasms.31
1.2.2.!Immunosuppression in AML:
The tumor microenvironment in AML is quite immunosuppressed. Leukemic blasts, themselves, can alter host immune responses in both a contact-dependent and
6 contact-independent manner. Indoleamine 2,3-dioxygenase (IDO) is an important enzyme in tryptophan metabolism and plays a role in the immunosuppressive leukemic environment. AML cells constitutively express IDO which causes tryptophan metabolism and inhibits T-cell activation.32–34 Specifically, in AML, this causes the conversion of
CD4+CD25- cells into CD4+CD25+ regulatory T-cells (Treg) in vitro.32,35 Clinically, the expression of IDO in patients with AML has been associated with poor clinical outcomes.32
Arginase I expression in Myeloid-derived suppressor cells (MDSCs) plays a role in the suppressive nature of these cells.32,36,37 Since AML cells are myeloid in nature, it was hypothesized that Arginase I could also play a role in their immunosuppressive phenotype. In fact, it has been shown that AML cells are able to inhibit T-cell proliferation and induce an M2-like phenotype in monocytes in an Arginase I dependent fashion.32,37
Another direct mechanism by which AML cells can evade immune cell destruction is through the expression of the programmed death-ligand 1 (PD-L1). PD-L1 is a ligand for the receptor Programmed death-1 (PD-1), which is primarily expressed on
T-cells. Under normal state, the PD-1 receptor binds to PD-L1 on antigen-presenting cells causing T-cells to become tolerogenic. This phenomenon plays an important role in peripheral tolerance. However, AML cells can also express PD-L1, which inhibits the T- cell anti-tumor response.38 In fact, higher PD-L1 expression has been shown to correlate with AML progression. Recently, the PD-1 blocking antibody Nivolumab has been studied in the context of AML. In a phase IB/II clinical trial, Daver et al, showed that full
7 dose azacytidine (AZA) and Nivolumab are both tolerable and produce encouraging response rates in patients with AML.39,40
1.2.3.!Differentiating AML blasts into effector cells:
Since AML blasts can cause immunosuppression, many have focused on ways to induce AML cell differentiation. Transcription factors involved in myeloid differentiation are aberrantly expressed causing the differentiation block in AML. Many studies have explored mechanisms of differentiating AML blasts.41 The most successful of these studies is related to acute promyelocytic leukemia (APL), the M3 subtype of AML. Most
APL is characterized by a t(15;17)(q22;21) translocation which generates the PML-RARa fusion protein. This oncogenic protein is able to prevent the activation of many target genes involved in myeloid differentiation.41,42 In the early 1980’s researchers discovered that retinoic acid (RA) could differentiate human promyelocytic leukemic cells in vitro.41,43 In the first clinical trial, 23/24 patients with APL went into complete remission
(CR) with all-trans retinoic acid (ATRA) treatment. ATRA is able to degrade the PML-
RARa fusion protein leading to APL cell differentiation and better outcomes in patients.41,42 Although successful in APL, ATRA did not have success in other forms of
AML, leading to a need for alternative differentiation therapies. Today, other therapeutic agents are being assessed for their differentiation potential. In fact, Sykes et al. evaluated over 300,000 small molecules for their differentiation potential. They found 12 compounds, which showed an ability to induce differentiation, including inhibitors of dihydroorate dehydrogenase (DHODH).44,45 Yea et al. looked at the effect of an agonist antibody specific for the Thrombopoietin receptor (TPOR) on AML cells. They found
8 that this antibody is able to differentiate AML blasts into an NK-like state. These cells are then able to kill other AML cells in a Granzyme B/Perforin B-mediated manner.46,47
These studies show the importance of focusing on therapies to induce AML differentiation. Specifically, Yea et al. illustrated how AML blasts can be coaxed into developing an effector-like phenotype targeting cancer cells, themselves.
1.3.!Acute Myeloid Leukemia, Therapeutics:
In addition to conventional chemotherapy, novel AML therapeutics are being generated. Fms-like tyrosine kinase 3 (FLT3) inhibitors have been studied in depth.
Unfortunately, one major problem with using this class of inhibitors as a sole agent is drug resistance. Today, the novel FLT3 inhibitors, G-749 and ASP2215, are showing promising results in overcoming drug resistance. Another therapeutic target being studied in AML is isocitrate dehydrogenase 1/2 (IDH 1/2). Somatic gain-of-function mutations in
IDH 1/2 are found in both hematologic and solid tumors. IDH inhibitors such as AG-221 have shown promising results in phase I clinical trials. Chromosome maintenance 1
(CRM1) is another therapeutic target that is up-regulated in AML. CRM1 plays a role in the export and inactivation of the tumor suppressors p53, p73, FOXO1, RB1, and p21.
Currently, both Phase I/II clinical trials are being completed with the CRM1 inhibitor,
Selinexor, in AML. Monoclonal antibodies targeting AML specific antigens are also being studied. Sialic acid-binding Ig-lectin or CD33 is a receptor expressed preferentially on myeloid cells, including leukemic blasts.48 The toxin-conjugated anti-CD33 antibody,
Gemtuzumab ozagomicin (GO) was FDA approved after promising Phase 3 clinical results. However, it was later withdrawn from the market because of toxicity issues,
9 specifically veno-occlusive disease. Today, lower doses of this drug are being revisited in combination with chemotherapy.48 In addition to GO, Vadastuximab talrine (SGN-
CD33A) an anti-CD33 antibody conjugated to pyrrolobenzodiazapine (PBD) dimer is being evaluated as an addition to chemotherapy. Other antigens that have been targeted by antibody therapy in AML include CD123 and CD48. CSL360, an Fc-engineered anti-
CD123 antibody is being studied in early-phase clinical trials. Additionally, pre-clinical studies of CD47 blocking antibodies (Hu5F9-G4) have shown promising results. CD47 expressed on AML cells binds to SIRPα on macrophages in order to evade phagocytosis.
Phase 1 clinical trials using the CD47 blocking agent are currently in progress.48
Bispecific T cell-engaging antibodies (BiTEs) are also being evaluated in the context of AML. These antibodies are constructed by joining two single-chain variable fragments (scFVs) allowing them to bind to both a tumor cell and T cell. In AML, an anti-CD33/CD3 BiTE has been developed. Currently, a phase 1 clinical trial is in progress studying this therapeutic (NCT02520427) Finally, the field of CAR-T cells
(Chimeric antigen receptor T cells) has started to progress. Although CAR-T cells have been successful in B-cell malignancies, they have caused profound myeloablation in
AML. Recently however, a LeY-CAR-T cell showed promising results against AML in a phase 1 Clinical Trial. This CAR-T cell was generated by using an scFv region directed against the TAA Lewis (LE)-Y coupled to the cytoplasmic domains of the co-stimulatory
T-cell marker CD28 and TCR-ζ chain.48,49
1.3.1.!Interferons in AML
There are two primary classes of interferons. Type 1 Interferons (IFNs) are
10 composed of Interferon-alpha (IFNα), Interferon-beta (IFNβ) and Interferon-omega
(IFNω), which bind to the Type 1 IFN receptor. Type II IFNs consist of Interferon- gamma (IFNγ), which binds to the Type II IFN receptor. The Type 1 IFN receptor is composed of two subunits: IFNAR1, which associates with tyrosine kinase 2 (TYK2) and
IFNAR 2, which associates with JAK1. In the conventional pathway, once Type 1 IFNs bind to the Type 1 IFN receptor, the receptor subunits dimerize causing the autophorphorylation of JAK1/TYK2. This results in the phosphorylation of STAT1 and
STAT2, which leads to the formation of the STAT1-STAT2-IRF9 complex, also known as the IFN-stimulated gene (ISG) factor 3 (ISGF3) complex. ISGF3 then translocates to the nucleus and binds IFN-simulated response elements (ISREs) initiating transcription.
Unlike Type 1 IFNs, IFNγ, activates JAK1/JAK2 auto-phosphorylation and subsequent
STAT1/STAT1 activation. This complex then translocates to the nucleus to bind IFNγ- activated site (GAS) elements. Interestingly, there are many instances of crossover between Type 1 and Type 2 IFN signaling. For example, Type 1 IFN signaling can also result in STAT1/STAT1 homodimer formation and subsequent GAS transcription.
In addition to the canonical, JAK/STAT signaling pathway, there are many non- canonical pathways that play a role in IFN signaling. Type 1 IFN-activated JAKs can lead to the phosphorylation of both Vav and other guanine-nucleotide-exchange factors
(GEFs) which initiate p38 MAPK signaling. Additionally, both the MEK-ERK and phosphatidylinositol 3-kinase (PI3K) pathways have been demonstrated to be activated by both Type 1 and Type II IFNs.50–52
Both Type 1 and Type 2 IFNs are being used to treat immune malignancies today.
11
Interferon gamma-1b is an FDA-approved drug that is being used to prevent infections in
Chronic Granulomatous Disease and to delay severe malignant osteopetrosis.53–55 IFNβ has been used in the context of Multiple Sclerosis.50 IFNα has been used in hematologic malignancies, solid tumors and viral syndromes. IFNα, has also been studied in the context of AML for the induction of remission or as a post-remission therapy.56 Type 1
IFNs have shown promise because they are able to exert anti-tumor effects on cancer cells by limiting the secretion of certain cytokines which promote growth, stimulate apoptosis, increase the immunogenicity of AML cells, and inhibit AML cell proliferation.56 Additionally, Type 1 IFNs have indirect anti-tumor effects by activating dendritic cells (DCs), T cells, and NK cells. In fact, Lowdell et al. reported a complete remission and recovery of NK cell function in two AML patients treated with IFNα.57
Other clinical trials in AML using IFNα have been completed with moderate success.
Problems with inter-study variability and the short half-life of exogenous IFNα may have contributed to the moderate success. However, longer-acting formulations such as pegylated IFNs or albumin-IFN fusion proteins have renewed hope for the drug.58
1.3.2.!Natural Products, Overview
Cancer immunotherapies and adjuvants can help stimulate the immune system and lead to a better immune response against cancer cells. These immune modulators, which include both IFNs and natural products, are being explored as potential enhancers of antibody therapy.59 Natural products are especially valuable because they do not cause severe side effects that other cancer therapeutics can cause. Since 2007, there have been
12 novel natural products that have been brought to market including Ixabepilone
12
(Ixempra ®) used for aggressive breast cancer, Vinflunine (Javlor ®) used for bladder cancer, among many others.60 In combination with monoclonal antibody therapy, adjuvants can have a tremendous effect against cancer cells. If synergism with natural products does occur, one could potentially taper down the dose of other therapeutics that cause harsher side effects.
1.3.3.!Natural Products in the context of AML
Although AML patients given conventional chemotherapy usually have high remission rates, many still do relapse. Currently, the belief is that leukemic stem cells
(LSCs) play a major role in AML relapse. Recent studies on natural products have focused on ways to target leukemic stem cells (LSCs) while leaving normal hematopoietic cells unaffected. Parthenolide is a sesquiterpene lactone that is present in the medicinal plant Tanacetum parthenium. It has been shown that this natural product is able to induce apoptosis through the inhibition of NF-κB in CD34+/CD38- AML cell populations while sparing normal hematopoietic cells. Parthenolide analogs are currently being evaluated in Phase II clinical trials for AML.62–64 Triptolide is a natural product derived from the plant Tripterygium wilfordii that has been shown to induce apoptosis of
LSC-like cells as well as sensitize AML cells to chemotherapy. Cyclopamine is an alkaloid derived from Veratrum californicum that is able to inhibit hedgehog signaling.
Since CD34+ cell lines have higher levels of hedgehog signaling compared to CD34- cell lines, it was found that cyclopamine could induce apoptosis in CD34+ cells, while sparing CD34- cells.62,65 Resveratrol is a natural product found in the skins of grapes and other berries. Hu et al. reported that this natural product can both inhibit the growth and
13 induce cytolysis of the leukemic stem-cell like KG1a cells.62,66,67 These are a few of the many examples of natural products being tested in AML that may be used in combination with other therapeutics in the future.
1.4.!Conclusion and Significance
This thesis aims to understand the importance of both the innate immune system and tumor cell in the context of monoclonal antibody therapies. Monocytes/macrophages are important effector cells in antibody therapy. In Chapter 2, we examine different ways to enhance antibody signaling by modulating FcγR expression on monocytes. However, since many cancers induce an immunosuppressive state, it is important to look at different ways to activate the cancer cell itself. In Chapters 3 and 4, we focus our attention on AML blasts. Since AML cells are of myeloid origin, we hypothesized that
IFNs would be able to shift the phenotype of these cells to an effector-like state. We were able to see that both Type 1 and Type 2 IFNs could induce AML cell-to-cell-killing in the context of antibody therapy. By focusing on the cancer cell itself, we were able to demonstrate a novel mechanism of antibody-mediated killing and possibly reduce the immunosuppressive nature of blasts, themselves. In Chapter 5, we conclude our explorations with a natural product, active-hexose correlated compound (AHCC) that was able to induce extrinsically-mediated apoptosis in AML blasts, but not in healthy donor monocytes. Overall, the in-depth studies in this dissertation illustrate the importance of targeting both the innate immune system and tumor itself as a mechanism of cancer therapy.
14
Figure 1.1: FcγRs on monocytes/macrophages
Monocytes and macrophages express both activating and inhibitor FcγRs. The activating
FcγRs include FcγRI, FcγRIIa, FcγRIIIa (in green) and the inhibitory FcγR includes
FcγRIIb (in red). FcγRI and FcγRIIIa are both associated with the ITAM containing common γ-chain adaptor. FcγRIIa is able to function independently because it has an
ITAM present within its own cytoplasmic tail. FcγRIIb, contains an immunoreceptor tyrosine-based inhibitor (ITIM) motif within its cytoplasmic tail. This image has been developed in the Tridandapani Laboratory.
15
Chapter 2. !Toll-like Receptor 4 Ligands Down-regulate Fcγ Receptor IIb (FcγRIIb)
via MARCH3 Protein-mediated Ubiquitination
2.1.!Abstract
Monocytes and macrophages are critical for the effectiveness of monoclonal
antibody therapy. Responses to antibody-coated tumor cells are largely mediated by
FcγRs, which become activated upon binding to immune complexes. FcγRIIb is an
inhibitory FcγR that negatively regulates these responses, and it is expressed on
monocytes and macrophages. Therefore, deletion or down-regulation of this receptor may
substantially enhance therapeutic outcomes. Here we screened a panel of TLR agonists
and found that those selective for TLR4 and TLR8 could significantly down-regulate the
expression of FcγRIIb. Upon further examination, we found that treatment of monocytes
with TLR4 agonists could lead to the ubiquitination of FcγRIIb protein. A search of our
earlier microarray database of monocytes activated with the TLR7/8 agonist R-848
revealed an up-regulation of membrane-associated ring finger (C3HC4)3(MARCH3), an
E3 ubiquitin ligase. Since R848 is also able to down-regulate FcγRIIb, we asked whether
MARCH3 could be involved in LPS-mediated down-regulation of FcγRIIb. Therefore,
we next tested whether lipopolysaccharide (LPS) treatment could up-regulate MARCH3
in monocytes and whether this E3 ligase was involved with LPS-mediated FcγRIIb
down-regulation. The results showed that LPS activation of TLR4 significantly increased
MARCH3 expression and that siRNA against MARCH3 prevented the decrease in
FcγRIIb following LPS treatment. These data suggest that activation of TLR4 on 16 monocytes can induce a rapid down-regulation of FcγRIIb protein and that this involves ubiquitination.
2.2.!Introduction
In this chapter, we will examine the role of monocytes/macrophages in antibody therapy. Antibody-dependent destruction of target cells is largely mediated by Fcγ receptors (FcγRs).8,68,69 Human monocytes and macrophages express at least four different functional FcγRs: FcγRI, FcγRIIa, FcγRIIb, and FcγRIIIa.70 Of these, FcγRI,
FcγRIIa, and FcγRIIIa are activating receptors that drive cellular responses to antibodies.
These receptors either contain, within their cytoplasmic tails, an ITAM, as in the case of
FcγRIIa,71 or are associated with the γ-chain homodimer that has an ITAM.72 The association of the γ-chain is critical not only for surface expression of FcγRI and
FcγRIIIa but also for signaling from these receptors. In mice that do not express the
ITAM-containing FcγRIIa, deficiencies in γ-chain expression abrogate the surface expression and function of activating FcγR.73
In contrast, FcγRIIb is an inhibitory receptor that has an immune receptor tyrosine-based inhibitory motif in its cytoplasmic tail.74,75 Co-clustering of FcγRIIb with
ITAM-FcγR results in phosphorylation of the immune receptor tyrosine-based inhibitory motif tyrosine (ITIM) and association of Src homology 2 domain-containing inositol 5′- phosphatase (SHIP) with FcγRIIb.75–78 This clustering of FcγRIIb and its association with
SHIP serves to inhibit FcγR-mediated responses.79 Without FcγRIIb (or SHIP), FcγR activity is increased. For example, bone marrow-derived macrophages from FcγRII- deficient mice display enhanced phagocytic ability compared with wild-type bone
17 marrow-derived macrophages,80 and SHIP-deficient bone marrow-derived macrophages can more effectively phagocytose IgG-coated particles than wild-type bone marrow- derived macrophages.81 Therefore, the effectiveness of FcγR-mediated function is dictated by the ratio of activating to inhibitory FcγR on effector cells.82 Indeed, this has been demonstrated by Clynes et al.,69 who showed that antibody-mediated clearance of
B16 melanoma cells was enhanced markedly in mice that had a genetic deletion of
FcγRIIb.
The expression of FcγR is malleable. It has been shown that pro-inflammatory cytokines such as IFNγ up-regulate the expression of ITAM-FcγR, thereby enhancing monocyte/macrophage responses.83–85 In contrast, IL-13 has been shown to downregulate these activating FcγRs,86 and IL-4 can up-regulate expression of the ITIM -bearing
FcγRIIb, with the combination of interleukin-4 (IL-4) and interleukein-10 (IL-10) leading to synergistic increases in this receptor.83,87–89 TLR agonists can also influence FcγR expression. For example, previous work in our laboratory has shown that the TLR7/8 agonist R-848 could simultaneously increase the expression of activating FcγR and decrease expression of the inhibitory FcγRIIb.28 In this earlier study, we also found that up-regulation of activating FcγR depended on autocrine/paracrine signaling, whereas the downregulation of FcγRIIb did not. However, the precise mechanisms involved in the
TLR-mediated down-regulation of FcγRIIb are not fully understood.
Here we examined the down-regulation of FcγRIIb by TLR agonists in greater detail in an attempt to uncover the underlying mechanism(s) of the modulation. We began by screening a battery of TLR agonists to identify those capable of decreasing FcγRIIb
18 and found that agonists for TLR4 and TLR8 caused a rapid and simultaneous decrease in transcript and protein levels. We interrogated the mechanisms behind the rapid reduction in FcγRIIb protein using the TLR4 agonist LPS and found that it involved the ubiquitination of FcγRIIb and that it depended on the E3 ubiquitin ligase MARCH3.
Therefore, these results identify a novel mechanism by which TLR agonists can modulate expression of the inhibitory FcγR and, thereby, alter the ratio of activating to inhibitory
Fcγ receptors.
2.3.!Materials and Methods
Antibodies and Reagents.
LPS, used at 1 to 1000 ng/ml was purchased from Sigma-Aldrich (St. Louis,
MO). Agonists for TLR2 (Pam2CSK4, used at 100 ng/ml), TLR3 (polyI:C, used at 10
µg/ml), TLR5 (Flagellin, used at 100 ng/ml), TLR8 (CL075, used at 0.01–10 µM), and
CpG (used at 10 µg/ml) were purchased from Invivogen (San Diego, CA). The TLR7- selective agonist 3M-055 (used at 1 µM) was provided by 3M Drug Delivery Systems
(Minneapolis, MN). The TLR8-selective agonist motolimod, formerly known as VTX-
2337 (used at 1 µM) was provided by VentiRx (Seattle, WA). Anti-FcγRIIb (CD32b) antibody for Western blotting was purchased from Abcam (Cambridge, MA). Anti- ubiquitin antibody was purchased from Cell Signaling Technology (Beverly, MA).
Antibodies against actin and HRP-conjugated anti-goat and anti-mouse secondary antibodies were from Santa Cruz Biotechnology. Anti-rabbit HRP-conjugated secondary antibody was purchased from Cell Signaling Technology. TRIzol® was purchased from
19
Invitrogen. Reverse transcriptase, random hexamers, and SYBR Green PCR mix were purchased from Applied Biosystems (Foster City, CA).
PCR primers were purchased from Invitrogen. Sequences for FcγRIIa, FcγRIIb, and GAPDH were as described previously.19 Primer sequences to detect MARCH transcripts were as follows: MARCH3 forward, GCGAGGACGATGGAAATCCT;
MARCH3 reverse, CTTGCATGACATACTGCGGC; MARCH7forward,
CAAGCACACGTGTCCGATTTA; MARCH7 reverse,
TGGTCTCCGTCTTCTTCGGA; MARCH9 forward, AGAAGGTCCAGATTGCTGCC; and MARCH9 reverse, GATGAGGCCTATGCAGACGA.
Human and mouse whole-molecule IgG were from Jackson ImmunoResearch
Laboratories (West Grove, ‘PA). N-[1-(2,3-dioleoyloxy)propyl]-N,N,N- trimethylammonium methyl-sulfate liposomal transfection reagent was purchased from
Roche Applied Science. Dharmacon control and MARCH3 siRNA constructs were purchased from GE Life Sciences (Lafayette, CO). Recombinant protein G-agarose beads were purchased from Invitrogen. Red blood cell lysis buffer was purchased from eBioscience (San Diego, CA). The ubiquitin E1 inhibitor UBEI-41 (PYR-41) was purchased from Biogenova (Potomac, MD).
Western Blotting and ELISAs
Western blotting was done as described previously.90 Cells were lysed in TN1 buffer (50 mM Tris (pH 8.0), 10 mM EDTA, 10 mM Na4P2O7, 10 mM NaF, 1% Triton
X-100, 125 mM NaCl, 10 mM Na3VO4, and 10 µg/ml each aprotinin and leupeptin).
Protein lysates were boiled in Laemmli sample buffer, separated by SDS-PAGE,
20 transferred to nitrocellulose membranes, probed with the antibody of interest, and then developed by Pierce ECL 2 Western blotting substrate (Thermo Scientific, Rockford, IL) or SuperSignal West Femto maximum sensitivity substrate (Thermo Scientific).
Densitometry was performed using ImageJ software (National Institutes of Health,
Bethesda, MD), and ratios between the indicated probes and their respective anti-actin reprobes were calculated. Cell supernatants were collected, centrifuged at full speed to clear cellular debris, and then assayed for cytokine via sandwich ELISA (R&D Systems,
Minneapolis, MN) according to the protocol of the manufacturer.
Real-time RT-PCR (qPCR)
Cells were lysed in TRIzol® reagent (Invitrogen), and RNA isolation was completed according to the instructions of the manufacturer. Reverse transcription was done with 50–200 ng of total RNA. The cDNA was run in duplicate for each donor on an
Applied Biosystems Step One Plus system with automatically calculated thresholds.
Relative copy number was calculated as 2↽−ΔCt, with ΔCt calculated by subtracting the Ct of the housekeeping control (GAPDH) from the experimental sample Ct.91,92
Peripheral Blood Monocyte Isolation
Peripheral blood monocytes (PBM) were isolated from Red Cross Leukopaks via
Ficoll separation (Mediatech, Manassas, VA), followed by CD14-positive selection using
MACS® (Miltenyi Biotec, Inc., Cambridge, MA) as described previously.28 PBM were resuspended in RPMI 1640 containing 10% heat-inactivated FBS (Hyclone, Logan, UT), penicillin/streptomycin, and L-glutamate (Invitrogen). The purity of the monocytes obtained was > 97%, as determined by flow cytometry with CD14 antibody.
21
Phagocytosis
Phagocytosis assays were performed as described previously.19 Briefly, IgG- coated, PKH26-labeled sheep red blood cells (SRBC) were added to the PBM. Cells were pelleted briefly by slow centrifugation, followed by 30 min of incubation at 37 °C. Non- ingested SRBC were subjected to hypotonic lysis with RBC lysis buffer and PBS wash prior to fixation with 1% paraformaldehyde. Samples were analyzed by fluorescence microscopy in a blinded fashion. The phagocytic index was defined as the total number of SRBC ingested by 100 phagocytes.
Immunoprecipitations
Immunoprecipitations were performed as described previously.93 PBM were treated with or without TLR agonists at different time points. Cells were lysed in 500 µl of TN1 buffer (50 mM Tris (pH 8.0), 10 mM EDTA, 10 mM Na4P2O7, 10 mM NaF, 1%
Triton X-100, 125 mM NaCl, 10 mM Na3VO4, and 10 µg/ml each aprotinin and leupeptin), and protein lysates were incubated overnight with the specified antibody and protein G-agarose beads. A negative control was included without the specified antibody or without protein G-agarose beads. After incubation, the beads were washed twice with
500 µl of TN1 buffer, boiled with 40 µl of 1× Laemmli sample buffer for 5 min, and subjected to SDS-PAGE. Proteins were transferred to nitrocellulose membranes, probed with the antibody of interest (anti-ubiquitin or anti-CD32B), and then developed by
Pierce ECL 2 Western blotting substrate (Thermo Scientific).
Transfections
22
Transfections were performed using N-[1-(2,3-dioleoyloxy)propyl]-N,N,N- trimethylammonium methyl-sulfate liposomal transfection reagent (Roche Applied
Science) in accordance with the instructions of the manufacturer. Briefly, N-[1-(2,3- dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate solution diluted in HBS buffer (20 mM HEPES (cell culture grade) and 150 mM NaCl (pH 7.4)) was incubated in a 2:1 ratio with either 1.5 µg of MARCH3 siRNA or 1.5 µg of control siRNA for 15 min at room temperature. After incubation, cells were treated with the N-[1-(2,3- dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate/nucleic acid mixture and incubated for 6 h at 37 °C. Cells were then stimulated with or without LPS and incubated for 18 h at 37 °C. Cells were either lysed in TN1 buffer for Western blotting or TRIzol® for real-time RT-PCR to verify transfection efficacy.
Statistics
For experiments that involved placing the cells of each donor across multiple conditions, data were analyzed by using analysis of variance with repeated measures. For experiments with only two groups involved, paired Student's t tests were used to test for statistically significant differences. Analyses of variance were performed using SAS statistical software (SAS, Inc., Cary, NC). p ≤ 0.05 was considered significant.
2.4.!Results
TLR Ligands Down-regulate FcγRIIb
We have found previously that the TLR7/8 agonist R-848 was capable of down- regulating FcγRIIb in monocytes,28 which led us to ask whether other TLR agonists could
23 do this. We treated human PBM overnight with selective agonists for TLR2, TLR3, TLR4,
TLR5, TLR7, TLR8, and TLR9 and then measured the levels of FcγRIIb protein. The results (Figure 2.1 A) showed that agonists for TLR4 and TLR8 almost completely eliminated FcγRIIb, whereas agonists for TLR9 showed modest effects. TLR2 agonists led to variable results, occasionally leading to a slight decrease but, more often, to a modest increase in FcγRIIb, which is in agreement with our earlier findings.19 We repeated this and examined the transcript levels of FcγRIIb and found similar results (Figure 2.1 B), although only agonists for TLR4, TLR8, and TLR9 led to significant differences (Figure
2.1 C). There was a modest trend toward statistical significance for the TLR2 agonist, but the magnitude of change was not sufficient to achieve statistical significance despite the relatively low variability.
A protein Basic Local Alignment Search Tool alignment showed that the isoform of FcγRIIb expressed by monocytes was 90% identical to FcγRIIa with a 74% query coverage, so we next verified that the TLR agonist treatment was specific in down- regulating FcγRIIb and not FcγRIIa. We treated PBM overnight with the TLR4 agonist
LPS and examined protein levels of FcγRIIb and FcγRIIa. The results showed that LPS significantly down-regulated FcγRIIb protein and significantly up-regulated FcγRIIa
(Figure 2.1 D and E, respectively). Similarly, qPCR analysis showed that LPS up-regulated the FcγRIIa transcript (Figure 2.1 F). Because of the robust response, we chose to focus on
TLR4 activation by LPS.
24
Dose and Time Course Responses of FcγRIIb to LPS
Next, we tested the concentration of LPS required to down-regulate FcγRIIb. We treated PBM overnight with LPS concentrations between 0–1000 ng/ml and found that as little as 1 ng/ml was sufficient to elicit at least a partial decrease in protein and transcript levels of the receptor (Figure 2.2 A and B, respectively). We then examined the time course of FcγRIIb down-regulation. As shown in Figure 2.2 C, LPS treatment decreased the levels of FcγR protein in as little as 1 h, although some degree of donor-to-donor variability was seen. Transcript levels were also decreased as early as 1 h (Figure 2.2 D). We next examined the activating receptor FcγRIIa as a control and found that 1 ng/ml was sufficient for up-regulation of protein and transcript (Figure 2.3 A and B, respectively). However, in contrast to FcγRIIb, where changes were seen in as little as 1 h, changes in FcγRIIa protein were not seen until after the 6-h mark (Figure 2.3 C), with transcript increasing at 6 h
(Figure 2.3 D). This is consistent with autocrine-paracrine signaling being required for up- regulation of FcγRIIa, as we have shown previously using the TLR7/8 agonist R-848.28
These results show that LPS modulates FcγRIIb and the nearly identical activating receptor
FcγRIIa through different means because it causes down-regulation of one and up- regulation of the other. Indeed, up-regulation of FcγRIIa has been shown to be caused by secreted factors such as IFNγ and IL-10.83,89,94 Importantly, regarding FcγRIIb, the LPS- mediated decrease in transcript did not precede the decrease in protein, which suggested that LPS was driving the down-regulation of protein and transcript through separate mechanisms.
25
LPS Treatment Leads to FcγRIIb Ubiquitination
The apparent discrepancy between protein and transcript down-regulation of
FcγRIIb was of interest. In particular, the N-terminal MG95 and its lack of a PEST domain suggested that the normal half-life of FcγRIIb should be relatively long, meaning that the reduction in transcript would not account for the rapid decrease in protein levels. Indeed, in murine macrophages, the half-life of FcγRIIb has been measured at ∼10 h.96 Because the plasma membrane is recycled in its entirety two to three times per hour,97 it is likely that FcγRIIb is recycled back to the cell surface under normal conditions but that TLR4 activation somehow disrupts this. Previous reports have shown that binding of immune complexes in J774 cells can lead to lysosomal localization of FcγR within 1 h,98 and phagocytosis of IgG-coated particles in mouse peritoneal macrophages can result in over
50% FcγR degradation within 2 h.96
In an effort to gain insights into the cause of this LPS-driven decrease in FcγRIIb protein, we examined the possibility that ubiquitin was involved. We used UbPred to predict possible ubiquitination sites in FcγRIIb and found one medium- and one high- confidence site at residues 101 and 263, respectively. Interestingly, FcγRIIa shared the medium-confidence site but contained a completely different high-confidence site. This distinct high-confidence ubiquitination site in FcγRIIb opened the possibility that this receptor, but not the activating receptor FcγRIIa, was ubiquitinated following LPS treatment.
We tested whether LPS led to the ubiquitination of FcγRIIb by treating PBM with
LPS for time points from 15 min to 6 h and performing immunoprecipitations to detect
26 receptor-ubiquitin associations. As shown in Figure 2.4, a strong ubiquitin association was found at 1 h. This decreased at later time points, likely because FcγRIIb levels themselves were decreasing. Reciprocal immunoprecipitation experiments in which ubiquitin was pulled down and blots done for FcγRIIb showed roughly similar results, with the strongest association occurring at 30 min (Figure 2.4 B). We also examined ubiquitination of
FcγRIIa, which is up-regulated rather than degraded following LPS treatment. Results showed that, as expected, LPS did not increase its ubiquitination (data not shown).
We then examined the effect of blocking ubiquitination by using the E1-activating enzyme inhibitor Pyr-41. As shown in Figure 2.4 C, pretreatment of PBM with increasing concentrations of Pyr-41 led to attenuation of LPS-mediated FcγRIIb down-regulation.
These results suggest that LPS treatment leads to ubiquitination of FcγRIIb and that this may mediate its degradation.
MARCH3 Is Required for LPS-induced FcγRIIb Down-regulation
A proteomics study of B cells identified the E3 ubiquitin ligase MARCH9 as a potential effector of FcγRIIb degradation.99 Because we have found previously that the
TLR7/8 agonist R-848 could down-regulate FcγRIIb,28 we searched through our microarray datasets of monocytes treated with TLR7 or TLR8 agonists92 to see whether
MARCH9 had been up-regulated. We found a modest increase of MARCH9 but a very strong up-regulation of the related MARCH3 in monocytes treated with the TLR8 agonist. These results suggested that MARCH9 or MARCH3 might be involved in the down-regulation of FcγRIIb. To test this, we treated PBM overnight with LPS and measured the expression of MARCH9, MARCH3, and the related MARCH7 in response
27 to TLR4 activation. The results showed that LPS significantly increased the expression of
MARCH3 (Figure 2.5 A, left panel) but not of MARCH7 or MARCH9 (data not shown).
Because the decrease in FcγRIIb levels occurred in as little as 1 h, we also repeated the
LPS treatment and evaluated MARCH3 expression after 1 h. The results showed up- regulation of MARCH3 at this early time point as well (Figure 2.5 A, right panel).
Next, to determine whether MARCH3 was required for the LPS-mediated decrease in FcγRIIb protein, we transfected PBM with siRNA against MARCH3 prior to treating them with LPS. To verify the efficacy of the knockdown, we performed qPCR to measure MARCH3 and found that LPS-treated PBM transfected with control siRNA showed significant up-regulation of MARCH3, whereas siRNA against MARCH3 prevented the increase in response to LPS treatment (Figure 2.5 B). We also verified that the siRNA treatments had no effect on the transcript levels of FcγRIIb, with qPCR showing that overnight LPS treatment reduced RNA levels of FcγRIIb in both control and MARCH3 siRNA treatments (Figure 2.5 C). Finally, we measured protein levels of
FcγRIIb following siRNA and LPS treatments and found that knockdown of MARCH3 inhibited the LPS-mediated decrease in FcγRIIb (Figure 2.5, D and E). Collectively, these results suggest that LPS up-regulates the expression of MARCH3 in monocytes, which then targets FcγRIIb for degradation.
LPS Treatment Enhances FcγR Function
To test whether LPS treatment led to a difference in FcγR function, we treated
PBM overnight with LPS and then incubated them for 20 h with immobilized IgG to cluster the Fcγ receptors. Production of TNFα was then measured in the cleared
28 supernatants, and the results showed a super-additive effect of LPS plus IgG (Figure 2.6
A). Next, we treated PBM overnight with LPS and then subjected them to a phagocytosis assay using antibody-opsonized SRBC. As shown in Figure 2.6 B, LPS treatment significantly enhanced the number of ingested SRBC by the PBM. These results indicate that activation of TLR4 with LPS enhances FcγR function.
2.5.!Discussion
Modulation of FcγRIIb expression is important within the context of both tumor immunotherapy and autoimmune diseases. For example, genetic deletion of FcγRIIb can permit the development of collagen-induced arthritis in a typically non-susceptible mouse strain.100 In humans, levels of FcγRIIb on monocytes were found to be equivalent in rheumatoid arthritis patients and healthy donors, but the patient monocytes expressed more activating receptors. Treatment in vitro of both healthy donor and patient monocytes with IL-4 plus IL-10 led to increases in FcγRIIb expression and decreases in
IgG-mediated cytokine production.89 It has also been shown that a FcγRIIb polymorphism that was less inhibitory could serve as a strong predictor of joint damage in rheumatoid arthritis patients.101
Conversely, within a tumor setting, reductions rather than increases in FcγRIIb expression or function may be beneficial. In a mouse B16 melanoma model of antibody therapy, the genetic deletion of FcγRIIb led to an almost complete clearance of tumor cells in the lung following antibody treatment.69
29
It has been shown recently that the use of a blocking antibody against FcγRIIb led to enhanced antitumor effects from therapeutic antibody treatment, especially in stromal regions in which there is typically reduced effectiveness of antibodies.102
In this study, we found that TLR agonists, most notably those for TLR4 and
TLR8, led to a marked down-regulation of FcγRIIb transcript and, separately, to a down- regulation of FcγRIIb protein. Further examination showed that LPS caused FcγRIIb to become ubiquitinated and that the E3 ubiquitin ligase MARCH3 was required for the observed decrease in protein following LPS treatment. Of note, the ubiquitination of
FcγRIIb preceded the strong LPS-driven up-regulation of MARCH3, suggesting that LPS had an earlier effect on MARCH3 activity prior to up-regulation of MARCH3 transcription. LPS treatment may have enhanced the ubiquitin system in general, perhaps affecting the E1-activating enzyme or MARCH3-binding E2-conjugating enzymes. This, in turn, could increase the activity of basally expressed MARCH3. Further studies are required to elucidate this.
Interestingly, treatment with the TLR8 agonist also led to rapid decreases in
FcγRIIb protein as well as to receptor ubiquitination (data not shown). However, we were unable to see a reversal of TLR8-mediated FcγRIIb down-regulation after MARCH3 knockdown (data not shown). It is possible that our knockdown was not complete enough to have an effect or that other pathways are involved with TLR8-mediated FcγRIIb degradation. For example, TLR8 agonist treatment up-regulated MARCH9 and
MARCH3, suggesting that, in contrast to TLR4 activation, both E3 ligases could be involved following TLR8 agonist treatment.
30
Ubiquitination can lead to degradation by either the proteasome or lysosome, depending on the type of ubiquitination and the cellular location.103 Because there is a natural recycling of FcγR from the cell surface to the endosome and back (with complete membrane recycling taking place as rapidly as two or three times per hour,97 it is likely that TLR4 activation breaks this recycling pattern by triggering ubiquitination that shunts
FcγRIIb to the lysosome. In partial support of ubiquitin-mediated lysosomal rather than proteasomal degradation, we found that the proteasomal inhibitor MG-132 did not block
R-848-mediated degradation of FcγRIIb (data not shown).
The finding that some but not all TLR agonists led to FcγRIIb down-regulation is of interest because it not only brings attention to the qualitative and quantitative differences in signaling between the various TLR, but it also has implications for disease.
For example, certain pathogens such as Gram-negative bacteria or RNA viruses might be predicted to exacerbate the symptoms of rheumatoid arthritis (RA) and other immune diseases involving autoantibodies. Conversely, it may also suggest that certain TLR ligands would be more suited than others as adjuvants for antibody therapy against tumors. Indeed, the TLR8-selective agonist motolimod has been tested in a phase 1 clinical trial in combination with cetuximab for the treatment of recurrent or metastatic squamous cell carcinomas of the head and neck (NCT01334177). A phase II trial to test this TLR8 agonist in combination with cisplatin or carboplatin, fluorouracil, and cetuximab is also underway (NCT01836029). The therapeutic hypothesis for the TLR8 agonist motolimod is increased antibody-dependent cellular cytotoxicity because of
31 stronger activation of natural killer cells and monocytes, and enhancement of this activation via loss of the inhibitory FcγRIIb would be consistent with this.
Although the TLR4 pathway is commonly associated with excessive cytokine production during sepsis,104,105 it is also being examined as a potential therapeutic target for the treatment of cancer. One preclinical study has shown that monophosphoryl lipid A significantly enhanced the effectiveness of antitumor antibody treatment in a mouse melanoma model.106 Similarly, the synthetic lipid A mimetic E6020 enhanced the survival of mice treated with trastuzumab in a model of HER2+cancer.107 Interestingly, depletion of macrophages, but not of natural killer cells, led to a reduction in the efficacy of treatment.107 Although no clinical trials combining TLR4 agonists with antibody therapy are listed (https://clinicaltrials.gov), trials are being conducted to test several agonists as antitumor agents. The TLR4 agonist glucopyranosyl lipid A stable emulsion is being tested against sarcoma in combination with radiation therapy (NCT02180698).
The same agonist is being tested as a vaccine adjuvant against melanoma
(NCT02320305) and as a single agent against Merkel cell carcinoma (NCT02035657) and follicular non-Hodgkin lymphoma (NCT02501473).
In summary, we identified the mechanism by which TLR4 activation by LPS down-regulates the protein levels of the inhibitory FcγRIIb, namely up-regulation of the
E3 ubiquitin ligase MARCH3. This uncovers a more specific potential therapeutic target that may be of value within certain disease settings in which FcγRs are involved. It is conceivable that selective inhibitors of MARCH3 might be beneficial within the context of rheumatoid arthritis or that the administration of agents that up-regulate MARCH3, in
32 conjunction with antitumor antibodies, may lead to improved outcomes for cancer patients.
In this Chapter, we have focused primarily on mechanisms of enhancing the innate immune response (i.e. monocyte/macrophage response) against cancer and will now shift to focusing on the cancer itself.
A great part of this Chapter has been published previously:
Fatehchand, K., Ren, L., Elavazhagan, S., Fang, H., Mo, X., Vasilakos, J. P., Dietsch, G.
N., Hershberg, R. M., Tridandapani, S., and Butchar, J. P. (2015) Toll-like receptor 4 ligands down-regulate FcgammaRIIb via MARCH3-mediated ubiquitination. J Biol
Chem
33
Figure 2.1: Ligands for TLR4 and TLR8 down-regulate FcγRIIb. A, human PBM were isolated and incubated overnight (∼18 h) either without (UT, untreated) or with a panel of TLR agonists for TLR2, TLR3, TLR4, TLR5, TLR7, TLR8, and TLR9 (described under “Experimental Procedures”). Western blotting was done to measure FcγRIIb protein expression (n = 4, representative blot shown). IB, immunoblot. Band C, PBM were treated without or with the indicated TLR agonists as in A. Then mRNA was collected, and qPCR was done to measure FcγRIIb transcript (B). 34
Statistical analyses were done to identify the agonists that down-regulated FcγRIIb transcript (n = 3) (C). RCN, relative copy number; CI, confidence interval. D and E,
PBM were treated overnight without or with 500 ng/ml LPS, and then Western blotting and qPCR were done to measure protein levels of FcγRIIb (D) and FcγRIIa (E) (n = 3, representative blots shown). F, PBM were treated as in D and E, and then transcript of
FcγRIIa was measured by qPCR (n = 3). For all blots, membranes were reprobed for actin to verify equivalent loading. *, p ≤ 0.05.
35
Figure 2.2: Concentration and time course responses of FcγRIIb to LPS.
A and B, human PBM were incubated overnight with LPS at increasing concentrations (0,
1, 10, 50, 100, 500, and 1000 ng/ml for protein analyses and 0, 1, 10, 50, 100, and 500 ng/ml for transcript analyses). Western blotting and qPCR were done to measure FcγRIIb protein (A) and mRNA expression (B) (n = 3). IB, immunoblot; RCN, relative copy number. C and D, PBM (n = 4) were treated with 500 ng/ml LPS for 0, 1, 3, 6, 18, or 24 h, and then Western blotting was done to measure FcγRIIb protein (C), and qPCR was done to measure transcript (D). For all blots, membranes were reprobed for actin to verify equivalent loading.
36
Figure 2.3: Concentration and time course responses of FcγRIIa to LPS A and B, human PBM were incubated overnight with LPS at increasing concentrations (0,
1, 10, 50, 100, 500, and 1000 ng/ml for protein analyses and 0, 1, 10, 50, 100, and 500 ng/ml for transcript analyses). Western blotting and qPCR were done to measure FcγRIIa protein (A) and mRNA expression (B). IB, immunoblot; RCN, relative copy number. C and D, PBM were treated with 500 ng/ml LPS for 0, 1, 3, 6, 18, or 24 h, and then
Western blotting was done to measure FcγRIIa protein (C), and qPCR was done to measure transcript (D) (n = 3). For all blots, membranes were reprobed for actin to verify equivalent loading.
37
Figure 2.4: LPS treatment leads to FcγRIIb ubiquitination
A and B, human PBM were incubated with LPS (500 ng/ml) for 0, 15, or 30 min or 1, 3, or 6 h. For each time point, FcγRIIb was immunoprecipitated (IP), and Western blotting was done to detect ubiquitin (A). The reciprocal experiment was also done with immunoprecipitations of ubiquitin and Western blotting for FcγRIIb (B). Ctl, control; IB, 38 immunoblot. C, human PBM were pre-treated for 30 min with increasing doses of the E1 ubiquitin-activating enzyme inhibitor PYR-41 (0, 1, 5, or 10 µm) and then incubated overnight without (UT, untreated) or with 500 ng/ml LPS. Western blotting was done to analyze FcγRIIb expression (n = 3). C, membranes were reprobed for actin to verify equivalent loading.
39
Figure 2.5: MARCH3 is required for LPS-induced FcγRIIb down-regulation
A, human PBM were incubated overnight without (UT, untreated) or with 500 ng/ml LPS, and qPCR was done to measure MARCH3 expression (left panel, n = 6). This was repeated, and transcript of MARCH3 was measured at the 1-h time point (right panel, n =
4). RCN, relative copy number. B, human PBM were transfected with either control (Ctl) siRNA or siRNA against MARCH3 and then incubated overnight without or with 500 ng/ml LPS. MARCH3 expression was measured by qPCR (n = 3). C–E, human PBM were transfected with control or MARCH3 siRNA and then LPS-treated as in B. qPCR
40 was done to measure FcγRIIb expression (C), and Western blotting was to measure
FcγRIIb protein (D). Densitometric analysis of the Western blotting results is shown in E
(n = 3). *, p ≤ 0.05.
41
Figure 2.6: LPS treatment enhances FcγR function PBM were treated overnight without (UT, untreated) or with 500 ng/ml LPS. A, after treatment, cells were incubated for 20 h without (PBS) or with immobilized IgG, and then cleared supernatants were analyzed for TNFα by ELISA. B, after treatment, cells were incubated with fluoresceinated, antibody-coated SRBC for 30 min, and then the numbers of ingested SRBC were counted via fluorescence microscopy (n = 3). *, p ≤ 0.05.
42
Chapter 3. !Interferon-γ Promotes Antibody-mediated Fratricide of Acute Myeloid
Leukemia Cells
3.1.!Abstract:
AML is characterized by the proliferation of immature myeloid lineage blasts.
Due to its heterogeneity and to the high rate of acquired drug resistance and relapse, new
treatment strategies are needed. Here, we demonstrate that IFNγ promotes AML blasts to
act as effector cells within the context of antibody therapy. Treatment with IFNγ drove
AML blasts toward a more differentiated state, wherein they showed increased
expression of the M1-related markers HLA-DR and CD86, as well as of FcγRI, which
mediates effector responses to therapeutic antibodies. Importantly, IFNγ was able to up-
regulate CD38, the target of the therapeutic antibody daratumumab. Because the antigen
(CD38) and effector receptor (FcγRI) were both simultaneously up-regulated on the
AML blasts, we tested whether IFNγ treatment of the AML cell lines THP-1 and MV4-
11 could stimulate them to target one another after the addition of daratumumab. Results
showed that IFNγ significantly increased daratumumab-mediated cytotoxicity, as
measured both by 51Cr release and lactate dehydrogenase release assays. We also found
that the combination of IFNγ and activation of FcγR led to the release of granzyme B by
AML cells. Finally, using a murine NSG model of subcutaneous AML, we found that
treatment with IFNγ plus daratumumab significantly attenuated tumor growth. Taken
together, these studies show a novel mechanism of daratumumab-mediated killing and a
possible new therapeutic strategy for AML. 43
3.2.!Introduction:
Enhancing the innate immune response against cancer is an important strategy in mAb therapy. However, it is just as vital to examine the role of the tumor cell in the cancer setting. In Chapters 3 and 4, we elucidate two mechanisms of shifting the immunosuppressed AML cell phenotype to a more effector-like state so that these cells can partake in antibody therapy.
AML is the most common type of acute leukemia in adults and affects over
20,830 people each year.108,109 AML is a hematologic malignancy characterized by a proliferation of myeloid precursors (“blasts”), which infiltrate the bone marrow, blood, and other tissues.29,110 Despite the existence of multiple biologically distinct subtypes of
AML, the current methodology of treatment includes a regimen of chemotherapy and stem cell transplant.111,112 Allogeneic hematopoietic stem cell transplantation can be curative for certain patients with AML; however, very few patients are candidates for this procedure.113,114 Patients over 60 years of age have a worse prognosis due to both chemoresistance and intolerance to intensive chemotherapy, with a median survival of 5–
10 months.29,111,115,116 Hence, there is an urgent need for the development of safer and more effective therapeutics for AML.
Monoclonal antibodies are being utilized as a treatment for many different types of cancer and are being actively pursued as a treatment for AML.117,118 Perhaps the most well-known antibody in clinical use for AML was the toxin-conjugated anti-CD33 antibody, GO (Mylotarg®). This took advantage of the rapid internalization of CD33 upon antibody binding, thereby delivering the toxin into CD33-expressing cells.
44
However, it was withdrawn from the market due to toxicity issues.118,119 Today, other
CD33-targeting drug-antibody conjugates, such as SGN-CD33A and Fc-engineered anti-
CD33 antibodies, are being studied in AML.66,76,79 The targeting of FcγRI has similarly been proposed, especially after the finding that IFNγ could increase the expression of the high affinity Fcγ receptor, FcγRI.64,80–82 Recently, a study was completed using a monoclonal antibody to CD123 that has been humanized, affinity-matured, and Fc- engineered for increased affinity toward CD16 (FcγRIIIa), which showed an effect against AML both in vitro and in vivo in an environment with adequate NK cell function.23
CD38 is a transmembrane glycoprotein expressed in many different cells, including lymphocytes.123 The anti-CD38 monoclonal antibody daratumumab has shown a favorable safety profile and encouraging efficacy in patients with refractory multiple myeloma,124–126 and the anti-CD38 SAR650984 is being examined as a treatment for
CD38+ hematological malignancies, including AML (clinicaltrials.gov registration NCT01084252). Here, we have found that treatment of AML cell lines and primary AML apheresis samples with IFNγ leads to the up-regulation of M1-related markers and of the daratumumab target CD38. IFNγ also induced AML cell fratricide in vitro and reduced tumor growth in vivo, an effect that was significantly enhanced by the addition of anti-CD38. Interestingly, IFNγ also led to FcγR-mediated granzyme B production in AML cell lines. These results suggest that IFNγ can cause the AML cells themselves to become immune effectors and that IFNγ plus anti-CD38 antibody may be an effective treatment for AML.
45
3.3.!Materials and Methods:
Cell Culture
The AML cell lines used in this study (MOLM-13, MV4-11, OCI-AML3, and
THP-1) were purchased from the ATCC and cultured according to ATCC recommendations. Cells were maintained below 1 × 106 cells/ml in RPMI 1640 medium
(Gibco) supplemented with 10% heat-inactivated FBS (Hyclone Laboratories, Grand
Island, NY), 2 mM L-glutamine (Invitrogen), and penicillin/streptomycin (56 units/ml/56
µg/ml; Invitrogen) at 37 °C in an atmosphere of 5% CO2.
Primary Cells
White blood cells apheresed from AML patients were obtained after written informed consent in accordance with the Declaration of Helsinki under a protocol approved by the Ohio State University institutional review board. Cells were stored in liquid nitrogen in 20% FBS and 10% DMSO until needed for experiments. At the time of the experiment, cells were thawed at 37 °C and incubated in RPMI 1640 medium (Gibco) supplemented with 20% FBS, 2 mM L-glutamine (Invitrogen), and penicillin/streptomycin (56 units/ml/56 µg/ml; Invitrogen) at 37 °C in an atmosphere of
5% CO2 for 1 h. Cells were then centrifuged and incubated in RPMI 1640 medium
(Gibco) supplemented with 20% FBS, 2 mM L-glutamine (Invitrogen), and penicillin/streptomycin (56 units/ml/56 µg/ml; Invitrogen) and were either left untreated or treated with 10 ng/ml recombinant human IFNγ (R&D Systems, Minneapolis, MN) and incubated for 18 h at 37 °C. The next day, cells were counted using trypan blue exclusion and used for assays.
46
Cytokines and Antibodies
Recombinant human IFNγ (R&D Systems) was added to cell cultures at a concentration of 10 ng/ml. For the LDH assays, anti-human CD38 (clone HIT2; BD
Biosciences) was used to coat cells. Briefly, cells were incubated with 10 µg/ml antibody for 1 h on ice, washed once with PBS, and resuspended in medium. Daratumumab was used for ADCC (20 µg/ml), conjugate studies (10 µg/ml), and in vivo experiments (1 µg/g mouse weight) and was supplied by commercial sources (Ohio State University,
Columbus, OH).
For flow cytometry, unconjugated mouse anti-human CD64 (clone 32.2) with an
FITC goat anti-mouse secondary antibody (Invitrogen), anti-human CD38 conjugated to
FITC (clone HIT2; BD Biosciences), anti-human CD86 conjugated to phycoerythrin
(clone 2331 (FUN-1); BD Biosciences), and anti-human CD80 conjugated to APC-H7
(clone L307.4; BD Biosciences) were used. Briefly, cells were incubated with 1 µg of antibody at a concentration of 1 × 106 cells/ml for 30 min at 4 °C. Cells were washed twice with FACS buffer (PBS, 0.09% sodium azide, 10% FBS). Secondary only (anti- human-CD64) and isotype control (all others) labeling was done in parallel to control for nonspecific staining. Samples were analyzed using an LSRII flow cytometer (BD
Bioscience) and FlowJo software (FLOWJO, LLC, Ashland, OR).
Inhibitors
The PI3K inhibitor LY294002 (used at 20 µM) and ERK inhibitor U0126 (used at
25 µM) were purchased from Calbiochem (Billerica, MA). The p38 inhibitor, SB203580
47
(used at 5 µM), was purchased from Sigma. The NF-κB inhibitor, BAY 11-7085 (used at
5 µM), was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX). The JAK1/2 inhibitor, ruxolitinib (used at 50 nM), was purchased from Selleck Chemicals (Houston,
TX).
Real-time PCR
Total RNA was isolated using TRIzol reagent (Invitrogen) and chloroform extraction followed by DNase treatment (Invitrogen). RNA was reverse transcribed and subjected to quantitative real-time PCR using Power SYBR Green Master Mix (Applied
Biosystems, Grand Island, NY). The following primers were used: GAPDH (forward primer, 5′-ATT CCC TGG ATT GTG AAA TAG TC-3′; reverse primer, 5′-
ATTAAAGTCACCGCCTTCTGTAG-3′), FcγRI (CD64) (forward primer, 5′-
GGCAAGTGGACACCACAAAGGCA-3′; reverse primer, 5′-
GCTGGGGGTCGAGGTCGAGGTCTGAGT-3′), CD38 (forward primer, 5′-
GCTCAATGGATCCCGCAGT-3′; reverse primer, 5′-TCCTGGCARAAGTCTCTGG-
3′), CD80 (forward primer, 5′-GGTCTGGCTGGTCTTTCT-3′; reverse primer, 5′-
CACTCGTATGTGCCCTCGTC-3′), CD86 (forward primer, 5′-
GGGCCGCACAAGTTTTGA-3′; reverse primer, 5′-GCCCTTGTCCTTGATCTGAA-
3′). qPCR primers for HLA-DQ (Hs.PT.58.15134093), HLA-DR (Hs.PT.58.15096946),
NOS-2 (Hs.PT.58.14740388), and SDF-1 (Hs.PT.58.27881121) were purchased from
Integrated DNA Technology (San Diego, CA). GAPDH was used for normalization of the genes of interest. Data were presented as mean relative copy number for at least three
48 separate experiments using relative copy number = 2−ΔCt × 100,91 where ΔCt is the Cttarget − CtGAPDH.
Lactate Dehydrogenase Assay
Antibody-coated (anti-CD38) or uncoated cells (5 × 104/100 µl of medium) that were pretreated for 24 h with 10 ng/ml IFNγ or left untreated were plated in quadruplicate in a 96-well plate. IFNγ (10 ng/ml) was added to appropriate wells and then incubated for 18 h at 37 °C. The CyTox 96 non-radioactive cytotoxicity assay
(Promega, Madison, WI) was used to measure released LDH from cells. This assay was performed as per the manufacturer's instructions. After an 18-h incubation, plates were centrifuged at 250 × g for 4 min, supernatants were collected and transferred to an ELISA plate, and then the supernatants were incubated with LDH substrate for 30 min. Stop solution was added, and the plates were read on a plate reader at a wavelength of 490 nm.
Percentage cytotoxicity was calculated as (experimental absorbance/LDH maximum release) × 100. The assay was repeated at least three times for each cell line.
Phagocytosis
Phagocytosis assays were performed as described previously with minor adaptations for the experimental requirements of this study.88 Briefly, SRBCs; Colorado
Serum Company, Denver, CO) were labeled with PKH26 fluorescent cell membrane dye
(Sigma) and then opsonized with anti-SRBC antibody (Sigma). SRBCs were added to the respective AML cell lines (treated with IFNγ for 24 or 48 h) or primary AML apheresis samples (treated with IFNγ for 24 h), gently pelleted by slow centrifugation, and then incubated at 37 °C for 1 h. Non-phagocytosed SRBCs were lysed with red blood cell
49 lysis buffer (eBioscience, San Diego, CA) at room temperature for 10 min and washed with PBS before fixation with 4% paraformaldehyde. The SRBCs ingested by the AML cells were counted in a blinded fashion using fluorescence microscopy, with three separate such counts per condition. For each set of counts, 100 phagocytes/condition were examined. The phagocytic index is defined as the total number of SRBCs ingested by 100 phagocytes.
Conjugate Formation Assay
Conjugate formation assays were performed using MV4-11 and THP-1 cell lines.
Cells were treated with or without 10 ng/ml IFNγ and incubated at 37 °C for 48 h.
Following incubation, samples were washed twice with PBS and split evenly into two tubes, one-half to be stained red and the other to be stained green. Staining was done using the CellVue® claret far red fluorescent cell linker kit and PKH67 green fluorescent cell linker kit, both from Sigma-Aldrich, according to the manufacturer's instructions.
Following this, selected cell groups were opsonized by incubating with 10 µg/ml anti-
CD38 antibody on ice for 1 h, followed by two washes with complete medium. For the assay, red and green cells were combined into 1 ml of medium and incubated at 37 °C for
1 h. Samples were washed in PBS three times and fixed in 4% paraformaldehyde. 30 random images were taken using a fluorescence microscope, and conjugates were counted in a blinded fashion.
Murine Model of Antibody Therapy
Female non-obese diabetic severe combined immunodeficient-γ (NSG) mice were purchased from Jackson ImmunoResearch Laboratories (Ban Harbor, ME). MV4-11 cells
50
(0.25 × 106 cells resuspended in PBS) were subcutaneously injected into the right flank of
6-week-old NSG mice and allowed to grow for 7 days.127 Intraperitoneal injections with
PBS vehicle, IFNγ (3,000 units/mouse), daratumumab (anti-CD38 antibody; 1 µg/g mouse weight), or IFNγ + daratumumab (anti-CD38 antibody) were administered twice per week for 2 weeks, with tumor measurements recorded on each treatment day in a blinded fashion. Tumor volumes were calculated as π/6(length × width × height).128
All in vivo experiments were performed in strict accordance with guidelines set by the institutional animal care and use committee, under an approved protocol.
ADCC
ADCC assays were done as described previously.28 In brief, THP-1 and MV4-11 cells were treated with or without IFNγ (10 µg/ml), loaded with 51Cr, coated with anti-
CD38 antibody or IgG antibody, and plated in V-bottom 96-well plates. After 48 h of incubation, levels of 51Cr in supernatants were measured using a γ counter. The percentage cytotoxicity was calculated as (sample − minimum)/(maximum − minimum)
× 100, where minimum consisted of untreated cells not incubated with antibody and maximum was measured as cells that had been lysed with 10% SDS.
Statistics
The qPCR and phagocytosis data were analyzed using paired Student's t tests. To evaluate the association of IFNγ-mediated changes in phagocytosis and changes in FcγRI expression (Table 3.1) we first transformed the changes relative to baseline by using log transformation to fit the normality assumption, followed by performing Pearson correlation analysis. Cell death assays using released LDH were analyzed by mixed effect
51 modeling, incorporating repeated measures for each sample. Tumor volumes from the in vivo study were first baseline-subtracted and then analyzed by mixed effect modeling, incorporating repeated measures for each tumor. Tumor growth rates and final tumor volumes were both compared. SAS 9.4 (SAS Inc., Cary, NC) was used for analyses.
3.4.!Results:
IFNγ Promotes an M1-related Phenotype in AML Cells
Myeloid cells within the context of tumors commonly display M2-like characteristics, which serve to promote tumor growth and survival.129,130 Here, we tested whether treatment with IFNγ could lead to a shift toward an M1-like phenotype. M1 macrophages can be identified by many different phenotypic markers, including
CD80/B7-1, CD86/B7-2, HLA-DR, and NOS2.129,131 To test this, we treated AML cell lines MV4-11, MOLM-13, OCI-AML3, and THP-1 for 24 or 48 h and primary AML samples for 18 h, with or without 10 ng/ml IFNγ. Levels of CD86/B7–2 (T-cell co- activator molecule), NOS2, and HLA-DR were measured using qPCR. CD80/B7-1, which works in tandem with CD86/B7-2 as a T-cell co-activator, is expressed at low levels on most M4/M5 AML cells.132 In agreement with this, we found little to no CD80 transcript in the four AML cell lines tested (data not shown).
Results showed that IFNγ significantly increased the transcript of CD86 in all cell lines except THP-1, which showed a strong trend toward significance (Figure 3.1 A). In primary AML apheresis samples, CD86 increased after 18-h IFNγ treatment (Figure 3.1
B). We then verified that these increases occurred at the cell surface using flow
52 cytometry, with results showing that treatment with IFNγ for 24 h (MV4-11, OCI-AML3, and THP-1) or 48 h (MOLM-13) led to increases in CD86 expression (Figure 3.1 C).
This was recapitulated in primary AML apheresis samples (Figure 3.1 D). Similarly,
IFNγ significantly increased transcript and surface expression of HLA-DR in primary
AML apheresis samples (Figure 3.1 E and F, respectively), although NOS2 was variable
(data not shown).
IFNγ Increases FcγRI Expression and Phagocytic Ability in AML Cells
Because we observed that IFNγ is able to enhance the expression of M1-related markers, we hypothesized that IFNγ could also enhance Fcγ receptor functions, such as phagocytosis. It has previously been shown that IFNγ could increase the expression of
FcγRI in AML cells, which led at one point to the exploration of IFNγ treatment combined with drug-conjugated anti-FcγRI antibody as a potential therapy for AML.121
However, FcγRI is not only a candidate therapeutic target; it is also a major effector of phagocytosis in myeloid cells.106,120,122 Hence, we tested the possibility that IFNγ treatment not only would increase FcγRI expression, but would also enhance the phagocytic ability of AML cells. We began by treating AML cell lines (MOLM-13,
MV4-11, OCI-AML3, and THP-1) and primary AML apheresis samples with or without
10 ng/ml IFNγ and measured FcγRI transcript by qPCR (18-h treatment) and flow cytometry (24-h treatment). As expected, results showed that IFNγ increased the transcript (Figure 3.2 A and B, for cell lines and primary AML apheresis samples, respectively) and surface expression (Figure 3.2 C and D, for cell lines and primary AML apheresis samples, respectively) of FcγRI.
53
To assess the effects of IFNγ on phagocytic ability, cell lines were treated with 10 ng/ml IFNγ for either 24 h (MOLM-13, OCI-AML3, and THP-1) or 48 h (MV4-11, which appeared to show a delayed response to IFNγ). Phagocytosis of fluorescently labeled opsonized sheep red blood cells was measured. As shown in Figure 3.2 E, IFNγ treatment significantly enhanced the phagocytic ability of all cell lines. We then treated primary AML cells for 24 h with IFNγ and tested them in a phagocytosis assay. Results showed that four of the five donors performed better with IFNγ (Figure 3.2 F). We also measured surface expression of FcγRI in these samples and compared changes in receptor expression with changes in phagocytic ability following IFNγ treatment. We found that the four donors with IFNγ-mediated enhancements of phagocytic ability also showed increases in FcγRI. Likewise, the non-responding donor showed no change in FcγRI expression with IFNγ. Pearson correlation analysis showed a positive correlation between
FcγRI surface expression and phagocytosis with regard to IFNγ response (p = 0.015, r =
0.945; Table 3.1: Changes in phagocytic ability and FcγRI expression in primary AML cells following IFNγ treatment. These results suggest that IFNγ can enhance the expression and function of FcγR in AML cells and that the degree of enhanced phagocytic ability is related at least in part to the degree of increased FcγRI expression.
IFNγ Increases CD38 Expression in AML Cells
Because IFNγ is able to activate these immature myeloid cancer cells, we next tested whether IFNγ would have an effect on CD38 expression. We treated the AML cell lines MOLM-13, MV4-11, OCI-AML3, and THP-1, as well as primary AML apheresis samples, with or without 10 ng/ml IFNγ and measured the expression of CD38 using
54 qPCR (18-h treatment) and flow cytometry (24-h treatment). Results showed that IFNγ treatment led to an increase in CD38 transcript in cell lines (Figure 3.3 A) and primary
AML apheresis samples (Figure 3.3 B). Surface expression also increased for cell lines and primary AML apheresis samples (Figure 3.3 C and D, respectively). No changes in
CD33 were observed (data not shown). Hence, not only does IFNγ promote increased
FcγR expression and function in AML cells; it also increases the expression of a candidate antibody target, CD38. Next, to test which concentration of IFNγ was required for this up-regulation of CD38, primary AML apheresis samples were treated for 18 h with 0–10 ng/ml IFNγ, and CD38 transcript was measured via qPCR. Results showed trends toward an increase at 0.5 ng/ml but a statistically significant increase at only 10 ng/ml (Figure 3.3 E).
IFNγ-mediated CD38 Up-regulation Requires p38, NF-κB, and JAK/STAT
Previous studies have shown increased expression of CD38 by IFNγ in chronic lymphocytic leukemia to be JAK/STAT and T-bet-dependent.23 To determine which downstream signaling pathways were required for the up-regulation of CD38 seen with
IFNγ treatment, primary AML apheresis samples were pretreated with inhibitors for
ERK, PI3K, p38 MAPK, JAK/STAT, and NF-κB. Results showed that IFNγ-mediated up-regulation of CD38 was prevented by the inhibitors for JAK/STAT, p38, and NF-κB
(Figure 3.4 A-C, respectively). CD38 did not seem to be regulated by ERK (Figure 3.4 D) or PI3K (data not shown). Western blots with phospho-specific antibodies were performed to verify the efficacy of the inhibitors (data not shown).
IFNγ Enhances Antibody-mediated Fratricide in AML Cells
55
Results have shown that IFNγ treatment of AML cells promoted their shift toward an M1-related phenotype, enhanced the expression and function of FcγRI, and increased the expression of an antigen target for antibody therapy. Next, we tested the ability of
IFNγ to promote antibody-mediated killing within pools of AML cells, a phenomenon termed fratricide.133,134 We treated THP-1 and MV4-11 cells for 48 h with or without 10 ng/ml IFNγ and then split each group of samples in half to be labeled with either a red or green dye. Green-stained samples within each cell line were opsonized with anti-CD38 antibody on ice, washed with media, and then incubated with their corresponding non- opsonized red cells for 3 h. Conjugate formation was scored using fluorescence microscopy, with non-antibody-mediated conjugates represented as red-red (RR) interactions and antibody-mediated conjugates represented as red-green (RG) plus green- green (GG) (Figure 3.5). Results showed that IFNγ led to increased antibody-mediated conjugates for both the THP-1 (Figure 3.5 A) and MV4-11 (Figure 3.5 B) cell lines.
To further quantify the amount of antibody-mediated fratricide, we measured cytotoxicity using a 51Cr release assay. Cells were treated with or without 10 ng/ml IFNγ, loaded with 51Cr, opsonized with either anti-CD38 or control IgG, and then incubated for
48 h. Results showed that there was significantly greater antibody-mediated 51Cr release in samples treated with IFNγ within both the THP-1 and MV4-11 sets (Figure 3.5
C, left and right, respectively). In fact, the combination of anti-CD38 and IFNγ seemed to have a synergistic effect on cytotoxicity, suggesting that the effectiveness of anti-CD38 was dependent on IFNγ-mediated up-regulation of the CD38 antigen.
56
Granzymes are serine proteases that have been shown to be important effectors of natural killer cell and cytotoxic T cell responses.135 We have recently shown that monocytes treated with TLR8 agonists produced granzyme B and that this contributed to
ADCC,92 so we tested whether IFNγ treatment plus FcγR activation might elicit granzyme B from AML cells. We pretreated THP-1 and MV4-11 cells with or without
IFNγ for 18 h and then incubated cells with or without immobilized IgG for 24 h. Results showed that this combination led to significant increases in granzyme B production in both THP-1 (Figure 3.5 D) and MV4-11 (Figure 3.5 E) cells.
Next, to further confirm cytotoxicity and to extend the studies to all four AML cell lines, we treated MOLM-13, MV4-11, OCI-AML3, and THP-1 for 24 h with or without 10 ng/ml IFNγ and incubated them for an additional 3 h with anti-CD38 antibody. Cell death was measured via lactate dehydrogenase (LDH) release. As shown in Figure 3.6 A, IFNγ significantly enhanced antibody-mediated killing within each respective AML cell line. To test whether this was due to a toxic effect of anti-CD38, we incubated the AML cell lines on immobilized anti-CD38 for the same length of time and found that LDH release was not affected (data not shown). This again suggests that the anti-CD38 antibody led to cell-against-cell killing, which was triggered and enhanced by
IFNγ pretreatment.
IFNγ Enhances Anti-CD38 Therapy in Vivo
We next tested whether IFNγ-induced antibody-mediated fratricide could occur in vivo. To do this, we injected MV4-11 cells subcutaneously into the flanks of NSG mice, which are deficient in B, T, NK, and dendritic cell activity,127 whereas the parent
57
NOD/scid mice show defects in macrophage maturation.136 After 1 week (to permit tumor growth), mice were treated with PBS, anti-CD38 antibody, IFNγ, or a combination of anti-CD38 and IFNγ. Both the rate of tumor growth and the final tumor volumes were measured. Results showed that neither of the single-agent treatments had an effect on the rate of growth, but the combination of anti-CD38 and IFNγ led to a significantly reduced growth rate (Figure 3.6 B, p < 0.01). Final tumor sizes (day 17) were also compared, and results showed that both the IFNγ-treated and the combination-treated groups had significantly smaller tumors (p < 0.01 and p < 0.001, respectively; Figure 3.6 B). These results suggest that the combination treatment was superior, although single-agent IFNγ also showed an effect on final tumor size. Because NSG mice are severely immunodeficient, these results suggest that at least a large portion of the antitumor effects seen with IFNγ and daratumumab were mediated by the AML cells themselves.
3.5.!Discussion
Herein, we have shown that treatment of AML blasts with IFNγ enables them to perform antibody-mediated fratricide. IFNγ treatment of AML cells was accompanied by increased expression of M1-related markers, resulting in an activated phenotype and increased expression of CD38, the target for the daratumumab. In addition, IFNγ significantly enhanced the IgG-mediated production of granzyme B, suggesting that the
AML cells had taken on bona fide effector functions.
Previous work has shown that myeloid leukemia cells could be induced to differentiate by external signals. For example, all-trans-retinoic acid can cause acute
58 promyelocytic leukemia cells to differentiate,136 and an agonistic antibody for the thrombopoietin receptor has been shown to cause AML cells to differentiate into active effector cells with characteristics of both dendritic and natural killer cells. These cells expressed substantial levels of granzyme B, perforin, and IFNγ and were capable of attacking one another via contact with needle-like filopodia.46
The potential for IFNγ to stimulate effector functions on AML cells was of particular interest to us in light of its known role in up-regulating FcγRI expression.121
Attempts to exploit this have been made by linking anti-FcγRI to ricin, and this was tested in vitro and in vivo.121 However, although FcγRI is known to mediate cytotoxicity against tumor cells,137 IFNγ treatment for the purpose of stimulating antibody-mediated fratricide had not been fully explored. It is likely that the success of this strategy was not due solely to the up-regulation of FcγRI, however, because we also observed changes in
M1-related markers. Such non-FcγR-mediated effects would be expected (and desired).
Indeed, STAT1 and STAT3 were among the top responders to treatment with a pleiotropic thrombopoietin agonist antibody that elicited a shift toward DC/NK phenotypes in AML cells.46 Results from the present study suggest that, although IFNγ alone may not drive the full differentiation of AML cells as seen by Yea et al.,46 it is sufficient to promote antibody-mediated fratricide and enhance efficacy of antibody therapy. Traditionally, antibodies exert antitumor activity through antibody-dependent cellular cytotoxicity or complement-mediated cytotoxicity. Here we show that combination treatment with IFNγ resulted in a novel mechanism of action of
59 daratumumab against AML blasts. As such, IFNγ may represent a broader treatment that could be tailored to a number of different antibody-based strategies.
One unexpected finding in the present study was that IFNγ led to the up- regulation of CD38 on AML cells. Although CD38 is known for its pro-survival signaling,138,139 higher levels of CD38 could also make it more targetable by therapeutic antibodies, such as daratumumab. Indeed, certain agents are already being investigated for their ability to modulate CD38 expression for this purpose. For example, it was recently shown that all-trans-retinoic acid (ATRA) increased CD38 expression in multiple myeloma cell lines and in primary patient samples, significantly enhancing the effects of daratumumab in vitro and in vivo.140 Within the context of AML, ATRA is already being used as a therapy in the M3 subtype, acute promyelocytic leukemia, due to its ability to promote terminal differentiation of malignant cells. Although ATRA does not show single-agent efficacy in other AML subtypes,141,142 its use with daratumumab is clearly a potential treatment strategy that should be explored.
IFNγ (IFNγ1b, Actimmune®, Horizon Pharma, Inc.) is an approved treatment for preventing infections in chronic granulomatous disease and for delaying severe malignant osteopetrosis.54,143–145 IFNγ is also being evaluated in combination with checkpoint inhibitors (nivolumab) in solid tumors (NCT02614456). The preclinical data presented here provide a strong rationale for combination of IFNγ and daratumumab in patients with AML. For example, Toll-like receptor agonists have been previously shown as effective enhancers of immune responses. In fact, the TLR7 agonist imiquimod is being used as a treatment for superficial basal cell carcinoma and HPV infection.146,147 NK cells
60 express both TLR7 and TLR8 and have been shown to produce IFNγ when stimulated by
TLR7/8 ligands.148 TLR agonists combined with antibody therapy may stimulate a more localized production of IFNγ, which could be of benefit where there is binding of therapeutic antibody.
In summary, we have found that IFNγ can stimulate AML blasts to become effector cells and target one another in an antibody-dependent manner. Hence, strategies to enhance IFNγ production, including exogenous administration, may offer an effective way to improve the efficacy of antibody therapy for AML.
A great part of this Chapter has been published previously:
Fatehchand K, McMichael EL, Reader BF, Fang H, Santhanam R, Elavazhagan S,
Mehta P, Buteyn NJ, Merchand-Reyes G, Vasu S, Mo X, Benson DM Jr, Blachly JS,
Carson WE 3rd, Byrd JC, Butchar JP, Tridandapani S. (2016) Interferon-γ promotes antibody-mediated fratricide of Acute Myeloid Leukemia cells. J. Biol. Chem.
61
Figure 3.1: IFNγ promotes an M1-related phenotype in AML cells.
AML cell lines MOLM-13, MV4-11, OCI-AML3, and THP-1 (n = 3 or more separate experiments each) and primary AML apheresis samples were treated with or without 10 ng/ml IFNγ for 18 h (qPCR) or for 24 h (flow cytometry, except for MOLM-13 treated for 48 h). A and B, CD86 expression in AML cell lines (A) and primary AML apheresis samples (B, n = 7 donors) was measured by qPCR. C and D, CD86 expression in AML cell lines (C) and primary AML apheresis samples (D, n = 7 donors, representative histogram shown; inset bar graph depicts all donors) was measured by flow cytometry. E and F, HLA-DR expression in primary cells was measured by qPCR (E, n = 6 donors) and flow cytometry (F, n = 7, representative histogram shown; inset bar graph depicts all donors). *, p ≤ 0.05. Error bars, S.D.
62
Figure 3.2: IFNγ increases FcγRI expression and phagocytic ability in AML cells.
AML cell lines MOLM-13, MV4-11, OCI-AML3, and THP-1 (n ≥ 3 separate experiments each) and primary AML apheresis samples were treated with or without 10 ng/ml IFNγ for 18 h (qPCR) or for 24 h (flow cytometry). A–D, FcγRI expression in
AML cell lines (A) and primary AML apheresis samples (B, n = 12 donors) was measured by qPCR. FcγRI expression in AML cell lines (C) and primary AML apheresis samples (D, n = 3 donors, representative histogram shown; inset bar graph depicts all donors) was measured by flow cytometry. E, AML cell lines were treated with or without
10 ng/ml IFNγ for 24 h (MV4-11 cells for 48 h) and then incubated with opsonized sheep red blood cells. Phagocytosis was counted via microscopy in a blinded fashion. The
63 phagocytic index represents the number of red blood cells ingested by 100 AML cells for each respective cell line. F, primary AML apheresis samples (n = 5 donors) were treated with or without 10 ng/ml IFNγ for 24 h and then incubated for 60 min with opsonized sheep red blood cells. Phagocytosis was counted via fluorescence microscopy in a blinded fashion. The phagocytic index represents the number of red blood cells ingested by 100 AML cells for each donor. *, p ≤ 0.05. Error bars, S.D.
64
Figure 3.3: IFNγ increases CD38 expression in AML cells. AML cell lines MOLM-13, MV4-11, OCI-AML3, and THP-1 (n = 3 or more separate
experiments each) and primary AML apheresis samples were incubated with or without
10 ng/ml IFNγ for 18 h (qPCR) or for 24 h (flow cytometry). A and B, CD38 expression
in AML cell lines (A) and primary AML apheresis samples (B, n = 7 donors) was
measured by qPCR. C and D, CD38 expression in AML cell lines (C) and primary AML
apheresis samples (D, n = 8 donors, representative histogram shown; inset bar graph
depicts all donors) was measured by flow cytometry. E, primary AML apheresis samples
(n = 4 donors) were treated for 18 h with concentrations of IFNγ from 0 to 10 ng/ml.
qPCR was done to measure transcript levels of CD38. *, p ≤ 0.05 compared with
untreated (UT). Error bars, S 65
Figure 3.4: IFNγ-mediated CD38 up-regulation requires p38, NF-κB, and JAK/STAT A–D, primary AML apheresis samples (n = 3) were pre-treated for 30 min with a 5 nm concentration of the JAK1/2 inhibitor ruxolitinib (A), 5 µm p38 inhibitor SB203580 (B),
5 µm NF-κB inhibitor BAY 11-7085 (C), or 25 µm ERK inhibitor U0126 (D) and then treated for 18 h with or without 10 ng/ml IFNγ. qPCR was done to measure CD38 transcript. *, p ≤ 0.05. UT, untreated. Error bars, S.D.
66
Figure 3.5: IFNγ enhances antibody-mediated fratricide in AML cells A and B, THP-1 cells were treated for 48 h with or without IFNγ (10 ng/ml) and then split in half to be labeled with either a red or green dye. 10 µg/ml anti-CD38 antibody was added to the green stained samples, and samples were incubated at 4 °C for 1 h. Red and green stained untreated (UT) samples were mixed, incubated for 1 h, and fixed in 4% paraformaldehyde. 30 random images were taken by fluorescence microscopy, and conjugates were counted in a blinded fashion. The same was done for the IFNγ-treated samples. Red-red (RR) conjugates represent non-antibody-mediated conjugate formation, whereas green-green (GG) or red-green (RG) conjugates represent antibody-mediated
67 conjugate formation. Data are represented as -fold change compared with untreated sample (n = 2 separate experiments, average shown) (A). The same procedure was repeated with MV4-11 cells (n = 2 separate experiments, average shown) (B). C, THP-1 cells (left) and MV4-11 cells (right) were treated with or without IFNγ (10 ng/ml) for 48 h, loaded with 51Cr, and labeled with anti-CD38 or IgG control antibodies. After 48 h of incubation, levels of 51Cr in supernatants were measured using a γ counter (n = 3). *, p ≤
0.05 versus both untreated + CD38 or IFNγ + IgG. D and E, THP-1 cells were treated with or without IFNγ (10 ng/ml) for 18 h and then plated on IgG-coated 96-well plates.
24 h later, supernatants were collected, and granzyme B levels were detected via an
ELISA (n = 4). *, p ≤ 0.05 versus IgG alone (D). The same procedure was repeated with
MV4-11 cells (E). Error bars, S.D.
68
Figure 3.6: IFNγ enhances anti-CD38 therapy in vivo. A, AML cell lines MOLM-13, MV4-11, OCI-AML3, and THP-1 (n ≥ 3 separate experiments each) were treated for 24 h with or without 10 ng/ml IFNγ and then incubated for 3 h with or without 10 µg/ml anti-CD38 antibody (CD38). IFNγ was added to the respective treatments for 18 h, and LDH assays were performed to measure cytotoxicity. *, p ≤ 0.05 versus untreated (UT). B, NSG mice were subcutaneously injected with 2.5 × 106 MV4-11 cells and then treated with either PBS, anti-CD38 antibody, IFNγ, or a combination of anti-CD38 and IFNγ (n = 6/group). Tumor growth rate as well as final tumor volumes were measured. *, p ≤ 0.05 versus PBS control at day
17 for rate of tumor growth. Error bars, S.D.
69
Table 3.1: Changes in phagocytic ability and FcγRI expression in primary AML cells following IFNγ treatment.
AML apheresis samples (n = 5 donors) were treated without or with 10 ng/ml IFNγ for 24 h and then subjected to a phagocytosis assay as described under “Experimental
Procedures.” Flow cytometry was also done to measure changes in FcγRI expression. The phagocytic index (mean number of opsonized sheep red blood cells ingested by 100 donor cells) and mean fluorescence intensity of FcγRI surface expression are shown.
MFI, mean fluorescence intensity.
70
Chapter 4. !Shifting the plasmacytoid dendritic cell phenotype in Acute Myeloid
Leukemia to enhance daratumumab-mediated fratricide
4.1.!Abstract
Acute myeloid leukemia (AML) is caused by the proliferation of immature myeloid blasts. In Chapter 3, we demonstrated how IFNγ (Type II IFN) could stimulate
AML blasts to act as effector cells against one another (fratricide) within the context of anti-CD38 (daratumumab) therapy. Here, we sought to determine whether endogenous
Type 1 IFNs could act in a similar manner as IFNγ to enhance antibody-mediated fratricide.
Type 1 IFNs are produced by plasmacytoid dendritic cells (pDCs), however, these cells exist in a quiescent state in AML. Since pDCs express TLR 7-9, we hypothesized that the TLR 7/8 agonist, R848, would be able to shift this pDC phenotype. Here, we saw that R848-treated AML pDCs showed an enhanced Type 1 IFN response. We next tested whether IFNβ would be able to shift AML cells to more of an M1 phenotype and increase the expression of the antibody target CD38. Results showed that IFNβ led to significant increases in CD86, FcγRI and CD38. Additionally, we saw that IFNβ increased daratumumab-mediated cytotoxicity and decreased colony formation.
These findings suggest that it is possible to overturn the tolerogenic phenotype of pDCs in AML, and also demonstrate a possible means of enhancing endogenous Type 1
IFN production for the purpose of inducing antibody-mediated fratricide of AML blasts.
71
4.2.!Introduction:
In the past few years, new strategies to fight cancer, specifically cancer immunotherapy, have garnered tremendous interest. This idea of harnessing the immune system to fight cancer was introduced to us in the beginning of the 20th century when
Paul Ehrlich and later Lewis Thomas presented the “immune surveillance” hypothesis.
Since immune cells were able to destroy foreign particles, they hypothesized that this same idea would apply to cancer cells.149–151 Today, we know that certain immune cells such as M1-like macrophages, NK cells, and CD8+ T cells can play a role in tumor clearance; however, we have also elicited the roles of cells such as M2-like macrophages and regulatory T-cells which can both play a role in tumor promotion and metastasis 152.
In Acute Myeloid Leukemia (AML), patients suffer from a defective innate and adaptive immune response, similar to other malignancies. This stems from both direct and indirect interactions with the Leukemic Stem Cells (LSCs), host regulatory T-cells, tolerogenic myeloid stem cells or tolerogenic dendritic cells.32
Plasmacytoid Dendritic Cells (pDCs) are immune cells that play an important role in connecting the innate and adaptive immunity.153 These cells express TLR 7-9 and are able to produce many cytokines including TNF-α, CXCL8, and IL-6, but most importantly Type I Interferons after TLR stimulation.154–158 In cancer, pDCs have been shown to take on a more tolerogenic state by inducing regulatory T-cells. Additionally, these cells are unable to produce nearly as much Type 1 Interferon required for tumor clearance.159 In AML, it has been shown that both FLT3-ITD+ and FLT3-ITD- patients have higher frequencies of circulating pDCs when compared to healthy donors. However,
72 these pDCs express lower levels of HLA-DR which may explain the inability for these cells to present antigen as well as healthy donors.160 Nevertheless, since pDCs express
TLR 7-9, 155,161 re-programming these cells by TLR stimulation may help shift their phenotype to a more active state.159
Testing this notion, we found that TLR 7/8 stimulation of pDCs in AML patient samples with R848 increased the surface expression of the activation markers CD86,
CD40, as well as TRAIL. This is consistent with previously published studies.162
Interestingly, not all R848-treated pDCs from AML patients responded with an increase in Type I Interferon production. In fact, we only saw an increase in Type 1 Interferon response in the M5-classifed subtype of AML. Since, AML cells are relatively insensitive to TRAIL-dependent killing,163 we next asked whether IFNβ had any direct effects on
AML cells themselves.
In Chapter 3, we reported that IFNγ was able to stimulate AML blasts to become effector cells and target one another in an antibody-dependent manner. In fact, IFNγ led to the up-regulation of M1-related markers and the daratumumab antibody target CD38.
The combination of IFNγ and daratumumab induced AML cell-to-cell killing (fratricide) both in vitro and led to reduced tumor growth in vivo.164 Here, we saw that IFNβ was likewise able to up-regulate M1-related markers, CD38, and the high-affinity FcγRI.
Additionally, we show that IFNβ-induced AML fratricide in vitro similarly to IFNγ.
Taken together, these results show a novel mechanism of shifting the pDC phenotype in
AML from a more inactive to active state by the use of TLR ligands. This TLR 7/8
73 agonist can induce a Type 1 IFN response in a subset of patients that ultimately causes
AML cells to act as effectors themselves in daratumumab-mediated therapy.
4.3.!Materials and Methods:
Cell culture.
The AML cell lines used in this study (MV-4-11 and OCI-AML3) were purchased from the ATCC and cultured according to ATCC recommendations. Cells were maintained below 1 x 106 cells/mL in RPMI 1640 media (Gibco, Grand Island, NY) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Hyclone Laboratories,
Grand Island, NY), 2mM L-glutamine (Invitrogen, Grand Island, NY), and penicillin/streptomycin (56 U/mL/56 µg/mL; Invitrogen) at 37°C in an atmosphere of 5%
CO2.
Primary cells.
Primary cell handling was done as described previously.164 White blood cells apheresed from AML patients were obtained after written informed consent in accordance with the Declaration of Helsinki under a protocol approved by the institutional review board of The Ohio State University. Cells were stored in liquid nitrogen in 20% FBS and 10% DMSO until needed for experiments. At the time of the experiment, cells were thawed at 37°C and incubated in RPMI 1640 media (Gibco) supplemented with 20% FBS, 2mM L-glutamine (Invitrogen) and penicillin/streptomycin
(56 U/mL/56 µg/mL; Invitrogen) at 37°C in an atmosphere of 5% CO2 for 1 hour. Cells were then centrifuged and incubated in RPMI 1640 media (Gibco) supplemented with
20% FBS, 2mM L-glutamine (Invitrogen) and penicillin/streptomycin (56 U/mL/56 74
µg/mL; Invitrogen) and were either left untreated or treated with Interferon-beta (IFN-β) and incubated for 24 hours at 37°C. The next day, cells were counted using Trypan blue exclusion and used for assays.
Western Blotting.
Anti-pSTAT1, Anti-p-MAPKAPK-2, Anti-p-ERK, Anti-MAPKAPK-2, and anti-
IRF9 for Western blotting were purchased from Cell Signaling Technology (Danvers,
MA). Anti-Calreticulin antibody was purchased from Enzo Life Sciences (Farmingdale,
NY). Anti-GAPDH antibody was purchased from Santa Cruz Biotechnology (Dallas,
TX). Western blotting was done as described previously.165 Cells were lysed in TN1 buffer (50 mM Tris (pH 8.0), 10 mM EDTA, 10 mM Na4P2O7, 10 mM NaF, 1% Triton
X-100, 125 mM NaCl, 10 mM Na3VO4, and 10 µg/ml each aprotinin and leupeptin).
Protein lysates were boiled in Laemmli sample buffer, separated by SDS-PAGE, transferred to nitrocellulose membranes, probed with the antibody of interest, and then developed by Pierce ECL 2 Western blotting substrate (Thermo Scientific, Rockford, IL) or SuperSignal West Femto maximum sensitivity substrate (Thermo Scientific).
Densitometry was performed using ImageJ software (National Institutes of Health,
Bethesda, MD), and ratios between the indicated probes and their respective anti-actin reprobes were calculated.
Colony Forming Assay.
MV4-11 cells were treated with or without IFN-β (500 U/mL) in the presence or absence of daratumumab (20 µg/mL) for 24 hours then plated in duplicates in Methocult
75
H4100 methylcellulose medium (StemCell Technologies) on cell culture plates for 10 days. After 10 days, colonies were scored in a double-blind fashion.
Lactate Dehydrogenase Assay.
OCI-AML3 cells were plated at 5x105 cells/mL and treated with 500 U
IFNβ and/or 20 µg/mL Daratumumab. After 48 hours, supernatants were removed and used for a CytoTox96® Non-Radio Cytotoxicity Assay (Promega, Madison, WI) according to manufacturer’s instruction. Percent cytotoxicity was defined as
[Experimental LDH release OD490 / Maximum LDH release OD490] x 100.
Phagocytosis.
Phagocytosis assays were performed as described previously with minor adaptations for the experimental requirements of this study.88 Briefly, sheep red blood cells (SRBCs; Colorado Serum Company, Denver, CO) were labeled with PKH26 fluorescent cell membrane dye (Sigma) and then opsonized with anti-SRBC antibody
(Sigma). SRBCs were added to the respective AML cell lines (treated with IFN-β for 24 hours) or primary AML apheresis samples (treated with IFN-β for 24 h), gently pelleted by slow centrifugation, and then incubated at 37 °C for 1 h. Non-phagocytosed SRBCs were lysed with red blood cell lysis buffer (eBioscience, San Diego, CA) at room temperature for 10 min and washed with PBS before fixation with 4% paraformaldehyde.
The SRBCs ingested by the AML cells were counted in a blinded fashion using fluorescence microscopy, with three separate such counts per condition. For each set of counts, 100 phagocytes/condition were examined. The phagocytic index is defined as the total number of SRBCs ingested by 100 phagocytes.
76
Antibodies and Reagents:
Recombinant human IFNβ-1a (PBL, Piscataway, NJ) was added to cell cultures at a concentration of 500 U/mL. Daratumumab was used for LDH (20 µg/ml) and colony forming assays. For flow cytometry, unconjugated mouse anti-human CD64 (clone 32.2) with an FITC goat anti-mouse secondary antibody (Invitrogen), anti-human CD38 conjugated to FITC (clone HIT2; BD Biosciences), anti-human CD86 conjugated to phycoerythrin (clone 2331 (FUN-1); BD Biosciences) were used to measure markers of activation on AML cells. For sorting, anti-human Lineage cocktail conjugated to APC
(clone UCHT1, HCD14, 3G8, HIB19, 2H7, HCD56, Biolegend), anti-human HLA-DR conjugated to APC/Cy7 (clone L243, Biolegend), anti-human BDCA-2conjugated to
FITC (clone 201A, Biolegend), and anti-human CD123 conjugated to PE/Cy7 (clone
6H6, Biolegend) were used. For the identification and measurement of activation status of plasmacytoid dendritic cells, anti-human Lineage cocktail conjugated to BV510 (clone
OKT3, M5E2, 3G8, HIB19, 2H7, HCD56, Biolegend), anti-human CD123 conjugated to
BV650 (clone 6H6, Biolegend), anti-human HLA-DR conjugated to APC/Cy7 (clone
L243, Biolegend), anti-human BDCA-2 conjugated to PE/Cy7 (clone 201A, Biolegend), anti-human CD80 conjugated to BV421 (clone 2D10, Biolegend), anti-human CD62L conjugated to PerCP (clone DREG-56, Biolegend), anti-human CD86 conjugated to APC
(clone IT2.2, Biolegend), and anti-human CD40 conjugated to PE (clone 5C3, Biolegend) were used. Samples were analyzed using an LSRII flow cytometer (BD Bioscience) and
FlowJo software (FLOWJO, LLC, Ashland, OR).
77
Inhibitors:
The JAK1/2 inhibitor, ruxolitinib (used at 50 nM), was purchased from Selleck
Chemicals (Houston, TX). The MEK inhibitor, PD0325901 (used at 0.5 µM) was purchased from Selleck Chemicals (Houston, TX). The p38 MAPK inhibitor, SB202190
(used at 1 µM) was purchased from Selleck Chemicals (Houston, TX).
Real-time PCR:
Total RNA was isolated using the Norgen Biotek Total RNA Purification Kit
(Norgen Biotek Corp, Ontario, Canada) according to manufacturer’s instructions. RNA was reverse transcribed and subjected to quantitative real-time PCR using Power SYBR
Green Master Mix (Applied Biosystems, Grand Island, NY) as previously described. 164
The following primers were used: GAPDH (forward primer, 5′-ATT CCC TGG ATT
GTG AAA TAG TC-3′; reverse primer, 5′-ATTAAAGTCACCGCCTTCTGTAG-3′),
CD38 (forward primer, 5′-GCTCAATGGATCCCGCAGT-3′; reverse primer, 5′-
TCCTGGCARAAGTCTCTGG-3′), and TRAIL (forward primer 5’-AAG GCT CTG
GGC CGC AAA ATA AAC-3’and reverse primer 5’-GCC AAC TAA AAA GGC CCC
GAA AAA-3’). GAPDH was used for normalization of the genes of interest. Data were presented as mean relative copy number for at least three separate experiments using
−Δ 91 relative copy number = 2 Ct × 100, where ΔCt is the Cttarget − CtGAPDH.
Transfections:
Transfections were done as previously described.166 MV4-11 cells were transfected with siRNA constructs using the Amaxa Nucleofector apparatus (Amaxa biosystem Cologne, Germany). Briefly, 2x107 MV4-11 cells were re-suspended in Cell
78 line Nucleofector Solution and nucleofected with either scrambled, IRF9 (Dharmacon
Lafayette, CO) or p38 siRNA (Cell Signaling Technology Danvers, MA). Cells were then transferred to RPMI supplemented with 10% FBS and incubated with or without IFNβ
(500 U/mL) for 24 hours. After, Western blotting was performed to measure IRF9 expression and mRNA was collected to measure CD38, CD64, and CD86 expression.
Statistics:
For experiments that involved placing the cells of each donor across multiple conditions, data were analyzed by using analysis of variance with repeated measures. For experiments with only two groups involved, paired Student's t tests were used to test for statistically significant differences.
4.4.!Results:
TLR 7/8 agonists reverse the tolerogenic phenotype of pDCs in AML
The cancer microenvironment is composed of tumor cells, supporting cells, immune cells, and different soluble factors. The role of pDCs in cancer has been studied numerous times in the context of carcinoma, melanoma, as well as hematopoietic malignancies. However, unlike pDCs in healthy donors, pDCs in cancer have been reported to take on a tolerogenic phenotype and lose their ability to produce the classic
Type 1 Interferon.159 Relative to healthy donors, AML patients have elevated frequencies of pDCs, however, have decreased expression of certain activation markers including
HLA-DR.160 Here, we first identified pDCs from AML patients and healthy donor
PBMCs (Lin-/HLA-DR+/CD123+/BDCA-2+, Figure 4.1 A) in order to measure the
79 surface expression of the pDC activation markers CD80, CD86, CD40 and the transmigration marker CD62L. As previously reported, pDCs isolated from AML patients exhibited a more inactive phenotype with significantly reduced surface expression of
CD86, CD40, and CD62L (Figure 4.1 B). There was no significant difference in the expression of CD80 between AML patients and healthy donors (Figure 4.1 B). We next asked whether we could shift the phenotype of pDCs into a more active state. Since pDCs express TLR7-9, 155,161 we treated both healthy donors and primary AML patient PBMCs with the TLR 7/8 agonist R848 for 24 hours. We then identified pDCs and measured the surface expression of CD80, CD86, CD40, and CD62L. Interestingly, pDCs in healthy donors responded to lower doses of R848 (1 µM) showing significant increases in the surface expression of all four markers. However, pDCs in AML patient samples only responded to higher doses of R848 (5 µM) at 48 hours with significant increases in the surface expression of CD86 and CD40 (Figure 4.1 C and D).
R848 induces functional changes in AML pDCs
We have shown how R848 is able to up-regulate the surface expression of CD86 and CD40 on AML pDCs. However, we next asked whether R848-treated pDCs demonstrated any functional changes in either TRAIL expression or Type 1 IFN production. Here, we FACS sorted pDCs from AML patients and treated them with or without R848 (5 µM) for 48 hours. Next, we collected RNA and supernatants to measure message levels of TRAIL and IFNβ production, respectively. R848-treated pDCs had significantly elevated levels of TRAIL, compared to untreated pDCs (Figure 4.2 A),
80 however, only pDCs from M5-classified AML samples had significantly increased levels of IFNβ (Figure 4.2 B).
Since AML cells have been reported to be insensitive to TRAIL-mediated killing, we next asked whether IFNβ had any direct effects on AML cells. We have previously shown that the Type II Interferon, IFNγ, could stimulate AML blasts to become effector cells and target one another in an antibody-dependent manner.164 When stimulated with
IFNγ, AML cells are able to up-regulate different M1 markers including the antibody target CD38 as well as the important high-affinity FcγR, CD64. When AML cells are treated with IFNγ in combination with the anti-CD38 targeting antibody daratumumab, there are increased levels in cytotoxicity suggesting that these cells are acting as effectors and killing one another. We sought to determine whether IFNβ acted in the same manner as IFNγ in up-regulating the M1 markers CD86, CD38 as well as CD64. Here, we treated primary AML apheresis samples with or without IFNβ for 24 hours. Next, we measured the surface expression of CD38, CD86 and CD64 by flow cytometry and found that IFNβ significantly increased the expression of all three markers on primary AML cells (Figure
4.2 C).
IFNβ mediated up-regulation of CD38 and CD86 is IRF9 dependent
We have previously shown that IFNγ up-regulation of CD38 on AML blasts is p38, NF-κB, and JAK/STAT dependent.164 Although Type I and Type II IFN signaling have many similarities, there exist some dissimilarities.50 Therefore, we sought to determine the mechanism of IFNβ up-regulation of CD38, CD64, and CD86. In the canonical pathway, Type 1 IFNs bind to the IFNAR receptor, resulting in JAK/STAT
81 signaling. Once Jak1/Tyk2 are activated, tyrosine residues on STAT1 and STAT 2 are phosphorylated leading to their activation. This results in the formation of the IFN- stimulated gene (ISG) factor 3 (ISGF3) complex forming between STAT1, STAT2 and
IRF9, which then induces different Interferon Stimulated Genes (ISGs). In the non- canonical pathway, Type 1 Interferons can act independently of JAK/STAT signaling through both the PI3K or MAPK pathways.167 To determine which downstream signaling pathways were required for IFNβ-mediated up-regulation of CD38, primary AML apheresis samples were pre-treated with inhibitors for Jak 1/2 (JAK/STAT canonical pathway), p38 (PI3K pathway), and MEK (MAPK pathway). Western blots analysis was performed in order to determine the efficacy of each inhibitor (Figure 4.3 A-C). qPCR results showed that IFNβ-mediated up-regulation of CD38 was prevented by both the Jak 1/2 and p38 inhibitors (Figure 4.3 A-B). However, CD64 up-regulation by IFNβ was prevented by the Jak 1/2 inhibitor alone (Figure 4.3 A). MEK/ERK did not seem to play a role in IFNβ-mediated up-regulation of CD38, CD64, or CD86 (Figure 4.3 C). In order to further verify the role of the canonical JAK/STAT/IRF9 pathway in the up- regulation of CD38 and CD64, we transfected MV4-11 cells with a control siRNA or
IRF9 siRNA prior to treating them with IFNβ. To verify the efficacy of the knockdown, we collected whole cell lysates to measure IRF9 protein expression (Figure 4.3 D).
Interestingly, results showed that the IRF9 siRNA prevented the increase of both CD38 and CD86 expression in MV4-11 cells significantly, but not CD64. This suggests that the canonical pathway plays a role in IFNβ-mediated up-regulation of both CD38 and CD86 in MV4-11 cells.
82 pDC-dependent IFNβ production enhances CD38 expression on AML cells
We have demonstrated how TLR 7/8 is able to shift AML pDCs to a more activated phenotype and increase IFNβ production in M5-classified AML pDCs. We next asked whether pDC-dependent IFNβ production after R848 treatment could enhance
CD38 expression on AML cells in a paracrine fashion. Here, we treated both pDC- positively and pDC-negatively sorted populations from M5-classified primary AML
PBMC samples with R848 (5 µM for 48 hours). Next, we collected supernatants and placed them on MV4-11 cells in the presence or absence of IFNβ neutralizing antibody
(1000 U/mL) for 24 hours. Subsequently, supernatants were collected to measure IFNβ production (Figure 4.4 B) and cells were stained for CD38 expression (Figure 4.4 C).
Here, we saw that R848 was able to enhance IFNβ production in pDC-positively sorted populations. This increase in IFNβ production was reduced with the addition of IFNβ neutralizing antibody, demonstrating the efficacy of the neutralizing antibody (Figure 4.4
B). More importantly, CD38 expression was enhanced in MV4-11 cells that were incubated with R848-treated pDC supernatants. However, this increase was diminished with the addition of IFNβ neutralizing antibody (Figure 4.4 C-D). This suggests that
IFNβ from pDCs treated with R848 are able to act on AML cells in their microenvironment and increase the antibody target CD38. These results help demonstrate the potential role of R848 as a therapeutic strategy to induce of IFNβ production in AML.
IFNβ-induced AML cytotoxicity is enhanced with anti-CD38 antibody daratumumab
IFNβ is able to up-regulate the M1-marker CD86, the antibody target CD38, and the high-affinity FcγR, CD64. We next asked whether IFNβ could induce any functional 83 changes in AML cells, similarly to IFNγ.168 Since IFNβ is able to increase the surface expression of FcγRI (CD64), we hypothesized that IFNβ could also enhance FcγR- mediated effector functions, such as phagocytosis. Here, we treated two AML cell lines
(OCI-AML3 and MV4-11) and primary AML apheresis samples with IFNβ (500 U/mL) for 24 hours. Phagocytosis of fluorescently labeled opsonized sheep red blood cells was measured. As shown in Figure 4.5 A-C, IFNβ treatment significantly enhanced the phagocytic ability of both cell lines (Figure 4.5 A-B) and primary AML cells (Figure 4.5
C).
We next tested the ability of IFNβ to promote antibody-mediated fratricide within pools of AML cells, or fratricide. Here, we treated the AML cell line, OCI-AML3 with or without IFNβ (500 U/mL) in the presence or absence of the anti-CD38 antibody, daratumumab (20 µg/mL) for 48 hours. Cell death was measured via lactate dehydrogenase (LDH) release. Here, we saw that IFNβ alone was able to significantly increase cytotoxicity alone, as previously reported with IFNγ.168 However, when combined with daratumumab, IFNβ was able to significantly increase cytotoxicity as measured by LDH release (Figure 4.5 D). In order to further confirm these findings, we treated the AML cell line, MV4-11 with or without IFNβ (500 U/mL) in the presence or absence of anti-CD38 antibody, daratumumab (20 µg/mL) for 48 hours. We then performed a colony-forming assay and counted colony forming units in a double-blinded fashion, after two weeks. Our data indicated that IFNβ significantly reduced colony formation and the combination therapy of IFNβ + daratumumab reduced colony formation even further (Figure 4.5 E-F).
84
In our working model shown in Figure 4.5G, we propose that R848 can induce both a phenotypic and functional change in pDCs from AML patients. Specifically,
R848-induced IFNβ production, seen in specific AML patients can then increase the expression of the antibody target CD38, CD86, and CD64. When combined with the anti-
CD38 antibody, daratumumab, these cells are able to partake in daratumumab-mediated fratricide (Figure 4.5 G).
IFNβ increases CD38 expression on Leukemic Stem-like cells.
LSC populations are believed to be the major cause of relapse in AML.169,170
Here, we asked whether IFNβ could up-regulate CD38 expression on LSC-like cells so that they can potentially be targeted by daratumumab. Although LSCs were originally identified as CD34+/CD38-, today many unique surface markers have been developed to identify LSCs.171 Here, we treated AML bone marrow samples with IFNβ for 24 hours.
Next, we stained samples for LSC-like markers (Lin-/CD123+/CD34+/CD45Ra+) and measured CD38 expression (Figure 4.6 A). Results showed that LSC-like cells treated with IFNβ had significantly increased CD38 expression (Figure 4.6 B). This opens up the exciting possibility for the combination of IFNβ and daratumumab to not only clear AML blasts, but also target the leukemia initiating LSC populations.
4.5.!Discussion:
In this study, we demonstrate a method of shifting the pDC phenotype in AML through TLR 7/8 stimulation. R848-treated pDCs demonstrate better antigen presentation capabilities and select patients respond with increased levels of IFNβ production. IFNβ
85 treatment of AML cells was accompanied by increased surface expression of CD38,
CD86, and CD64 resulting in AML cells acting as effectors in the context of daratumumab-mediated therapy.
The pDC phenotype has been shown to be tolerogenic in many different cancers, including AML. By use of TLR ligands, we have found a method of enhancing the innate immune response against the tumor cells. pDCs are able to kill by inducing TRAIL- mediated apoptosis of tumor cells or by the production of Type 1 Interferons.172,173
Although, R848 did induce TRAIL expression on pDCs from AML patient samples,
AML cells remain relatively insensitive to TRAIL. This phenomenon has previously been reported,163 however, certain agents have been shown to sensitive AML cells to TRAIL- dependent killing. Triptolide is able to sensitize AML cells to TRAIL-mediated apoptosis by decreasing XIAP expression and increasing DR5 expression on AML cells.163
However, due to its severe toxicity and water-insolubility, the clinical use of this drug is quite limited.174 Nonetheless, newer water-soluble pro-drugs, such as Minnelide, have been developed which have entered Phase II clinical trials (NCT03117920).175 In combination with R848, Minnelide may help induce TRAIL-mediated apoptosis of AML cells introducing another possible therapeutic strategy for AML.
R848 is not only able to increase TRAIL expression, but is also able to up- regulate the surface expression of both CD86 and CD40 on AML pDCs. Although pDCs do take up less antigen than myeloid dendritic cells, they have been shown to still induce potent CD4+ and CD8+ T cell responses when activated.176 Activated pDCs express high levels of the co-stimulatory molecule CD86 (B7-2) which, when bound to CD28 on T-
86 cells can induce T cell activation.177 Another important interaction is between CD40 on pDCs and CD40L on T cells. Upon this interaction, IL-6 is released by pDCs, which then allows B cells to become antibody secreting plasma cells.177–181 These R848-induced phenotypic changes help shift pDCs into their activated counterparts, which can then potentially play a role in anti-tumor immunity both directly and indirectly.
Although R848 induced TRAIL expression on pDCs consistently, the Type 1 IFN response was limited to the M5-classified subset of patients. Type 1 IFN response via pDCs has known to be decreased in a multitude of cancers. pDCs express many different receptors including ILT7,182 which recognizes The Bone Marrow Stromal Antigen 2
(BST2). This protein is highly expressed on the cell membranes of tumor cell lines and primary carcinomas.183,184 It has been reported that the binding of ILT7 to its ligand
BST2 may in fact shut down Type 1 Interferon production.159 This may help explain why some AML patients are more response to R848 stimulation than others in terms of Type 1
IFN production. If this is the case, disrupting the ILT7/BST2 interaction may be another tool to circumvent the inability to produce Type 1 Interferons in certain AML patients.
Additional studies are required to examine these issues.
Both the Type 1 IFNs, IFNα and IFNβ have been approved by the FDA for clinical use. IFNα has been used in the treatment of hairy cell leukemia, chronic myeloid leukemia, and has been studied in the context of AML.185–187 In the setting of AML, IFNα therapy has been studied in multiple clinical trials in the context of inducing remission, salvage therapy, and post-remission therapy.58,188,189 Type 1 IFNs have both direct and indirect effects on AML cells, which provide rational into their use. Type 1 IFNs are able
87 to induce both the canonical and non-canonical pathways, which can eventually induce apoptosis, inhibit cell proliferation, enhance AML cell immunogenicity, sensitize AML cells to differentiation, and reduce growth-promoting cytokine production by the AML blasts.58 In addition, Type 1 IFNs can increase the cross-priming ability of dendritic cells, and increase the cytotoxic abilities against leukemic cells by both DC,58,190,191 T,58,192 and
NK cells.58 Although IFNα has shown promising results in vitro, there have been problems that have led to modest results in in vivo and in clinical trials. Both IFNα and
IFNβ have relatively short serum half-lives. Benjamin et al. showed that stable expression of IFNβ by viral-mediated gene transfer resulted in anti-leukemic effects when compared to bolus administration of IFNβ. Although IFNβ levels were as low as 10 IU/mL in mice with stable expression of IFNβ, AML tumor burden was significantly reduced when compared to control treated animals.193 These data show the importance of generating longer lasting IFN preparations in order to achieve clinical efficacy. In order to combat this issue, both pegylated IFNs and albumin-IFN fusion proteins have been developed that help extend the serum half-life.194 Both pegylated forms of IFNα and IFNβ have been developed which have been used in the setting of Hepatitis B and C (Pegylated Alfa-
2a/Pegasys, Genentench Inc) and in Multiple Sclerosis (Pegylated interferon beta-
1a/Plegridy, Biogen Canada).195–197 In our study, we suggest another way to combat this pharmacokinetic problem by inducing endogenous an Type 1 IFN response, by using the
TLR 7/8 agonist R848.
In summary, we focused on a novel mechanism of inducing the effector-like
AML blast phenotype seen in Chapter 3, by targeting pDCs through TLR stimulation.
88
Instead of exogenously delivering IFNs, we propose that enhancing endogenous Type 1
IFN production through the activation of pDCs will be far superior. This Chapter, therefore, illustrates a novel mechanism of AML therapy using TLR agonists in combination with daratumumab that should be examined in the future.
89
Figure 4.1: TLR 7/8 agonists reverse the tolerogenic phenotype of pDCs in AML
A, pDCs were identified by flow cytometry. Lymphocytes were gated upon based on FSC and SSC followed by CD3, CD14, CD16, CD19, CD20, CD56 exclusion. pDCs were then identified as HLA-DR+/CD123+ followed by BDCA-2+/CD123+. B, Both healthy donor PBMC and AML PBMC were stained in order to identify pDC populations using multi-color flow cytometry. Surface expression of the pDC activation markers including
CD80, CD86, and CD40 and transmigration marker CD62L were then measured using flow cytometry. MFI values were calculated. C, Healthy donor PBMCs were treated with the TLR 7/8 agonist, R848 (1 µM), for 24 hours. After, cells were stained and pDC populations were identified using multi-color flow cytometry. pDC activation markers
90
CD86, CD30, CD80, and CD62L were measured. D, AML PBMCs were treated with increasing concentrations of the TLR 7/8 agonist, R848 (1 and 5 µM), for 48 hours.
After, cells were stained and pDC populations were identified using multi-color flow cytometry. pDC activation markers CD86, CD30, CD80, and CD62L were measured.
91
Figure 4.2: R848 induces functional changes in AML pDCs
A and B, pDCs were sorted from AML PBMC samples then treated with or without R848
(5µM) for 24 hours. Both mRNA and supernatants were collected to measure TRAIL (A) and IFNβ (B) levels, respectively. C, Primary AML apheresis samples were treated with or without IFNβ (500 U/mL) and the surface expression of CD38, CD86, and CD64 was measured.
92
Figure 4.3: IFNβ mediated up-regulation of CD38 and CD86 is IRF9 dependent. A-D, Primary AML apheresis samples were pre-treated for 30 minutes with either the JAK 1/2 inhibitor (A), Ruxolitinib (5 nM), the p38 inhibitor (B) SB202190 (1 µM) or the ERK inhibitor (C) PD0325901 (0.5 µM) and then treated for 24 hours with or without IFNβ 93
(500 U/mL). qPCR was done to measure CD38 transcript (D). MV4-11 cells were transfected with control or IRF9 siRNA and then treated with IFNβ (500 U/mL) for 24 hours. Western blotting was done to measure IRF9 expression and qPCR was done to measure
CD38, CD64, and CD86 expression.
94
Figure 4.4: pDC-dependent IFNβ production enhances CD38 expression on AML cells A-D, AML PBMC samples were sorted for both pDC+ and pDC- populations and treated overnight with R848 (5 µM). Supernatants were collected and placed on MV4-11 cells in the presence or absence of IFNβ neutralizing antibody (1000 U/mL) for 24 hours (A).
Supernatants were collected and IFNβ was measured (B). Cells were stained for CD38 and surface expression was measured (C-D).
95
Figure 4.5: IFNβ-induced AML cytotoxicity is enhanced with anti-CD38 antibody daratumumab
A-C, AML cell lines (MV-411 and OCI-AML3) and primary AML apheresis samples were treated with or without 1000 U/mL for 24 h and then incubated with opsonized sheep red blood cells. Phagocytosis was counted via microscopy in a blinded fashion. The
96 phagocytic index represents the number of red blood cells ingested by 100 AML cells for each respective cell line. D, OCI-AML3 cells were treated with or without anti-CD38 antibody (20 µg/mL), with IFNβ (500 U/mL), and anti-CD38 antibody (20 µg/mL) +
IFNβ (500 U/mL) for 48 hours. Cytotoxicity was then measured using a Lactate dehydrogenase Assay. E and F, MV4-11 cells were treated with IFNβ (500 U/mL) for 48 hours. Cells were then plated on methocult-media containing plates in order to perform a colony forming assay. After 10 days, colonies were counted in a double blinded fashion. G, Working model
97
*
Figure 4.6: IFNβ increases CD38 expression on Leukemic Stem-like cells A and B, AML bone marrow samples were treated with or without IFNβ (1000 U/mL) for
24 hours. LSCs were identified by flow cytometry (Lineage-/CD123+/CD34+/CD45Ra+,
A) then CD38 expression was measured (B).
98
Chapter 5. !Active hexose-correlated compound enhances extrinsic-pathway-mediated
apoptosis of Acute Myeloid Leukemic Cells
5.1.!Abstract
AHCC has been shown to have many immunostimulatory and anti-cancer
activities in mice and in humans. As a natural product, AHCC has potential to create
safer adjuvant therapies in cancer patients. AML is the least curable and second-most
common leukemia in adults. AML is especially terminal to those over 60 years old,
where median survival is only 5 to 10 months, due to inability to receive intensive
chemotherapy. Hence, the purpose of this study was to investigate the effects of AHCC
on AML cells both in vitro and in vivo. Results showed that AHCC induced Caspase-3-
dependent apoptosis in AML cell lines as well as in primary AML leukopheresis samples.
Additionally, AHCC induced Caspase-8 cleavage as well as Fas and TRAIL
upregulation, suggesting involvement of the extrinsic apoptotic pathway. In contrast,
monocytes from healthy donors showed suppressed Caspase-3 cleavage and lower cell
death. When tested in a murine engraftment model of AML, AHCC led to significantly
increased survival time and decreased blast counts. These results uncover a mechanism
by which AHCC leads to AML-cell specific death, and also lend support for the further
investigation of AHCC as a potential adjuvant for the treatment of AML.
99
5.2.!Introduction
Thus far, we have examined the role of TLR ligands and IFNs as adjuvants to mAb therapy. In Chapter 2, we used TLR ligands to enhance monocyte mediated FcγR- mediated functions in antibody therapy. In Chapters 3 and 4, we used IFNs to shift the phenotype of AML blasts into effectors in antibody therapy. In this Chapter, we will examine the role of a natural product for its ability to suppress AML blast proliferation.
Cancer immunotherapies and adjuvants can help stimulate the immune system to respond more effectively against tumors and tumor cells. Such immune modulators, which include recombinant cytokines such as Interferons, synthetic compounds such as
Toll-like receptor agonists, and natural products containing immune-stimulatory molecules, are being explored as potential enhancers of antibody therapy. We have previously looked at the TLR4 ligand, LPS as a possible cancer therapy adjuvant, but here we choose to focus on a natural product, which has been demonstrated to be a possible TLR2/4 agonist.198
Active Hexose-Correlated Compound (AHCC) is a mushroom extract derived from several species of Basidiomycetes mushrooms including Shiitake (Lentinus edodes) and Shimeji (Lyophyllum shimeji).199 This natural product is composed of a mixture of amino acids, minerals, polysaccharides and lipids enriched in α-1,4-linked glucan.200–202
AHCC is used as a nutritional supplement in Japan and has been shown to be effective against hyperlipidemia, obesity and cancer.200 AHCC is an immunostimulatory agent
199,203,204 and has improved the prognosis and quality of life of patients with liver, lung,
100 and head and neck cancer.205–207 Here, we sought to examine the potential for AHCC as a treatment against AML. We found that treatment of AML cell lines and primary AML leukopheresis samples with AHCC led to an increase in apoptosis, which was Caspase-3- dependent. Additionally, treatment with AHCC induced both extrinsic apoptotic pathway members Fas and Caspase-8. In a mouse engraftment model of AML, AHCC led to reduced blast counts and increased survival time. Interestingly, AHCC induced opposite results in healthy donor monocytes suggesting a dual role for the therapeutic. These results uncover a mechanism of AHCC-induced AML cell death, and also suggest that further study of AHCC as a possible AML therapeutic may be warranted.
5.3.!Materials and Methods
Cell Culture
The AML cell lines used in this study (MV-4-11, MOLM-13, OCI-AML3 and
THP-1) was purchased from the ACC and cultured according to ATCC recommendations. Cells were maintained below 1x106 cells/mL in RPMI 1640 media
(Gibco, Grand Island, NY) supplemented with 10% heat-inactivated fetal bovine serum
(FBS; Hyclone Laboratories, Grand Island, NY), 2mM L-glutamine (Invitrogen, Grand
Island, NY), and penicillin/streptomycin (56 U/mL/56 µg/mL; Invitrogen) at 37°C in an atmosphere of 5% CO2. HS-5 stromal cells were generously provided by Shelley Orwick and Dr. John C. Byrd (The Ohio State University, Columbus, OH) and were cultured as described above.
101
Primary Cells
Primary cell handling was done as described previously.[22] White blood cells apheresed from AML patients were obtained after written informed consent in accordance with the Declaration of Helsinki under a protocol approved by the institutional review board of The Ohio State University. Cells were stored in liquid nitrogen in 20% FBS and 10% DMSO until needed for experiments. At the time of the experiment, cells were thawed at 37°C and incubated in RPMI 1640 media (Gibco) supplemented with 20% FBS, 2mM L-glutamine (Invitrogen) and penicillin/streptomycin
(56 U/mL/56 µg/mL; Invitrogen) at 37°C in an atmosphere of 5% CO2 for 1 hour. Cells were then centrifuged and maintained at 3 x 106 cells/mL in RPMI 1640 media (Gibco) supplemented with 20% FBS, 2mM L-glutamine (Invitrogen) and penicillin/streptomycin
(56 U/mL/56 µg/mL; Invitrogen) and were either left untreated or treated with increasing doses of AHCC (0, 1, 5, 10 mg/mL) (Quality of Life Labs LLC, Purchase, NY) and incubated for 24 hours at 37°C. The next day, cells were counted using Trypan blue exclusion and used for assays.
Antibodies
Anti-Caspase-3, Anti-Caspase-8, Anti-Caspase-9, and anti-PARP antibodies for
Western blotting were purchased from Cell Signaling Technology (Danvers, MA). Anti-
Calreticulin antibody was purchased from Enzo Life Sciences (Farmingdale, NY). Anti- rabbit and anti-mouse HRP conjugated secondary antibodies were purchased from Cell
Signaling Technology (Danvers, MA). For cell viability assays, Annexin V
102
FITC/propidium iodide (BD Biosciences) was used following the protocol of the manufacturer.
Colony forming assay
MV4-11 cells were treated with increasing doses of AHCC (0, 1, 5, 10 mg/mL) for 24 hours then plated at 1x103 in duplicate, in 0.9% methylcellulose medium
(Methocult H4100, Stem Cell Technologies) on cell culture plates for 2 weeks. Colonies were then scored in a double-blind fashion.
Western blotting
Western blotting was done as described previously.[23] Cells were lysed in TN1 buffer (50 mM Tris (pH 8.0), 10 mM EDTA, 10 mM Na4P2O7, 10 mM NaF, 1% Triton
X-100, 125 mM NaCl, 10 mM Na3VO4, and 10 µg/ml each aprotinin and leupeptin).
Protein lysates were boiled in Laemmli sample buffer, separated by SDS-PAGE, transferred to nitrocellulose membranes, probed with the antibody of interest, and then developed by Pierce ECL 2 Western blotting substrate (Thermo Scientific, Rockford, IL) or SuperSignal West Femto maximum sensitivity substrate (Thermo Scientific).
Densitometry was performed using ImageJ, normalizing bands in each lane to loading control to generate the bar graphs.
Real-time polymerase chain reaction
Total RNA was isolated using the Total RNA Purification Plus Kit (Norgen
Biotek Corporation, Ontario, Canada). RNA was reverse transcribed and subjected to quantitative real-time (qRT)–PCR using Power SYBR Green Master Mix (Applied
Biosystems, Grand Island, NY). The following primers (Invitrogen) were used: GAPDH
103
(forward primer 5′-ATT CCC TGG ATT GTG AAA TAG TC-3′ and reverse primer 5′-
ATT AAA GTC ACC GCC TTC TGT AG-3′); Fas/CD95 (forward primer 5’-AAG ACT
GTT ACT ACA GTT G-3’ and reverse primer 5’-GCT TAT GGC AGA ATT GGC CA-
3’); TRAIL (forward primer 5’-AAG GCT CTG GGC CGC AAA ATA AAC-3’and reverse primer 5’-GCC AAC TAA AAA GGC CCC GAA AAA-3’); TRAIL-R1
(forward primer 5’-CAG AAC GTC CTG GAG CCT GTA AC-3’ and reverse primer 5’-
ATG TCC ATT GCC TGA TTC TTT GTG-3’); TRAIL-R2 (forward primer 5’-GGG
AAG AAG ATT CTC CTG AGA TGT G-3’and reverse primer 5’-ACA TTG TCC TCA
GCC CCA GGT CG-3’). GAPDH was used for normalization of the genes of interest.
Relative copy number (RCN) was calculated as 2–ΔCt × 100 (52), where 0078Ct is the
Ct(target) –Ct(GAPDH). RCN was then normalized to calculate fold-change versus untreated.
AHCC preparation for experiments in vitro
AHCC was purchased from Quality of Life Labs LLC (Purchase, NY). Following de-waxing and lyophilization (according to manufacturer instructions), AHCC was freshly prepared by dissolving into PBS at a final concentration of 100 mg/mL. After dissolving, the solution was passed through a 0.22-micron filter (Millipore, Billerica,
MA) and used immediately, at up to 10 mg/ml.208
AML murine model
All animal experiments were done in full accordance with a protocol approved by the Institutional Animal Care and Use Committee (IACUC) at The Ohio State University.
Female non-obese diabetic severe combined immunodeficient-γ (NSG) mice were purchased from Jackson ImmunoResearch Laboratories (Ban Harbor, ME) and bred
104 within a campus-located vivarium under the direction of Dr. Adrienne Dorrance
(Division of Hematology, The Ohio State University). Splenocytes from MV4-11- engrafted mice (0.3x106 resuspended in PBS) were intravenously injected into the tail vein of 6-week-old NSG mice. After one week, mice received either AHCC (600 mg/kg) mixed into PBS, or PBS control by gavage twice per week for 2 weeks. Similar doses of
AHCC were used previously as daily treatments with no evidence of toxic effects.199,200,209,210 Gavage was performed by using a plastic feeding tube (Instech
Laboratories, Inc, Plymouth Meeting, PA). Survival was measured as the time before meeting early-removal criteria set within the protocol, which included 20% weight loss, paralysis or inability to stand, uncontrolled shivering, or unwillingness to eat or drink.
Cell survival assay
AML cells were treated with increasing doses of AHCC (0, 1, 5, 10 mg/ml) for 24 or 48 hours. Cells were either subjected to Trypan Blue (Sigma St. Louis, MO) or harvested and stained with Annexin V FITC/propidium iodide (BD Biosciences) using the protocol of the manufacturer.
Phagocytosis
Phagocytosis assays were performed as described previously.19 Briefly, IgG- coated, PKH26-labeled sheep red blood cells (SRBC) were added to the PBM. Cells were pelleted briefly by slow centrifugation, followed by 30 min of incubation at 37 °C. Non- ingested SRBC were subjected to hypotonic lysis with RBC lysis buffer and PBS wash prior to fixation with 1% paraformaldehyde. Samples were analyzed by fluorescence
105 microscopy in a blinded fashion. The phagocytic index was defined as the total number of SRBC ingested by 100 phagocytes.
Statistics
Cell-line data were analyzed by analysis of variance (ANOVA). For the experiments using healthy-donor or AML-patient samples, since the same sample was under different treatment conditions, data were analyzed by mixed-effect models. For the mouse experiment, the probabilities of disease development were compared between groups using a log-rank test, and the white-blood-cell (WBC) counts analyzed by mixed- effect modeling. Holm’s method was used to adjust for multiplicity.
5.4.!Results
AHCC decreases survival of AML cells
Because AHCC can activate monocytes and monocytic cell lines 199,210,211 and because AML blasts are immature myeloid-lineage cells, we sought to determine whether
AHCC could directly affect blast-cell survival and proliferation. We began by testing
AHCC against the MV4-11 cell line, which contains the FLT3-ITD mutation shared by approximately 20% of AML patients 212 and is linked to increased risk of relapse and mortality.213 We treated MV4-11 cells with AHCC (concentrations from 0 to 10 mg/ml) and measured cell viability. Results showed that 10 mg/ml of AHCC significantly reduced viability at 24 and 48 hours (Figure 5.1 A). To determine whether this involved apoptosis, we treated MV4-11 cells with increasing concentrations of AHCC. Annexin V and Propidium Iodide (PI) staining showed significantly higher apoptosis in treated
106
MV4-11 cells (Figure 5.1 C). We repeated this using primary patient samples and found that 5 mg/ml of AHCC was sufficient to significantly increase apoptosis (Figure 5.1 D).
To supplement this, we also tested the AML cell lines OCI-AML3, MOLM-13 and THP-
1. Results showed that AHCC decreased the viability of OCI-AML3 and MOLM-13 cells, but not THP-1 (Figure 5.2 A). Similarly, Annexin/PI staining showed that AHCC led to apoptosis in OCI-AML3 and MOLM-13 but not in THP-1 cells (Figure 5.2 B).
These results show that 3 of 4 cell lines and all tested patient samples are sensitive to
AHCC treatment. However, AML blasts typically rely on stromal-cell support,214 and the lack of this support in our culture conditions may have played a role. To address this, we tested the effects of AHCC on co-cultures of primary AML samples and HS-5 stromal cells, finding that the stromal cells had no effect on AHCC-induced reductions in viability and increased apoptosis (data not shown).
AHCC decreases AML-cell proliferation
To test the effects of AHCC on blast-cell proliferative ability, we treated MV4-11 cells with increasing concentrations of AHCC and plated them on methocult media- containing plates for 2 weeks. Following this, colony formation was counted in a double- blinded fashion and results showed significantly fewer colonies with increasing doses of
AHCC (Figure 5.3 A and B).
AHCC-induced cell death is Caspase-3-dependent
Caspases are vital mediators of both the extrinsic and intrinsic apoptotic pathways. Caspase-3 plays an especially crucial role as a death protease activated either by tumor necrosis factor (TNF) family receptors, FADD, and Caspase-8 in the extrinsic
107 pathway, or via the intrinsic pathway involving mitochondrial release of cytochrome c and Apaf-1-mediated processing of Caspase-9. Following such extrinsic or intrinsic activation, Caspase-3 can then act to cleave a battery of substrates and thereby initiate apoptotic processes.215 To test whether Caspase-3 played a role in AHCC-induced AML- cell death, we treated all four AML cell lines and primary AML leukopheresis cells with increasing concentrations of AHCC (0, 1, 5 or 10 mg/ml) for 24 hours and measured cleaved Caspase-3. Results showed that higher doses of AHCC induced Caspase-3 cleavage in MV4-11 (Figure 5.4 A) and primary patient cells (Figure 5.4 B). In concordance with results seen with apoptosis, Caspase-3 cleavage was seen with OCI-
AML3 and MOLM-13 cells (Figure 5.4 C and D) but not THP-1 cells (Figure 5.4 E).
Next, to test the involvement of cleaved Caspase-3 in AML-cell death, we pretreated MV4-11 cells and primary AML leukopheresis samples with a Caspase-3 inhibitor, Z-DEVD-FMK for 45 minutes, and treated with increasing concentrations of
AHCC for 24 hours. Inhibitor efficacy was confirmed by measuring Caspase-3 cleavage
(Figure 5.5 A). Cell viability was measured, and results from Trypan Blue (Figure 5.5 B and C) for MV4-11 and primary AML cells, respectively) and Annexin V and Propidium
Iodide (PI) staining (Figure 5.5 D and E for MV4-11 and primary AML cells, respectively) showed that the Caspase-3 inhibitor ameliorated the apoptotic effect of
AHCC. This suggests that the pro-apoptotic effects of AHCC on AML cells are mediated by Caspase-3.
AHCC induces Caspase-8 cleavage and upregulation of Fas and TRAIL
108
Since AHCC induced Caspase-3 cleavage in three out of four AML cell lines, we next asked which upstream molecules were involved in the induction of Caspase-3 cleavage. Both the extrinsic and intrinsic apoptotic pathways may be involved in
Caspase-3 cleavage, so we chose to look at the intrinsic apoptotic molecule Caspase-9 and the extrinsic molecule Caspase-8. Caspase-9 is an initiator caspase involved in intrinsic apoptosis. Upon apoptotic stimulation, cytochrome c is released from the mitochondria, which forms a complex with pro-Caspase-9 and apoptotic peptidase activating factor 1 (Apaf-1). This results in the cleavage and activation of Caspase-9, which can then activate other caspases including Caspase-3.216 In the extrinsic apoptotic pathway, death receptors can activate Caspase-8 through their interaction with adaptor proteins. Active Caspase-8 or the p18 subunit is the first step in the apoptotic signaling cascade, which eventually leads to Caspase-3 cleavage, and apoptosis.217–219
Here, we treated MV4-11 cells with increasing doses of AHCC (0, 1, 5, 10 mg/ml) for 24 hours and measured levels of cleaved Caspase-8 and Caspase-9. Results showed that AHCC induced the cleavage of Caspase-8 (Figure 5.6 A and B) but not
Caspase-9 (data not shown) in MV4-11 cells.
This suggested involvement of the extrinsic apoptotic pathway so we next tested whether the death receptors Fas or tumor necrosis factor (TNF)-related apoptosis inducing ligand receptor (TRAILR) increased upon AHCC stimulation. We treated MV4-
11 cells as described above and measured TRAIL-R1, TRAIL-R2 and Fas by qPCR.
Results showed that the death receptor Fas increased with higher concentrations of
AHCC (Figure 5.6 C), whereas TRAIL-R1 and TRAIL-R2 did not change (data not
109 shown). Similarly, we examined the effects of AHCC on poly (ADP-ribose) polymerase
(PARP) and saw no increase in the cleaved form (data not shown). However, TRAIL itself increased with AHCC (Figure 5.6 D). Hence, Fas and TRAIL may be engaged during cell-to-cell interactions, initiating the apoptotic cascade. AML blasts have been shown to kill one another via ADCC after treatment with IFNγ,213 so this AHCC- mediated Fas and TRAIL upregulation may represent a separate mechanism by which
AML blasts can be induced to target one another.
AHCC is not toxic toward healthy monocytes
Because AHCC reduced viability in AML cells, we next tested whether it had similar effects on more fully-developed myeloid-lineage cells. For this we treated primary healthy-donor monocytes with increasing doses of AHCC as above. Cell viability and Caspase-3 cleavage were both measured. In sharp contrast to its effects on
AML cells, AHCC increased cell viability at 10 mg/ml (Figure 5.7 A) and decreased
Caspase-3 cleavage (Figure 5.7 B). This selective cytotoxic effect of AHCC may suggest that it targets certain molecules and / or pathways found in AML blasts but not in mature, healthy myeloid-lineage cells.
AHCC increases survival in vivo
AHCC induced both cleaved Caspase-3 and AML-cell death in vitro. Here, we tested whether AHCC could increase survival time in a murine model of AML. For this, we injected human MV4-11 cells intravenously into NSG mice, waited one week to permit engraftment, then gavaged mice twice per week for 2 weeks with either AHCC or
PBS. Results showed that mice treated with AHCC survived significantly longer than
110 those receiving PBS (Figure 5.8 A). White-blood-cell counts were also taken on Days 21 and 27 (before and after disease symptoms appeared), and results showed that the AHCC- treated mice had significantly fewer WBC at Day 27 compared to untreated mice (Figure
5.8 B and C). Hence, AHCC antagonizes AML blasts not only in vitro, but also in vivo.
5.5.!Discussion
In Chapters 2 through 4, we concentrated on enhancing either the innate immune system or cancer in the context of antibody therapy. Here, we shift our focus to a natural mushroom extract, which is able to enhance healthy donor monocyte responses and induce cytotoxicity in AML blasts. We demonstrate that AHCC has a direct effect on
AML blasts, reducing viability and proliferation in AML cell lines and in primary AML samples. AHCC drove a pro-apoptotic signal that appeared dependent at least in large part on Caspase-3 activation, as blocking Caspase-3 restored AML-cell viability. AHCC also decreased white-blood-cell counts and increased survival in a murine engraftment model of AML.
AHCC consists of a mixture of various compounds, and the mechanisms by which it acts have not been fully elucidated. It is thought that TLR4 and possibly TLR2 may play a role in AHCC induced immune responses in intestinal epithelial cells.198
Here, at least with regard to AML cells we found that AHCC leads to activation of Caspase-3, which in turn induces apoptosis. Caspase-3 is a part of the family of executioner caspases (along with Caspases 6 and 7), which form inactive pro-caspase dimers. Once activated, these dimers are cleaved by initiator caspases into large and small subunits, allowing the two active sites of the dimer to become a mature protease.220
111
Once Caspase-3 is cleaved into a mature protease, it can then initiate the apoptotic process. The activation of Caspase-3 can be initiated by both an extrinsic and intrinsic stimulus. The extrinsic apoptotic pathway is activated by the binding of a ligand to its death receptor, whereas the intrinsic pathway can be activated through various cellular stresses resulting in the release of cytochrome c.221 In the extrinsic pathway, once the death receptor binds to its ligand, the initiator Caspase-8 becomes activated. Activated
Caspase-8 can then directly cleave and activate downstream effector caspases including
Caspase-3, triggering apoptosis.222 Our results suggest that AHCC triggered this extrinsic pathway as it upregulated Fas and TRAIL, with accompanying Caspase-8, but not
Caspase-9 cleavage.
Although not widely popular in the west, AHCC has been used as a nutritional supplement throughout Japan and Asia for the last decade 200 and appears well- tolerated.223 The extract has previously been shown to have antitumor effects. For example, it prolongs survival in advanced liver cancer patients,205 enhances the antitumor activity of 5-fluorouracil,224 and reduces tumor burden alone and in combination with
CpG oligodeoxynucleotides in a murine melanoma model.205 It shows immune- modulatory effects as well such as serving to sooth hapten-induced colitis in rats,225 to decrease bacterial burden,226 and to enhance resistance to pathogens such as Chlamydia trachomatis in murine models of stress.210 As such, AHCC may not only aid in the clearance of AML blasts, it may also help reduce the incidence of infections in these typically immune-compromised patients.
112
Perhaps as importantly, AHCC has been shown to reduce the adverse effects seen with chemotherapeutic agents.227–230 Current AML therapies largely consist of intensive chemotherapy and allogeneic hematopoietic stem cell transplantation, but outcomes in elderly patients are especially poor due to their inability to receive intensive chemotherapy.29 Hence, AHCC may enable these treatments to be extended to the elderly population. Younger patients may also benefit, especially if the AML-clearing effects of
AHCC can be borne out in future clinical trials. Along with this, newer drugs such as hypomethylating agents are emerging and immune-based therapies have already shown great promise for other types of malignancies.231 AHCC likely will not be curative for
AML by itself, but still might provide powerful antitumor effects in combination with one or more of these therapies. The potential protective and / or antitumor effects of
AHCC in combination with chemotherapeutic agents has been shown to have positive effects within the context of solid tumors including pancreatic, ovarian, lung, colorectal and breast cancer.228–230 Our results suggest that it may be particularly effective for AML, as it appears to directly induce blast-cell apoptosis without harming later-lineage monocytes.
Although not surprising given the low toxicity seen with AHCC, it is nevertheless interesting that AHCC led to apoptosis in AML cells but not their healthy-donor monocyte counterparts. It is known that the metabolic needs and intracellular signaling profiles of tumor cells differ from those of normal cells,232 and one or more compounds within AHCC might exploit this to effect Caspase-3-mediated apoptosis. Alternatively, tumor cells may express more AHCC-binding molecules and thereby bind one or more of
113 the AHCC components. Our initial tests using MV4-11 cells opened the possibility that
FLT3 signaling may sensitize the cells to AHCC, as they carry the FTL3-ITD mutation.233 However, OCI-AML3 is FTL3-WT233 and showed similar Caspase-3 cleavage and apoptosis. Of particular interest, THP-1 cells, also FLT3-WT,234 showed no
Caspase-3 cleavage and virtually no signs of apoptosis. The THP-1 cell line carries a t(9;11)(p22;q23) which leads to an MLL-AF9 fusion gene, whereas the FLT3-WT and
AHCC-sensitive OCI-AML3 cells carry an NPM1-mutation.235,236 In vitro, this fusion protein causes an increase in the expression of both migration and invasion genes in hematopoietic stem cells, driving an extremely invasive subtype of AML. Additionally, the transplantation of retrovirally-expressing MLL-AF9 hematopoietic cells into mice causes rapidly-progressing disease when compared to control mice.237 The other two cell lines that responded to AHCC do not carry this specific translocation,238,239 suggesting that it could be a factor with regard to AHCC resistance. However, numerous mutations and mutational combinations exist within AML cells and cell lines that might influence their response to AHCC. Differential screens between resistant versus sensitive cell lines may help uncover the molecules and signaling pathways that are targeted by AHCC, and perhaps which AML subtypes may be most responsive. The mutational status of 5 of the
7 patient samples we tested represented 3 different mutational classes, including FLT3-
ITD, FLT3-TKD and NPM1 (Table 5.1). All responded to AHCC, suggesting that its effect is likely independent of FLT3 and NPM1. Due to the large number of known mutations and cytogenetic profiles, as well as patient-to-patient variability, very large sets
114 of patient samples will be required to determine which are associated with response to
AHCC.
In summary, we have found that AHCC can cause Caspase-3-dependent AML cell death in both MV4-11 cells and primary AML samples. It also increased survival time in a murine engraftment model. Importantly, AHCC suppressed Caspase-3 cleavage in healthy donor monocytes suggesting a dual therapeutic role for this natural product.
Hence, the study of AHCC as a potential adjuvant for the treatment of AML may be warranted.
A great part of this Chapter has been published previously:
Fatehchand, K., R. Santhanam, B. Shen, E. L. Erickson, S. Gautam, S. Elavazhagan, X.
Mo, T. Belay, S. Tridandapani, and J. P. Butchar. 2017. Active hexose-correlated compound enhances extrinsic-pathway-mediated apoptosis of Acute Myeloid Leukemic cells. PloS One 12: e0181729.
115
Figure 5.1: AHCC decreases survival of AML cells. A and B, The AML cell line MV4-11 (1 x 106 cells/ml) and primary AML-patient leukopheresis samples (3 x 106 cells/ml) were treated with 0, 1, 5 or 10 mg/ml AHCC for
24 or 48 hours. Trypan Blue Exclusion was done with (A) MV4-11 cells (n = 3 separate experiments) and (B) primary AML leukopheresis samples (n = 7 donors). C and D,
MV4-11 (C, n = 3 separate experiments) and patient leukopheresis samples (D, n = 7 donors) were treated as above and then analyzed via flow cytometry following Annexin
V and Propidium Iodide (PI) staining. * p≤0.05; ** p≤0.01.
116
Figure 5.2: AHCC increases apoptosis in most AML cell lines.
A, The AML cell lines OCI-AML3 (left panels, 1 x 106 cells/ml), MOLM-13 (middle panels, 1 x 106 cells/ml) and THP-1 (right
panels, 1 x 106 cells/ml) were treated with 0, 1, 5 or 10 mg/ml of AHCC for 24 or 48 hours. B, Trypan Blue Exclusion was done to
measure viability (n = 3 separate experiments). The 3 respective cell lines were treated as above and Annexin V / Propidium Iodide
(PI) staining was measured using flow cytometry (n = 3 separate experiments). * p≤0.05.
117
Figure 5.3: AHCC decreases AML-cell proliferation. A and B, MV4-11 cells (1 x 106 cells/ml) were treated with AHCC as in Figure 5.1, then
incubated on Methocult-media-containing plates for 2 weeks. Colonies were counted in a
blinded fashion. Graph of 3 separate experiments (A). Photographs of representative
plates (B). *** p≤0.001.
118
Figure 5.4: AHCC-induced cell death is Caspase-3-dependent. A and B, The AML cell line MV4-11 (1 x 106 cells/ml) and primary AML-patient leukopheresis samples (3 x 106 cells/mL) were treated with 0, 1, 5 or 10 mg/ml AHCC for 24 hours. Western blotting was done to measure cleaved Caspase-3, using Calreticulin as a loading control. Representative blots are shown for MV4-11 (A, n = 3 separate experiments) and primary leukopheresis samples (B, n = 3 donors). C-E, OCI-AML3 (C),
MOLM-13 (D) and THP-1 (E) cells were treated with AHCC as above. Western blotting was done to measure cleaved Caspase-3, using Calreticulin as a loading control (n = 3 separate experiments).
119
Figure 5.5: Caspase-3 cleavage is required for AHCC-induced apoptosis of AML cells. A, MV4-11 cells (1 x 106 cells/ml) were treated with 0, 1, 5 or 10 mg/ml AHCC for 24 hours in the presence or absence of 50 µM Z-DEVD-FMK, the Caspase-3 inhibitor.
Western blotting was done to measure cleaved Caspase-3, with Calreticulin as loading control (n = 2 separate experiments, representative blots shown). B-C, MV4-11 cells (B, n
= 2 separate experiments) and primary leukopheresis samples (C, n = 3 donors) were
120 treated for 24 hours with 0 (UT), 5 or 10 mg/ml AHCC with or without Caspase-3 inhibitor, followed by Trypan Blue counts to measure viability. D-E, MV4-11 cells (D, n
= 2 separate experiments) and primary leukopheresis samples (E, n = 3 donors) were treated for 24 hours with 0 (UT), 5 or 10 mg/ml AHCC with or without Caspase-3 inhibitor and Annexin V / Propidium Iodide (PI) staining measured by flow cytometry. * p≤0.05; **** p≤0.0001.
121
Figure 5.6: AHCC induces Caspase-8 cleavage and upregulation of Fas and TRAIL. A-B, The AML cell line MV4-11 (1 x 106 cells/ml) was treated with 0, 1, 5 or 10 mg/ml
AHCC for 24 hours. Western blotting was done to measure cleaved Caspase-8, with
Calreticulin as a loading control (A, representative blot shown), and densitometric
analysis was performed (B, n = 3 separate experiments). C-D, Fas (C, n = 3 separate
experiments) and TRAIL (D, n = 4 separate experiments) were measured by qPCR. *
p≤0.05.
122
Figure 5.7: AHCC is not toxic toward healthy monocytes. A-B. Healthy-donor monocytes (5 x 106 cells/ml, n = 3 donors) were treated with 0, 1, 5 or 10 mg/ml of AHCC for 24 hours. Trypan Blue counts were done to measure viability
(A). Western blotting was done to measure cleaved Caspase-3, using Calreticulin as the loading control. Representative blots shown (B). ** p≤0.01.
123
Figure 5.8: AHCC increases survival in vivo. A-C, NSG mice (n = 10 per group) were intravenously injected with 0.3 x 106 MV4-11
cells, then monitored for one week. Mice were then treated with either PBS or AHCC
(600 mg/kg) twice a week for two weeks via gavage. Survival time was measured and
plotted (A) Peripheral blood was collected and white-blood-cell (WBC) counts done at
day 21 and day 27 (B, n = 3 mice per group). Wright-Giemsa stains of peripheral blood
was performed at day 27 to visualize blast count and morphology, for control (top panel)
and AHCC-treated (bottom panel) mice (C). * p≤0.05; ** p≤0.01.
124
Table 5.1: Mutational status of AML patients
De-identified AML patient samples provided through the Leukemia Tissue Bank (LTB) at The Ohio State University were tested for FLT3-ITD, FLT3-TKD, NPM1, CEBPα,
BCR-ABL and PML-RARα. The symbols “-” indicate negative and “+” positive for each respective mutation. 2 of the 7 patient sets had not been tested by the LTB.
125
Chapter 6. !Summary and Future Perspectives
Collectively, these studies have helped examine the interplay between of the innate immune system and tumor cell in cancer progression. We have focused on harnessing the effector-like state of both monocytes and tumor cells in the context of antibody therapy. In Chapter 2, we elucidated the role of TLRs in enhancing FcγR- mediated activities in monocytes. Here, we demonstrated that the mechanism of LPS- mediated down-regulation of FcγRIIb is through ubiquitination by the March3 ubiquitin ligase. Determining the mechanism of FcγRIIb down-regulation is crucial because it opens up many therapeutic options in enhancing antibody therapy. Future studies can assess the adjuvant potential of different TLR4 agonists in antibody therapy.
Furthermore, since March3 played a role in FcγRIIb down-regulation, potential studies using agents that up-regulate March3 are warranted in conjunction with anti-tumor antibodies.
Cancer cells play a crucial role in disease progression through their ability to induce an immunosuppressive microenvironment. The host response is dampened in the context of many cancers.240 In the third and fourth chapter, we draw attention to the importance of modulating the cancer cell phenotype in the setting of AML. Here, we examined a novel mechanism of antibody-mediated killing by AML cells, themselves.
When stimulated with IFNγ or IFNβ, these cells are able to take on an effector-like state by up-regulating the M1-markers CD86 and HLA-DR. Additionally, IFNγ and IFNβ
126 induce the up-regulation of the surface expression of FcγRI and antibody target CD38 on
AML cells. This results in the ability of AML cells to be effectors and targets in the context of anti-CD38 daratumumab antibody therapy. Specifically, when AML cells were treated with the combination of IFNγ or IFNβ and daratumumab, we saw increases in cytotoxicity suggesting that these cells were in fact killing each other. Additional future studies are needed in order to elucidate the exact mechanism of daratumumab-mediated fratricide, whether it is mediated through ADCP or ADCC. Additionally, we need to focus on more targeted IFN delivery methods. Our laboratory is working on developing an IFNγ conjugated anti-CD38 antibody, which may help reduce non-specific toxic effects of IFNγ and help increase target specificity. Additionally, although Type 1 IFNs are cytotoxic to AML cells in vitro, they lose their effect in vivo due to their short serum half-lives. In Chapter 4, we focused on enhancing endogenous Type 1 IFNs by stimulating pDCs with the TLR 7/8 ligand, R848. In this way, we propose that Type 1
IFN production can be enhanced endogenously and locally, which can then act on AML cells in a paracrine fashion to enhance fratricide in the context of daratumumab therapy.
In the final chapter of this study, we target both AML cells and healthy donor monocytes in different ways using a natural product. We were able to illustrate a novel mechanism of AHCC-induced apoptosis of AML cells through an extrinsically-mediated pathway. Importantly, this effect was lost in healthy donor monocytes. In fact, AHCC suppressed apoptosis and enhanced healthy donor monocyte mediated FcγR-function in vitro. This study opens up many questions regarding the ability of AHCC to elicit different effects on LSCs versus their HSC counterparts. Future studies need to be
127 completed in order to determine whether AHCC is able to induce apoptosis in LSC populations. Additionally, since we were able to see increases in FcγR-mediated phagocytosis by AHCC in healthy donor monocytes, we need to examine the potential role of AHCC as an adjuvant to antibody therapy. Together, these in-depth studies will help discover novel therapeutic options for cancer, focusing on the innate immune system, cancer, or both.
TLRs as therapeutic options:
The aforementioned studies on the TLR4 ligand, LPS, demonstrate its ability to enhance FcγR-mediated responses in antibody therapy. We demonstrated that LPS- mediated down-regulation of the inhibitory FcγR, FcγRIIb is through March3 ubiquitination. This down-regulation of FcγRIIb resulted in an enhanced FcγR-mediated cytokine response and phagocytic ability. LPS forms the major component on the outer membrane of gram-negative bacteria. LPS is able to activate macrophages to produce many pro-inflammatory cytokines resulting in fever, tissue damage, and sepsis in patients.241 In order to combat these negative side effects, many different LPS mimetics have been developed and evaluated as immune modulators. As mentioned above, both monophosphoryl lipid A and E6020 have been studied as adjuvants to antibody therapies in the context of mouse melanoma and HER2+ cancer.107 Additionally, RC-529, a second-generation lipid A mimetic is being studied in the context of hepatitis B.242
Although LPS-derived agonists have limited toxicities compared to LPS, they are composed of a multiple different inactive and active ingredients leading to heterogeneous responses. Cohen et al. were able to counter these issues by developing TLR4 agonistic
128 antibodies to elicit TLR4-mediated effects without the potential non-specific LPS- mediated inflammation. The 5D24.D4 antibody is able to induce IL-8 secretion, up- regulate NF-κβ expression, and may be a possible safe anti-cancer therapeutic.242
Ultimately, our goal is to be able to use an LPS mimetic or TLR4 agonist antibody to modulate FcγR expression in order to enhance their responses in antibody therapy against cancer.
Alternative approaches to enhancing the innate immune response:
Enhancing FcγR-mediated responses through TLR4-agonist stimulation is just one way of achieving greater efficacy of antibody therapy. Recently, novel methods of immunotherapy have been developed including CAR T-cell therapy. CAR T-cell therapy involves generating T-cells that express chimeric antigen receptors to target tumor antigens. Since Gross et al. published their initial studies on chimeric T-cell receptors directed against tumor cells, four generations of CAR-T cells have been developed. First generation CAR T-cells are composed of an scFV fused directly to the TCR signaling domain (CD3ζ). Second generation CARs have an additional co-stimulatory molecule
(CD28). Third generation CARs include multiple co-stimulatory molecules and fourth generation CARs or TRUCKs (T-cell redirected for universal cytokine-mediated killing) are engineered with the expression of an inducible cytokine (IL-12).243 CAR T-cells have been used in the context of many hematologic malignancies and are showing promising results in solid tumors as well.244 Although CAR T-cells are demonstrating much success, like any therapy, they do have their own pitfalls. One of the major issues, other than the incredible cost of this therapy, has been the association with adverse events, including
129 cytokine release syndrome (CRS).245 The purpose of a CAR T-cell is to produce an inflammatory response to tumor antigens. However, in many patients hyper- responsiveness to the therapy can occur, resulting in an elevation of pro-inflammatory cytokines, causing mild to severe CRS.246 Many believe that a safer alternative to CAR
T-cell therapy could be cellular therapy using either autologous or allogenic NK cells.
Unfortunately, autologous NK cells typically are not very effective as they are silenced when encountering self-MHC and are usually tolerogenic in cancer patients.
Alternatively, allogenic NK cells can play a role in graft-versus-host (GvH) reactions. In order to combat this, researchers have developed cytotoxic NK cell lines, including NK-
92, which have been involved in different clinical trials
(NCT00900809 and NCT00990717).245 Unlike blood NK cells, these cell lines can also be easily transfected to express molecules to help them target tumor cells. In fact, recently both high affinity natural killer (haNK) and target activated natural killer (taNK) have been developed. haNKs are NK-92 cell lines that express the high-affinity FcγR,
FcγRIIIa. Once infused into patients, these cells will then be able to partake in antibody- mediated killing against tumor cells. taNKs, on the other hand, have been engineered to express a CAR directed against a tumor antigen. Monocytes and macrophages are extremely important effectors in antibody therapy. Future cellular therapies may focus on developing high affinity monocytes or target-activated monocytes from monocytic cell lines. Working with cell lines will also help reduce the cost of therapies because they will be much more “off the shelf.” One will not have to worry about donor availability and ease of transfection as with primary cells.245 These new therapies create novel ways to
130 enhance the innate immune response against cancer and provide many different avenues for immunotherapy.
Mechanism of antibody-mediated fratricide:
In Chapter 3, we examined the effect of IFNγ on AML blasts. We were able to demonstrate the ability of IFNγ to shift the phenotype of the cancer cell itself into a more effector-like state. When AML blasts were treated with IFNγ combined with daratumumab, they formed significantly increased conjugates suggesting that they were targeting one another. In fact, when AML cells were treated with this combination therapy, we saw significantly higher levels of cytotoxicity as measured by LDH and chromium release, suggesting ADCC. However, we still have not elucidated the exact mechanism of daratumumab-mediated fratricide of AML cells. Daratumumab can function in many different ways including complement-dependent cytotoxicity (CDC),
ADCC, ADCP, or direct killing.125
Future studies are needed to test the exact mechanism of antibody-mediated fratricide with live-cell imaging. One way to achieve this would be to treat AML cell lines and primary AML patient samples overnight with or without IFNγ (10ng/mL), then label with Claret fluorescent membrane dye. Target AML cells will be labeled with green fluorescent membrane dye and coated with anti-CD38 or control IgG. Cell sets will be mixed and incubated together on lysine-coated slides and used for time-lapse microscopy.
Recently, a group demonstrated macrophage-mediated daratumumab-induced phagocytosis of myeloma cells through live cell imaging. In this study, researchers co- cultured daratumumab-treated mouse macrophages (effector cells) with either Burkitt’s
131 lymphoma cells or Daudi cells (targets). After 4 hours, effectors and targets were labeled with either anti-F4/80-PE or anti-CD11b-PE and for flow cytometry. In order to measure phagocytosis, both double positive events were counted and the percentage of eliminated target cells were calculated. Here, it was shown that daratumumab did induce macrophage-mediated phagocytosis of target cells when compared to an irrelevant antibody control. They repeated these studies using human macrophages as effectors and primary MM cells as targets with similar results. This group also showed that daratumumab-mediated phagocytosis is important in vivo. In order to test this, the group treated a subcutaneous Daudi-luc tumor xenograft model with two isotypes of the daratumumab antibody, DARA-K322A (IgG1) or DARA-IgG2-K322A. Earlier, they had showed that mouse macrophages demonstrated limited phagocytic activity with the IgG2 isotype. They were also able to show that the IgG1 isotype of the antibody displayed significantly stronger inhibition of tumor growth, demonstrating the importance of daratumumab-mediated phagocytosis in vivo.17 These results provide evidence that IFNγ- treated AML blasts may be partaking in daratumumab-mediated phagocytosis.
If daratumumab-mediated fratricide is at least in part occurring through ADCP, we must next investigate which FcγR plays a role in this killing. It has been shown that there are significant differences in signaling and outcome between FcγRI and FcγRIIa.247
Even though IFNγ up-regulates FcγRI, it has not been conclusively shown that the enhanced FcγR response (including fratricide) is mediated by this receptor. Additional studies are warranted to determine which activating FcγR is most responsible for antibody-mediated fratricide. Our studies described in Chapter 3 demonstrate that
132 virtually no antibody-mediated fratricide occurs without prior treatment with IFNγ. We, and others have also demonstrated that IFNγ treatment upregulates expression of
FcγRI.120 Based on this, we expect to see FcγRI play the largest role in fratricide following IFNγ treatment. However, it remains to be seen whether other FcγRs contribute to fratricide including FcγRIIa, FcγRIII, and the inhibitory FcγRIIb.
IFNγ and anti-CD38 antibody as a therapeutic option
Clinical trials using the recombinant derived protein (IFN-γ1b, Actimmune) or adenovirus vectors expressing IFN-γ have been used to treat many diseases. For example,
IFN-γ1b has been used in the context of severe malignant osteopetrosis, chronic granulomatous disease, certain cancers, tuberculosis, scleroderma and many others. In the context of cancer, there are several clinical trials being completed studying IFN-γ as an adjuvant to chemotherapy (NCT00428272, NCT0049-9772, NCT00824733,
NCT00004016).248 However, at high doses, IFN-γ can have significant side effects as demonstrated by Sriskandan et al.248 Here, eighteen patients with solid tumors were treated with increasing doses of human recombinant IFN-γ over a period of four weeks.
Throughout the study, it was seen that at lower doses the toxicity of IFN-γ was quite mild. However, at higher doses, patients faced severe dose-limiting toxicities including tiredness, anorexia, hypotension, and disorientation.249 Therefore, if we are able to deliver
IFNγ in a targeted fashion to AML blasts, we may be able to observe strong anti-tumor effects with minimal toxicity. In order to do this, as described above, our lab has been working on developing an antibody-drug conjugate (ADC) that combines the scFv-Fc portion of an anti-CD38 antibody to IFNγ. Our hypothesis is that by linking IFNγ to anti-
133
CD38 antibody, we will be able to selectively target and deliver IFNγ to AML blasts.
With this selective targeting, we hypothesize that lower doses of IFNγ will be needed in order to shift the AML cell phenotype into an effector-like state. After IFNγ up-regulates
CD38, these cells will then be opsonized and primed to partake in antibody-mediated fratricide. Although a viable option, one problem we may face is that AML blasts express low levels of CD38 without IFNγ treatment. In order to combat this, patients may need to be treated with an initial “priming” dose of IFNγ before receiving the ADC. Another option would be to generate a tri-functional, bi-specific ADC such as the Triomab® family of antibodies which combine two half antibodies that originate from parental mouse IG2a and rat IgG2b isotypes.250 Here, we could combine our anti-CD38 antibody with an anti-CD123 antibody conjugated to IFNγ. In this way, the antibody would more specifically target CD123+ AML blasts while still delivering IFNγ to the cells.
Targeting Leukemic stem cells:
Relapse remains to be a critical issue when treating patients with AML.
Researchers attribute a major cause for relapse to be due to leukemia initiating or leukemic stem cells.169,170 In fact, Shlush et al. discovered that relapse can originate from rare leukemic stem cells or from larger subclones of committed leukemia cells that retain features of stem cells.169 Today, many therapeutic strategies have been focused on targeting and eliminating AML LSCs while leaving normal hematopoietic stem cells
(HSCs) unharmed. However, in order to successfully target LSCs, we must identify unique markers that they share. In 1997, Bonnet and Dick first identified LSCs as
CD34+/CD38- cells by their ability to engraft into NOD/SCID mice.171,251 Since HSCs
134 share these surface markers, unique markers still needed to be discovered. In 2008,
Bonnet et al, were able to demonstrate engraftment with CD34+CD38+ cells.252 Since then, many different membrane markers have been identified on LSCs including CD33,
CD34, CD38, CD123, TIM3, CD25, CD32, CD96, and CD45RA among many others.170,253 In Chapter 4, we examined the effect of IFNβ on LSCs. Results showed that
IFNβ was able to up-regulate CD38 expression on these LSC-like cells. Since the antigen target for daratumumab is also an identified LSC marker, it made it quite difficult to successfully identify LSCs. In order to confirm whether the combination of IFNβ with daratumumab can successfully target LSCs, we will need to perform a serial transplantation assay. Here, AML-engrafted recipient mice will be treated with IFNβ, daratumumab, IFNβ + daratumumab, or PBS control twice a week for 3 weeks. For serial transplantation, CD34+CD123+ cells will be purified from the BM and transplanted into secondary recipient mice. Engraftment status and survival will be measured over time to determine whether IFNβ + daratumumab reduced LSC burden in secondary recipient mice.254,255
AHCC as an adjuvant therapy in AML:
In Chapter 5, we examined the effect of the natural product, AHCC, on AML cells. Here, we were able to see AHCC-induced extrinsically-mediated apoptosis in AML cells and suppressed Caspase-3 cleavage in healthy donor monocytes. This contrasting effect raises the question of whether AHCC could potentially target LSC populations while maintaining HSC populations. To test this, serial transplantation must be performed, as described above. Although we did see effects with AHCC alone, studies
135 need to be done to determine whether it would be successful as an adjuvant therapy.
Preliminary results in our laboratory showed that AHCC induces changes in FcγR, specifically increasing the expression of the γ-chain (data not shown). Additionally,
AHCC at higher doses seemed to increase the expression of the antibody target CD38
(data not shown). Future studies need to be completed in order to determine whether
AHCC and daratumumab can induce cell death in a similar manner as IFNγ and IFNβ. If so, AHCC may be a suitable candidate for combination therapy with the anti-CD38 antibody daratumumab in the context of AML. AHCC has also been shown to have multiple immunostimulatory effects including the increase of NK cell cytotoxicity and increase in pro-inflammatory cytokine production in THP-1 cells.204,225 In the context of
AML, AHCC could potentially shift the immunosuppressed phenotype and enhance innate immune cell function. Future studies must address the effect of AHCC on NK cells and monocytes from AML patients. Specifically, it must be determined whether AHCC enhances the production of pro-inflammatory cytokines, phagocytosis, ADCC and/or the production of ROS in monocytes. In summary, AHCC has shown much promise and could possibly exhibit both direct and indirect mechanisms of killing in the context of
AML.
In conclusion, these findings have helped develop potential novel therapeutic options for cancer by enhancing the monocyte or AML blast response. This dissertation emphasizes the important interaction between the innate immune system, particularly monocytes/macrophages and tumor cells in the context of cancer, specifically AML.
Many questions still need to be answered in this diverse field, as described above. This
136 dissertation lays the groundwork for these future studies.
137
Bibliography
1. Scott AM, Wolchok JD, Old LJ. Antibody therapy of cancer. Nat. Rev. Cancer.
2012;12(4):278–287.
2. Carter PJ, Lazar GA. Next generation antibody drugs: pursuit of the “high- hanging fruit.” Nat. Rev. Drug Discov. 2017;
3. Mellor JD, Brown MP, Irving HR, Zalcberg JR, Dobrovic A. A critical review of the role of Fc gamma receptor polymorphisms in the response to monoclonal antibodies in cancer. J. Hematol. Oncol.J Hematol Oncol. 2013;6:1.
4. Byrd JC, Murphy T, Howard RS, et al. Rituximab using a thrice weekly dosing schedule in B-cell chronic lymphocytic leukemia and small lymphocytic lymphoma demonstrates clinical activity and acceptable toxicity. J. Clin. Oncol. Off. J. Am. Soc.
Clin. Oncol. 2001;19(8):2153–2164.
5. O’Brien SM, Kantarjian H, Thomas DA, et al. Rituximab dose-escalation trial in chronic lymphocytic leukemia. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol.
2001;19(8):2165–2170.
6. Hainsworth JD, Litchy S, Barton JH, et al. Single-Agent Rituximab as First-Line and Maintenance Treatment for Patients With Chronic Lymphocytic Leukemia or Small
Lymphocytic Lymphoma: A Phase II Trial of the Minnie Pearl Cancer Research
Network. J. Clin. Oncol. 2003;21(9):1746–1751.
138
7. Oflazoglu E, Stone IJ, Brown L, et al. Macrophages and Fc-receptor interactions contribute to the antitumour activities of the anti-CD40 antibody SGN-40. Br. J. Cancer.
2009;100(1):113.
8. Uchida J, Hamaguchi Y, Oliver JA, et al. The Innate Mononuclear Phagocyte
Network Depletes B Lymphocytes through Fc Receptor–dependent Mechanisms during
Anti-CD20 Antibody Immunotherapy. J. Exp. Med. 2004;199(12):1659–1669.
9. Yazawa N, Hamaguchi Y, Poe JC, Tedder TF. Immunotherapy using unconjugated CD19 monoclonal antibodies in animal models for B lymphocyte malignancies and autoimmune disease. Proc. Natl. Acad. Sci. U. S. A.
2005;102(42):15178–15183.
10. Macrophages contribute to the antitumor activity of the anti-CD30 antibody
SGN-30 | Blood Journal.
11. Minard-Colin V, Xiu Y, Poe JC, et al. Lymphoma depletion during CD20 immunotherapy in mice is mediated by macrophage FcgammaRI, FcgammaRIII, and
FcgammaRIV. Blood. 2008;112(4):1205–1213.
12. Beers SA, French RR, Chan HTC, et al. Antigenic modulation limits the efficacy of anti-CD20 antibodies: implications for antibody selection. Blood. 2010;115(25):5191–
5201.
13. Gong Q, Ou Q, Ye S, et al. Importance of Cellular Microenvironment and
Circulatory Dynamics in B Cell Immunotherapy. J. Immunol. 2005;174(2):817–826.
14. Lefebvre M-L, Krause SW, Salcedo M, Nardin A. Ex vivo-activated human macrophages kill chronic lymphocytic leukemia cells in the presence of rituximab:
139 mechanism of antibody-dependent cellular cytotoxicity and impact of human serum. J.
Immunother. Hagerstown Md 1997. 2006;29(4):388–397.
15. Weiskopf K, Ring AM, Ho CCM, et al. Engineered SIRPα variants as immunotherapeutic adjuvants to anticancer antibodies. Science. 2013;341(6141):88–91.
16. Watanabe M, Wallace PK, Keler T, et al. Antibody dependent cellular phagocytosis (ADCP) and antibody dependent cellular cytotoxicity (ADCC) of breast cancer cells mediated by bispecific antibody, MDX-210. Breast Cancer Res. Treat.
1999;53(3):199–207.
17. Overdijk MB, Verploegen S, Bögels M, et al. Antibody-mediated phagocytosis contributes to the anti-tumor activity of the therapeutic antibody daratumumab in lymphoma and multiple myeloma. mAbs. 2015;7(2):311–321.
18. Charles A Janeway J, Travers P, Walport M, Shlomchik MJ. The structure of a typical antibody molecule. 2001;
19. Shah P, Fatehchand K, Patel H, et al. Toll-like Receptor 2 Ligands Regulate
Monocyte Fcγ Receptor Expression and Function. J. Biol. Chem. 2013;288(17):12345–
12352.
20. Ravetch JV, Kinet JP. Fc receptors. Annu. Rev. Immunol. 1991;9:457–492.
21. Nimmerjahn F, Ravetch JV. Fcgamma receptors as regulators of immune responses. Nat. Rev. Immunol. 2008;8(1):34–47.
22. Rajasekaran N, Chester C, Yonezawa A, Zhao X, Kohrt HE. Enhancement of antibody-dependent cell mediated cytotoxicity: a new era in cancer treatment.
Immunotargets Ther. 2015;4:91–100.
140
23. Busfield SJ, Biondo M, Wong M, et al. Targeting of acute myeloid leukemia in vitro and in vivo with an anti-CD123 mAb engineered for optimal ADCC. Leukemia.
2014;28(11):2213–2221.
24. Vasu S, He S, Cheney C, et al. Decitabine enhances anti-CD33 monoclonal antibody BI 836858-mediated natural killer ADCC against AML blasts. Blood.
2016;127(23):2879–2889.
25. Carter PJ. Potent antibody therapeutics by design. Nat. Rev. Immunol.
2006;6(5):343.
26. Hinton PR, Johlfs MG, Xiong JM, et al. Engineered human IgG antibodies with longer serum half-lives in primates. J. Biol. Chem. 2004;279(8):6213–6216.
27. Hinton PR, Xiong JM, Johlfs MG, et al. An engineered human IgG1 antibody with longer serum half-life. J. Immunol. 2006;176(1):346–356.
28. Butchar JP, Mehta P, Justiniano SE, et al. Reciprocal regulation of activating and inhibitory Fc{gamma} receptors by TLR7/8 activation: implications for tumor immunotherapy. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2010;16(7):2065–
2075.
29. Döhner H, Weisdorf DJ, Bloomfield CD. Acute Myeloid Leukemia. N. Engl. J.
Med. 2015;373(12):1136–1152.
30. Hematology AS of. Gupta V, Tallman MS, Weisdorf DJ. Allogeneic hematopoietic cell transplantation for adults with acute myeloid leukemia: myths, controversies, and unknowns. Blood. 2011;117(8):2307–2318. Blood.
2012;120(26):5250–5250.
141
31. Saultz JN, Garzon R. Acute Myeloid Leukemia: A Concise Review. J. Clin. Med.
2016;5(3):.
32. Isidori A, Salvestrini V, Ciciarello M, et al. The role of the immunosuppressive microenvironment in acute myeloid leukemia development and treatment. Expert Rev.
Hematol. 2014;7(6):807–818.
33. Frumento G, Rotondo R, Tonetti M, et al. Tryptophan-derived Catabolites Are
Responsible for Inhibition of T and Natural Killer Cell Proliferation Induced by
Indoleamine 2,3-Dioxygenase. J. Exp. Med. 2002;196(4):459–468.
34. Mellor AL, Munn DH. Tryptophan catabolism and T-cell tolerance: immunosuppression by starvation? Immunol. Today. 1999;20(10):469–473.
35. Curti A, Trabanelli S, Onofri C, et al. Indoleamine 2,3-dioxygenase-expressing leukemic dendritic cells impair a leukemia-specific immune response by inducing potent
T regulatory cells. Haematologica. 2010;95(12):2022–2030.
36. Gabrilovich DI, Ostrand-Rosenberg S, Bronte V. Coordinated regulation of myeloid cells by tumours. Nat. Rev. Immunol. 2012;12(4):253–268.
37. Mussai F, De Santo C, Abu-Dayyeh I, et al. Acute myeloid leukemia creates an arginase-dependent immunosuppressive microenvironment. Blood. 2013;122(5):749–
758.
38. Isidori A, Salvestrini V, Ciciarello M, et al. The role of the immunosuppressive microenvironment in acute myeloid leukemia development and treatment. Expert Rev.
Hematol. 2014;7(6):807–818.
142
39. Daver N, Basu S, Garcia-Manero G, et al. Phase IB/II Study of Nivolumab in
Combination with Azacytidine (AZA) in Patients (pts) with Relapsed Acute Myeloid
Leukemia (AML). Blood. 2016;128(22):763–763.
40. Guo L, Zhang H, Chen B. Nivolumab as Programmed Death-1 (PD-1) Inhibitor for Targeted Immunotherapy in Tumor. J. Cancer. 2017;8(3):410–416.
41. Olsson I, Bergh G, Ehinger M, Gullberg U. Cell differentiation in acute myeloid leukemia. Eur. J. Haematol. 1996;57(1):1–16.
42. Zhou G-B, Zhao W-L, Wang Z-Y, Chen S-J, Chen Z. Retinoic Acid and Arsenic for Treating Acute Promyelocytic Leukemia. PLoS Med. 2005;2(1):.
43. Breitman TR, Selonick SE, Collins SJ. Induction of differentiation of the human promyelocytic leukemia cell line (HL-60) by retinoic acid. Proc. Natl. Acad. Sci. U. S. A.
1980;77(5):2936–2940.
44. Sykes DB, Kfoury YS, Mercier FE, et al. Inhibition of Dihydroorotate
Dehydrogenase Overcomes Differentiation Blockade in Acute Myeloid Leukemia. Cell.
2016;167(1):171–186.e15.
45. Villanueva MT. Cell differentiation: Pushing differentiation. Nat. Rev. Cancer.
2016;
46. Yea K, Zhang H, Xie J, et al. Agonist antibody that induces human malignant cells to kill one another. Proc. Natl. Acad. Sci. U. S. A. 2015;112(45):E6158-6165.
47. Lerner RA. Combinatorial antibody libraries: new advances, new immunological insights. Nat. Rev. Immunol. 2016;16(8):498.
143
48. Kavanagh S, Murphy T, Law A, et al. Emerging therapies for acute myeloid leukemia: translating biology into the clinic. JCI Insight. 2(18):.
49. Ritchie DS, Neeson PJ, Khot A, et al. Persistence and Efficacy of Second
Generation CAR T Cell Against the LeY Antigen in Acute Myeloid Leukemia. Mol.
Ther. 2013;21(11):2122–2129.
50. Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signalling.
Nat. Rev. Immunol. 2005;5(5):375.
51. David M, Petricoin E, Benjamin C, et al. Requirement for MAP kinase (ERK2) activity in interferon alpha- and interferon beta-stimulated gene expression through
STAT proteins. Science. 1995;269(5231):1721–1723.
52. Hu J, Roy SK, Shapiro PS, et al. ERK1 and ERK2 activate CCAAAT/enhancer- binding protein-beta-dependent gene transcription in response to interferon-gamma. J.
Biol. Chem. 2001;276(1):287–297.
53. Key LL, Rodriguiz RM, Willi SM, et al. Long-Term Treatment of Osteopetrosis with Recombinant Human Interferon Gamma. N. Engl. J. Med. 1995;332(24):1594–1599.
54. Errante PR, Frazão JB, Condino-Neto A. The use of interferon-gamma therapy in chronic granulomatous disease. Recent Patents Anti-Infect. Drug Disc. 2008;3(3):225–
230.
55. Woodman RC, Erickson RW, Rae J, Jaffe HS, Curnutte JT. Prolonged recombinant interferon-gamma therapy in chronic granulomatous disease: evidence against enhanced neutrophil oxidase activity. Blood. 1992;79(6):1558–1562.
144
56. Smits ELJM, Anguille S, Berneman ZN. Interferon α may be back on track to treat acute myeloid leukemia. OncoImmunology. 2013;2(4):e23619.
57. Lowdell MW, Ray N, Craston R, et al. The in vitro detection of anti-leukaemia- specific cytotoxicity after autologous bone marrow transplantation for acute leukaemia.
Bone Marrow Transplant. 1997;19(9):891–897.
58. Anguille S, Lion E, Willemen Y, et al. Interferon-α in acute myeloid leukemia: an old drug revisited. Leukemia. 2011;25(5):739–748.
59. Davis TA, Grillo-López AJ, White CA, et al. Rituximab anti-CD20 monoclonal antibody therapy in non-Hodgkin’s lymphoma: safety and efficacy of re-treatment. J.
Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 2000;18(17):3135–3143.
60. Basmadjian C, Zhao Q, Bentouhami E, et al. Cancer wars: natural products strike back. Med. Pharm. Chem. 2014;2:20.
61. Siveen KS, Uddin S, Mohammad RM. Targeting acute myeloid leukemia stem cell signaling by natural products. Mol. Cancer. 2017;16:.
62. Guzman ML, Rossi RM, Karnischky L, et al. The sesquiterpene lactone parthenolide induces apoptosis of human acute myelogenous leukemia stem and progenitor cells. Blood. 2005;105(11):4163–4169.
63. Pajak B, Gajkowska B, Orzechowski A. Molecular basis of parthenolide- dependent proapoptotic activity in cancer cells. Folia Histochem. Cytobiol.
2008;46(2):129–135.
64. Kobune M, Takimoto R, Murase K, et al. Drug resistance is dramatically restored by hedgehog inhibitors in CD34+ leukemic cells. Cancer Sci. 2009;100(5):948–955.
145
65. Estrov Z, Shishodia S, Faderl S, et al. Resveratrol blocks interleukin-1beta- induced activation of the nuclear transcription factor NF-kappaB, inhibits proliferation, causes S-phase arrest, and induces apoptosis of acute myeloid leukemia cells. Blood.
2003;102(3):987–995.
66. Hu L, Cao D, Li Y, He Y, Guo K. Resveratrol sensitized leukemia stem cell-like
KG-1a cells to cytokine-induced killer cells-mediated cytolysis through NKG2D ligands and TRAIL receptors. Cancer Biol. Ther. 2012;13(7):516–526.
67. Clynes R, Takechi Y, Moroi Y, Houghton A, Ravetch JV. Fc receptors are required in passive and active immunity to melanoma. Proc. Natl. Acad. Sci. U. S. A.
1998;95(2):652–656.
68. Clynes RA, Towers TL, Presta LG, Ravetch JV. Inhibitory Fc receptors modulate in vivo cytoxicity against tumor targets. Nat. Med. 2000;6(4):443.
69. Daëron M. Fc RECEPTOR BIOLOGY. Annu. Rev. Immunol. 1997;15(1):203–
234.
70. Van den Herik-Oudijk IE, Capel PJ, van der Bruggen T, Van de Winkel JG.
Identification of signaling motifs within human Fc gamma RIIa and Fc gamma RIIb isoforms. Blood. 1995;85(8):2202–2211.
71. Ernst LK, Duchemin AM, Anderson CL. Association of the high-affinity receptor for IgG (Fc gamma RI) with the gamma subunit of the IgE receptor. Proc. Natl. Acad.
Sci. 1993;90(13):6023–6027.
72. Takai T, Li M, Sylvestre D, Clynes R, Ravetch JV. FcR γ chain deletion results in pleiotrophic effector cell defects. Cell. 1994;76(3):519–529.
146
73. Choquet D, Ku G, Cassard S, et al. Different patterns of calcium signaling triggered through two components of the B lymphocyte antigen receptor. J. Biol. Chem.
1994;269(9):6491–6497.
74. Muta T, Kurosaki T, Misulovin Z, et al. A 13-amino-acid motif in the cytoplasmic domain of Fc gamma RIIB modulates B-cell receptor signalling. Nature.
1994;369(6478):340.
75. Ono M, Okada H, Bolland S, et al. Deletion of SHIP or SHP-1 Reveals Two
Distinct Pathways for Inhibitory Signaling. Cell. 1997;90(2):293–301.
76. Chacko GW, Tridandapani S, Damen JE, et al. Negative signaling in B lymphocytes induces tyrosine phosphorylation of the 145-kDa inositol polyphosphate 5- phosphatase, SHIP. J. Immunol. 1996;157(6):2234–2238.
77. Tridandapani S, Pradhan M, LaDine JR, et al. Protein Interactions of Src
Homology 2 (SH2) Domain-Containing Inositol Phosphatase (SHIP): Association with
Shc Displaces SHIP from FcγRIIb in B Cells. J. Immunol. 1999;162(3):1408–1414.
78. Hunter S, Indik ZK, Kim M-K, et al. Inhibition of Fcγ Receptor-Mediated
Phagocytosis by a Nonphagocytic Fcγ Receptor. Blood. 1998;91(5):1762–1768.
79. Clynes R, Maizes JS, Guinamard R, et al. Modulation of Immune Complex– induced Inflammation In Vivo by the Coordinate Expression of Activation and Inhibitory
Fc Receptors. J. Exp. Med. 1999;189(1):179–186.
80. Cox D, Dale BM, Kashiwada M, Helgason CD, Greenberg S. A Regulatory Role for Src Homology 2 Domain–Containing Inositol 5′-Phosphatase (Ship) in Phagocytosis
147
Mediated by Fcγ Receptors and Complement Receptor 3 (αMβ2; Cd11b/Cd18). J. Exp.
Med. 2001;193(1):61–72.
81. Clynes R, Ravetch JV. Cytotoxic antibodies trigger inflammation through Fc receptors. Immunity. 1995;3(1):21–26.
82. Pricop L, Redecha P, Teillaud J-L, et al. Differential Modulation of Stimulatory and Inhibitory Fcγ Receptors on Human Monocytes by Th1 and Th2 Cytokines. J.
Immunol. 2001;166(1):531–537.
83. Vogel SN, Finbloom DS, English KE, Rosenstreich DL, Langreth SG. Interferon- induced enhancement of macrophage Fc receptor expression: beta-interferon treatment of
C3H/HeJ macrophages results in increased numbers and density of Fc receptors. J.
Immunol. 1983;130(3):1210–1214.
84. Guyre PM, Morganelli PM, Miller R. Recombinant immune interferon increases immunoglobulin G Fc receptors on cultured human mononuclear phagocytes. J. Clin.
Invest. 1983;72(1):393–397.
85. Malefyt R de W, Figdor CG, Huijbens R, et al. Effects of IL-13 on phenotype, cytokine production, and cytotoxic function of human monocytes. Comparison with IL-4 and modulation by IFN-gamma or IL-10. J. Immunol. 1993;151(11):6370–6381.
86. Tridandapani S, Siefker K, Teillaud J-L, et al. Regulated Expression and
Inhibitory Function of FcγRIIb in Human Monocytic Cells. J. Biol. Chem.
2002;277(7):5082–5089.
148
87. Joshi T, Ganesan LP, Cao X, Tridandapani S. Molecular analysis of expression and function of hFcγRIIbl and b2 isoforms in myeloid cells. Mol. Immunol.
2006;43(7):839–850.
88. Wijngaarden S, van de Winkel JGJ, Jacobs KMG, et al. A shift in the balance of inhibitory and activating Fcgamma receptors on monocytes toward the inhibitory
Fcgamma receptor IIb is associated with prevention of monocyte activation in rheumatoid arthritis. Arthritis Rheum. 2004;50(12):3878–3887.
89. Tridandapani S, Wang Y, Marsh CB, Anderson CL. Src Homology 2 Domain-
Containing Inositol Polyphosphate Phosphatase Regulates NF-κB-Mediated Gene
Transcription by Phagocytic FcγRs in Human Myeloid Cells. J. Immunol.
2002;169(8):4370–4378.
90. Gavrilin MA, Bouakl IJ, Knatz NL, et al. Internalization and phagosome escape required for Francisella to induce human monocyte IL-1beta processing and release.
Proc. Natl. Acad. Sci. U. S. A. 2006;103(1):141–146.
91. Elavazhagan S, Fatehchand K, Santhanam V, et al. Granzyme B expression is enhanced in human monocytes by TLR8 agonists and contributes to antibody-dependent cellular cytotoxicity. J. Immunol. Baltim. Md 1950. 2015;194(6):2786–2795.
92. Ganesan LP, Fang H, Marsh CB, Tridandapani S. The Protein-tyrosine
Phosphatase SHP-1 Associates with the Phosphorylated Immunoreceptor Tyrosine-based
Activation Motif of FcγRIIa to Modulate Signaling Events in Myeloid Cells. J. Biol.
Chem. 2003;278(37):35710–35717.
149
93. Roon J van, Wijngaarden S, Lafeber FPJG, et al. Interleukin 10 treatment of patients with rheumatoid arthritis enhances Fc gamma receptor expression on monocytes and responsiveness to immune complex stimulation. J. Rheumatol. 2003;30(4):648–651.
94. Bachmair A, Finley D, Varshavsky A. In vivo half-life of a protein is a function of its amino-terminal residue. Science. 1986;234(4773):179–186.
95. Mellman IS, Plutner H, Steinman RM, Unkeless JC, Cohn ZA. Internalization and degradation of macrophage Fc receptors during receptor-mediated phagocytosis. J. Cell
Biol. 1983;96(3):887–895.
96. Steinman RM, Brodie SE, Cohn ZA. Membrane flow during pinocytosis. A stereologic analysis. J. Cell Biol. 1976;68(3):665–687.
97. Ukkonen P, Lewis V, Marsh M, Helenius A, Mellman I. Transport of macrophage
Fc receptors and Fc receptor-bound ligands to lysosomes. J. Exp. Med. 1986;163(4):952–
971.
98. Hör S, Ziv T, Admon A, Lehner PJ. Stable Isotope Labeling by Amino Acids in
Cell Culture and Differential Plasma Membrane Proteome Quantitation Identify New
Substrates for the MARCH9 Transmembrane E3 Ligase. Mol. Cell. Proteomics.
2009;8(8):1959–1971.
99. Yuasa T, Kubo S, Yoshino T, et al. Deletion of Fcγ Receptor IIB Renders H-2b
Mice Susceptible to Collagen-induced Arthritis. J. Exp. Med. 1999;189(1):187–194.
100. Radstake TRDJ, Franke B, Wenink MH, et al. The functional variant of the inhibitory Fcγ receptor IIb (CD32B) is associated with the rate of radiologic joint damage
150 and dendritic cell function in rheumatoid arthritis. Arthritis Rheum. 2006;54(12):3828–
3837.
101. Roghanian A, Teige I, Mårtensson L, et al. Antagonistic Human FcγRIIB
(CD32B) Antibodies Have Anti-Tumor Activity and Overcome Resistance to Antibody
Therapy In Vivo. Cancer Cell. 2015;27(4):473–488.
102. Clague MJ, Urbé S. Ubiquitin: Same Molecule, Different Degradation Pathways.
Cell. 2010;143(5):682–685.
103. Savva A, Roger T. Targeting Toll-Like Receptors: Promising Therapeutic
Strategies for the Management of Sepsis-Associated Pathology and Infectious Diseases.
Front. Immunol. 2013;4:.
104. Duan G, Zhu J, Xu J, Liu Y. Targeting myeloid differentiation 2 for treatment of sepsis. Front. Biosci. Landmark Ed. 2014;19:904–915.
105. Bevaart L. The High-Affinity IgG Receptor, Fc RI, Plays a Central Role in
Antibody Therapy of Experimental Melanoma. Cancer Res. 2006;66(3):1261–1264.
106. Wang S, Astsaturov IA, Bingham CA, et al. Effective antibody therapy induces host-protective antitumor immunity that is augmented by TLR4 agonist treatment.
Cancer Immunol. Immunother. 2012;61(1):49–61.
107. Stein EM, Tallman MS. Emerging therapeutic drugs for AML. Blood.
2016;127(1):71–78.
108. Estey E, Levine RL, Lowenberg B. Current challenges in clinical development of
“targeted therapies”: the case of acute myeloid leukemia. Blood. 2015;125(16):2461–
2466.
151
109. Masoumi-Dehshiri R, Hashemi A, Neamatzadeh H, Zare-Zardeini H. A Case
Report: Acute Myeloid Leukemia (FAB M7). Iran. J. Pediatr. Hematol. Oncol.
2014;4(4):188–190.
110. Löwenberg B, Downing JR, Burnett A. Acute myeloid leukemia. N. Engl. J. Med.
1999;341(14):1051–1062.
111. Thomas ED, Buckner CD, Clift RA, et al. Marrow Transplantation for Acute
Nonlymphoblastic Leukemia in First Remission. N. Engl. J. Med. 1979;301(11):597–599.
112. Curran E, Corrales L, Kline J. Targeting the innate immune system as immunotherapy for acute myeloid leukemia. Tumor Immun. 2015;5:83.
113. Gupta V, Tallman MS, Weisdorf DJ. Allogeneic hematopoietic cell transplantation for adults with acute myeloid leukemia: myths, controversies, and unknowns. Blood. 2011;117(8):2307–2318.
114. Dombret H, Gardin C. An update of current treatments for adult acute myeloid leukemia. Blood. 2016;127(1):53–61.
115. Löwenberg B, Rowe JM. Introduction to the review series on advances in acute myeloid leukemia (AML). Blood. 2016;127(1):1.
116. Kung Sutherland MS, Walter RB, Jeffrey SC, et al. SGN-CD33A: a novel CD33- targeting antibody-drug conjugate using a pyrrolobenzodiazepine dimer is active in models of drug-resistant AML. Blood. 2013;122(8):1455–1463.
117. Cohen AD, Luger SM, Sickles C, et al. Gemtuzumab ozogamicin (Mylotarg) monotherapy for relapsed AML after hematopoietic stem cell transplant: efficacy and
152 incidence of hepatic veno-occlusive disease. Bone Marrow Transplant. 2002;30(1):23–
28.
118. Kell J. The addition of gemtuzumab ozogamicin to chemotherapy in adult patients with acute myeloid leukemia. Expert Rev. Anticancer Ther. 2016;
119. Poel CE van der, Spaapen RM, Winkel JGJ van de, Leusen JHW. Functional
Characteristics of the High Affinity IgG Receptor, FcγRI. J. Immunol.
2011;186(5):2699–2704.
120. Zhong RK, van de Winkel JG, Thepen T, Schultz LD, Ball ED. Cytotoxicity of anti-CD64-ricin a chain immunotoxin against human acute myeloid leukemia cells in vitro and in SCID mice. J. Hematother. Stem Cell Res. 2001;10(1):95–105.
121. Ravetch JV, Clynes and RA. DIVERGENT ROLES FOR Fc RECEPTORS AND
COMPLEMENT IN VIVO. Annu. Rev. Immunol. 1998;16(1):421–432.
122. Keyhani A, Huh YO, Jendiroba D, et al. Increased CD38 expression is associated with favorable prognosis in adult acute leukemia. Leuk. Res. 2000;24(2):153–159.
123. Lokhorst HM, Plesner T, Laubach JP, et al. Targeting CD38 with Daratumumab
Monotherapy in Multiple Myeloma. N. Engl. J. Med. 2015;373(13):1207–1219.
124. van de Donk NWCJ, Janmaat ML, Mutis T, et al. Monoclonal antibodies targeting
CD38 in hematological malignancies and beyond. Immunol. Rev. 2016;270(1):95–112.
125. de Weers M, Tai Y-T, van der Veer MS, et al. Daratumumab, a novel therapeutic human CD38 monoclonal antibody, induces killing of multiple myeloma and other hematological tumors. J. Immunol. Baltim. Md 1950. 2011;186(3):1840–1848.
153
126. Ranganathan P, Yu X, Na C, et al. Preclinical activity of a novel CRM1 inhibitor in acute myeloid leukemia. Blood. 2012;120(9):1765–1773.
127. Tomayko MM, Reynolds CP. Determination of subcutaneous tumor size in athymic (nude) mice. Cancer Chemother. Pharmacol. 1989;24(3):148–154.
128. Quatromoni JG, Eruslanov E. Tumor-associated macrophages: function, phenotype, and link to prognosis in human lung cancer. Am. J. Transl. Res.
2012;4(4):376–389.
129. Heusinkveld M, van der Burg SH. Identification and manipulation of tumor associated macrophages in human cancers. J. Transl. Med. 2011;9:216.
130. Mosser DM. The many faces of macrophage activation. J. Leukoc. Biol.
2003;73(2):209–212.
131. Costello RT, Mallet F, Sainty D, et al. Regulation of CD80/B7-1 and CD86/B7-2 molecule expression in human primary acute myeloid leukemia and their role in allogenic immune recognition. Eur. J. Immunol. 1998;28(1):90–103.
132. Madera S, Rapp M, Firth MA, et al. Type I IFN promotes NK cell expansion during viral infection by protecting NK cells against fratricide. J. Exp. Med.
2016;213(2):225–233.
133. Nakamura K, Nakayama M, Kawano M, et al. NK-cell fratricide: Dynamic crosstalk between NK and cancer cells. Oncoimmunology. 2013;2(11):e26529.
134. Hoves S, Trapani JA, Voskoboinik I. The battlefield of perforin/granzyme cell death pathways. J. Leukoc. Biol. 2010;87(2):237–243.
154
135. Shultz LD, Schweitzer PA, Christianson SW, et al. Multiple defects in innate and adaptive immunologic function in NOD/LtSz-scid mice. J. Immunol. Baltim. Md 1950.
1995;154(1):180–191.
136. Graziano RF, Fanger MW. Fc gamma RI and Fc gamma RII on monocytes and granulocytes are cytotoxic trigger molecules for tumor cells. J. Immunol. Baltim. Md
1950. 1987;139(10):3536–3541.
137. Funaro A, Morra M, Calosso L, et al. Role of the human CD38 molecule in B cell activation and proliferation. Tissue Antigens. 1997;49(1):7–15.
138. Moreno-García ME, López-Bojórques LN, Zentella A, et al. CD38 Signaling
Regulates B Lymphocyte Activation via a Phospholipase C (PLC)-γ2-Independent,
Protein Kinase C, Phosphatidylcholine-PLC, and Phospholipase D-Dependent Signaling
Cascade. J. Immunol. 2005;174(5):2687–2695.
139. Nijhof IS, Groen RWJ, Lokhorst HM, et al. Upregulation of CD38 expression on multiple myeloma cells by all-trans retinoic acid improves the efficacy of daratumumab.
Leukemia. 2015;29(10):2039–2049.
140. Breitman TR, Collins SJ, Keene BR. Terminal differentiation of human promyelocytic leukemic cells in primary culture in response to retinoic acid. Blood.
1981;57(6):1000–1004.
141. Wang ZY, Chen Z. Differentiation and apoptosis induction therapy in acute promyelocytic leukaemia. Lancet Oncol. 2000;1:101–106.
155
142. Marciano BE, Wesley R, De Carlo ES, et al. Long-term interferon-gamma therapy for patients with chronic granulomatous disease. Clin. Infect. Dis. Off. Publ.
Infect. Dis. Soc. Am. 2004;39(5):692–699.
143. Nunoi H, Ishibashi F, Mizukami T, Hidaka F. Clinical evaluation of interferon- gamma treatment to chronic granulomatous disease patients with splice site mutations.
Jpn. J. Infect. Dis. 2004;57(5):S25-26.
144. Wilson CJ, Vellodi A. Autosomal recessive osteopetrosis: diagnosis, management, and outcome. Arch. Dis. Child. 2000;83(5):449–452.
145. Bong AB, Bonnekoh B, Franke I, et al. Imiquimod, a topical immune response modifier, in the treatment of cutaneous metastases of malignant melanoma. Dermatol.
Basel Switz. 2002;205(2):135–138.
146. So EY, Ouchi T. The application of Toll like receptors for cancer therapy. Int. J.
Biol. Sci. 2010;6(7):675–681.
147. Adib-Conquy M, Scott-Algara D, Cavaillon J-M, Souza-Fonseca-Guimaraes F.
TLR-mediated activation of NK cells and their role in bacterial/viral immune responses in mammals. Immunol. Cell Biol. 2014;92(3):256–262.
148. Montgomery GL. THE COLLECTED PAPERS OF PAUL EHRLICH. Compiled and edited by F. Himmelweit. Pp. VIII + 653. London and New York: Pergamon Press.
1956. Four volumes £28. Q. J. Exp. Physiol. Cogn. Med. Sci. 1957;42(3):322–323.
149. Ueber den jetzigen Stand der Karzinomforschung. Ned. Tijdschr. Geneeskd.
2009;
156
150. Ichim CV. Revisiting immunosurveillance and immunostimulation: Implications for cancer immunotherapy. J. Transl. Med. 2005;3:8.
151. Janssen LME, Ramsay EE, Logsdon CD, Overwijk WW. The immune system in cancer metastasis: friend or foe? J. Immunother. Cancer. 2017;5:79.
152. Swiecki M, Colonna M. The multifaceted biology of plasmacytoid dendritic cells.
Nat. Rev. Immunol. 2015;15(8):471.
153. Swiecki M, Colonna M. Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance. Immunol. Rev. 2010;234(1):142–
162.
154. Liu Y-J. IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu. Rev. Immunol. 2005;23:275–306.
155. Gilliet M, Cao W, Liu Y-J. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat. Rev. Immunol. 2008;8(8):594–606.
156. Ito T, Wang Y-H, Liu Y-J. Plasmacytoid dendritic cell precursors/type I interferon-producing cells sense viral infection by Toll-like receptor (TLR) 7 and TLR9.
Springer Semin. Immunopathol. 2005;26(3):221–229.
157. Decalf J, Fernandes S, Longman R, et al. Plasmacytoid dendritic cells initiate a complex chemokine and cytokine network and are a viable drug target in chronic HCV patients. J. Exp. Med. 2007;204(10):2423–2437.
158. Plasmacytoid dendritic cells and cancer.
157
159. Rickmann M, Krauter J, Stamer K, et al. Elevated frequencies of leukemic myeloid and plasmacytoid dendritic cells in acute myeloid leukemia with the FLT3 internal tandem duplication. Ann. Hematol. 2011;90(9):1047–1058.
160. Akira S, Hemmi H. Recognition of pathogen-associated molecular patterns by
TLR family. Immunol. Lett. 2003;85(2):85–95.
161. Martinson JA, Roman-Gonzalez A, Tenorio AR, et al. Dendritic Cells from HIV-
1 Infected Individuals are Less Responsive to Toll-like Receptor (TLR) Ligands. Cell.
Immunol. 2007;250(1–2):75–84.
162. Carter BZ, Mak DH, Schober WD, et al. Triptolide sensitizes AML cells to
TRAIL-induced apoptosis via decrease of XIAP and p53-mediated increase of DR5.
Blood. 2008;111(7):3742–3750.
163. Fatehchand K, McMichael EL, Reader BF, et al. Interferon-γ Promotes Antibody- mediated Fratricide of Acute Myeloid Leukemia Cells. J. Biol. Chem.
2016;291(49):25656–25666.
164. Fatehchand K, Ren L, Elavazhagan S, et al. Toll-like Receptor 4 Ligands Down- regulate Fcγ Receptor IIb (FcγRIIb) via MARCH3 Protein-mediated Ubiquitination. J.
Biol. Chem. 2016;291(8):3895–3904.
165. Mehta P, Wavreille A-S, Justiniano SE, et al. LyGDI, a Novel SHIP-Interacting
Protein, Is a Negative Regulator of FcγR-Mediated Phagocytosis. PLOS ONE.
2011;6(6):e21175.
166. Chen K, Liu J, Cao X. Regulation of type I interferon signaling in immunity and inflammation: A comprehensive review. J. Autoimmun. 2017;83(Supplement C):1–11.
158
167. Fatehchand K, McMichael EL, Reader BF, et al. Interferon-γ promotes antibody- mediated fratricide of Acute Myeloid Leukemia cells. J. Biol. Chem. 2016;
168. Shlush LI, Mitchell A, Heisler L, et al. Tracing the origins of relapse in acute myeloid leukaemia to stem cells. Nature. 2017;547(7661):104–108.
169. Ding Y, Gao H, Zhang Q. The biomarkers of leukemia stem cells in acute myeloid leukemia. Stem Cell Investig. 2017;4:.
170. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 1997;3(7):730–737.
171. Chaperot L, Blum A, Manches O, et al. Virus or TLR agonists induce TRAIL- mediated cytotoxic activity of plasmacytoid dendritic cells. J. Immunol. Baltim. Md 1950.
2006;176(1):248–255.
172. Stary G, Bangert C, Tauber M, et al. Tumoricidal activity of TLR7/8-activated inflammatory dendritic cells. J. Exp. Med. 2007;204(6):1441–1451.
173. Liu Q. Triptolide and its expanding multiple pharmacological functions. Int.
Immunopharmacol. 2011;11(3):377–383.
174. Banerjee S, Saluja A. Minnelide, a novel drug for pancreatic and liver cancer.
Pancreatol. Off. J. Int. Assoc. Pancreatol. IAP Al. 2015;15(0):S39–S43.
175. Tel J, Schreibelt G, Sittig SP, et al. Human plasmacytoid dendritic cells efficiently cross-present exogenous Ags to CD8+ T cells despite lower Ag uptake than myeloid dendritic cell subsets. Blood. 2013;121(3):459–467.
176. Mathan TSM, Figdor CG, Buschow SI. Human Plasmacytoid Dendritic Cells:
From Molecules to Intercellular Communication Network. Front. Immunol. 2013;4:.
159
177. Fonteneau J-F, Gilliet M, Larsson M, et al. Activation of influenza virus-specific
CD4+ and CD8+ T cells: a new role for plasmacytoid dendritic cells in adaptive immunity. Blood. 2003;101(9):3520–3526.
178. Jego G, Palucka AK, Blanck J-P, et al. Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity.
2003;19(2):225–234.
179. Donhauser N, Pritschet K, Helm M, et al. Chronic Immune Activation in HIV-1
Infection Contributes to Reduced Interferon Alpha Production via Enhanced CD40:CD40
Ligand Interaction. PLOS ONE. 2012;7(3):e33925.
180. García-Marquez M, Shimabukuro-Vornhagen A, von Bergwelt-Baildon M.
Complex interactions between B cells and dendritic cells. Blood. 2013;121(12):2367–
2368.
181. Cao W, Rosen DB, Ito T, et al. Plasmacytoid dendritic cell–specific receptor
ILT7–FcεRIγ inhibits Toll-like receptor–induced interferon production. J. Exp. Med.
2006;203(6):1399–1405.
182. Up-regulation of bone marrow stromal protein 2 (BST2) in breast cancer with bone metastasis | BMC Cancer | Full Text.
183. HM1.24 (CD317) is a novel target against lung cancer for immunotherapy using anti-HM1.24 antibody. - PubMed - NCBI.
184. Damasio EE, Clavio M, Masoudi B, et al. Alpha-interferon as induction and maintenance therapy in hairy cell leukemia: a long-term follow-up analysis. Eur. J.
Haematol. 2000;64(1):47–52.
160
185. Kujawski LA, Talpaz M. The role of interferon-alpha in the treatment of chronic myeloid leukemia. Cytokine Growth Factor Rev. 2007;18(5–6):459–471.
186. Kiladjian J-J, Chomienne C, Fenaux P. Interferon-alpha therapy in bcr-abl- negative myeloproliferative neoplasms. Leukemia. 2008;22(11):1990–1998.
187. Berneman ZN, Anguille S, Van Marck V, Schroyens WA, Van Tendeloo VF.
Induction of complete remission of acute myeloid leukaemia by pegylated interferon- alpha-2a in a patient with transformed primary myelofibrosis. Br. J. Haematol.
2010;149(1):152–155.
188. Dagorne A, Douet-Guilbert N, Quintin-Roue I, et al. Pegylated interferon α2a induces complete remission of acute myeloid leukemia in a postessential thrombocythemia myelofibrosis permitting allogenic stem cell transplantation. Ann.
Hematol. 2013;92(3):407–409.
189. Ferrantini M, Capone I, Belardelli F. Interferon-alpha and cancer: mechanisms of action and new perspectives of clinical use. Biochimie. 2007;89(6–7):884–893.
190. Le Bon A, Tough DF. Type I interferon as a stimulus for cross-priming. Cytokine
Growth Factor Rev. 2008;19(1):33–40.
191. Watanabe N, Narita M, Yokoyama A, et al. Type I IFN-mediated enhancement of anti-leukemic cytotoxicity of gammadelta T cells expanded from peripheral blood cells by stimulation with zoledronate. Cytotherapy. 2006;8(2):118–129.
192. Benjamin R, Khwaja A, Singh N, et al. Continuous delivery of human type I interferons (α/β) has significant activity against acute myeloid leukemia cells in vitro and in a xenograft model. Blood. 2007;109(3):1244–1247.
161
193. Luxon BA, Grace M, Brassard D, Bordens R. Pegylated interferons for the treatment of chronic hepatitis C infection. Clin. Ther. 2002;24(9):1363–1383.
194. Marcellin P, Lau GKK, Bonino F, et al. Peginterferon alfa-2a alone, lamivudine alone, and the two in combination in patients with HBeAg-negative chronic hepatitis B.
N. Engl. J. Med. 2004;351(12):1206–1217.
195. Fried MW, Shiffman ML, Reddy KR, et al. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N. Engl. J. Med. 2002;347(13):975–982.
196. Kieseier BC, Calabresi PA. PEGylation of interferon-β-1a: a promising strategy in multiple sclerosis. CNS Drugs. 2012;26(3):205–214.
197. Mallet J-F, Graham É, Ritz BW, Homma K, Matar C. Active Hexose Correlated
Compound (AHCC) promotes an intestinal immune response in BALB/c mice and in primary intestinal epithelial cell culture involving toll-like receptors TLR-2 and TLR-4.
Eur. J. Nutr. 2016;55(1):139–146.
198. Daddaoua A, Martínez-Plata E, Ortega-González M, et al. The nutritional supplement Active Hexose Correlated Compound (AHCC) has direct immunomodulatory actions on intestinal epithelial cells and macrophages involving TLR/MyD88 and NF-
κB/MAPK activation. Food Chem. 2013;136(3–4):1288–1295.
199. Gao Y, Zhang D, Sun B, et al. Active hexose correlated compound enhances tumor surveillance through regulating both innate and adaptive immune responses.
Cancer Immunol. Immunother. CII. 2006;55(10):1258–1266.
162
200. Matsui Y, Uhara J, Satoi S, et al. Improved prognosis of postoperative hepatocellular carcinoma patients when treated with functional foods: a prospective cohort study. J. Hepatol. 2002;37(1):78–86.
201. Matsushita K, Kuramitsu Y, Ohiro Y, et al. Combination therapy of active hexose correlated compound plus UFT significantly reduces the metastasis of rat mammary adenocarcinoma. Anticancer. Drugs. 1998;9(4):343–350.
202. Ignacio RM, Kim C-S, Kim Y-D, et al. Therapeutic effect of Active Hexose-
Correlated Compound (AHCC) combined with CpG-ODN (oligodeoxynucleotide) in B16 melanoma murine model. Cytokine. 2015;76(2):131–137.
203. Vetvicka V, Vetvickova J. Immune-enhancing effects of Maitake (Grifola frondosa) and Shiitake (Lentinula edodes) extracts. Ann. Transl. Med. 2014;2(2):14.
204. Cowawintaweewat S, Manoromana S, Sriplung H, et al. Prognostic improvement of patients with advanced liver cancer after active hexose correlated compound (AHCC) treatment. Asian Pac. J. Allergy Immunol. Launched Allergy Immunol. Soc. Thail.
2006;24(1):33–45.
205. Parida DK, Wakame K, Nomura T. Integrating Complimentary and Alternative
Medicine in Form of Active Hexose Co-Related Compound (AHCC) in the Management of Head & Neck Cancer Patients. Int. J. Clin. Med. 2011;02(05):588.
206. Ishizuka R, Fujii H, Miura T, Fukuchi Y, Tajima K. Personalized cancer therapy for stage IV non-small cell lung cancer: Combined use of active hexose correlated compound and genistein concentrated polysaccharide. Pers. Med. Universe.
2012;1(1):39–44.
163
207. Tokunaga M, Baron B, Kitagawa T, Tokuda K, Kuramitsu Y. Active Hexose- correlated Compound Down-regulates Heat Shock Factor 1, a Transcription Factor for
HSP27, in Gemcitabine-resistant Human Pancreatic Cancer Cells. Anticancer Res.
2015;35(11):6063–6067.
208. Ritz BW, Nogusa S, Ackerman EA, Gardner EM. Supplementation with active hexose correlated compound increases the innate immune response of young mice to primary influenza infection. J. Nutr. 2006;136(11):2868–2873.
209. Belay T, Fu C-L, Woart A. Active Hexose Correlated Compound Activates
Immune Function to Decrease Chlamydia trachomatis Shedding in a Murine Stress
Model. J. Nutr. Med. Diet Care. 2015;1(1):.
210. Lee W-W, Lee N, Fujii H, Kang I. Active Hexose Correlated Compound promotes T helper (Th) 17 and 1 cell responses via inducing IL-1β production from monocytes in humans. Cell. Immunol. 2012;275(1–2):19–23.
211. Nakao M, Yokota S, Iwai T, et al. Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia. 1996;10(12):1911–1918.
212. Mrózek K, Marcucci G, Nicolet D, et al. Prognostic significance of the European
LeukemiaNet standardized system for reporting cytogenetic and molecular alterations in adults with acute myeloid leukemia. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol.
2012;30(36):4515–4523.
213. Stromal cells prevent apoptosis of AML cells by up-regulation of anti-apoptotic proteins.
164
214. Porter AG. Flipping the safety catch of procaspase-3. Nat. Chem. Biol.
2006;2(10):509–510.
215. McDonnell MA, Wang D, Khan SM, Vander Heiden MG, Kelekar A. Caspase-9 is activated in a cytochrome c-independent manner early during TNFα-induced apoptosis in murine cells. Cell Death Differ. 2003;10(9):1005–1015.
216. Ichim G, Tait SWG. A fate worse than death: apoptosis as an oncogenic process.
Nat. Rev. Cancer. 2016;16(8):539–548.
217. Chang DW, Xing Z, Capacio VL, Peter ME, Yang X. Interdimer processing mechanism of procaspase!8 activation. EMBO J. 2003;22(16):4132–4142.
218. Hughes MA, Harper N, Butterworth M, et al. Reconstitution of the Death-
Inducing Signaling Complex Reveals a Substrate Switch that Determines CD95-
Mediated Death or Survival. Mol. Cell. 2009;35(3):265–279.
219. Riedl SJ, Shi Y. Molecular mechanisms of caspase regulation during apoptosis.
Nat. Rev. Mol. Cell Biol. 2004;5(11):897–907.
220. McIlwain DR, Berger T, Mak TW. Caspase Functions in Cell Death and Disease.
Cold Spring Harb. Perspect. Biol. 2013;5(4):a008656.
221. Cellular Mechanisms Controlling Caspase Activation and Function.
222. Spierings ELH, Fujii H, Sun B, Walshe T. A Phase I study of the safety of the nutritional supplement, active hexose correlated compound, AHCC, in healthy volunteers. J. Nutr. Sci. Vitaminol. (Tokyo). 2007;53(6):536–539.
165
223. Cao Z, Chen X, Lan L, et al. Active hexose correlated compound potentiates the antitumor effects of low-dose 5-fluorouracil through modulation of immune function in hepatoma 22 tumor-bearing mice. Nutr. Res. Pract. 2015;9(2):129–136.
224. Daddaoua A, Martínez-Plata E, López-Posadas R, et al. Active hexose correlated compound acts as a prebiotic and is antiinflammatory in rats with hapten-induced colitis.
J. Nutr. 2007;137(5):1222–1228.
225. Aviles H, O’Donnell P, Orshal J, et al. Active hexose correlated compound activates immune function to decrease bacterial load in a murine model of intramuscular infection. Am. J. Surg. 2008;195(4):537–545.
226. Shigama K, Nakaya A, Wakame K, Nishioka H, Fujii H. Alleviating effect of active hexose correlated compound (AHCC) for anticancer drug-induced side effects in non-tumor-bearing mice. J. Exp. Ther. Oncol. 2009;8(1):43–51.
227. Hangai S, Iwase S, Kawaguchi T, et al. Effect of active hexose-correlated compound in women receiving adjuvant chemotherapy for breast cancer: a retrospective study. J. Altern. Complement. Med. N. Y. N. 2013;19(11):905–910.
228. Ito T, Urushima H, Sakaue M, et al. Reduction of adverse effects by a mushroom product, active hexose correlated compound (AHCC) in patients with advanced cancer during chemotherapy--the significance of the levels of HHV-6 DNA in saliva as a surrogate biomarker during chemotherapy. Nutr. Cancer. 2014;66(3):377–382.
229. Yanagimoto H, Satoi S, Yamamoto T, et al. Alleviating Effect of Active Hexose
Correlated Compound (AHCC) on Chemotherapy-Related Adverse Events in Patients
166 with Unresectable Pancreatic Ductal Adenocarcinoma. Nutr. Cancer. 2016;68(2):234–
240.
230. Cruijsen M, Lübbert M, Wijermans P, Huls G. Clinical Results of
Hypomethylating Agents in AML Treatment. J. Clin. Med. 2014;4(1):1–17.
231. Amoêdo ND, Valencia JP, Rodrigues MF, Galina A, Rumjanek FD. How does the metabolism of tumour cells differ from that of normal cells. Biosci. Rep. 2013;33(6):.
232. Kojima K, Konopleva M, Tsao T, et al. Selective FLT3 inhibitor FI-700 neutralizes Mcl-1 and enhances p53-mediated apoptosis in AML cells with activating mutations of FLT3 through Mcl-1/Noxa axis. Leukemia. 2009;24(1):33–43.
233. Inhibition of FLT3 Expression by Green Tea Catechins in FLT3 Mutated-AML
Cells.
234. Quentmeier H, Martelli MP, Dirks WG, et al. Cell line OCI/AML3 bears exon-12
NPM gene mutation-A and cytoplasmic expression of nucleophosmin. Leukemia.
2005;19(10):1760–1767.
235. Odero MD, Zeleznik-Le NJ, Chinwalla V, Rowley JD. Cytogenetic and molecular analysis of the acute monocytic leukemia cell line THP-1 with an MLL-AF9 translocation. Genes. Chromosomes Cancer. 2000;29(4):333–338.
236. Stavropoulou V, Kaspar S, Brault L, et al. MLL-AF9 Expression in
Hematopoietic Stem Cells Drives a Highly Invasive AML Expressing EMT-Related
Genes Linked to Poor Outcome. Cancer Cell. 2016;30(1):43–58.
237. Matsuo Y, MacLeod RA, Uphoff CC, et al. Two acute monocytic leukemia
(AML-M5a) cell lines (MOLM-13 and MOLM-14) with interclonal phenotypic
167 heterogeneity showing MLL-AF9 fusion resulting from an occult chromosome insertion, ins(11;9)(q23;p22p23). Leukemia. 1997;11(9):1469–1477.
238. Andersson A, Edén P, Lindgren D, et al. Gene expression profiling of leukemic cell lines reveals conserved molecular signatures among subtypes with specific genetic aberrations. Leukemia. 2005;19(6):1042–1050.
239. Goldszmid RS, Dzutsev A, Trinchieri G. Host immune response to infection and cancer: unexpected commonalities. Cell Host Microbe. 2014;15(3):295–305.
240. Meng F, Lowell CA. Lipopolysaccharide (LPS)-induced Macrophage Activation and Signal Transduction in the Absence of Src-Family Kinases Hck, Fgr, and Lyn. J.
Exp. Med. 1997;185(9):1661–1670.
241. Cohen S b., Gaskins C, Nasoff M s. Generation of a Monoclonal Antibody
Agonist to Toll-Like Receptor 4. Hybridoma. 2005;24(1):27–35.
242. Zhang C, Liu J, Zhong JF, Zhang X. Engineering CAR-T cells. Biomark. Res.
2017;5:.
243. CAR T Cell Therapy: A Game Changer in Cancer Treatment.
244. Klingemann H, Boissel L, Toneguzzo F. Natural Killer Cells for Immunotherapy
– Advantages of the NK-92 Cell Line over Blood NK Cells. Front. Immunol. 2016;7:.
245. Bonifant CL, Jackson HJ, Brentjens RJ, Curran KJ. Toxicity and management in
CAR T-cell therapy. Mol. Ther. - Oncolytics. 2016;3:16011.
246. Dai X, Jayapal M, Tay HK, et al. Differential signal transduction, membrane trafficking, and immune effector functions mediated by FcgammaRI versus
FcgammaRIIa. Blood. 2009;114(2):318–327.
168
247. Clinical Use of Interferon-γ - Miller - 2009 - Annals of the New York Academy of Sciences - Wiley Online Library.
248. Sriskandan K, Garner P, Watkinson J, et al. A toxicity study of recombinant interferon-gamma given by intravenous infusion to patients with advanced cancer.
Cancer Chemother. Pharmacol. 1986;18(1):63–68.
249. Chelius D, Ruf P, Plöscher M, et al. Structural and functional characterization of the trifunctional antibody catumaxomab. mAbs. 2010;2(3):309–319.
250. Blair A, Hogge DE, Sutherland HJ. Most acute myeloid leukemia progenitor cells with long-term proliferative ability in vitro and in vivo have the phenotype
CD34(+)/CD71(-)/HLA-DR-. Blood. 1998;92(11):4325–4335.
251. Taussig DC, Miraki-Moud F, Anjos-Afonso F, et al. Anti-CD38 antibody- mediated clearance of human repopulating cells masks the heterogeneity of leukemia- initiating cells. Blood. 2008;112(3):568–575.
252. Kersten B, Valkering M, Wouters R, et al. CD45RA, a specific marker for leukaemia stem cell sub-populations in acute myeloid leukaemia. Br. J. Haematol.
2016;173(2):219–235.
253. Thomas D, Majeti R. Biology and relevance of human acute myeloid leukemia stem cells. Blood. 2017;129(12):1577–1585.
254. Saito Y, Kitamura H, Hijikata A, et al. Identification of Therapeutic Targets for
Quiescent, Chemotherapy-Resistant Human Leukemia Stem Cells. Sci. Transl. Med.
2010;2(17):17ra9.
169