Equine Clinic Head: Ao.Univ.-Prof. Dr.med.vet. Christine Aurich Department for Companion Animals and Horses University of Veterinary Medicine, Vienna

Subject: Equine Surgery

POSSIBLE INVOLVEMENT OF HERPESVIRUS AND TREPONEMA

IN PERIODONTAL DISEASE OF THE ANTERIOR DENTITION IN

HORSES

INAUGURAL-DOCTORAL THESIS

for promotion to

DOCTOR MEDICINAE VETERINARIAE

at the University of Veterinary Medicine, Vienna

Presented by Katharina Pieber, Mag.med.vet. Vienna, October 2012 Academic Supervisor: O. Univ. Prof. Dr. med. vet. Christian Stanek Assistent Supervisor: Dipl.-Ing. Dr. Sabine Brandt Assistent Supervisor: Ass.Prof. Dr. Hubert Simhofer Reviewer: Prof. Dr. Carsten Staszyk

Keywords: horse, periodontitis, EOTRH, hypercementosis, resorption Contents

Contents

List of Abbreviations vi

I. Review of literature 1

1. The microbiome of the human oral cavity 1

1.1. Normal bacterial flora in humans ...... 1

1.2. Saliva as sampling fluid ...... 2

2. Periodontal disease 2

2.1. Definition ...... 2

2.2. Pathogenesis of periodontal disease ...... 2

2.3. Classification of periodontal disease ...... 3

2.4. Progression of periodontal disease ...... 3

2.5. Risk factors ...... 5

2.6. Diagnosing periodontal disease ...... 6

2.7. Measuring periodontal indices ...... 6

2.8. Other factors leading to diagnosis ...... 7

2.9. Prevalence of periodontal disease ...... 7

2.10. Therapy of periodontal disease ...... 8

3. Pathogens in the oral cavity of periodontitis-affected patients 8

3.1. Bacteria ...... 8

3.2. Viruses ...... 11

4. The normal oral microbiome in horses 12

5. Periodontal disease in horses 13

5.1. Risk factors for periodontal disease in equines ...... 13

5.2. Clinical symptoms of periodontal disease ...... 13

5.3. Grading of periodontal disease in horses ...... 13

iii Contents

5.4. Comparing human and equine periodontal disease ...... 14

5.5. Bacteria in the equine oral cavity with periodontal disease ...... 15

5.6. Treatment of periodontal disease in horses ...... 15

6. EOTRH 16

6.1. Definition ...... 16

6.2. Risk factors for EOTRH ...... 16

6.3. Clinical symptoms ...... 16

6.4. Radiological signs ...... 17

6.5. Aetiology of EOTRH ...... 18

6.6. Histological features of EOTRH ...... 20

6.7. Treatment of EOTRH ...... 20

7. Treponemes 22

7.1. Characterisation of Treponemes ...... 22

7.2. Diseases caused by treponemes ...... 22

7.3. Treponemes in human periodontal disease ...... 23

II. Hypotheses and objectives 25

III. Material and Methods 26

8. Clinical evaluation 26

8.1. General examination of horses ...... 26

8.2. Oral examination ...... 26

8.3. Radiological examination ...... 27

8.4. Animals ...... 27

8.5. Sampling of crevicular fluid/saliva...... 27

9. Molecular genetic methods 28

9.1. Sample processing ...... 28

iv Contents

9.2. PCR for detection of herpesviruses ...... 31

9.3. Detection of Treponema sp...... 32

9.4. Sequence analysis ...... 32

IV. Results 33

10. Information provided by owners 33

11. Clinical findings 34

11.1. General findings ...... 34

11.2. Dental disease-related findings ...... 35

11.3. Radiological findings ...... 37

12. Molecular biological findings 40

V. Discussion 45

VI. Summary 52

VII. Zusammenfassung 53

Bibliography 54

List of Figures 63

List of Tables 64

VIII. Acknowledgements 65

v List of Abbreviations

List of Abbreviations

ACTH ...... Adrenocorticotropic hormone

AST...... Aspartate aminotransferase

AT ...... Annealing temperatures

BHV ...... Bovine herpesvirus

BLAST ...... Basic Local Alignment Search Tool

BOP...... Bleeding on probing

bp ...... Basepairs

BVH-1 ...... Bovine herpesvirus type 1

BVH-2 ...... Bovine herpesvirus type 3

BVH-4 ...... Bovine herpesvirus type 4

BVH-5 ...... Bovine herpesvirus type 5

C ...... Control horse

CAL...... Clinical attachment loss

CMV ...... Cytomegalovirus

D ...... Dentine

DD ...... Digital dermatitis

DNA ...... Deoxyribonucleic acid

DNS...... German: Desoxyribonukleinsaure¨

e.g...... Forexample

EBV...... Epstein-Barr-Virus

EDTA ...... Ethylenediaminetetraacetic acid

EGUS ...... Equine Gastric Ulcer Syndrome

EHV...... Equine herpesvirus

EMS...... Equine Metabolic Syndrome

EOTRH...... Equine odontoclastic tooth resorption and hypercementosis

ET ...... Elongation temperatures

EVH-1 ...... Equine herpesvirus type 1

EVH-21 ...... Equine herpesvirus type 2

vi List of Abbreviations

EVH-3 ...... Equine herpesvirus type 3

EVH-4 ...... Equine herpesvirus type 4

EVH-5 ...... Equine herpesvirus type 5

F ...... Further EOTRH-affected horse

GCF...... Gingival crevicular fluid

H2S ...... Hydrogen sulphide HIV ...... Human immunodeficiency virus

HIV-1...... Human immunodeficiency virus type 1 i.e...... That is i.v...... Intravenous

ID...... Identification

IL-1α ...... Interleukin 1 alpha

IL-1β ...... Interleukin 1 beta irC ...... Irregular Cement

LLD...... Lamina dura dentis

M ...... Moderate m ...... Mild mm...... Millimetre

MMP...... Matrix metalloproteinases mRNA...... Messenger RNA n ...... No nC...... Normal Cement nr ...... Number nT...... Necrotic Tissue ntc ...... No-template control

P ...... Patient horse

PCR...... Polymerase chain reaction

PD ...... Pocket depth

PDL...... Periodontal ligament

vii List of Abbreviations

PGE2 ...... Prostaglandin E2 rads ...... Radiographs

RAO...... Recurrent airway obstruction

RNA...... Ribonucleic acid

RT-PCR ...... Reverse transcription PCR

S ...... Severe

SD ...... Standard deviation sIg ...... Secretory Immunoglobulin sIgA ...... Secretory Immunoglobulin A sIgM ...... Secretory Immunoglobulin M

T...... Treponema

TAE ...... Tris-Acetate-EDTA

TNF-α ...... Tumour necrosis factor-alpha vc ...... Vascular channel

Vetmeduni ...... Veterinary University

WNL ...... Within normal limits y ...... Yes

viii Part I. Review of literature

Part I.

Review of literature

1. The microbiome of the human oral cavity

1.1. Normal bacterial flora in humans

The healthy oral cavity is a habitat for numerous microorganisms. Bacteria and viruses, but also fungi and archaes can be found. Over the past few decades, knowledge on these microorganisms has dramat- ically improved. To date, about 700 different microbial species are known to reside in the human oral cavity (AAS et al., 2005), consisting of mainly anaerobic bacteria, fungi and protozoa. It is estimated that

34 to 72 different species can be found in the oral cavity of one individual. Their distribution is variable, depending on the localization within the oral cavity (AAS et al., 2005). Most of the microorganisms live in subgingival pockets; others are compounds of the supragingival bacterial biofilm (FABIAN et al.,

2008). Some of the individual variations regarding compositions of the microflora can by explained by cultural factors and age; other factors still remain to be elucidated.

Little is known about the microbiome of the healthy oral cavity because most studies focus on pa- tients suffering from various dental/gingival oral diseases (SAKAMOTO et al., 2000; AAS et al., 2005;

FABIAN et al., 2008). AAS et al. (2005) have detected 141 different bacterial taxa representing six dif- ferent bacterial phyla in only five patients, with thirteen new phylotypes being identified. Remarkable,

60 to 99 % of detected bacteria are not cultivable so far (FABIAN et al., 2008).

Knowledge of the oral microbiome in healthy patients is crucial as it paves the way for a better un- derstanding of the pathogenic impact of bacterial infection in patients with oral disease. It is accepted to date that the oral microbiome of healthy and diseased individuals differs substantially (AAS et al., 2005).

Bacteria, which are currently known to be associated with periodontal disease in man, are those of the so called “red complex”, i.e. Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, which are only rarely detected in healthy individuals (BYRNE et al., 2009).

1 Part I. Review of literature

1.2. Saliva as sampling fluid

Saliva is often used as a sampling fluid. It circulates in the oral cavity and takes along microorganisms crowding the mucosal surfaces. Despite of its antimicrobial properties, saliva has been shown to harbour high numbers of bacteria that are able to survive or even grow in this apparently unfavourable environ- ment (BOUTAGA et al., 2007). The microbial composition of saliva varies according to the sampling site (AAS et al., 2005). Technically, molecular biological methods such as PCR do not require the pres- ence of living bacteria. A few copies of bacterial DNA in saliva are sufficient for detection (FABIAN et al., 2008). Accordingly, saliva can be used as sample material for the reliable detection of oral bacteria.

2. Periodontal disease

2.1. Definition

SEXTON et al. (2011) define periodontal disease as a chronic microbial and inflammatory process char- acterized by the presence of sulcular pathogenic bacteria, impaired host immune response and destruction of the connective tissue attachment. KLUGH (2005) differentiates between the terms periodontal dis- ease, which is more general and the term periodontitis, which describes an active pathologic process. The role of gingivitis as disease precursor is discussed controversially and is presented later in this chapter

(PAGE et al., 1997).

2.2. Pathogenesis of periodontal disease

During the past decades, the theories on the pathogenesis of periodontal disease have changed substan- tially. Initially, disease was believed to be exclusively of bacterial origin. Today, considerable importance is also attributed to the host’s reaction to oral bacterial infection (PAGE et al., 1997). In general, peri- odontitis is assumed to be of multifactorial origin with bacterial infection have a major, but not exclusive role in the onset and progression of disease (BODET et al., 2007).

Gingival crevicular fluid is known to be closely associated with the pathogenic process. Its production in periodontal spaces is typically related to inflammatory events (GRIFFITHS, 2003). Circulating crevic- ular fluid abounds in bacteria detached from the epithelial walls and in inflammation products. Although the latter have an antibiotic effect, they also promote the destruction of normal dental tissues, which

2 Part I. Review of literature in turn results in the formation of periodontal pockets (KLUGH, 2005), where more crevicular fluid harbouring corrosive compounds can accumulate. This results in a vicious circle of inflammation and tissue damage, ultimately leading to complete destruction of the periodontal system and the exfoliation of teeth (BURT, 2005). However, it has to be noted that periodontal disease may also be a manifestation of systemic disease (ARMITAGE, 1999).

2.3. Classification of periodontal disease

The severity of disease and the localisation of affection vary between individuals. In 1999, members of the America Academy of Periodontology developed a classification system for human periodontal diseases. According to this system, the three most important groups of disease are gingival disease, chronic periodontitis and aggressive periodontitis (BURT, 2005; see Figures 1, and 2).

2.4. Progression of periodontal disease

Gingival disease is seen in numerous patients (BURT, 2005). Accumulation of plaque leads to inflam- mation of the gingiva because of the immune response to the bacteria in the plaque. The severity of symptoms varies within and between individuals. Oedema, reddening of the gingiva and a tendency to local or generalised bleeding are the main clinical symptoms (HOFFMANN, 2006). Modifying factors

(i.e. deregulated sexual hormone levels, interaction with medication) contribute to overreaction of the gingival immune system to plaque.

Initially, it has been thought that gingivitis is a precursor of periodontal disease and leads to the for- mation of subgingival pockets. Today, it is widely accepted that gingivitis can persist over many years without progressing to periodontitis. Therefore gingivitis is regarded as a distinct disease (PAGE et al.,

1997). It was shown that plaque accumulation leads to more severe inflammation in older than in younger people (FRANSSON et al., 1999).

Chronic periodontitis is the most common form of periodontal disease. Loss of tooth attachment to the bone and reduced bone density are the major symptoms. Clinically, periodontal pockets are charac- teristic findings, sometimes in concurrence with gingival retraction. The severity of chronic periodon- titis is classified according to the percentage of affected dental surfaces and the degree of attachment loss (HOFFMANN, 2006).

3 Part I. Review of literature

Figure 1: Classification of periodontal diseases and conditions (ARMITAGE, 1999)

Aggressive periodontitis is the most rapidly progressing form of periodontal disease. It is mainly seen in young patients. Consequently, the term “early-onset periodontitis” was used until 1999. In the frame of The International Workshop for a Classification of Periodontal Diseases and Conditions the term was replaced by the designation “aggressive periodontitis” because not all patients suffering this form of periodontal disease are juvenile (ARMITAGE, 1999).

In the last five decades, the perception of periodontal disease has changed in so far as disease is thought to be of multifactorial origin, with genetic predisposition also having a pathogenic role. This may also be one explanation for the various courses of periodontal disease (CAPPUYNS et al., 2005). Three decades ago, periodontitis was believed to progress in bursts, interrupted by phases of quiescence, but always being deteriorating at the end (BORRELL and PAPAPANOU, 2005). Yet, others have shown that

4 Part I. Review of literature

Figure 2: Classification of periodontal diseases and conditions, continued (ARMITAGE, 1999)

periodontitis is characterized by alternating phases of improvement and progression. This suggests that it might be possible to cure the disease (GILTHORPE et al., 2003).

2.5. Risk factors

Multiple risk factors for periodontal disease have meanwhile been identified (BORRELL and PAPA-

PANOU, 2005; BURT, 2005). In a meta-study, non-modifiable background factors as well as environ- mental, acquired, and behavioural factors have been shown to promote the onset and progression of periodontal disease (BORRELL and PAPAPANOU, 2005). For example, patients with certain systemic diseases such as diabetes mellitus are at greater risk of developing periodontal disease. However, there is no convincing evidence for diabetes mellitus contributing to specific forms of periodontitis (ARMITAGE,

1999). The same principle applies to smoking, which can enhance the severity of the disease but is not believed to cause specific forms of it (ARMITAGE, 1999).

5 Part I. Review of literature

• Non-modifiable background factors:

– Age, gender, ethnicity, gene polymorphisms

• Environmental, acquired, and behavioural factors:

– Socioeconomic status, specific oral microbiota, smoking, diabetes mellitus, obesity, osteope-

nia/osteoporosis, HIV infection

2.6. Diagnosing periodontal disease

To establish the diagnosis of periodontitis, a thorough knowledge of the patient’s history is crucial. In patients with aggressive periodontitis, knowing the family history is especially important. Moreover, systemic diseases and life situations (i.e. pregnancy, puberty) can influence the onset or progression of the disease. In the process of diagnosing periodontal disease all those factors need to be considered.

Typical clinical symptoms of periodontitis are the following (HOFFMANN, 2006):

• tendency to bleed on probing

• depth of periodontal pockets/degree of attachment loss

• bone resorption on radiography

• movable teeth

• influence on occlusion

• accumulation of plaque

2.7. Measuring periodontal indices

Human literature is controversial regarding the correct evaluation and interpretation of disease-related measurements. It is certainly important to differentiate between clinically observed attachment loss

(CAL) and pocket depth (PD). CAL describes the distance between the bottom of the pocket and the cemento-enamel junction. PD is measured from the bottom of the pocket to the gingival margin. Hence, the measured pocket depth depends on the condition of the gingiva, which might be retraced or swollen.

Accordingly, CAL is regarded as the gold standard (GOODSON, 1992).

6 Part I. Review of literature

Moreover, CAL and PD are not always measured in the same way in human studies. There is a great discrepancy in the number of teeth measured and the number of measurement sites per tooth (BURT,

2005). Currently, six point-measurements per tooth are proposed (HOFFMANN, 2006). The probe needs to be introduced into the pocket with a consistent pressure of 0.25 Newton, and parallel to the longitudinal axis of the tooth. It has to be kept in mind that measuring errors of up to 0.8 mm are not uncommon, so that only changes of more than 2 mm are considered to be clinically relevant. Usually, a probing depth of 2 to 3 mm is considered as normal, whereas a CAL of more than 3 mm is indicative for a periodontal pocket (HOFFMANN, 2006). An increase in CAL of more than 1 mm per year or of 2 mm at a specific point in time is suggestive for an active pathogenic process (HOFFMANN, 2006).

2.8. Other factors leading to diagnosis

Because of the inaccuracy of described measuring techniques, research has focused on identifying al- ternative indicators for periodontitis. Inflammatory markers such as prostaglandin E2 (PGE2), tumour necrosis factor-alpha (TNF-α), interleukin 1 alpha (IL-1α) and beta (IL-1β) were analysed in samples of gingival crevicular fluid (GCF) (BODET et al., 2006; SEXTON et al., 2011). An increase in the enzyme aspartate aminotransferase (AST) has been found in affected patients (MAGNUSSON et al.,

1996). However, so far conducted studies yielded inconsistent results, illustrating that more research is necessary for the establishment of a sensitive and reliable marker-based diagnostic systems (BURT,

2005).

2.9. Prevalence of periodontal disease

According to the above mentioned classification system, severe generalised periodontitis affects 5 to

15 % of the world’s population (BURT, 2005). The incidence depends on the cut-off that is used for

CAL. If ≤ 2 mm are considered to be normal, around 80 % of all people are affected; when 4 mm are measured at least at one site, only 50 % meet the inclusion criteria, and with 6 mm only 20 % are affected (BURT, 2005).

7 Part I. Review of literature

2.10. Therapy of periodontal disease

Removal of plaque and bacterial biofilm is an important measure in periodontitis therapy. This can be achieved manually, but is preferably performed with ultrasound devices. One has to be careful not to destroy the surface of the tooth or to irritate the gingiva. In advanced and aggressive cases, antibiotic therapy can be indicated (HOFFMANN, 2006). When severe pain and loss of function occur, extraction of the affected teeth has to be performed (MCCAUL et al., 2001).

3. Pathogens in the oral cavity of periodontitis-affected patients

3.1. Bacteria

The presence of bacteria alone does not necessarily lead to periodontal disease. However, there is no periodontal disease without contribution of specific bacterial pathogens (BURT, 2005). As previously mentioned, considerable efforts have been made to elucidate the role of bacteria in the pathogenesis of periodontitis (PAGE et al., 1997; SAKAMOTO et al., 2000; KUMAR et al., 2003; FAVERI et al., 2008;

BYRNE et al., 2009).

The healthy gingival sulcus provides many defence mechanisms against invasion by bacteria (PAGE et al., 1997). The dental surface is smooth and makes is difficult for bacteria to attach. Bacteria are easily washed away by circulating saliva and movements of the tongue (GREEN, 1996). Therefore, bacteria need a particular environment ensuring their survival on dental and oral surfaces.

Moreover, a lot of periodontal pathogens are anaerobic. In conjunction with periodontitis a shift from a mixed flora to gram-negative, anaerobic bacteria takes place. The pool of bacteria needs to create an anaerobic environment for those pathogens. All these needs can be fulfilled by a complex system - the biofilm. The biofilm is well-structured conglomerate of multiple microorganisms (SOCRANSKY and

HAFFAJEE, 2002). In this conglomerate, microbes are protected from host-derived defence mecha- nisms and noisome substances such as antibiotics or disinfectants. Biofilm consists of different types of bacteria with various abilities that interact synergistically. In the biofilm bacteria arrange themselves in different layers, with the most resistant bacteria forming the most exposed layers, whilst less resistant microbes reside in the shelter of deeper areas. A primitive circulatory system consisting of voids and water channels ensures the transport of diverse substances within the biofilm. The latter readily produces

8 Part I. Review of literature lactamases, catalases and superoxid-dismutases, which protect bacteria from antibiotics and various host mechanisms (SOCRANSKY and HAFFAJEE, 2002).

In agreement with this theory, bacteria in supra- and subgingival plaques form complexes (SOCRAN-

SKY et al., 1998). This has been confirmed by cluster and community organisation analysis in subgingi- val plaque samples (SOCRANSKY et al., 1998). Accordingly, six closely associated groups of bacteria

– so-called clusters – have been defined according to their nutritional and environmental requirements

(SOCRANSKY et al., 1998; DUMITRESCU and KAWAMURA, 2010; see Figure 3).

• The red complex: Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola

• The orange complex: Fusobacterium nucleatum subspecies, Prevotella intermedia, Prevotella

nigrescens, Peptostreptococcus micros, Campylobacter rectus, Campylobacter showae, Campy-

lobacter gracilis, Eubacterium nodatum, Streptococcus constellatus

• The green complex: Campylobacter concisus, Eikenella corrodens, Aggregatibacter (Acinobacil-

lus) actinomycetemcomitans serotype a

• The yellow complex: Streptococcus mitis, Streptococcus sanguis, Streptococcus oralis

• The purple complex: Actinomyces odontolyticus, Veillonella parvula

• Non-clustering bacteria (blue): Actinomyces naeslundii genospecies 2, Actinomyces viscosus,

Selenomonas noxia, Aggregatibacter (Acinobacillus) actinomycetemcomitans serotype b

Interactions exist not only between individual bacterial species but also between the different bacterial clusters. The Actinomyces family (non-clustering), the purple, green and yellow complexes (see Figure 4) are early interacting colonisers of the dental and oral surfaces. Members of the orange and particularly the red complex are late colonisers and are commonly associated with each other (SOCRANSKY et al.,

1998). These complex-complex interactions are depicted in Figure 4.

When relating the composition of the oral microbiome to clinical periodontitis-related findings, early colonisers predominantly reside in small pockets. Deep inside of larger pockets, conditions become increasingly anaerobic, thus favouring the growth of bacteria of the orange and the red complex (DU-

MITRESCU and KAWAMURA, 2010).

9 Part I. Review of literature

Figure 3: Bacterial complexes in plaque; caption modified by K. PIEBER (SOCRANSKY and HAFFAJEE, 2002)

Figure 4: Relationship between bacterial complexes; caption modified by K. PIEBER (SOCRAN- SKY and HAFFAJEE, 2002)

10 Part I. Review of literature

Figure 5: Viruses in the oral cavity of periodontitis-affected patients; caption modified by K. PIEBER (CAPPUYNS et al., 2005)

3.2. Viruses

In patients with periodontal disease, numerous groups have also reported the presence of viruses (PARRA and SLOTS, 1996; CONTRERAS et al., 2000; CONTRERAS and SLOTS, 2000). Although it seems un- likely that viruses would be exclusive initiators of periodontitis, there is substantial evidence for viruses contributing to disease onset and progression (SLOTS, 2010).

For a long time, periodontal research was centred on a bacterial aetiology. Accordingly, the find- ing of herpesviruses in oral samples from periodontitis-affected patients marked a scientific turning point (SLOTS, 2010). Presence of herpesviral sequences, namely of Epstein-Barr virus (EBV) and cytomegalovirus (CMV) DNA and mRNA in affected periodontium was shown by qualitative and quan- titative PCR and RT-PCR techniques, and further confirmed by the use of virus-specific DNA probes, immunofluorescence staining and flow cytometry (MADINIER et al., 1992; AMIT et al., 1992; CON-

TRERAS et al., 1999; SLOTS, 2010).

Detection rates of periodontal herpesviruses vary considerably. They depend on the type of periodon- titis, the sensitivity and specificity of employed detection methods and on ethnic affiliation, as well as on

11 Part I. Review of literature the natural fluctuation of periodontal herpesviruses. Accordingly, the incidence of herpes simplex virus in periodontal tissue ranges between 13 and 100 %, of EBV between 3 and 89 %, and of CMV between

0.3 and 83 %. It is widely accepted that high EBV and CMV concentrations are particularly found at sites of severe and progressive periodontitis (SLOTS, 2010 and references within).

The mechanisms by which herpesviruses contribute to periodontal disease are thought to be synergis- tically linked to bacterial infection. It is proposed that herpesvirus infection promotes the release of pro- inflammatory cytokines, which in turn activate osteoclasts and matrix metalloproteinases (MMPs) and abrogate immune surveillance, thus paving the way for invasion by periodontopathic bacteria (SLOTS,

2010).

Viral infection can induce specific clinical symptoms in the oral cavity (see Figure 5). In patients with human immunodeficiency virus type 1 (HIV-1) infection, oral symptoms are often the first being noted.

In general, HIV-1 infection is thought to predispose to chronic periodontitis (CAPPUYNS et al., 2005).

The hypothesis of herpesviruses being involved in periodontal disease is not generally accepted yet.

There are concerns regarding sample collection, employed detection methods and the interpretation of results, which cast certain doubts on an aetiologic association of herpesviruses with periodontitis

(CAPPUYNS et al., 2005).

4. The normal oral microbiome in horses

Many different microorganisms colonize the oral cavity of equines (KLUGH, 2005). However, little in- formation on the equine oral microbiome is currently available (BIENERT, 2002). There is evidence for high numbers of Streptococci, Micrococci and starch hydrolyzers, moderate numbers of anaerobes, Veil- lonella spp. and H2S producers, and a small number of Lactobacillus spp., Fusobacterium spp. and co- liforms residing in plaques collected from healthy horses (BAKER, 1979). Analyses of sample material collected from the pharyngeal tonsillar surface in unaffected equines revealed 270 bacterial phylotypes,

98 of which were obligatory anaerobic bacteria. The seven commonest genera were Peptostreptococ- cus, Eubacterium, Clostridium, Veillonella, Megasphera, Bacteroides and Fusobacterium (BAILEY and

LOVE, 1991). There is also a report describing the detection of Actinobacillus equuli from the oral cavity of healthy horses using a swab sampling technique (STERNBERG, 1998). Two strains of Gram-negative, anaerobic, non-sporulating bacteria highly resembling Fusobacterium necrophorum were found in the

12 Part I. Review of literature oral cavity of healthy and periodontitis-affected horses (DORSCH et al., 2001).

5. Periodontal disease in horses

5.1. Risk factors for periodontal disease in equines

Periodontal disease is a well-recognised condition in horses. It mostly occurs as a consequence of other problems such as irregularities of wear (BAKER, 1970, 1979), diastemata or displaced teeth (DIXON et al., 1999). Older horses are more often affected, as emphasized by a reported incidence of 60 % in horses older than 15 years (BAKER, 1979). In young horses, a mild and transient form may occur during cheek teeth eruption (BAKER, 1970).

5.2. Clinical symptoms of periodontal disease

Horses with moderate to severe periodontal disease frequently have mastication problems as revealed by quidding and prolonged chewing. Usually, this is caused by loose teeth, which are only held in place be biting pressure and gravity (KLUGH, 2005). Irregularities of wear promote teeth movement, leading to small interdental spaces, termed diastemata. In the latter, food gets stuck, thus causing inflammation, which in turn results in the destruction of the periodontal ligament (PDL). Sometimes affected teeth lose all periodontal attachment, so that they can be manually extracted. Some horses also show bitting problems when ridden. In conclusion, it can be stated that periodontal disease impairs the welfare and performance of affected horses (KLUGH, 2005).

5.3. Grading of periodontal disease in horses

Based on the Veterinary Periodontal Disease Index, the following grading system has been proposed

(KLUGH, 2005):

• Grade 0: normal; no loss of tooth attachment, probing depth ≤ 5mm

• Grade 1: gingival inflammation, no loss of tooth attachment, probing depth ≤ 5mm

• Grade 2: early periodontitis; attachment loss <25 %

• Grade 3: moderate periodontitis; attachment loss of 25 to 50 %

13 Part I. Review of literature

• Grade 4: advanced periodontitis; attachment loss > 50 %

Alternatively, a grading system for tooth mobility may be used:

• Grade 0: normal

• Grade 1: mild changes

• Grade 2: moderate changes, with tooth mobility of 3 mm

• Grade 3: severe changes, with tooth mobility exceeding 3 mm

5.4. Comparing human and equine periodontal disease

Periodontal disease in man and horses differ to some respect. This is mainly due to anatomical and physiological discrepancies regarding the periodontal ligament. In horses, the teeth continue to erupt during their whole life whilst the grinding surface is worn down by chewing. The teeth of young horses are extremely long and exhibit a reserve crown. In the course of time, the so-called clinical crown, which protrudes from the gingival margin, is worn off and the reserve crown emerges and becomes the clinical crown. In old horses, the teeth are shorter and the roots are not so deeply embedded anymore (DIXON et al., 2011). Thus, the PDL has a more active role in horses (STASZYK et al., 2011).

In man, the dental roots are covered by cement and the crown by enamel. The respective transition site is termed cemento-enamel junction. Accordingly, attachment loss is reflected by the measured distance from this junction to the bottom of the pocket. Given that there is no such junction in the horse; the pocket depth is determined by the bottom of the pocket to the gingival margin (KLUGH, 2005). Thus obtained values may not accurately reflect the pocket depth as they are influenced by the condition of the gingiva, which may be swollen or hypoplastic.

Moreover, dental calculus plays a major role in man (DUMITRESCU and KAWAMURA, 2010). Cal- culus develops upon mineralization of bacterial dental plaque and typically paves the way for periodontal disease. In horses, calculus is very common in the canines, but can also be found in incisors, premolars and molars. KLUGH (2005) stated that in equine teeth with attachment loss, calculus is rarely found.

Recently, this topic is discussed controversially and further investigation is needed (H. SIMHOFER, personal communication).

14 Part I. Review of literature

5.5. Bacteria in the equine oral cavity with periodontal disease

Only little is known about bacteria specifically residing in the oral cavity of periodontitis-affected horses.

There is evidence for gram-negative aerobes and anaerobes supplanting gram-positive cocci and rods in the oral cavity of affected individuals (KLUGH, 2005). Horses with anterior periodontitis have been shown to harbour Bacillus spp., Streptococcus spp., Corynebacterium spp., Bacteroides spp. and Fu- sobacterium spp. (BAKER, 1979). Dental abscesses seem to be associated with gram-negative and gram-positive bacteria as well as pleomorphic rods, as detected in pus from the inside of the maxillary sinus, and from pus surrounding the tooth roots of a horse and a donkey. On micro-aerophilic plates, no colonies were detected whereas many different species (Bacteroides fragilis, Bacteroides melaninogeni- cus, Bacteroides oralis, Fusobacterium mortiferum, Fusobacterium sp., Peptostreptococcus anaerobius, textitPeptostreptococcus species) grew in anaerobic culture (MACKINTOSH and COLLES, 1987). In a recent publication, 27 bacterial species were detected in bacterial samples of 19 horses taken from extracted teeth with dental pathologies. In 15 horses, a mixed flora of aerobic, anaerobic and mi- croaerophilic bacteria were identified after cultivation but the group of anaerobic gramnegative bacteria was predominant with Fusobacterium spp. and Prevotella spp. found in most of the patients (BIENERT,

2002).

5.6. Treatment of periodontal disease in horses

Occlusal equilibration, pocket debridement, and perioceutic therapy are currently proposed for the treat- ment of horses with periodontal disease of grades 1 to 3 (KLUGH, 2005). Exceedingly long teeth need to be trimmed in order to avoid unbalanced pressure. Packed feed material and debris have to be removed from the periodontal pockets and the grinding surface has to be cleaned. Hydrotherapy and air abrasion can be helpful. Removal of necrotic tissue is imperative. In some cases, periodontal application of dis- infectants and antibiotics is indicated (KLUGH, 2005). Excessive dental mobility (grade 4) is generally treated by tooth extraction. Nowadays, this is mostly performed in the standing sedated horse under local anaesthesia. In rare cases, general anaesthesia may be necessary. When diastemata and consequent food pocketing between cheek teeth are identified as reason for periodontal disease, interdental spaces are cleaned and widened with a burr as to prevent further food pocketing and by this sustainably reduce inflammation (DIXON et al., 2008).

15 Part I. Review of literature

6. EOTRH

6.1. Definition

In the last few years, some reports on a newly described type of equine anterior periodontitis have been published (GREGORY et al., 2006; BARATT, 2007; CALDWELL, 2007; KREUTZER et al., 2007).

The term EOTRH – Equine Odontoclastic Tooth Resorption and Hypercementosis – has been suggested for this particular form of periodontal disease (STASZYK et al., 2008). EOTRH predominantly affects the incisors and canines, yet is only rarely seen in premolars (SIMHOFER and ROS, 2011).

Major disease characteristics are manifest bulbous tooth root enlargement that were initially inter- preted as tumour and hence termed “cementoma” (KREUTZER et al., 2007) in accordance to a com- parable disease seen in man (CALDWELL, 2007). Other typical features are resorptive changes of the dental hard substances, which likely represent an early event in the onset of EOTRH (STASZYK et al.,

2008).

6.2. Risk factors for EOTRH

EOTRH is a quite uncommon disease (DIXON et al., 2011). To date, no studies on the incidence are available. In an on-going study, a mean age of 21 years has been observed for a group of 23 EOTRH- affected patients. Male animals were significantly more affected, and a breed disposition for Icelandic horses has been noted (M. KOWELKA, personal communication).

6.3. Clinical symptoms

EOTRH is often diagnosed at an advanced stage because most horses do not show obvious clinical symp- toms at early stages of the disease. Owners frequently report that their horses are unable to snap hard foot material like carrots or dry bread (SIMHOFER and ROS, 2011; M. KOWELKA, personal commu- nication). Some horses show halitosis and weight loss. In a few cases unwillingness to drink cold water is reported (M. KOWELKA, personal communication). Quidding is usually not a symptom of EOTRH.

Insertion and opening of a mouth gag may be very painful in advanced stages of EOTRH due to pres- sure exercised on diseased incisors (GREGORY et al., 2006; SIMHOFER and ROS, 2011). Reluctance of the horse during application of the mouth gag may also indicate the presence of advanced EOTRH

16 Part I. Review of literature stages. In some patients the clinical appearance is characterized by bulbous enlargement of the alveo- lar processes caused by massive deposition of cement around the tooth roots and reserve crowns of the incisors and canines, and enlargement of the adjacent bone (M. KOWELKA, personal communication).

In other horses resorptive lesions are the dominant findings. In most cases however, resorptive lesions and hypercementosis affection of the anterior dentition are observed simultaneously. Hypercementosis is usually recognised earlier because of the obvious bulbous enlargements (CALDWELL, 2007; see Fig- ure 6). Tooth mobility is only rarely encountered (SIMHOFER and ROS, 2011). The gingiva is often unchanged, fistulae are rarely present. This form appears to be less painful for the individual compared to the resorptive form (H. SIMHOFER, personal communication). In cases of EOTRH where resorptive lesions prevail, the clinical findings are significantly different. Severe gingivitis and gingival retraction of variable degree are the major symptoms (see Figure 7). Fistula formation is observed at various levels of the reserve crowns. Dental mobility and painful palpation are other features frequently encountered in advanced cases (SIMHOFER and ROS, 2011). Periodontal food pocketing might be seen in some horses. In advanced cases, teeth can be extracted manually (SIMHOFER and ROS, 2011). Calculus is often evident but recent data show that its extent does not correlate with the severity of EOTRH (M.

KOWELKA, personal communication).

6.4. Radiological signs

Radiography is the method of choice for the diagnosis of EOTRH. As previously described, the radi- ological appearance of the disease is variable. In horses with predominantly hypercementotic changes the bulbous enlargements of the tooth roots are easily diagnosed on radiographs (SIMHOFER and ROS,

2011; see Figures 8) with lytic lesions being only rarely encountered (M. KOWELKA, personal commu- nication).

The large hypercementotic areas are surrounded by a distinct bony periodontal layer. In most cases re- sorptive changes of the teeth and the surrounding bone present as irregular areas within the incisor region.

Gross radiological changes of the lamina dura dentis are characteristic for these horses (SIMHOFER and

ROS, 2011; see Figure 9). Dental fragmentations and/or bony sequestra may be present (H. SIMHOFER, personal communication). In advanced stages of the disease, the pulp cavity is also affected and cannot be clearly distinguished on radiographs. Moreover, regions of hyperdense material are found around

17 Part I. Review of literature

Figure 6: Patient with severe EOTRH; severe bulbous enlargements of the tooth roots, mild re- traction of gingiva

the tooth roots and reserve crowns. On histological examination this material was shown to be ce- ment (STASZYK et al., 2008). Osteolytic changes in the surrounding alveolar bone are the predominant bony changes (M. KOWELKA, personal communication).

6.5. Aetiology of EOTRH

At present, the aetiology of EOTRH is still unclear. In general, EOTRH is thought to be of multifacto- rial origin (STASZYK et al., 2008). Several theories have been discussed, but no particular aetiological cause has been identified so far. Microorganisms are thought to have an important role in the progres- sion of the disease. However, some patients lack clear signs of microbial infection such as draining tracts (STASZYK et al., 2008).

A current hypothesis is that excessive pressure on the periodontal ligament of the anterior dentition may be an initiating factor (STASZYK et al., 2011). In the rat model, excessive pressure on the peri- odontal ligament caused micronecrosis, leading to activation of odonto- and osteoclasts and tooth resorp-

18 Part I. Review of literature

Figure 7: Patient with severe EOTRH; severe gingiva retraction and exposed tooth roots

Figure 8: Intraoral radiograph of the maxilla of same patient as in Figure 6, with severe hyperce- mentotic and only mild resorptive lesions

19 Part I. Review of literature

Figure 9: Intraoral radiograph of the mandible of the same patient as in Figure 7, the third mandibular incisors (303 and 403 after Triadan) are missing, severe resorptive lesions of all remaining incisor teeth

tion (BRUDVIK and RYGH, 1993). Other initiating factors discussed as aetiological agents are ischemic necrosis, genetic linkage and/or systemic diseases (Cushing’s, hypervitaminosis A, hypocalcaemia or hy- perparathyroidism; CALDWELL, 2007; STASZYK et al., 2011).

6.6. Histological features of EOTRH

Histological examination of affected teeth usually reveals infiltration of tissue with inflammatory cells in concurrence with fibrosis of the gingiva and the PDL, and lysis of the adjacent bone (CALDWELL,

2007). Accumulation of cement was encountered in many horses, leading to the question whether this should be classified as cementoma or hypercementosis (KREUTZER et al., 2007).

Therefore, resorptive changes are thought to represent an initial event of disease, with deposition of irregular cement constituting a secondary process (STASZYK et al., 2011).

6.7. Treatment of EOTRH

As previously mentioned, most EOTRH cases are diagnosed at an advanced stage. Currently there is no effective therapy for the treatment of progressive EOTRH. It has also been shown that treatment of milder cases with systemic administration of antimicrobials, corticosteroids or local chlorhexidine only leads to

20 Part I. Review of literature

Figure 10: Top (b): Extracted incisor of an EOTRH-affected horse, irregular cement (irC) and necrotic tissue (nT) is visible in the apical region. Bottom (d): Transversal sections of the same tooth; left: resorptive lesion filled with irC next to dentine (D) and normal cement (nC)); right: destruction leads to exposure of the pulp cavity; caption modified by K. PIEBER (STASZYK et al., 2008)

Figure 11: Histological analysis of a decalcified EOTRH-affected incisor by toluidine-blue stain- ing, irregular cement (irC) with wavy incremental lines; caption modified by K. PIEBER (STASZYK et al., 2008)

21 Part I. Review of literature

Figure 12: Histological analysis of an EOTRH-affected incisor by Picrosirius red-staining, accumulation of irC around the vascular channel (vc); caption modified by K. PIEBER (STASZYK et al., 2008)

transient improvement of disease (BARATT, 2007). In analogy to treatment in man, dental extraction is currently recommended for severely compromised, loose or fragmented teeth and in case of fistula formation (BARATT, 2007; KREUTZER et al., 2007).

7. Treponemes

7.1. Characterisation of Treponemes

Treponemes belong to the phylum Spirochaetes. These bacteria have a unique morphology. They are long and thin and spirally shaped (see Figure 13). Typical for the Spirochaetes are flagella. They are encased within an outer layer and ensure the motility of the bacteria, allowing them to move even through viscous material. In treponemes one to eight flagella are existent (EDWARDS et al., 2003).

Most treponemes need anaerobic conditions for their survival with only few microaerophilic excep- tions. Hence, they are often found in the human oral cavity and genital region. In animals they are known to mainly reside within the intestinal tract or affect interdigital spaces (EDWARDS et al., 2003).

7.2. Diseases caused by treponemes

In man, Treponema pallidum is a well-known pathogen causing syphilis, endemic syphilis, yaws and pinta (EDWARDS et al., 2003). Interestingly, it lacks the machinery required for protein secretion

(RADOLF et al., 1999). Phylogenetically, Treponema pallidum clusters with Treponema denticola,a

22 Part I. Review of literature

Figure 13: Transmission electron micrograph of a Treponema species; caption modified by K. PIEBER (EDWARDS et al., 2003)

member of the red complex, which is consistently detectable in the oral cavity of periodontitis-affected man (BODET et al., 2007), but also in bovine tissue affected by digital dermatitis (DD).

In bovids and ovids there is ample evidence for treponemes being causally involved in the onset and maintenance of DD. Treponemes most frequently detected in DD lesions are T. denticola, T. phagedenis,

T. medium, and T. vincentii (BRANDT et al., 2011b). Recently, a novel Treponema species termed

Treponema pedis sp. novum has been identified as putative aetiologic agent of bovine DD (EVANS et al., 2009; BRANDT et al., 2011b). DD-associated treponemes have also been detected in cases of bovine ulcerative mammary dermatitis and contagious ovine digital dermatitis (STAMM and TROTT,

2006). Although treponemes constitute a scientific issue since many years, various facets of pathogenic mechanisms involving treponemes still remain to be elucidated.

7.3. Treponemes in human periodontal disease

In the course of periodontal disease onset and progression, the formation of gingival pockets constitutes a major event. Within the pockets, anaerobic conditions favour the growth of proteolytic gram-negative anaerobes such as Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola, i.e. the bacteria of the red complex (EDWARDS et al., 2003).

In many studies, treponemes were detected in periodontitis-affected patients. DEWHIRST et al. (2000) found 500 clones of 57 Treponema species in samples of 13 patients. These species cluster into ten phylogenetic groups, as outlined in Figure 14. Of these, 82 % have not been cultivated yet. In healthy subjects, detection of Treponema species is less likely (DEWHIRST et al., 2000). The role of treponemes in the aetiology of periodontal disease still needs to be elucidated.

23 Part I. Review of literature

Figure 14: Phylogenetic diversity of oral treponemes in human periodontitis; caption modified by K. PIEBER (PASTER and DEWHIRST, 2006)

24 Part II. Hypotheses and objectives

Part II.

Hypotheses and objectives

It is generally accepted today that specific microorganisms are chiefly involved in the onset and progres- sion of human periodontitis, with treponemes having a crucial pathogenic role (BODET et al., 2007).

Moreover, there are indications for herpesviruses contributing to disease development by a synergistic interaction with periodontogenic bacteria (SLOTS, 2010).

In equids, nothing is known regarding a possible aetiologic involvement of treponemes in the patho- genesis of anterior periodontitis and EOTRH as a particular form of anterior periodontitis. In addition, no data are available regarding a possible co-involvement of herpesviruses in the onset and progression of these forms of equine dental disease.

Based on the consistent finding of treponemes and EBV as well as CMV in the oral cavity of perio- dontitis-affected man, it is hypothesized that

• Treponema species are predominantly detectable in the oral cavity of EOTRH-affected horses

• herpesviruses are predominantly detectable in the oral cavity of EOTRH-affected horses

To address these hypotheses, the major objectives of the herein presented study were to

• collect crevicular fluid/saliva from periodontal pockets of a representative number of EOTRH-

affected horses, and from periodontium of healthy control horses

• extract DNA from saliva samples and screen DNA isolates for PCR-compatibility

• establish and use a sensitive PCR-based system for reliable detection of Treponema sp. and her-

pesvirus DNA from salival DNA isolates

• identify detected pathogens by amplicon sequencing and subsequent sequence alignment using

BLAST program

• identify putative bacterial and/or viral agent that may have a causal role in the pathogenesis of

EOTRH

25 Part III. Material and Methods

Part III.

Material and Methods

8. Clinical evaluation

8.1. General examination of horses

Healthy control horses and horses with confirmed diagnosis of EOTRH were examined at the Equine

Clinic of the Veterinary University Vienna (Vetmeduni Vienna) or at the horse’s home yard under the supervision of Doctor Simhofer, specialist for equine dentistry of the Vetmeduni Vienna. All owners were asked to complete a questionnaire on the horses’ history including feeding habits, housing condi- tions and riding problems. Horses underwent a thorough clinical examination and a short neurological examination. The horses’ weight was determined with scales at the University, or with Body Measuring

Tape. Blood samples were collected and sent to the Vetmeduni Vienna laboratory for complete blood count.

8.2. Oral examination

An oral examination was performed in all horses. For this procedure the animals were sedated using a combination of detomidine (10-80 μg/kg i.v.; Domidine, Animal Health B.V., Bladel, Netherlands) and butorphanol (10-50 μg/kg i.v.; Butomidor, Richter Pharma AG, Wels, Austria). The anterior denti- tion was inspected for clinical signs of periodontitis. The gingiva was examined for signs of pathology like reddening, swelling or retraction. Presence of periodontal pockets, fistulae or food pocketing was recorded. The maxillary and mandibulary alveolar regions were checked for swellings. The incisors and canines were inspected for mobility, discolouration, carious lesions, fractures and diastemata. Presence of calculus was recorded. For each horse, photographs of the anterior dentition were taken.

The cheek teeth were examined after rinsing of the oral cavity and application of a full mouth speculum by palpation, visual and endoscopic examination. Pathologic changes were recorded.

26 Part III. Material and Methods

8.3. Radiological examination

Intraoral radiographs were taken from every EOTRH patient using a portable X ray machine (Reginato

Gierth 100 HF plus ultra leicht, Gierth X-Ray International GmbH, Riesa, Germany). The cassette was placed between the upper and lower incisors as far caudal as possible. The central beam was focussed on the central incisors at an angle of 60 to 80 degrees. The radiographs were processed using a digital cas- sette reading device (Fujifilm Austria GmbH, Vienna, Austria) and viewed at high resolution. Inspection of the lamina dura dentis for irregularities and widening, and determination of the degree of resorption and hypercementosis served to establish an overall periodontitis score. Resorptive lesions of the bone or teeth were graded as mild, moderate or severe according to their extent. Hypercementosis was graded as mild when the reserve crown and the tooth roots were only rounded, but as moderate or severe when hypercementosis was more pronounced (see Table 1). The mandibular and maxillary anterior dentition were evaluated separately with the most severe finding defining the overall radiological score.

8.4. Animals

According to examination results, 27 horses were enrolled in the study and assigned to three different groups according to the defined inclusion criteria - see Table 2.

Details on the individuals of the three groups are shown in Tables 3, 4, and 5.

8.5. Sampling of crevicular fluid/saliva

Saliva was collected from the crevicular sulcus and from periodontal pockets, when present. A total of two samples (a & b) per horse was taken using a pipette and a long, thin, and sterile 100 μl filter tips

(Biozym, Hessisch-Oldendorf, Germany). Aspirated saliva was introduced into sterile 1.5 ml microcen- trifuge tubes (Biozym) by flushing the tip with 80 μl of sterile water. Then the samples were stored at

−20 ◦C until further use.

27 Part III. Material and Methods

Table 1: Definition of radiological scores

Osteolysis mild (m) lamina dura dentis (LLD) missing in some areas moderate (M) LDD missing in up to 50 % of its entity severe (S) LDD missing in more than 50 % of its entity Osteosclerosis mild (m) LLD thickened only in some areas moderate (M) LDD thickened up to 50 % of its own thickness and/or in up to 50 % of its entity severe (S) LDD thickened more than 50 % and/or in more than 50 % of its entity Overall grade of irregularity mild (m) osteolysis and osteosclerosis mostly consistent throughout patient moderate (M) osteolysis and osteosclerosis change at least one grade severe (S) osteolysis and osteosclerosis change two or more grades Widening of periodontal ligament mild (m) slight widening less than 50 % moderate (M) widening between 50 and 100 % severe (S) widening more the 100 % Hypercementosis of teeth mild (m) tooth roots rounded moderate (M) enlargement up to 50 % of normal size severe (S) enlargement more than 50 % of normal size Resorption of teeth mild (m) surface of teeth roots irregular moderate (M) moth-eaten appearance in up to 50 % of tooth roots severe (S) moth-eaten appearance in more than 50 % of tooth roots

9. Molecular genetic methods

9.1. Sample processing

Saliva samples were subjected to extraction of total DNA by using a DNeasy blood & tissue kit

(Qiagen, Hilden, Germany) according to instructions of the manufacturer. PCR-compatible purity of

DNA isolates was addressed by standard β-actin PCR as described by BRANDT et al. (2008).

28 Part III. Material and Methods

Table 2: Inclusion criteria for patient, further and control horses

Group Inclusion criteria Patient group (P) clinically and radiologically overt EOTRH, graded as moderate (M) or severe (S), with plaque formation, gingival inflammation and retraction; no diagno- sis/suspicion of metabolic, neurological or systemic disease; good general con- dition; otherwise clinically and haematologically unremarkable; no or only mi- nor changes of cheek teeth; no antibiotic treatment within the last three months; no other oral medication since one week Further EOTRH-affected horses (F) EOTRH-affected horses not fulfilling one or more inclusion criteria of the pa- tient group; no antibiotic treatment within the last three months; no other oral medication since one week Control group (C) no periodontitis or EOTRH; no diagnosis or suspicion of metabolic, neurological or systemic disease; good general condition; clinically and haematologically unremarkable; no antibiotic treatment within the last three months; no other oral medication since one week

Table 3: Patient group, affected with EOTRH horse & gender breed age in years EOTRH sample code subcode a Sch Warmblood 17 M P1 b a Vol Warmblood 24 M P2 b a Bla Icelandic horse 22 M P3 b a Lor Warmblood 24 S P4 b a Wem Warmblood 23 M P5 b a Bol Warmblood 15 M P6 b a Mtz Shetland pony 19 M P7 b a Cha Warmblood 22 S P8 b a Pon Warmblood 19 S P9 b a Ber Warmblood 17 S P10 b WNL - within normal limits, m - mild, M - moderate,S-severe

29 Part III. Material and Methods

Table 4: Further EOTRH-affected horses not fulfilling all inclusion criteria of the patient group horse & breed age in EOTRH sample reasons for exclusion gender years code subcode from P-group a Cushing’s disease; pergolide Fja Icelandic horse 29 M F1 b treatment a Suspected liver disease, Biv Fjord 17 S F2 b treated with pergolide a bone cysts treated with Att Warmblood 21 S F3 b calcium dobesilate a Mar Warmblood 20 m F4 b only mild periodontitis a Mor Warmblood 19 m F5 b only mild periodontitis ♀ a chronic weight loss, fat Dam Warmblood 24 m F6 b liver, cimetidine treatment a too old, missing rads from Ger Warmblood 27 m F7 b lower incisors, cimetidine ♀ German Riding a mild periodontitis, gums Sca pony18 m F8 b treated with chlorhexidine WNL - within normal limits, m - mild, M - moderate,S-severe; rads - radiographs

Table 5: Control group, no periodontitis horse & gender breed age in years sample code subcode ♀ a Evi Warmblood 16 C1 b ♀ a Fan Warmblood 15 C2 b ♀ a Fif Warmblood 20 C3 b ♀ a Gyo¨ Warmblood 17 C4 b a Hen German Riding pony 19 C5 b a Rai Warmblood 18 C6 b a Bil Warmblood 19 C7 b ♀ a Sta Draft horse 18 C8 b a Spa Appaloosa 20 C9 b

30 Part III. Material and Methods

Table 6: Primer sequences for herpesvirus PCR

Target size © primer sequence (5’ - 3’) position AT ET GenBank Accession nr in bp EHV1 thymidine kinase gcaagagcacgactggacgagttatgg 1206 72 ◦C 54” 697 [X67961] gcaaacaacgtgtcgctgagctcagg 1902 EHV2 thymidine kinase ggtcaaggaccaggtccaagtcc 62493 72 ◦C 30” 383 [NC 001650] gctcaagtccttcatggaggtcagc 62875 EHV3 DNA polymerase gcgagacatgctgctaggcacg 52 72 ◦C 30” 288 [AF514779] gtgatcagcagcagcttctggaagg 339 EHV4 thymidine kinase ccacaggcagtaatggctgcttgc 938 72 ◦C 30“ 463 [D14486] gctgctggaaagcatacggtagagg 1400 EHV5 glycoprotein H cgacacgttttcaccctgtcttatgagc 10 72 ◦C 30” 333 [DQ504440] gacatcaccgtagaaaccacaatggtc 342 BHV1 thymidine kinase ccacctcgtagactacgacctgg 64883 68 ◦C 30” 376 [AJ004801] ataaactccagaggcaggaggtcc 65258 BHV2 glycoprotein H ccacgtcaccagacatggagatgc 980 72 ◦C 30” 425 [AF375976] ccacaggttcacacgcagaaagagg 1404 BHV4 thymidine kinase gagagagacaatgtctatgaggctacc 1158 68 ◦C 30” 396 [S49773] cagaagctttgaggagacactaaaact 1553 BHV5 glycoprotein G ctcttcgacgagagcgacatgttc 67 71 ◦C 30” 361 [AF250038] ccagcgagaacagcagcactagc 427

9.2. PCR for detection of herpesviruses

Two strategies for detection of herpesviral DNA were adopted in order to be able to trace a maximum of herpesvirus types. The first strategy consisted in establishing type-specific PCR assays for the detection of equine herpesvirus types 1 to 5 (EHV-1 to EHV-5) and bovine herpesvirus types 1 to 5 (BHV-1, -2,

-4, -5). Primer details including PCR annealing temperatures (AT) and elongation times (ET) are shown in Table 6.

The second strategy consisted in implementing a published consensus nested PCR protocol for detec- tion of various herpesviral species (VANDEVANTER et al., 1996).

Type-specific PCR was carried out according to the Phusion-PCR protocol described by HARTL et al.

(2011) and S. BRANDT (personal communication), with primer annealing temperatures and elongation times as specified above (see Table 6). Consensus nested PCR was performed as described by VAN-

DEVANTER et al. (1996). Sterile water and healthy equine skin were used as no-template control (ntc)

31 Part III. Material and Methods and negative control. EHV-1 and EHV-4 DNA served as positive controls for type specific and nested- consensus PCR. No positive control was available for the other herpesvirus types. Amplicons (16 μl aliquots) were analysed by electrophoresis on 1.5 % TAE agarose gels and visualised by ethidium bro- mide staining. Specificity of PCR was further confirmed by amplicon sequencing.

9.3. Detection of Treponema sp.

PCR-screening of salival DNA isolates for bovine DD-associated treponemes such as T. phagedenis, T. vincentii, T. medium, T. denticola and other genetically related treponemes, T. brennaborense and related oral Treponema species, and for T. pedis was performed with flaB2-, Brenn- and TPed-primers according to the protocols described by BRANDT et al. (2011a). In all PCR reactions, the following controls have been included: sterile water as ntc, equine skin DNA from healthy individuals as negative controls, and bovine DD DNA as Treponema positive control. Amplification products (16 μl aliquots) were analysed by electrophoresis on 1.5 % TAE agarose gels and ethidium bromide staining, with a 100 bp DNA ladder

(Fermentas, Vienna, Austria) serving as DNA molecular weight standard.

Amplicons of correct size were gel-purified using Qiaex II gel purification kit according to the man- ufacturer’s instructions (Qiagen). Then, successfully extracted amplicons were sent to VBC-Biotech

(Vienna, Austria) for sequencing.

9.4. Sequence analysis

Amplicon sequences were analysed using BLAST program provided by the National Centre for Biotech- nology Information (NCBI; http://blast.ncbi.nlm.nih.gov/). Then, a table was designed resuming all PCR results and showing the best alignment hit for every sequence and the corresponding percentage of similarity. Sequences were regarded as identifiable for percentages of similarity of ≥ 95, and as similar for lower percentages.

32 Part IV. Results

Part IV.

Results

An overall of 27 horses were enrolled in the study and assigned to three different groups, i.e. the EOTRH patient-group (P-group; n=10), the group of further horses (F-group; n=8) being affected by EOTRH but not meeting all inclusion criteria of the P-group, and the disease-free control group (C-group; n=9).

10. Information provided by owners

Owners were interviewed concerning management, diet and anamnesis of the horses. In case of one individual from the F-group, the owner was not available for interview. The information obtained by owners is summarised below:

• Stabling: Most horses were kept in box stalls, some were also kept in open barns (P-group: two

horses, F-group: two horses, C-group: one horse). All but two horses of the C-group also had

access to grass paddocks.

• Feeding: All horses were fed on hay. One horse of the P- and two horses of the F-group addi-

tionally received hay pellets. One horse of the P-group was fed with silage and hay. Concentrates

were fed as well, mostly oats, muesli or pellets.

• Performance: Eight of ten patients were still ridden, with two of them being ”heavy on the bit”,

as noted by their owners. In the F-group, all horses were still ridden, with one being a head-shaker.

In the C-group, no performance problems were encountered.

• Weight loss: Three patients and one further horse showed signs of weight loss before presentation.

For the other 23 horses, no weight loss was observed.

• Mastication problems: In the P-group, six of ten horses showed problems with mastication. In

four of these six horses, the owners reported that the horses were unable or unwilling to snap hard

food material like carrots or dry bread. This symptom was variable and improved after extraction

33 Part IV. Results

Table 7: Duration of symptoms before presentation, in months

P-group (n=10) F-group (n=7) Mean ± SD 10.5 ± 18.0 3.9 ± 3.3 Median 14.0 3.0

of affected incisors. One horse was chewing very slowly but was able to snap hard feeds with-

out problems. Masticatory problems were also encountered in three horses of the F-group: two

were unable to snap hard feeds, one showed prolonged chewing movement with phases of mouth

opening, and one was quidding. None of the control horses showed any problems with mastication.

• Drinking problems: One of 10 horses of the P-group and of two further horses were unable to

use the automatic drinker. One horse of the patient group resented drinking cold water.

• Onset of symptoms: Symptoms were only present in the P- and F-group. The onset and duration

of symptoms until presentation is shown in Table 7.

In most cases the disease has been noted some months before presentation. In one patient and in

two further horses, the owner did not notice any problems. In these cases, signs of periodontitis

were recognised in the course of routine dental examination at the Equine Clinic, Vetmeduni

Vienna. In six patients and one further horse, the disease was diagnosed by the referring veterinar-

ian.

• Previous extractions: In four patients and four further horses extractions have already been per-

formed either at the Vetmeduni Vienna, or by the referring veterinarian. In these cases, therapeutic

intervention resulted in a decrease of clinical symptoms.

11. Clinical findings

11.1. General findings

The study mainly comprised Warmblood horses. The P-group consisted of eight Warmblood horses, one

Icelandic horse and one Shetland pony, the F-group of five Warmblood horses, one Icelandic horse, one

34 Part IV. Results

Table 8: Age of horses, in years

P-group (n=10) F-group (n=8) C-group (n=9) Mean ± SD 20.2 ± 3.2 21.9 ± 4.4 18.0 ± 1.7 Median 20.5 20.5 18.0

Table 9: Weight of horses, in kilogrammes

P-group (n=8) F-group (n=6) C-group (n=9) Mean ± SD 510.7 ± 115.2 497.6 ± 91.4 574.7 ± 106.5 Median 537.0 535.0 585.0

Fjord horse and one German Riding pony. In the C-group six of nine horses were Warmblood horses, whereas the other three were a Draft horse, an Appaloosa and a German Riding pony.

In the patient group all horses were geldings, the group of further horses comprised six geldings and two mares. In the control group, four animals were geldings and five were mares. Mean and median ages of enrolled horses are shown in Table 8. In general, horses of the F-group were older whereas horses of the C-group tended to be younger.

Weight was measured for eight of ten horses of the P-group, six of eight of the F-group, and for all control horses. Mean and median weights of enrolled horses are outlined in Table 9.

All horses were generally unremarkable at clinical and neurological examination with a few minor problems being noted. Most notably, five patients, three further horses and three control horses were slightly lame on trot. In two further horses, a heart murmur was audible but no clinical symptoms were present. In one patient, suspected Cushing’s disease was ruled out by ACTH analysis. The haematologi- cal parameters of the majority of horses ranged within normal limits.

11.2. Dental disease-related findings

In all patients and seven of eight further horses, mild to severe gingivitis was present. Gingivitis was more pronounced around teeth displaying gingival retraction. All patients and seven further horses exhibited moderate to severe retraction of gingiva. In one horse of the F-group (“Biv”), the gingiva was slightly retracted, but otherwise unchanged.

Gingival pockets were mainly observed adjacent to third maxillary or mandibular incisors (-03 after

35 Part IV. Results

Triadan). The pockets‘ depth was measured by insertion of periodontal probe, which was frequently difficult to accomplish due to the bumpiness of the tissue, and sometimes led to slight bleeding. In seven of ten patients, pockets were found and measure whereas only one of eight further horses exhibited periodontal pockets (F1, 3mm). Measured pocket depths varied between patient horses as outlined in

Table 10.

Table 10: Pocket depth in patient horses, in millimetres

Patient horses Pocket depth P1 10 P2 15 P3 3 P4 0 P5 0 P6 10 P7 3 P8 0 P9 4 P10 10 Mean ± SD 5.5 ± 5.3 Median 4

Four of ten patients and one of eight further horses presented with dental fistulae. Mild to moderate swellings of the mandibular and/or maxillary alveolar processes were noted in eight patients and four further horses, and mainly occurred in the maxillary region. In one of these further horses (“Biv”), the bulbous enlargements of the tooth roots were massive in all teeth. Discolouration of teeth was noted in five horses of the P-group and in six horses of the F-group mainly seen in regions were gingival retraction had led to exposure of the reserve crowns. Carious lesions were found on the labial aspects of the first maxillary incisors of three patients and five further horses. Three patients and one horse of the F-group also revealed fractured incisors and particularly pronounced gingival inflammation at these sites. Three patients and one further horse presented with diastemata between incisors. The incidence of calculus varied between individuals of the P and F-group; no calculus was present in two and five horses respectively, three horses of the P-group and one horse of the F-group were affected by mild, four individuals of the P-group by moderate and one patient and two further horses by severe calculus

36 Part IV. Results formation.

In two horses of the P-group and in three horses of the F-group, the canines exhibited signs of peri- odontitis. In all of these canines, retraction of the gingiva, tooth movement and fistula formation were present.

In none of the patients or further horses, major dental related findings of the cheek teeth were present.

All control horses had normal dental findings displaying only mild irregularities of dental wear in the cheek teeth region (i.e. ramps, hooks, exaggerated transverse ridges).

11.3. Radiological findings

Of all 27 horses, intraoral radiographs were available for evaluation. For one of eight further horses, radiographs of the mandibular incisors were missing. In four of ten patients and in two of eight further horses, latero-lateral and oblique views were also taken.

One radiograph was taken for the maxilla and for the mandible each. The canines – if existent – were not completely visible in all radiographs. Therefore, radiological evaluation of the canines was not performed in this study.

Radiological findings of the maxillary and mandibular incisors lead to disease classification (see Ta- bles 11, 12, and 13).

Table 11: Radiological findings on the lamina dura dentis of patient horses

ID Osteosclerosis Osteolysis Grade of irregularity P1 m WNL S P2 M m M P3 m M M P4 m S S P5 S S S P6 M m M P7 m m M P8 m WNL M P9SMS P10 S m M WNL - within normal limits, m - mild, M - moderate,S-severe

Affection of the lamina dura dentis showed a very irregular pattern. In none of the patient horses, yet

37 Part IV. Results

Table 12: Radiological findings on the lamina dura dentis of further horses

ID Osteosclerosis Osteolysis Grade of irregularity F1 M M S F2 S WNL S F3 M m S F4 m WNL m F5 m m m F6 WNL WNL m F7 m m M F8 m m M WNL - within normal limits, m - mild, M - moderate,S-severe

in three of eight further horses, the lamina dura dentis was at least partly intact. In the other horses of the F-group and all P-group horses the lamina dura dentis was pronouncedly irregular and often showed widening (osteosclerosis of the lamina) and/or osteolysis.

Table 13: Radiological findings on the periodontal ligament and the teeth of patient horses

PDL Teeth ID Widening Hypercementosis Resorption P1 M m M P2mMm P3 m m m P4SMS P5 S M m P6 m m m P7 m m M P8 M M S P9 S m S P10 S M S WNL - within normal limits, m - mild, M - moderate,S-severe

The periodontal ligament space was widened in all patient horses, mildly in four, moderately in two and severely in four patients. In the F-group, no changes were visible in two individuals, in one horse changes were mild, in two moderate and in three severe. Hypercementosis was seen in all horses but one, but in many cases (five of ten patients, four of eight further horses) hypercementosis was only mild.

38 Part IV. Results

Table 14: Radiological findings on the periodontal ligament and the teeth of further horses

PDL Teeth ID Widening Hypercementosis Resorption F1 S m M F2 S S m F3 S M M F4 M m m F5 m m m F6 WNL m WNL F7 WNL WNL WNL F8 M M m WNL - within normal limits, m - mild, M - moderate,S-severe

Severe hypercementosis was only noted in one horse of the F-group (“Biv”).

Table 15: Evidence for fracture or pulp exposure

Patients Further horses ID Fracture Pulp exposure ID Fracture Pulp exposure P1 n n F1 n n P2 n n F2 n n P3 n n F3 y y P4 y y F4 n n P5 n n F5 n n P6 n n F6 n n P7 y n F7 n n P8 y y F8 n n P9 n y - - - P10 y y - - - n-no,y-yes

Investigation for tooth fractures was difficult because of the moth-eaten appearance of the resorptive parts. In four patients and in one further horse fractures were suspected. In one of those five horses, the clinical crown was lost and the at presentation only the tooth root in the alveoli and part of the residual crown were left. In another patient the fracture was seen as a typical fine line in radiography at the level of the gingival margin whereas in the remaining three horses one or more lines were suspected in the tooth roots or resorptive crown but very hard to distinguish because of the moth-eaten appearance. No

39 Part IV. Results fractures of the clinical crowns were found. In four patients and in one further horses there was evidence for pulp exposure because of massive resorptive lesions.

Control horses revealed no changes on radiographs.

12. Molecular biological findings

Following beta-actin PCR of DNA isolates which confirmed their PCR compatibility (data not shown), the samples were screened for the presence of herpesviral DNA using type-specific and consensus primers. Whereas all samples scored consistently negative by specific PCR, consensus nested PCR tested positive for DNA isolates P2a, P2b, and P5a. Sequencing of corresponding amplicons identified the latter as genomic EHV-1 fragments.

FlaB-PCR of salival DNA samples scored positive for four patients (P3a, b; P4a, b; P8b; P10a, b) and one further horse (F3a, b), whilst all control horses tested negative. In six cases, amplified DNA sequences were 80 to 98 % similar to Treponema medium ssp.. In one case, a similarity of 94 % to

T. denticola was observed (P8b). The amplicon obtained for P10a could not be identified because it presented as a mixture of different Treponema-like sequences.

Brenn-PCR scored positive for all patients and almost all duplicates, with P4b and P8a being the sole exceptions. In addition 3 of 8 further horses (F2a, b; F3a, b; F7a) as well as 4 of 9 control horses (C1a;

C5b; C6a, b; C9b) tested positive by this assay. Detected sequences revealed 94 to 99 % homology to human oral Treponema clones JU025 and OMZ 840, or T. pectinovorum.

T. pedis-PCR scored negative for all salival DNA samples. Accordingly, this result is not displayed in Tables 16, 17, and 18, which outlines above described flaB2- and Brenn-PCR as well as amplicon alignment results in more detail.

From these results, an overall Treponema DNA detection score has been determined as shown in

Table 19.

40 Part IV. Results : Trep. oral clone JU025 (94 %) : Trep. sp. OMZ 840 (99 %) : Trep. oral clone JU025 (96 %) : Trep. sp. OMZ 840 (98 %) : Trep. sp. OMZ 840 (97 %) : Trep. oral clone JU025 (94 %) : Trep. sp. OMZ 840 (99: %) Trep. oral clone JU025 (98: %) Trep. oral clone JU025 (98 %) : Trep. oral clone JU025 (98: %) Trep. oral clone JU025 (98 %) : Trep. oral clone JU025 (97 %) : Trep. sp. OMZ 840 (99 %) : Trep. pectinovorum OMZ831 (99 %) : Trep. pectinovorum OMZ831 (99 %) : Trep. pectinovorum OMZ831 (99 %) : Trep. pectinovorum OMZ831 (99 %) : Trep. pectinovorum OMZ831 (99 %) DNA in patient horses Treponema Detection of new sequences; Underlined: Genbank Accession numbers; 0: PCR-negative / Table 16: : Trep. medium ssp. bovis (80: %) Trep. medium ssp. bovis (80 %): Trep. medium ATCC (89 %) AY349417 AY349417 0 : Trep. medium ssp. bovis (85 %) AF302940 : Trep. denticola (94 %) AY369248.1 95 %: Heterogeneous sequences < a heterogeneous AF302940 aa 0a 0a EF061274 a heterogeneousa 0a 0a0 0a 0 AY349417.1 AY369248.1 AF302940 AF302940 0 AY349417 AY349417.1 AY369248 bb EF061285 0b EF061274 AY349417 bb 0 0b 0 AY349417 AY369248 AY349417 b EF061274 b 0b 0 AF302940 AY369248.1 b AJ277353 ID flaB2-PCR and amplicon alignment results Brenn-PCR and amplicon alignment results P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 Similarity

41 Part IV. Results : Trep. pectinovorum str. ATCC 33768 (98 %) : Trep. oral clone JU025 (97 %) : Treponema sp. OMZ 839 (96 %) : Trep. pectinovorum OMZ831 (97 %) : Trep. pectinovorum OMZ831 (99 %) DNA in further horses Treponema Detection of new sequences; Underlined: Genbank Accession numbers; 0: PCR-negative / Table 17: : Trep. medium ATCC (98 %): Trep. medium ATCC (97 %) AF302940 AY349417 95 %: Heterogeneous sequences < a0aa 0a0 EF061285.1 a0a0aa0 0 0 0 GU562449 0 0 0 AY369247 b 0 AF302940 b EF061285.1 b0 0 b0b0b0b0b0 0 0 0 0 0 ID flaB2-PCR and amplicon alignment results Brenn-PCR and amplicon alignment results F1 F2 F3 F4 F5 F6 F7 F8 Similarity

42 Part IV. Results : Trep. pectinovorum ATCC 33768 (95 %) : Trep. pectinovorum ATCC 33768 (99 %) : Trep. oral clone JU025 (97 %) : Trep. sp. IV:18:C9 (97 %) : Trep. pectinovorum OMZ831 (99 %) DNA in control horses Treponema Detection of new sequences; Underlined: Genbank Accession numbers; 0: PCR-negative / Table 18: 95 %: Heterogeneous sequences < aa0 0a0a0a0aa0 0a0a0 0 0 AF023042 0 0 0 0 AF302940 0 b0b 0 0 AY349417 b0b0b0b 0b0b0b 0 0 0 0 0 GU562449 0 GU562449 ID flaB2-PCR and amplicon alignment results Brenn-PCR and amplicon alignment results C1 C2 C3 C4 C5 C6 C7 C8 C9 Similarity

43 Part IV. Results

Table 19: Overall results

Study group Treponema sp. % EOTRH patient group 10/10 100.00 Further EOTRH-affected horses 3/8 37.50 Total of affected horses 13/18 68.75 Control group 4/9 44.44

44 Part V. Discussion

Part V.

Discussion

In horses, periodontitis of the cheek teeth shares many features with human periodontitis. It is usually caused by misplaced teeth and food pocketing, leading to inflammation and consequent destruction of the periodontal ligament as seen in human periodontitis. In both diseases, tooth attachment gets lost whilst the tooth itself only exhibits minor changes (CRESPO ABELLEIRA et al., 1999).

EOTRH is a particular form of periodontitis. It mainly affects the incisors and the canines and in rare cases the premolars. Remarkably, destructive processes not only affect the periodontal ligament and the tooth attachment but also the tooth itself (STASZYK et al., 2008). During resorptive processes the tooth is disintegrated, sometimes leading to exposure of the pulp cavity. In the case of hypercementosis- formation, the tooth roots become pronouncedly enlarged. Hence, EOTRH comprises a periodontic and an endodontic compound, whereas equine periodontitis of the cheek teeth and human periodontitis are mainly periodontal diseases (KLUGH, 2005; SAVAGE et al., 2009).

In humans, hypercementosis constitutes a rare event (NAPIER SOUZA et al., 2004). In contrast, substantial accumulation of cement around the roots of the incisors and canines represents a common variant of EOTRH (STASZYK et al., 2008; SIMHOFER and ROS, 2011). In the herein described study, clinical examination of most EOTRH-affected horses revealed inflammation with reddening and retrac- tion of the gingiva, fistula formation and tooth mobility. On radiography, resorptive lesions of variable degree were dominant findings, whereas hypercementosis was usually mild to moderate. However, the individual “Biv” exhibited only slightly retracted gingiva with no signs of inflammation being apparent.

The teeth were firmly embedded in the alveoli, digital palpation provoked mild signs of pain. The alve- olar parts of the maxillary and mandibular incisors protruded massively. On radiological examination, pronounced hypercementosis was found to affect the tooth roots of all incisors and canines, whilst only mild resorptive lesions were noted.

Presence of pronounced hypercementosis in EOTRH-affected horses and lack of cement accumula- tion in human periodontitis patients may be due to the anatomical differences of the human and equine dentition. Human teeth are brachydont whereas equine teeth are hypsodont, which means that the teeth

45 Part V. Discussion erupt during the horses’ whole lifetime. This continuous eruption is triggered by the periodontal liga- ment, which thus has a more active role when compared to any brachydont dentition (STASZYK et al.,

2011). This activity may be the reason for the accumulation of massive amounts of cement as a repara- tive measure counteracting tooth loss. In some cases, this effort is successful and the teeth remain firmly embedded in the alveoli, within massive accumulations of cement. Inflammation ameliorates, only mild gingivitis is observed. In other cases, attachment loss progresses despite hypercementosis-formation and the tooth is lost (STASZYK et al., 2008). Since the hypercementotic form of EOTRH differs to some extent from the classical form of the disease, a further distinction between resorptive and the hyperce- mentotic EOTRH is proposed.

In man, various risk factors for periodontal disease have been identified, including advanced age and genetic factors, as well as socio-economic status, poor dental hygiene, smoking, obesity, diabetes melli- tus, osteopenia/osteoporosis, and HIV-infection (ARMITAGE, 1999). Whilst some of these predisposing factors cannot apply to horses, it can be speculated that e.g. age, malnutrition, obesity/equine metabolic syndrome (EMS) or Cushing’s disease may likewise act periodontitis-promoting factors. In humans, the occurrence of periodontitis significantly correlated with advanced age. This is thought to be due to pro- longed exposure of the dentition to risk factors (BURT, 2005). A similar scenario is seen in equines. The this study, horses with EOTRH were older than control animals.

Men develop periodontitis more commonly than women, possibly because they tend to underestimate the benefits of dental care (BURT, 2005; BORRELL and PAPAPANOU, 2005, and references within). In our study, male horses were over-represented (ten of ten patients, six of eight further horses). Despite the comparatively small size of the study groups, this observation may be suggestive for males being more susceptible to the disease than females (M. KOWELKA, personal communication). On the other hand, changes in hormonal status (i.e. puberty, pregnancy, menopause), which predominantly affect women, may trigger the progression and severity of periodontal disease (BURT, 2005).

Interestingly, human patients with a specific genotype of the polymorphic IL-1 gene cluster are more likely to develop severe forms of periodontitis than individuals lacking this genotype (BORRELL and

PAPAPANOU, 2005). In horses, no genetically predisposing factors have been identified thus far. How- ever, there are indications for certain horse breeds being particularly predisposed to periodontal disease.

For instance, a higher incidence of EOTRH has been reported for Icelandic horses (M. KOWELKA, per-

46 Part V. Discussion sonal communication). However, in-depth studies are needed to confirm this observation and to elucidate whether this putative predisposition would be genetically determined or feed-depending.

The dentition of omnivores and carnivores is designed to resist mechanical abrasion, with tooth roots being covered by cement and the crowns by enamel. At the cemento-enamel junction, dental plaque frequently accumulates. Plaque consists of microorganisms and extracellular matrix, i.e. proteins, long chain polysaccharides and lipids. Plaque mineralizes to calculus, which in turn may entail gingivitis and, as a consequence, pave the way for periodontal disease. Calculus may equally affect the dentition of horses, yet, due to their herbivorous mode of nutrition, its composition differs from that of carnivore and omnivores and is much softer (WHITE, 1997; WEISS, 2007). In equines, calculus is not as important in the development of periodontitis as in humans (KLUGH, 2005) although in depth studies are missing. It is most often found around canines. This may explain why canines also tend to be affected by EOTRH although no pressure is exercised on the canines’ periodontal ligament. Further studies are needed to elucidate this topic.

Of the 27 horses enrolled in this study, 18 exhibited symptoms of periodontitis of the anterior dentition.

However, after collection of the first samples, it became clear that a significant percentage of affected horses would not be fully representative because of having other age-related health problems possibly distorting results. Notably Cushing’s disease is more common in the geriatric horse (BROSNAHAN and PARADIS, 2003). There is evidence for older equines having increased cortisol levels, which in turn impair immunological functions (DONALDSON et al., 2005). For this reason, a group of further patients (F-group) has been created, to which not fully representative EOTRH-affected individuals such as Cushing’s patients were assigned.

Periodontitis of the anterior dentition was an incidental finding especially in horses, which were pre- sented because of weight loss. Grass pellets were supplemented as an energy source in one patient and two further horses. Oral medication was often applied to treat suspected of diagnosed diseases causing the wasting. Some horses received cimetidine for treatment of EGUS (equine gastric ulcer syndrome) or as a prophylactic therapy (“Dam”, “Ger”), others pergolide (“Fja”, “Biv”), a dopamine receptor agonist, for treatment of Cushing’s disease. Interference of these medications with the bacterial and viral flora of the saliva could not be ruled out so that these horses were assigned to the F-group.

In the typical EOTRH patient, symptoms were visible in the entire anterior dentition (mandibular and

47 Part V. Discussion maxillary incisors). The disease mainly affects the third teeth after Triadan (M. KOWELKA, personal communication). This is concurrent with equine literature (BARATT, 2007). In three horses of the

F-group (“Dam”, “Mor”, “Ger”) symptoms were more pronounced around one tooth, with mild to no symptoms noted for the adjacent teeth. The most affected tooth was displaced of fractured in all three cases. The lesions found were likely to be a result of the inflammation because of the displaced or fractured tooth, so that the diagnosis of EOTRH could not be fully confirmed. Other maxillary and mandibular incisors were more or less unchanged. Irregularity of the lamina dura dentis was even evident in some areas of the otherwise unchanged dentition.

All owners except for one were available for an interview. Some owners noticed symptoms of EOTRH in their horses. Yet, in the majority of cases, diagnosis was established by the referring veterinarian or veterinarian at the Vetmeduni Vienna in the course of a routine dental examination. In cases where symp- toms were noted by the owners, a major observation was that the horse as unable to snap hard food ma- terial. This finding is also reflected by the literature describing EOTRH as a painful disease (STASZYK et al., 2008; SIMHOFER and ROS, 2011). Presence of blisters or retraction of the gingiva was equally described by owners in accordance with SIMHOFER and ROS (2011).

Human periodontitis is a common, multifactorial disease induced by a polybacterial infection entailing the release of inflammatory cytokines, chemokines and mediators, some of which promote the destruc- tion of the periodontium (HOLT and EBERSOLE, 2005). Studies on bacterial colonization of the human oral cavity have revealed distinct bacterial communities in association with healthy gingiva, gingivitis and periodontitis (HAFFAJEE and SOCRANSKY, 1994; HAFFAJEE et al., 1998; SORKIN and NIE-

DERMAN, 1998; SOCRANSKY et al., 2002). Six bacterial clusters have been identified (SOCRAN-

SKY and HAFFAJEE, 2002), with the bacteria of the red complex, i.e. Porphyromonas gingivalis,

Treponema denticola and Tannerella forsythia, concomitantly occurring with signs of periodontal dis- ease (DUMITRESCU and KAWAMURA, 2010). Periodontitis is also found in dogs and cats and usu- ally associated with the presence of Treponema ssp. clusting with phylogenetic groups (PASTER and

DEWHIRST, 2006) I, II and IV of oral treponemes and groups VI and VII comprising T. socranskii and

T. pectinovorum (RIVIERE et al., 1996; VALDEZ et al., 2000; NORDHOFF et al., 2008).

Treponema ssp. DNA was detected in 100 % of patients, 37.5 % of further horses and 44.4 % of con- trol horses. Treponemes identified from affected horses mainly clustered within the phylogenetic groups

48 Part V. Discussion

I(T. medium), II (T. denticola), VIII (T. pectinovorum) and IV (PASTER and DEWHIRST, 2006). Whilst members of the groups VI and VII usually inhabit the oral cavity of periodontitis-affected humans, cats and dogs (PASTER and DEWHIRST, 2006), they are not detected in the frame of this equine study. Yet,

DNA sequences homologous or similar to Treponema clones OMZ 840 (Group IV; GenBank Accession nr. AY369248) were amplified from five samples derived from three patients (P2, P8, P9). This is worth emphasizing insofar as this clone is usually reported in association with canine periodontitis (VALDEZ et al., 2000). Group IV oral clone JU025 (also termed Treponema oral taxon 490) was detected from ten samples derived from 5 patients, one further and one control horse. In concert with T. pectinovo- rum, clone JU025 represented the most frequently detected treponeme. T. pectinovorum alike JU025 is frequently found in the oral cavity of human periodontitis patients (HOLT and EBERSOLE, 2005), yet, it also occurs in bovine digital dermatitis lesions (BRANDT et al., 2011a). Presence of the same

Treponema sp. in different species (e.g. in humans, bovines, equines and dogs) and locations (e.g. in the oral cavity, claws) raises the question as to how these treponemes are transmitted and whether asso- ciated disorders can be regarded as diseases of civilization. Human periodontic bacteria are transmitted by nasal or oral contact or via aerosol. A similar propagation mode can be perceived for animals. Nose contact to different body sites, e.g. the nose or the external genitals is very common in horses, cats and dogs. Especially the genital area is frequently inhabited by treponemes (EDWARDS et al., 2003) and may hence serve as possible propagation source.

The finding of oral treponemal infection in ten of ten EOTRH-affected horse is suggestive for these bacteria contributing to disease onset and/or progression. A lower occurrence of Treponema sp. has been observed for the F-group. This is interesting in so far as it matches with clinical and radiological data collected for individuals “Mar”, “Mor” and “Dam”, which is presented with only one displaced or fractured incisor showing signs of EOTRH whilst the remaining dentition was rather unremarkable.

As Treponemal DNA was detected in none of these individuals, it may be argued that the diagnosis of

EOTRH is incorrect. Individual “Sca” presented with only mild symptoms of EOTRH and had its gums treated with Chlorhexidine, a fact which may account for this horse testing negative by Treponema PCR.

A negative result was also obtained for “Fja”, a 29 years of Cushing-affected Icelandic horse with moderate EOTRH disease. In the frame of a distinct project, crevicular fluid of this individual scored markedly positive for Tannerella forsythia, another member of the human periodontitis-related red com-

49 Part V. Discussion plex. From this, it may be deduced that Tannerella infection may have contributed to disease in this animal (S. BRANDT, personal communication). From nine control horses, four horses tested positive by TBrenn- and none by flaB-PCR. Three of these horses suffered from RAO (information by owner) and are seasonally treated with prednisolone. It is thinkable that this circumstance may have acted as factor predisposing for oral treponemal infection. Yet, the finding of treponemes in a certain percentage of EOTRH-free individuals may simple represent a natural phenomenon. Is is common knowledge that infection by a pathogen not necessarily entails the outbreak of disease in every individual. Alternatively, it is thinkable that these horses may develop periodontal disease in the future, provided that treponemal infection constitutes a primary event in the onset of disease.

In humans with periodontal disease, the presence of viruses was confirmed (PARRA and SLOTS,

1996; CONTRERAS et al., 2000; CONTRERAS and SLOTS, 2000) although it is doubted whether there is an aetiologic association of viruses and periodontal disease. In this study, the incidence of herpesvirus detection was low; two patients score positive for EHV-1 whereas all other horse scored negative. This makes an aetiological role of herpesvirus in EOTRH unlikely. However, sample collection was only performed once for each horse. Herpesviruses are known exhibit latency periods (CAPPUYNS et al.,

2005) where no virus DNA is detectable. In further studies multiple samples of each individual should be taken at different time points.

It is still not known why some horses develop EOTRH whereas others don’t. It is also unclear whether all horses of a herd exhibit the same oral microbiome. EOTRH is certainly not an endemic disease, as confirmed by a recent study (H. SIMHOFER, personal communication). The individual immune status very likely represents a crucial factor, which in turn is influenced by genetic parameters as well as age and living conditions. It is accepted today, that secretory immunoglobulin antibodies (sIg), in particular sIgA and to a lesser extent sIgM, efficiently protect body cavities from infection by pathogenic microorganisms and their toxins (BRANDTZAEG, 2010). For example, there is evidence for salivary sIgA levels being significantly higher in children with Streptococcus mutans-induced dental caries, suggesting that sIgA has an important role in the control of caries disease (RANADHEER et al., 2011). In general, it seems that salivary IgA levels reflect the immunological intraoral defence potential (DE SOUZA-GUGELMIN et al., 1995). From this point of view, it can be speculated that equines with reduced intraoral secretion of sIgs are more susceptible to periodontal disease. This assumption is corroborated by KOSS et al.

50 Part V. Discussion

(2009) who detected significantly lower salival sIgA levels in humans affected by moderate to severe periodontitis than in healthy individuals. In this context, it seems not thus surprising, that older people and horses are more frequently affected by periodontal disease, as aged individuals show declines in many aspects of protective immunity (MILLER, 1996).

To our knowledge, this is the first report on the detection of Treponema sp. from gingival crevicular

fluid of periodontitis/EOTRH-affected horses versus equines without clinical signs of periodontal dis- ease. Our findings are indicative for treponemes playing an aetiologic role in periodontal disease, as already established for human periodontitis-affected patients. This work currently forms the basis for on-going in-depth investigations aiming at confirming this assumption and gaining more insight as to the exact mechanisms by which treponemes, and possibly other members of the red complex, contribute to equine periodontitis and EOTRH as particular form of disease.

51 Part VI. Summary

Part VI.

Summary

Human periodontitis is a multifactorial disease. Studies have shown that anaerobic bacteria, most notably treponemes, and possibly herpesviruses are chiefly involved in disease onset and progression by inducing the release of chemokines, cytokines and immune mediators, which in turn promote the destruction of periodontal ligament. EOTRH is a special form of equine periodontitis of thus far unknown aetiology.

The main objective of this study was to investigate the possibility of treponemes and herpesviruses being also associated with EOTRH. To this aim, crevicular fluid and saliva was collected from a total of 27 horses, with 18 being affected by EOTRH and nine control horses showing no signs of periodontal dis- ease. Herpesvirus-specific PCR revealed EHV-1 DNA in only two of ten patient horses, whilst remaining

EOTRH-affected and control horses scored negative. In contrast, ten of ten patients with manifest disease and three of eight further EOTRH-affected horses, as well as four of nine control horses scored positive for Treponema sp. DNA. Detected treponemes mainly comprised human oral Treponema clones and T. pectinovorum. These data are suggestive for Treponema sp. having a causative role in the development of EOTRH.

52 Part VII. Zusammenfassung

Part VII.

Zusammenfassung

Humane Periodontitis ist eine multifaktorielle Erkrankung, fur¨ die unter anderem eine bakterielle und eventuell auch virale Atiologie¨ nachgewiesen wurde. Die Erreger losen¨ eine starke Entzundungskaskade¨ aus, die zu einer Zerstorung¨ des periodontalen Apparats fuhrt.¨ Sowohl Treponemen als auch Her- pesviren (Epstein-Barr-Virus, Zytomegalovirus) wurden im Zusammenhang mit humaner Periodontitis nachgewiesen. EOTRH ist eine Spezialform der equinen Periodonititis, fur¨ die ebenfalls eine multifak- torielle Atiologie¨ vermutet wird. Das Ziel dieser Studie war mittels PCR festzustellen, ob Treponemen und/oder Herpesviren im Speichel von gesunden und EOTRH-erkrankten Pferden nachgewiesen wer- den konnen.¨ Im Rahmen der Studie wurde Krevikularflussigkeit¨ und Speichel von 27 Pferden entnom- men, wobei 18 an EOTRH litten, wahrend¨ neun Kontrollpferde keinerlei Symptome einer periodontalen

Erkrankung aufwiesen. Herpesvirus PCR testete lediglich fur¨ zwei Patientenproben positiv, wobei jew- eils equines Herpesvirus Typ 1 nachgewiesen wurde. Treponema DNS wurde hingegen bei zehn von zehn Patienten mit manifester EOTRH und bei drei von acht weiteren erkrankten Tiere detektiert sowie in vier von neun Kontrollpferden. Es handelte sich bei den detektierten Spezies vorrangig um einen hu- manen Periodontitis-assoziierten oralen Treponema-Klon und um T. pectinovorum. Diese Daten liefern einen Hinweis darauf, dass Treponema sp. bei der Entstehung von EOTRH eine kausale Rolle spielen.

53 Bibliography

Bibliography

AAS, J. A., PASTER, B. J., STOKES, L. N., OLSEN, I. and DEWHIRST, F. E. (2005): Defining the

normal bacterial flora of the oral cavity. J Clin Microbiol 43, 5721–5732.

AMIT, R., MORAG, A., RAVID, Z., HOCHMAN, N., EHRLICH, J. and ZAKAY-RONES, Z. (1992):

Detection of herpes simplex virus in gingival tissue. J Periodontol 63, 502–506.

ARMITAGE, G. C. (1999): Development of a classification system for periodontal diseases and condi-

tions. Ann Periodontol 4, 1–6.

BAILEY, G. D. and LOVE, D. N. (1991): Oral associated bacterial infection in horses: studies on the

normal anaerobic flora from the pharyngeal tonsillar surface and its association with lower respiratory

tract and paraoral infections. Vet Microbiol 26, 367–379.

BAKER, G. J. (1970): Some Aspects of Equine Dental Disease. Equine Vet J 2, 105–110.

BAKER, G. J. (1979): A study of dental disease in the horse. PhD thesis, University of Glasgow, UK.

BARATT, R. M. (2007): Equine incisor resorptive lesions. Proceedings of the 21st Annual Veterinary

Dental Forum, 18th-21st October 2007, Minneapolis, USA, pp. 23–30.

BIENERT, A. (2002): Digitalradiographische, computertomographische und mikrobiologische Unter-

suchungen bei Backenzahnerkrankungen des Pferdes. PhD thesis, Tierarztliche¨ Hochschule Hannover,

Germany.

BODET, C., CHANDAD, F. and GRENIER, D. (2006): Inflammatory responses of a

macrophage/epithelial cell co-culture model to mono and mixed infections with Porphyromonas gin-

givalis, Treponema denticola, and Tannerella forsythia. Microbes Infect 8, 27–35.

BODET, C., CHANDAD, F. and GRENIER, D. (2007): Pathogenic potential of Porphyromonas gingi-

valis, Treponema denticola and Tannerella forsythia, the red bacterial complex associated with peri-

odontitis. Pathol Biol 55, 154–162.

BORRELL, L. N. and PAPAPANOU, P. N. (2005): Analytical epidemiology of periodontitis. J Clin

Periodontol 32 Suppl 6, 132–158.

54 Bibliography

BOUTAGA, K., SAVELKOUL, P. H., WINKEL, E. G. and VAN WINKELHOFF, A. J. (2007): Compar-

ison of subgingival bacterial sampling with oral lavage for detection and quantification of periodontal

pathogens by real-time polymerase chain reaction. J Periodontol 78, 79–86.

BRANDT, S., APPRICH, V., HACKL, V., TOBER, R., DANZER, M., KAINZBAUER, C., GABRIEL,

C., STANEK, C. and KOFLER, J. (2011a): Prevalence of bovine papillomavirus and Treponema DNA

in bovine digital dermatitis lesions. Vet Microbiol 148, 161–167.

BRANDT, S., HARALAMBUS, R., SCHOSTER, A., KIRNBAUER, R. and STANEK, C. (2008): Pe-

ripheral blood mononuclear cells represent a reservoir of bovine papillomavirus DNA in sarcoid-

affected equines. J Gen Virol 89, 1390–1395.

BRANDT, S., SCHOSTER, A., TOBER, R., KAINZBAUER, C., BURGSTALLER, J. P., HARALAM-

BUS, R., STEINBORN, R., HINTERHOFER, C. and STANEK, C. (2011b): Consistent detection of

bovine papillomavirus in lesions, intact skin and peripheral blood mononuclear cells of horses affected

by hoof canker. Equine Vet J 43, 202–209.

BRANDTZAEG, P. (2010): Update on mucosal immunoglobulin A in gastrointestinal disease. Curr

Opin Gastroenterol 26, 554–563.

BROSNAHAN, M. M. and PARADIS, M. R. (2003): Demographic and clinical characteristics of geri-

atric horses: 467 cases (1989-1999). J Am Vet Med Assoc 223, 93–98.

BRUDVIK, P. and RYGH, P. (1993): The initial phase of orthodontic root resorption incident to local

compression of the periodontal ligament. Eur J Orthod 15, 249–263.

BURT, B. (2005): Position paper: Epidemiology of Periodontal Diseases. J Periodontol 76, 1406–1419.

BYRNE, S. J., DASHPER, S. G., DARBY, I. B., ADAMS, G. G., HOFFMANN, B. and REYNOLDS,

E. C. (2009): Progression of chronic periodontitis can be predicted by the levels of Porphyromonas

gingivalis and Treponema denticola in subgingival plaque. Oral Microbiol Immunol 24, 469–477.

CALDWELL, L. A. (2007): Clinical features of chronic disease of the anterior dentition in horses.

Proceedings of the 21st Annual Veterinary Dental Forum, 18th-21st October 2007, Minneapolis, USA,

pp. 18–21.

55 Bibliography

CAPPUYNS, I., GUGERLI, P. and MOMBELLI, A. (2005): Viruses in periodontal disease-areview.

Oral Dis 11, 219–229.

CONTRERAS, A., NOWZARI, H. and SLOTS, J. (2000): Herpesviruses in periodontal pocket and

gingival tissue specimens. Oral Microbiol Immunol 15, 15–18.

CONTRERAS, A. and SLOTS, J. (2000): Herpesviruses in human periodontal disease. J Periodont Res

35, 3–16.

CONTRERAS, A., ZADEH, H. H., NOWZARI, H. and SLOTS, J. (1999): Herpesvirus infection of

inflammatory cells in human periodontitis. Oral Microbiol Immunol 14, 206–212.

CRESPO ABELLEIRA, A. C., RODRIGUEZ COBOS, M. A., FUENTES BOQUETE, I. M., CAS-

TANO OREJA, M. T., JORGE BARREIRO, F. J. and RODRIGUEZ PATO, R. B. (1999): Morpholog-

ical study of root surfaces in teeth with adult periodontitis. J Periodontol 70, 1283–1291.

DEWHIRST, F. E., TAMER, M. A., ERICSON, R. E., LAU, C. N., LEVANOS, V. A., BOCHES, S. K.,

GALVIN, J. L. and PASTER, B. J. (2000): The diversity of periodontal spirochetes by 16S rRNA

analysis. Oral Microbiology and Immunology 15, 196–202.

DIXON, P. M., BARAKZAI, S., COLLINS, N. and YATES, J. (2008): Treatment of equine cheek teeth

by mechanical widening of diastemata in 60 horses (2000-2006). Equine Vet J 40, 22–28.

DIXON, P. M., DU TOIT, N. and DACRE, I. (2011): Equine Dental Pathology. In: EASLEY, J., DIXON,

P.M., SCHUMACHER, J. (Eds.): Equine Dentistry. 3rd ed. Elsevier - Health Sciences Division, Ed-

inburgh, UK, pp. 129–148.

DIXON, P. M., TREMAINE, W. H., PICKLES, K., KUHNS, L., HAWE, C., MCCANN, J., MCGO-

RUM, B. C., RAILTON, D. I. and BRAMMER, S. (1999): Equine dental disease part 2: a long-term

study of 400 cases: disorders of development and eruption and variations in position of the cheek

teeth. Equine Vet J 31, 519–528.

DONALDSON, M. T., MCDONNELL, S. M., SCHANBACHER, B. J., LAMB, S. V., MCFARLANE,

D. and BEECH, J. (2005): Variation in plasma adrenocorticotropic hormone concentration and dex-

56 Bibliography

amethasone suppression test results with season, age, and sex in healthy ponies and horses. J Vet

Intern Med 19, 217–222.

DORSCH, M., LOVET, D. N. and BAILEY, G. D. (2001): Fusobacterium equinum sp. nov., from the

oral cavity of horses. Int J Syst Evol Microbiol 51, 1959–1963.

DUMITRESCU, A. L. and KAWAMURA, M. (2010): Etiology of Periodontal Disease: Dental Plaque

and Calculus. In: DUMITRESCU, A.L., INAGAKI, K., KAWAMURA, M. (Eds.): Etiology and

pathogenesis of periodontal disease. Springer Verlag, Berlin, Heidelberg, Germany, pp. 1–38.

EDWARDS, A. M., DYMOCK, D. and JENKINSON, H. F. (2003): From tooth to hoof: treponemes in

tissue-destructive diseases. J Appl Microbiol 94, 767–780.

EVANS, N. J., BROWN, J. M., DEMIRKAN, I., MURRAY, R. D., BIRTLES, R. J., HART, C. A. and

CARTER, S. D. (2009): Treponema pedis sp. nov., a spirochaete isolated from bovine digital dermatitis

lesions. Int J Syst Evol Microbiol 59, 987–991.

FABIAN, T. K., FEJERDY, P. and CSERMELY, P. (2008): Salivary Genomics, Transcriptomics and

Proteomics: The Emerging Concept of the Oral Ecosystem and their Use in the Early Diagnosis of

Cancer and other Diseases. Curr Genomics 9, 11–21.

FAVERI, M., MAYER, M. P., FERES, M., DE FIGUEIREDO, L. C., DEWHIRST, F. E. and PASTER,

B. J. (2008): Microbiological diversity of generalized aggressive periodontitis by 16S rRNA clonal

analysis. Oral Microbiol Immunol 23, 112–118.

FRANSSON, C., MOONEY, J., KINANE, D. F. and BERGLUNDH, T. (1999): Differences in the in-

flammatory response in young and old human subjects during the course of experimental gingivitis. J

Clin Periodontol 26, 453–460.

GILTHORPE, M. S., ZAMZURI, A. T., GRIFFITHS, G. S., MADDICK, I. H., EATON, K. A. and

JOHNSON, N. W. (2003): Unification of the ”burst” and ”linear” theories of periodontal disease

progression: a multilevel manifestation of the same phenomenon. J Dent Res 82, 200–205.

GOODSON, J. M. (1992): Diagnosis of periodontitis by physical measurement: interpretation from

episodic disease hypothesis. J Periodontol 63, 373–382.

57 Bibliography

GREEN, G. E. (1996): Inherent Defense Mechanisms in Saliva. J Dent Res 45, 624–629.

GREGORY, R. C., FEHR, J. and BRYANT, J. (2006): Chronic Incisor Periodontal Disease with Cemen-

tal Hyperplasia and Hypoplasia in Horses. Equine Dentistry - AAEP Focus Meeting, 30th July-2nd

August 2006, Indianapolis, USA, pp. 312–316.

GRIFFITHS, G. S. (2003): Formation, collection and significance of gingival crevice fluid. Periodontol

2000 31, 32–42.

HAFFAJEE, A. D., CUGINI, M. A., TANNER, A., POLLACK, R. P., SMITH, C., KENT, R. L. and

SOCRANSKY, S. S. (1998): Subgingival microbiota in healthy, well-maintained elder and periodon-

titis subjects. J Clin Periodontol 25, 346–353.

HAFFAJEE, A. D. and SOCRANSKY, S. S. (1994): Microbial etiological agents of destructive peri-

odontal diseases. Periodontol 2000 5, 78–111.

HARTL, B., HAINISCH, E. K., SHAFTI-KERAMAT, S., KIRNBAUER, R., CORTEGGIO, A.,

BORZACCHIELLO, G., TOBER, R., KAINZBAUER, C., PRATSCHER, B. and BRANDT, S.

(2011): Inoculation of young horses with bovine papillomavirus type 1 virions leads to early infection

of PBMCs prior to pseudo-sarcoid formation. J Gen Virol 92, 2437–2445.

HOFFMANN, T. (2006): Grundlagen der Parodontaldiagnostik und -therapie. In: REITEMEIER, B.,

SCHWENGER, N., EHRENFELD, M. (Eds.): Einfuhrung¨ in die Zahnmedizin. Georg Thieme Verlag,

Stuttgart, Germany, pp. 153–165.

HOLT, S. C. and EBERSOLE, J. L. (2005): Porphyromonas gingivalis, Treponema denticola, and Tan-

nerella forsythia: ”the red complex”, a prototype polybacterial pathogenic consortium in periodontitis.

Periodontol 2000 38, 72–122.

KLUGH, D. O. (2005): Equine Periodontal Disease. Clin Tech Equine Pract 4, 135–147.

KOSS, M. A., CASTRO, C. E., SALUM, K. M. and LOPEZ, M. E. (2009): Changes in saliva protein

composition in patients with periodontal disease. Acta Odontol Latinoam 22, 105–112.

KREUTZER, R., WOHLSEIN, P., STASZYK, C., NOWAK, M., SILL, V. and BAUMGARTNER, W.

(2007): Dental benign cementomas in three horses. Vet Pathol 44, 533–536.

58 Bibliography

KUMAR, P. S., GRIFFEN, A. L., BARTON, J. A., PASTER, B. J., MOESCHBERGER, M. L. and

LEYS, E. J. (2003): New bacterial species associated with chronic periodontitis. J Dent Res 82,

338–344.

MACKINTOSH, M. E. and COLLES, C. M. (1987): Anaerobic bacteria associated with dental abscesses

in the horse and donkey. Equine Vet J 19, 360–362.

MADINIER, I., DOGLIO, A., CAGNON, L., LEFEBVRE, J. C. and MONTEIL, R. A. (1992): Epstein-

Barr virus DNA detection in gingival tissues of patients undergoing surgical extractions. Br J Oral

Maxillofac Surg 30, 237–243.

MAGNUSSON, I., PERSSON, R. G., PAGE, R. C., DEROUEN, T. A., CRAWFORD, J. M., COHEN,

R. L., CHAMBERS, D. A., ALVES, M. E. and CLARK, W. B. (1996): A multi-center clinical trial of

a new chairside test in distinguishing between diseased and healthy periodontal sites. II. Association

between site type and test outcome before and after therapy. J Periodontol 67, 589–596.

MCCAUL, L. K., JENKINS, W. M. and KAY, E. J. (2001): The reasons for the extraction of various

tooth types in Scotland: a 15-year follow up. J Dent 29, 401–407.

MILLER, R. A. (1996): The aging immune system: primer and prospectus. Science 273, 70–74.

NAPIER SOUZA, L., MONTEIRO LIMA JUNIOR,´ S., GARCIA SANTOS PIMENTA, F., RO-

DRIGUES ANTUNES SOUZA, A. and SANTIAGO GOMEZ, R. (2004): Atypical hypercementosis

versus cementoblastoma. Dentomaxillofacial Radiol 33, 267–270.

NORDHOFF, M., RUHE, B., KELLERMEIER, C., MOTER, A., SCHMITZ, R., BRUNNBERG, L. and

WIELER, L. H. (2008): Association of Treponema spp. with canine periodontitis. Vet Microbiol 127,

334–342.

PAGE, R. C., OFFENBACHER, S., SCHROEDER, H. E., SEYMOUR, G. J. and KORNMAN, K. S.

(1997): Advances in the pathogenesis of periodontitis: summary of developments, clinical implica-

tions and future directions. Periodontol 2000 14, 216–248.

PARRA, B. and SLOTS, J. (1996): Detection of human viruses in periodontal pockets using polymerase

chain reaction. Oral Microbiol Immunol 11, 289–293.

59 Bibliography

PASTER, B. J. and DEWHIRST, F. E. (2006): The phylogenetic Diversity of the Genus Treponema. In:

RADOLF, J.D., LUKEHART, S.A. (Eds.): Pathogenic Treponema: Molecular and Cellular Biology.

Caister Academic Press, USA, pp. 9–18.

RADOLF, J. D., STEINER, B. and SHEVCHENKO, D. (1999): Treponema pallidum: doing a remark-

able job with what it’s got. Trends Microbiol 7, 7–9.

RANADHEER, E., NAYAK, U. A., REDDY, N. V. and RAO, V. A. (2011): The relationship between

salivary IgA levels and dental caries in children. J Indian Soc Pedod Prev Dent 29, 106–112.

RIVIERE, G. R., THOMPSON, A. J., BRANNAN, R. D., MCCOY, D. E. and SIMONSON, L. G.

(1996): Detection of pathogen-related oral spirochetes, Treponema denticola, and Treponema socran-

skii in dental plaque from dogs. J Vet Dent 13, 135–138.

SAKAMOTO, M., UMEDA, M., ISHIKAWA, I. and BENNO, Y. (2000): Comparison of the oral bac-

terial flora in saliva from a healthy subject and two periodontitis patients by sequence analysis of 16S

rDNA libraries. Microbiol Immunol 44, 643–652.

SAVAGE, A., EATON, K. A., MOLES, D. R. and NEEDLEMAN, I. (2009): A systematic review of

definitions of periodontitis and methods that have been used to identify this disease. J Clin Periodontol

36, 458–467.

SEXTON, W. M., LIN, Y., KRYSCIO, R. J., DAWSON, D. R., EBERSOLE, J. L. and MILLER, C. S.

(2011): Salivary biomarkers of periodontal disease in response to treatment. J Clin Periodontol 38,

434–441.

SIMHOFER, H. and ROS, K. (2011): Schneidezahne,¨ Hengstzahne¨ und Laden. In: VOGT, C. (Ed.):

Lehrbuch der Zahnheilkunde beim Pferd. Schattauer GmbH, Stuttgart, Germany, pp. 125–182.

SLOTS, J. (2010): Human viruses in periodontitis. Periodontol 2000 53, 89–110.

SOCRANSKY, S. S. and HAFFAJEE, A. D. (2002): Dental biofilms: difficult therapeutic targets. Peri-

odontol 2000 28, 12–55.

SOCRANSKY, S. S., HAFFAJEE, A. D., CUGINI, M. A., SMITH, C. and KENT, R. L. (1998): Micro-

bial complexes in subgingival plaque. J Clin Periodontol 25, 134–144.

60 Bibliography

SOCRANSKY, S. S., SMITH, C. and HAFFAJEE, A. D. (2002): Subgingival microbial profiles in re-

fractory periodontal disease. J Clin Periodontol 29, 260–268.

SORKIN, B. C. and NIEDERMAN, R. (1998): Short chain carboxylic acids decrease human gingival

keratinocyte proliferation and increase apoptosis and necrosis. J Clin Periodontol 25, 311–315.

DE SOUZA-GUGELMIN, M. C., ITO, I. Y. and MAIA CAMPOS, G. (1995): Creation of the gingival

immunologic defense index (GIDI) to evaluate the immunological potential of the gingiva and the

possible risk for periodontal disease. Braz Dent J 6, 95–91.

STAMM, L. V. and TROTT, D. J. (2006): Treponema and Bovine skin disease: Papillomatous digital der-

matitis and ulcerative mammary dermatitis. In: RADOLF, J.D., LUKEHART, S.A. (Eds.): Pathogenic

Treponema: Molecular and Cellular Biology. Caister Academic Press, USA, pp. 403–420.

STASZYK, C., BIENERT, A., HULS,¨ I., SCHROCK, P., WOHLSEIN, P. and SIMHOFER, H. (2011):

EOTRH: Macroscopical and Pathohistological Investigations. Equine Dentistry - AAEP Focus Meet-

ing, 18th-20th September 2011, Albuquerque, USA, pp. 105–108.

STASZYK, C., BIENERT, A., KREUTZER, R., WOHLSEIN, P. and SIMHOFER, H. (2008): Equine

odontoclastic tooth resorption and hypercementosis. Vet J 178, 372–379.

STERNBERG, S. (1998): Isolation of Actinobacillus equuli from the oral cavity of healthy horses and

comparison of isolates by restriction enzyme digestion and pulsed-field gel electrophoresis. Vet Mi-

crobiol 59, 147–156.

VALDEZ, M., HAINES, R., RIVIERE, K. H., RIVIERE, G. R. and THOMAS, D. D. (2000): Isolation

of oral spirochetes from dogs and cats and provisional identification using polymerase chain reaction

(PCR) analysis specific for human plaque Treponema spp. J Vet Dent 17, 23–26.

VANDEVANTER, D. R., WARRENER, P., BENNETT, L., SCHULTZ, E. R., COULTER, S., GARBER,

R. L. and ROSE, T. M. (1996): Detection and analysis of diverse herpesviral species by consensus

primer PCR. J Clin Microbiol 34, 1666–1671.

WEISS, E. (2007): Verdauungsorgane. In: DAHME, E., WEISS, E. (Eds.): Grundriß der speziellen

pathologischen Anatomie der Haustiere. 6th ed. Enke, Stuttgart, Germany, pp. 90–147.

61 Bibliography

WHITE, D. J. (1997): Dental calculus: recent insights into occurrence, formation, prevention, removal

and oral health effects of supragingival and subgingival deposits. Eur J Oral Sci 105, 508–522.

62 List of Figures

List of Figures

1. Classification of periodontal diseases and conditions (ARMITAGE, 1999) ...... 4

2. Classification of periodontal diseases and conditions, continued (ARMITAGE, 1999) . . 5

3. Bacterial complexes in plaque (SOCRANSKY and HAFFAJEE, 2002) ...... 10

4. Relationship between bacterial complexes (SOCRANSKY and HAFFAJEE, 2002) . . . 10

5. Viruses in the oral cavity of periodontitis-affected patients (CAPPUYNS et al., 2005) . . 11

6. Patient with severe EOTRH; severe bulbous enlargements of the tooth roots, mild retrac-

tion of gingiva ...... 18

7. Patient with severe EOTRH; severe gingiva retraction and exposed tooth roots ...... 19

8. Intraoral radiograph of the maxilla of same patient as in Figure 6, with severe hyperce-

mentotic and only mild resorptive lesions ...... 19

9. Intraoral radiograph of the mandible of the same patient as in Figure 7, the third mandibu-

lar incisors (303 and 403 after Triadan) are missing, severe resorptive lesions of all re-

maining incisor teeth ...... 20

10. Top (b): Extracted incisor of an EOTRH-affected horse, irregular cement (irC) and

necrotic tissue (nT) is visible in the apical region. Bottom (d): Transversal sections

of the same tooth; left: resorptive lesion filled with irC next to dentine (D) and normal

cement (nC)); right: destruction leads to exposure of the pulp cavity (STASZYK et al.,

2008) ...... 21

11. Histological analysis of a decalcified EOTRH-affected incisor by toluidine-blue staining,

irregular cement (irC) with wavy incremental lines (STASZYK et al., 2008) ...... 21

12. Histological analysis of an EOTRH-affected incisor by Picrosirius red-staining, accumu-

lation of irC around the vascular channel (vc) (STASZYK et al., 2008) ...... 22

13. Transmission electron micrograph of a Treponema species (EDWARDS et al., 2003) . . 23

14. Phylogenetic diversity of oral treponemes in human periodontitis (PASTER and DE-

WHIRST, 2006) ...... 24

63 List of Tables

List of Tables

1. Definition of radiological scores ...... 28

2. Inclusion criteria for patient, further and control horses ...... 29

3. Patient group, affected with EOTRH ...... 29

4. Further EOTRH-affected horses not fulfilling all inclusion criteria of the patient group . . 30

5. Control group, no periodontitis ...... 30

6. Primer sequences for herpesvirus PCR ...... 31

7. Duration of symptoms before presentation, in months ...... 34

8. Age of horses, in years ...... 35

9. Weight of horses, in kilogrammes ...... 35

10. Pocket depth in patient horses, in millimetres ...... 36

11. Radiological findings on the lamina dura dentis of patient horses ...... 37

12. Radiological findings on the lamina dura dentis of further horses ...... 38

13. Radiological findings on the periodontal ligament and the teeth of patient horses ..... 38

14. Radiological findings on the periodontal ligament and the teeth of further horses ..... 39

15. Evidence for fracture or pulp exposure ...... 39

16. Detection of Treponema DNA in patient horses ...... 41

17. Detection of Treponema DNA in further horses ...... 42

18. Detection of Treponema DNA in control horses ...... 43

19. Overall results ...... 44

64 Part VIII. Acknowledgements

Part VIII.

Acknowledgements

To my parents who supported me emotionally and financially during my academic career, no matter how winding my paths were.

To my partner who introduced me to the benefits of LATEX and just for being by my side. To all my friends who provided me with millions of words of encouragement. To Sabine Brandt, Hubert Simhofer, and Christian Stanek who never gave up on me.

65