Probing the Role of Pparα in the Small Intestine
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Bile Acid Receptor Farnesoid X Receptor: a Novel Therapeutic Target for Metabolic Diseases
Review J Lipid Atheroscler 2017 June;6(1):1-7 https://doi.org/10.12997/jla.2017.6.1.1 JLA pISSN 2287-2892 • eISSN 2288-2561 Bile Acid Receptor Farnesoid X Receptor: A Novel Therapeutic Target for Metabolic Diseases Sungsoon Fang Severance Biomedical Science Institute, BK21 PLUS project for Medical Science, Yonsei University College of Medicine, Seoul, Korea Bile acid has been well known to serve as a hormone in regulating transcriptional activity of Farnesoid X receptor (FXR), an endogenous bile acid nuclear receptor. Moreover, bile acid regulates diverse biological processes, including cholesterol/bile acid metabolism, glucose/lipid metabolism and energy expenditure. Alteration of bile acid metabolism has been revealed in type II diabetic (T2D) patients. FXR-mediated bile acid signaling has been reported to play key roles in improving metabolic parameters in vertical sleeve gastrectomy surgery, implying that FXR is an essential modulator in the metabolic homeostasis. Using a genetic mouse model, intestinal specific FXR-null mice have been reported to be resistant to diet-induced obesity and insulin resistance. Moreover, intestinal specific FXR agonism using gut-specific FXR synthetic agonist has been shown to enhance thermogenesis in brown adipose tissue and browning in white adipose tissue to increase energy expenditure, leading to reduced body weight gain and improved insulin resistance. Altogether, FXR is a potent therapeutic target for the treatment of metabolic diseases. (J Lipid Atheroscler 2017 June;6(1):1-7) Key Words: Bile acids, Farnesoid X receptor, Metabolic diseases INTRODUCTION of endogenous bile acid nuclear receptor FXR proposes new perspectives to understand molecular mechanisms Bile acids are converted from cholesterol in the liver and physiological roles of bile acids and their receptors by numerous cytochrome P450 enzymes, including in various tissues to maintain whole body homeostasis. -
TEAD3 (NM 003214) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA -
Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R. -
Table 2. Significant
Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S. -
Itcs) in the Mouse Amygdala of Tshz1 Mutants Correlates with Fear, Depression, and Social Interaction Phenotypes
1160 • The Journal of Neuroscience, January 31, 2018 • 38(5):1160–1177 Development/Plasticity/Repair Loss of Intercalated Cells (ITCs) in the Mouse Amygdala of Tshz1 Mutants Correlates with Fear, Depression, and Social Interaction Phenotypes X Jeffrey Kuerbitz,1 Melinda Arnett,5 Sarah Ehrman,1 XMichael T. Williams,3 XCharles V. Vorhees,3 X Simon E. Fisher,6,7 Alistair N. Garratt,8 XLouis J. Muglia,5 Ronald R. Waclaw,1,4 and XKenneth Campbell1,2 Divisions of 1Developmental Biology, 2Neurosurgery, 3Neurology, 4Experimental Hematology and Cancer Biology, 5Center for Prevention of Preterm Birth, Perinatal Institute, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH 45229, 6Language and Genetics Department, Max Planck Institute for Psycholinguistics, 6500 AH Nijmegen, The Netherlands, 7Donders Institute for Brain, Cognition and Behaviour, Radboud University, Nijmegen, The Netherlands, and 8Institute of Cell Biology and Neurobiology, Center for Anatomy, Charite´ University Hospital Berlin, 10117 Berlin, Germany The intercalated cells (ITCs) of the amygdala have been shown to be critical regulatory components of amygdalar circuits, which control appropriate fear responses. Despite this, the molecular processes guiding ITC development remain poorly understood. Here we establish the zinc finger transcription factor Tshz1 as a marker of ITCs during their migration from the dorsal lateral ganglionic eminence through maturity. Using germline and conditional knock-out (cKO) mouse models, we show that Tshz1 is required for the proper migration and differentiation of ITCs. In the absence of Tshz1, migrating ITC precursors fail to settle in their stereotypical locations encapsulating the lateral amygdala and BLA. Furthermore, they display reductions in the ITC marker Foxp2 and ectopic persistence of the dorsal lateral ganglionic eminence marker Sp8. -
Modes of Interaction of KMT2 Histone H3 Lysine 4 Methyltransferase/COMPASS Complexes with Chromatin
cells Review Modes of Interaction of KMT2 Histone H3 Lysine 4 Methyltransferase/COMPASS Complexes with Chromatin Agnieszka Bochy ´nska,Juliane Lüscher-Firzlaff and Bernhard Lüscher * ID Institute of Biochemistry and Molecular Biology, Medical School, RWTH Aachen University, Pauwelsstrasse 30, 52057 Aachen, Germany; [email protected] (A.B.); jluescher-fi[email protected] (J.L.-F.) * Correspondence: [email protected]; Tel.: +49-241-8088850; Fax: +49-241-8082427 Received: 18 January 2018; Accepted: 27 February 2018; Published: 2 March 2018 Abstract: Regulation of gene expression is achieved by sequence-specific transcriptional regulators, which convey the information that is contained in the sequence of DNA into RNA polymerase activity. This is achieved by the recruitment of transcriptional co-factors. One of the consequences of co-factor recruitment is the control of specific properties of nucleosomes, the basic units of chromatin, and their protein components, the core histones. The main principles are to regulate the position and the characteristics of nucleosomes. The latter includes modulating the composition of core histones and their variants that are integrated into nucleosomes, and the post-translational modification of these histones referred to as histone marks. One of these marks is the methylation of lysine 4 of the core histone H3 (H3K4). While mono-methylation of H3K4 (H3K4me1) is located preferentially at active enhancers, tri-methylation (H3K4me3) is a mark found at open and potentially active promoters. Thus, H3K4 methylation is typically associated with gene transcription. The class 2 lysine methyltransferases (KMTs) are the main enzymes that methylate H3K4. KMT2 enzymes function in complexes that contain a necessary core complex composed of WDR5, RBBP5, ASH2L, and DPY30, the so-called WRAD complex. -
Genome-Wide Approach to Identify Risk Factors for Therapy-Related Myeloid Leukemia
Leukemia (2006) 20, 239–246 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Genome-wide approach to identify risk factors for therapy-related myeloid leukemia A Bogni1, C Cheng2, W Liu2, W Yang1, J Pfeffer1, S Mukatira3, D French1, JR Downing4, C-H Pui4,5,6 and MV Relling1,6 1Department of Pharmaceutical Sciences, The University of Tennessee, Memphis, TN, USA; 2Department of Biostatistics, The University of Tennessee, Memphis, TN, USA; 3Hartwell Center, The University of Tennessee, Memphis, TN, USA; 4Department of Pathology, The University of Tennessee, Memphis, TN, USA; 5Department of Hematology/Oncology St Jude Children’s Research Hospital, The University of Tennessee, Memphis, TN, USA; and 6Colleges of Medicine and Pharmacy, The University of Tennessee, Memphis, TN, USA Using a target gene approach, only a few host genetic risk therapy increases, the importance of identifying host factors for factors for treatment-related myeloid leukemia (t-ML) have been secondary neoplasms increases. defined. Gene expression microarrays allow for a more 4 genome-wide approach to assess possible genetic risk factors Because DNA microarrays interrogate multiple ( 10 000) for t-ML. We assessed gene expression profiles (n ¼ 12 625 genes in one experiment, they allow for a ‘genome-wide’ probe sets) in diagnostic acute lymphoblastic leukemic cells assessment of genes that may predispose to leukemogenesis. from 228 children treated on protocols that included leukemo- DNA microarray analysis of gene expression has been used to genic agents such as etoposide, 13 of whom developed t-ML. identify distinct expression profiles that are characteristic of Expression of 68 probes, corresponding to 63 genes, was different leukemia subtypes.13,14 Studies using this method have significantly related to risk of t-ML. -
Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript. -
Open Dogan Phdthesis Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
REV-Erbα Regulates CYP7A1 Through Repression of Liver
Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2017/12/13/dmd.117.078105.DC1 1521-009X/46/3/248–258$35.00 https://doi.org/10.1124/dmd.117.078105 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:248–258, March 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics REV-ERBa Regulates CYP7A1 Through Repression of Liver Receptor Homolog-1 s Tianpeng Zhang,1 Mengjing Zhao,1 Danyi Lu, Shuai Wang, Fangjun Yu, Lianxia Guo, Shijun Wen, and Baojian Wu Research Center for Biopharmaceutics and Pharmacokinetics, College of Pharmacy (T.Z., M.Z., D.L., S.W., F.Y., L.G., B.W.), and Guangdong Province Key Laboratory of Pharmacodynamic Constituents of TCM and New Drugs Research (T.Z., B.W.), Jinan University, Guangzhou, China; and School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou, China (S.W.) Received August 15, 2017; accepted December 6, 2017 ABSTRACT a Nuclear heme receptor reverse erythroblastosis virus (REV-ERB) reduced plasma and liver cholesterol and enhanced production of Downloaded from (a transcriptional repressor) is known to regulate cholesterol 7a- bile acids. Increased levels of Cyp7a1/CYP7A1 were also found in hydroxylase (CYP7A1) and bile acid synthesis. However, the mech- mouse and human primary hepatocytes after GSK2945 treatment. anism for REV-ERBa regulation of CYP7A1 remains elusive. Here, In these experiments, we observed parallel increases in Lrh-1/LRH- we investigate the role of LRH-1 in REV-ERBa regulation of CYP7A1 1 (a known hepatic activator of Cyp7a1/CYP7A1) mRNA and protein. -
Molecular Mechanisms of Nucleosome Positioning and DNA Methylation in Chromatin
Molecular mechanisms of nucleosome positioning and DNA methylation in chromatin Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) der Naturwissenschaftlichen Fakultät III - Biologie und vorklinische Medizin der Universität Regensburg durchgeführt am Lehrstuhl für Biochemie III der Universität Regensburg vorgelegt von: ANNA SCHRADER SENSERSTR. 8 81371 MÜNCHEN Abgabedatum: 29. Juli 2009 Die vorliegende Arbeit wurde unter der Betreuung von Prof. Dr. Gernot Längst in der Zeit von Februar 2006 bis Juli 2009 am Institut für Biochemie III der Universität Regensburg erstellt. Prüfungskomitee: Vorsitzender: Prof. Dr. Reinhard Wirth 1. Gutachter: Prof. Dr. Gernot Längst 2. Gutachter: Prof. Dr. Alexander Brehm 3. Gutachter (Prüfer): Prof. Dr. Ralf Wagner Ersatzprüfer: Prof. Dr. Michael Thomm Table of Contents Abbreviations........................................................................................... 1 A. Zusammenfassung ............................................................................... 5 B. Introduction ........................................................................................ 7 I. The Chromatin structure ............................................................................................ 7 1. In General ......................................................................................................................... 7 1.1. The nucleosome - basic packaging unit of chromatin.................................................. 7 1.2. Chromatin higher order structures