Escola De Ciências E Tecnologia Departamento

ESCOLA DE CIÊNCIAS E TECNOLOGIA

DEPARTAMENTO DE BIOLOGIA

PHYLOGEOGRAPHY, ECOLOGY AND CONSERVATION OF SKINK ADAMASTOR, TRACHYLEPIS ADAMASTOR CERÍACO, 2015 |

Ana Carolina Andrade de Sousa |

Orientação: Doutor – Luis Miguel Pires Ceríaco | Co-orientação: Mestre – Mariana Pimentel Marques |

Mestrado em Biologia da Conservação

Évora, 2017

UNIVERSIDADE DE ÉVORA

Mestrado em Biologia da Conservação Dissertação

PHYLOGEOGRAPHY, ECOLOGY AND CONSERVATION OF SKINK ADAMASTOR, TRACHYLEPIS ADAMASTOR CERÍACO, 2015

FILOGEOGRAFIA, ECOLOGIA E CONSERVAÇÃO DA LAGARTIXA ADAMASTOR, TRACHYLEPIS ADAMASTOR CERÍACO, 2015

Autora: Ana Carolina Andrade de Sousa

Orientador: Doutor - Luis Miguel Pires Ceríaco

Co-orientadora: Mestre - Mariana Pimentel Marques

Évora, 2017

Aos meus adorados Pais

Pedro (in memory and heart) e Teresa por serem os melhores Pais e Seres do Mundo, por tudo o que me ensinaram, por serem os meus heróis e os maiores lutadores que conheço. Eles são o meu maior orgulho. Pai, desde sempre me ensinaste a respeitar e amar a Natureza, e é isso que me define hoje, obrigada por tudo, para sempre juntos...

“Não é o mais forte que sobrevive, nem o mais inteligente, mas o que melhor se adapta às mudanças!” Charles Darwin

Agradecimentos

Para a realização desta dissertação de mestrado contei com uma lista enorme de apoios e incentivos muito importantes e aos quais agradeço do fundo do coração. Aos meus pais por todo o apoio que sempre me deram para que eu pudesse realizar os meus sonhos, um deles a Biologia. Pela ajuda na conquista e pelo consolo na tristeza, por estarem sempre presentes e serem incansáveis em proporcionarem-me o melhor. Foram eles, especialmente o meu Pai, que me ensinaram a amar e a respeitar a Natureza, e foi por isso que eu segui este caminho, sem dúvida que não podia estar noutro lugar. Sem eles nada seria possível, por isso agradeço todo o amor, carinho, alegrias, e felicidade que sempre me deram, e claro, pela minha vida. Ao meu orientador Luis Ceríaco e à minha co-orientadora Mariana Marques, que me ensinaram imenso e me proporcionaram a melhor viagem da minha vida. Agradeço muito por me terem levado a São Tomé e Príncipe e à Tinhosa Grande, sem vocês não era possível. Obrigada pelos dias incríveis que passámos, que embora fosse trabalho só soube a lazer, por toda a paciência que tiveram comigo, e por toda a ajuda. Obrigada por me terem lançado o desafio de escrever em Inglês e pelas mil correções, desculpem às vezes a minha nabice. Obrigada por todo o trabalho de campo, de laboratório e de escrita, para mim esta foi sem dúvida a tese de sonho, amei o que fiz e aprendi imenso. Obrigada por me terem aceite, pela amizade e por serem os melhores, foi um privilégio poder trabalhar com vocês. Ao Dr. Luís Mendes e ao Dr. Bívar-de-Sousa pela paciência, disponibilidade e pela ajuda na identificação dos invertebrados. Ao Professor João Rabaça por se mostrar sempre curioso e interessado em relação à minha dissertação. Obrigada por me ter ajudado, me ter acalmado e encontrado soluções para as pedras deste meu caminho. À Cristiane Bastos-Silveira por toda a disponibilidade, simpatia e ajuda, e por tudo o que me ensinou no laboratório. Ao Museu Nacional de História Natural e da Ciência por ter me disponibilizado as ferramentas necessárias de laboratório e acolhido na fase final da escrita da dissertação. Ao Príncipe Trust por todo o apoio logístico nas viagens ao ilhéu da Tinhosa Grande. À minha avó Isaura, que apesar de não estar presente há muito tempo foi como uma 2ª mãe para mim. Por todo o amor e carinho que sempre me deu e por ser uma mulher fantástica que dava tudo o que tinha e o que não tinha. És a melhor avó do Mundo. À minha irmã Patrícia Sousa, às minhas lindas sobrinhas Ana Rita e Maria Inês, e ao meu cunhado Zé, que sempre me apoiaram e deram muito carinho, amor, diversão e felicidade. Obrigada pelos momentos em que me fizeram esquecer que tinha uma dissertação por escrever e por me ajudarem a distrair com conversas e brincadeiras.

À Maria Lúcia Araújo que é a minha actual 2ª mãe, que me dá muito amor e carinho, e dá na cabeça quando é preciso, que me ajuda e apoia imenso, que me dá casa, lava a roupa, alimenta, que me ensina e educa. Que me foi levar e buscar ao aeroporto quando embarquei nesta aventura. Que é das poucas pessoas que sabe o nome científico da lagartixa desta dissertação, e que faz questão de sempre que estamos juntas de o dizer, ou perguntar quando não se lembra muito bem. À minha tia Lúcia Andrade por ser também como uma 2ª mãe, que me dá todo o apoio, ajuda, amor e carinho que uma mãe dá. Por estar sempre presente e me levar a passear, principalmente quando mais preciso. E por ser uma amante da Natureza, amiga do ambiente e por me dar a conhecer novas alternativas. Ao meu namorado Ricardo Sábio, que Évora me deu, por todo o amor, carinho, apoio e paciência. Por me dar aquela força extra, incentivar e acreditar que eu ia conseguir entregar a dissertação. Obrigada pelas distrações boas que fizeram com que eu não desse em louca. À Mariana Pissarra, que foi das melhores pessoas que Évora me deu, a minha melhor amiga do Mestrado! Pela ajuda, apoio e calma nas horas de maior aflição, desespero e drama. Obrigada por todos os concelhos, ajuda, correções, conversas e distrações boas que me deste. Ao meu afilhado Diogo Parrinha, por me aturar e ajudar nas correções do texto, por me apoiar, dar força e acreditar que eu era capaz de entregar a dissertação. Às minhas melhores amigas de sempre, Ana Carolina Ferreira, Joana Pinto, Inês Santos, Joana Albuquerque, Maria João Silva, Andreia Gonçalves, Raquel Pimentel e Carolina Bermejo por estarem sempre presentes, mesmo que a milhares de km de distância, por me apoiarem e por brincarem com esta minha “maluquice” pelos bichos e por não aniquilarem os insectos, pelo menos quando estamos juntas, obrigada pela amizade de anos e por tudo o que já vivemos. Que se sucedam muitos mais anos e mais histórias para contar. Às minhas amigas e amigos de Évora, Célia Freixa, Ana Machado, Catarina Simões, Liliana Coelho, Lorina Vieira, Vânia Henriques, Margarida Pereira, Luís Henriqueta, Tiago Batista e Francisco Marques, pelo enorme apoio e força que me foram dado ao longo deste caminho, obrigada por fazerem de Évora uma cidade tão especial e pela vossa amizade. Quero muitos mais encontros nesta que é e sempre será a nossa cidade! Às amigas que o Andebol de Évora uniu, Carolina Damas, Joana Ferreira e Micaela Estrelinha, obrigada pela amizade, cumplicidade, por todos os jogos e saídas, e por todas as aventuras que passámos. Que o nosso reencontro seja para breve para espalharmos o terror! À Marisa Esteves pela ajuda nas correções do texto e pela amizade, thanks girl! Ao Fernando Cachon pela disponibilidade e ajuda na realização dos mapas, mil gracias. Por fim, agradeço à restante família, amigos, amigas e professores pelo amor e carinho e por me apoiarem, motivarem e ajudarem sempre ao longo deste longo caminho.

Phylogeography, Ecology and Conservation of Skink Adamastor, Trachylepis adamastor Ceríaco, 2015

Abstract

The genus Trachylepis is one of the most diverse of reptiles inhabiting the Gulf of Guinea islands. Trachylepis adamastor, endemic to Tinhosa Grande islet, was recently described based solely on morphology. The phylogenetic relation between T. adamastor and remaining Trachylepis species, ecology and conservation status were unknown. This study investigates the phylogenetic and phylogeographic relationships, as well as the population density and the diet of T. adamastor. Results show that T. principensis from Príncipe and T. adamastor are genetically conspecific, although, given morphological differences and isolation, it is suggested that each population should be considered subspecies. The population density of T. a. adamastor was estimated as 0.012 per m2 with 2460 individuals. These obtained values, together with its distribution makes T. a. adamastor a “Critically Endangered” subspecies according to IUCN. The diet of T. a. adamastor was also compared with that of the populations of the surrounding islands.

Filogeografia, Ecologia e Conservação da lagartixa Adamastor, Trachylepis adamastor Ceríaco, 2015

Resumo

O género de répteis Trachylepis é um dos mais diversos das ilhas do Golfo da Guiné. Trachylepis adamastor, endémica do ilhéu da Tinhosa Grande, foi recentemente descrita com base apenas na morfologia. A relação filogenética entre T. adamastor e as restantes espécies Trachylepis, assim como a sua ecologia e estatuto de conservação são desconhecidos. Este estudo investiga as relações filogenética e filogeográfica, densidade populacional e dieta de T. adamastor. Os resultados mostraram que T. principensis do Príncipe e T. adamastor são geneticamente coespecificas. Tendo em conta as diferenças morfológicas e o seu isolamento, é sugerido que cada população deve ser considerada como subespécie. A estimativa da densidade populacional obtida foi 0.012 por m2 com 2460 indivíduos. Estes valores obtidos, juntamente com a distribuição da subespécie, tornam T. a. adamastor “Criticamente Em Perigo” de acordo com a IUCN. A sua dieta também foi comparada com a das populações das ilhas vizinhas.

Índice

Agradecimentos ...... 7 Abstract ...... 10 Resumo ...... 11 List of Figures ...... 14 List of Tables ...... 15 Main Introduction ...... 17 Main Objectives ...... 32 Paper I – Phylogeography of the Adamastor skink Trachylepis adamastor on the Tinhosa Grande islet, Gulf of Guinea ...... 34 Introduction ...... 35 Material and methods ...... 37 Sampling ...... 37 Morphological methods ...... 38 Molecular methods ...... 39 Phylogenetic analysis ...... 40 Results ...... 40 Morphology ...... 40 Phylogeny ...... 45 Discussion ...... 48 References ...... 52 Appendix I ...... 62 Paper II – Ecology and conservation status of an endemic Skink, Trachylepis (Squamata: Scincidae), from Tinhosa Grande islet, Gulf of Guinea...... 65 Introduction ...... 66 Material and methods ...... 68 Study area ...... 68 Specimen collecting ...... 69 Fieldwork and Population estimates ...... 70 Stomach contents/diet ...... 71 Results ...... 71 Populations estimates ...... 71 Stomach contents/diet ...... 72 Discussion ...... 74 References ...... 77 Appendix I ...... 85 Conclusion ...... 87 References of Main Introduction ...... 88

List of Figures

Fig. 1 Geographical location of São Tomé and Príncipe islands and Tinhosas islets ..... 20 Fig. 2 Tinhosa Grande and Tinhosa Pequena islets aerial photo (Photo: Luis Ceríaco)...... 21 Fig. 3 Tinhosa Grande islet view from the boat (Photo: Ana Carolina Sousa) ...... 21 Fig. 4 Tinhosa Grande islet with tens of thousands seabirds of breeding pairs (Photo: Luis Ceríaco)...... 22 Fig. 5 Hemidactylus sp. in life from Tinhosa Grande islet (Photo: Luis Ceríaco)...... 23 Fig. 6 Trachylepis adamastor in life from Tinhosa Grande islet (Photo: Luis Ceríaco)...... 25 Fig. 7 (Fig. 1 Paper I) Trachylepis adamastor in life from Tinhosa Grande islet (Photo: Luis Ceríaco) ...... 41 Fig. 8 (Fig. 2 Paper I) Trachylepis principensis in life from Príncipe island (Photo: Luis Ceríaco) ...... 42 Fig. 9 (Fig. 3 Paper I) Trachylepis thomensis in life from São Tomé island (Photo: Luis Ceríaco) ...... 42 Fig. 10 (Fig. 4 Paper I) Maximum-likelihood phylogeny of 16S gene dataset of Trachylepis ...... 47 Fig. 11 (Fig. 5 Paper I) Maximum-likelihood phylogeny of ND2 gene dataset of Trachylepis ...... 47 Fig. 12 (Fig. 6 Paper I) Maximum-likelihood phylogeny of RAG-1 gene dataset of Trachylepis ...... 48 Fig. 13 (Fig. 1 Paper II) Tinhosa Grande islet with tens of thousands seabirds of breeding pairs (Photo: Luis Ceríaco) ...... 69 Fig. 14 (Fig. 2 Paper II) Quadrats transect in the Tinhosa Grande islet. Yellow quadrats represent the survey conducted on February 16th of 2016, while the red quadrats represent the second day of prospections on February 19th of 2016 ...... 70

List of Tables

Table 1. (Table. 1 Paper I) Primers used in this study for the amplification of 16S, ND2 and RAG-1. Number of cycles, annealing temperatures and references of original primer publication ...... 39 Table 2. (Table. 2 Paper I) Measurements and scale counts of Trachylepis adamastor. Abbreviations are the same as those described in Materials and Methods ...... 43 Table 3. (Table. 3 Paper I) General comparison between Trachylepis species from Tinhosa Grande islet, Príncipe and São Tomé islands. Data present as "min-max (mean ± standard deviation)". Abbreviations are the same as those described in Material and Methods ...... 44 Table 4. (Appendix I Paper I) Specimens and sequences used for the genetic analysis ...... 62 Table 5. (Table. 1 Paper II) Number of Trachylepis a. adamastor records counted in the quadrats transect during the field trip in 16th and 19th February of 2016 ...... 72 Table 6. (Table. 2 Paper II) Summary of dietary data, collected from stomach contents of the three Trachylepis species from Tinhosa Grande islet, Príncipe and São Tomé islands ...... 72 Table 7. (Table. 3 Paper II) Number total of items prey found, frequency of occurrence and relative frequency for each prey item for Trachylepis a. adamastor, Trachylepis a. principensis and Trachylepis thomensis species ...... 73 Table 8. (Appendix I Paper II) Number of arthropods found in the stomach contents of the specimens of Trachylepis a. adamastor, Trachylepis a. principensis and Trachylepis thomensis (N=26). Arthropods are ordered by the taxonomy, from left to right from highest to lowest rank ...... 85

Main Introduction

Islands have always fascinated scientists (MacArthur & Wilson 1963; Foster 1964; MacArthur et al. 1972; Carlquist 1974; Hooijer 1976; Sondaar 1977; Heaney 1978; Báez 1982a,b; Reyment 1983; Lomolino 1983; Brown & Lomolino 1998; Grant 1998, 1998a; Whittaker 1998; Brown & Lomolino 2000; Calsbeek & Smith 2003; Vitousek et al. 2013; Cox et al. 2016). Their uncommon fauna and flora was used to establish both Darwin (1845) and Wallace (1902) theories, and since then island systems have become essential for studies of ecology and evolution (MacArthur & Wilson 1967; Whittaker 1998; Whittaker & Fernández-Palacios 2007; Lomolino et al. 2010). Their ecosystems are considered relatively simple which make them attractive for studies of ecology and evolution due to fewer, simpler, or stronger selective pressures (Whittaker 1998; Barahona et al. 2000; Schluter 2001). Theories such as island biogeography, dynamic equilibrium, and speciation, by MacArthur & Wilson (1967), illustrate the importance of studying islands. Besides that, islands also have importance at the biogeographic and conservationist level, owing to the high number of endangered or extinct species, and high number of endemism due to the processes of speciation (MacArthur & Wilson 1967; Mayr 1967; Whittaker & Fernández-Palacios 2007). Furthermore, islands are an excellent contribution to the study of biodiversity due to their peculiar characteristics (Adsersen 1995), such as the constitution of their communities, which are generally disharmonious given the absence of some taxa (Báez 1993; Cox & Moore 1993; Eliasson 1995; Itow 2003), the high number of endemism and different morphological characteristics such as dwarfism or gigantism.

In recent years the islands of the Gulf of Guinea have started to caught the attention of worldwide scientists. The Gulf of Guinea is located on the African coast and is composed of the continental island Bioko (also known as Fernando Pó), and the oceanic islands Príncipe, São Tomé and Annobon (also known as Pagalu) (Burke 2001). The Gulf of Guinea’s islands are part of the Cameroon volcanic line, extending from Mount Cameroon (Cameroon, Africa) to Annobon island, having an extension of at least 1600 km (Lee et al. 1994). Except for Bioko, all other islands are volcanic in origin and were formed at different times, with Príncipe being the oldest, formed 31 My ago, followed by São Tomé 14 My ago and Annobon 4.8 My (Lee et al. 1994). Bioko, separated from the African continent, was isolated due to sea level rise only 10-11 000 years ago (Eisentraut 1965; Moreau 1966). The three oceanic islands have never been

linked to the mainland (Jones 1994; Lee et al. 1994), and these islands are isolated by seawaters with depths over 4000 m (Jones 1994; Marzoli et al. 2000). Bioko differs from the previous three islands since it lies on the continental shelf, with depths of only 60 m, it is the largest island with 2017 km2 and the nearest to the mainland, by only 32 km (Lee et al. 1994; Marzoli et al. 2000). The island of São Tomé has an area of around 836 km2 and is about 280 km from the African continent (Lee et al. 1994; Marzoli et al. 2000). The Príncipe is smaller, having an area of around 128 km2 and is located closer to the mainland, about 250 km (Lee et al. 1994; Marzoli et al. 2000). Annobon is the smallest of these four islands, with only 17 km2, and is the farthest from the African continent, about 375 km (Lee et al. 1994; Marzoli et al. 2000).

According to WWF (2017), the islands of São Tomé, Príncipe and Annobon are an Afrotropical ecoregion and have a vulnerable status. Biogeographically the Gulf of Guinea islands belongs to the rainforest zone of West Africa, being located between two large regions - Guinean forest and Congo basin. These islands have recently received more attention due to their exceptional biodiversity and are part of one of the largest biodiversity hotspots in the world (Myers et al. 2000; Drewes 2002; Measey et al. 2007; Jesus et al. 2009). The geographic characteristics and the isolation of the islands gave origin to rapid speciation processes in its fauna, leading to a high rate of endemism (Frade 1958; Dutton 1994; Jones 1994; Drewes 2002; Measey et al. 2007; Uyeda et al. 2007; Vaz & Oliveira 2007; Melo et al. 2011).

Despite their relatively small size, the islands present a considerable diversity of flora and fauna species and exhibits one of the greatest number of endemic species per area worldwide (Juste 1996; Drewes & Wilkinson 2004). According to Exell (1973), the number of known flora species, including those introduced and non natives, in the Príncipe are 314 and 601 in São Tomé. The rates of plant endemism for Príncipe is 9.9% and for São Tomé it is 7.7% (Exell 1973). At the national level, the flora includes 157 Pteridophyta (ferns) and 791 plants with seeds (spermatophyte) (Figueiredo 1994; Vaz & Oliveira 2007). Orchids, which have 135 species, being 35 endemics, are an example of one particularly rich group (Lejoly 1995; Vaz & Oliveira 2007). The native fauna of Príncipe includes four species of bats, one of shrew (Feiler 1988; Feiler et al. 1993; Vaz & Oliveira 2007), ten of reptiles and three of amphibians (Ceríaco et al. in press). São Tomé included nine species of bats, one of shrew (Feiler 1988; Feiler et al. 1993; Vaz & Oliveira 2007), ten of reptiles and five of amphibians (Ceríaco et al. in

press) as native species. In addition to these, the remaining mammals found on the islands are practically all introduced, such as monkeys, rats, weasels, cats, dogs, etc. (Feiler 1988; Feiler et al. 1993; Dutton 1994). The rate of amphibian endemism in the São Tomé and Príncipe is 100% (Ceríaco et al. in press). For the reptiles, with the exceptions of Pelusios castaneus (Schweigger, 1812) in São Tomé, Trachylepis affinis (Gray, 1838) in Príncipe, and Hemidactylus mabouia (Moreau de Jonnès, 1818) and Hemidactylus longicephalus Bocage, 1873 on both islands (Manaças 1958), all other reptile species appear to be endemic (Ceríaco et al. in press). It is worth noting the high endemism of terrestrial snails, with about 60 endemic species between São Tomé, Príncipe and Annobon (Angus 1994), and of butterflies with 64 in São Tomé and 45 in Príncipe (Pyrez 1992). Invertebrates also have a high rate of endemism in both islands (Mendes & Bívar-de-Sousa 2012). In the case of marine reptiles, these islands have importance as a nesting site for sea turtles (Graff 1996). Birds on the islands include 33 terrestrial species and at least 6 species of seabirds in Príncipe and 51 terrestrial and freshwater species and 6 seabirds in São Tomé (Jones & Tye 2006; Leventis & Olmos 2009; Valle et al. 2014; Lima et al. 2016).

Since the end of the 15th century, the country's biodiversity has always been disturbed by anthropogenic activities, particularly in the lower altitude areas that have been occupied by sugarcane, coffee and cocoa plantations (Lains & Silva 1958) and numerous exotic species were introduced (Feiler 1988; Feiler et al. 1993; Dutton 1994). In recent years, there has been an impoverishment of the biological diversity of the archipelago's ecosystems, which translates into a deterioration in the quality of life of the populations that depend on them (Vaz & Oliveira 2007). Due to its high number of endemisms and taxonomic diversity, São Tomé and Príncipe forests are a global priority for conservation groups (Jones 1994; Juste & Fa 1994). These forests are included in the list of sites under imminent threat of extinction of Alliance for Zero Extinctions (American Bird Conservancy 2017) and they are considered the second highest priority site for bird conservation in Africa, as “conservation hotspots” and priority ecoregions (Leventis & Olmos 2009).

During the last decade these islands have received a lot of attention by international researchers, leading to a large number of published studies (Drewes & Stoelting 2004; Jesus et al. 2005a,b, 2006; Jones & Tye 2006; Measey et al. 2007, Jesus et al. 2007, 2009; Dallimer et al. 2009; Melo et al. 2011; Valle et al. 2014; Lima et al.

2015, 2016), and descriptions of new species of vertebrates (Measey et al. 2007; Uyeda et al. 2007; Miller et al. 2012; Ceríaco 2015; Ceríaco et al. 2015; Bell 2016; Ceríaco et al. 2016). Habitat destruction, introduction of exotic species and hunting are the main threats of São Tomé and Príncipe. Despite having a Law on the Conservation of Fauna, Flora and Protected Areas (Law n. 11/99), it still needs to be properly implemented (Vaz & Oliveira 2007). Obô Natural Park of São Tomé and Príncipe, with 295 km of area and that was created in 1993 but was only made official in 2006 (DGA 2006). In 2011, Príncipe Island was classified by UNESCO as World Biosphere Reserve. The islands of São Tomé and Príncipe are surrounded by islets and rocks of diverse sizes. Closer to São Tomé are the Rolas Islet and the Cabras Islet, larger islets with vegetation. Others, such as the Sete Pedras, on the south coast of São Tomé, and the Tinhosas, south of the Príncipe, mainly exhibit exposed rocks and only a few scattered herbaceous plants (Leventis & Olmos 2009). The Tinhosas (Fig. 1, 2), located approximately 20 km southwest of the Príncipe island are two small rocky islets, the Tinhosa Grande (N: -1,34135556, E: -7,29151389; WGS84) and the Tinhosa Pequena (N: -1,38241667, E: -7,28316944, WGS-84). Tinhosa Grande (Fig. 3) has a surface area of around 20.5 ha, while Tinhosa Pequena has only 3.3 ha (Leventis & Olmos 2009).

FIGURE 1. Geographical location of São Tomé and Príncipe islands and Tinhosas islets.

FIGURE 2. Tinhosa Grande and Tinhosa Pequena islets aerial photo (Photo: Luis Ceríaco).

FIGURE 3. Tinhosa Grande islet view from the boat (Photo: Ana Carolina Sousa).

Both islets are classified as Important Bird Areas (IBA) (BirdLife International 2017). They were also recognized as Wetlands of International Importance and official Waterfowl Habitat (RAMSAR 2017). They are large bare boulders devoid of any vegetation and feature some of the most important seabird colonies in West Africa, with tens of thousands of breeding pairs that use the place to nest (Jones & Tye 2006) (Fig. 4). The 4 species of seabirds that nest here are Brown Noddy, Anous stolidus (Linnaeus, 1758), Black Noddy, Anous minutus Boie, 1844, Brown Booby, Sula leucogaster (Boddaert, 1783), and Sooty Tern, Onychoprion fuscatus (Linnaeus, 1766) (Leventis & Olmos 2009; Valle et al. 2014; BirdLife International 2017). In an islet with such a small area and harsh environment, the presence of terrestrial vertebrates was not expected. However, two species of reptiles are found on the Tinhosa Grande islet – a gecko (Family Gekkonidae) (Fig. 5) and a skink (Family Scincidae) (Ceríaco 2015).

FIGURE 4. Tinhosa Grande islet with tens of thousands seabirds of breeding pairs (Photo: Luis Ceríaco).

FIGURE 5. Hemidactylus sp. in life from Tinhosa Grande islet (Photo: Luis Ceríaco).

The family Scincidae (Sauria: Squamata) has about 1,613 species, being one of the largest families of lizards in the world (Uetz & Hošek 2016). Scincids lizards exhibit a high diversity of body shapes, sizes and habits. They range from normal-legged animals, through tiny-legged to legless species, from very diminute species to considerably large animals, and can be semi-fossorial, the forest and savanna dwellers, leaf litter specialists, or sandy deserts inhabitants (Trape et al. 2012; Speybroeck et al. 2016). There are several genera of skinks on the oceanic islands of Gulf of Guinea as the case of Trachylepis Fitzinger, 1843; Feylinia Gray, 1845 and Panaspis Cope, 1868 (Uetz & Hošek 2016).

The genus Trachylepis Fitzinger, 1843 currently contains about 78 species (Uetz & Hošek 2016), with new species constantly being described, such as T. gonwouoi, recently described by Allen et al. (2017). Trachylepis is one of the most speciose genera of skinks (Uetz & Hošek 2016). It is distributed throughout Africa, on the islands of Comores, Madagascar, Seychelles, and also in Fernando Noronha island off the coast of Brazil, being one of the richest genus in terms of lizard species in the Gulf of Guinea islands (Mausfeld et al. 2000; Bauer 2003; Uetz & Hošek 2016). Five species of Trachylepis are known for the oceanic islands of the Gulf of Guinea, some of them recently described: the endemic Trachylepis thomensis Ceríaco, Marques & Bauer,

2016, on São Tomé island and the Rolas Islet; the endemic Trachylepis principensis Ceríaco, Marques & Bauer, 2016, on Príncipe island (both previously considered insular populations of Trachylepis maculilabris Gray, 1845) (Ceríaco et al. 2016); T. adamastor Ceríaco, 2015, endemic of Tinhosa Grande islet off the coast of Príncipe (Ceríaco 2015); T. affinis (Gray, 1838) on Príncipe island; and T. ozorii (Bocage, 1893) endemic to Annobon island (Manaças 1958, 1973; Jesus et al. 2003, 2005b).

In the last decades, vertebrate species description has seen a steady increase in many groups (Costello et al. 2013; Fjeldså 2013). Reptiles are one of the vertebrate group with the highest species rate found globally (Pincheira-Donoso et al. 2013), with 10,450 species described as of July 2017 (Uetz & Hošek 2016). Although hundreds of reptile species are described per year (Uetz & Hošek 2016), this group is poorly represented on The IUCN Red List of Threatened SpeciesTM, with only 52,37% of described species evaluated (IUCN 2017). Böhm et al. (2013) analyzed for the first time globally reptile conservation status. The global extinction risk of reptiles was analyzed with the selection of only 1500 random species (just 14,4% of the 10,450 described species as of July 2017; Uetz & Hošek 2016) being many of these (21%) classified as “Data Deficient” (Böhm et al. 2013). The high percentage of “Data Deficient” taxa can bring many constraints. For example, the risk of extinction is negatively affected when “Data Deficient” species are not considered (Butchart & Bird 2010, Hoffmann et al. 2010; Bland et al. 2012), thus affecting conservation priorities (Brooks et al. 2006). In addition, species classified as “Data Deficient” are rarely included in legislation or conservation plans (Sousa-Baena et al. 2014). The low number of reptile species evaluated can possibly be explained by the lower level of research on these group (Bonnet et al. 2002a), their secretive behavior (Doody et al. 2013), high rates of cryptic species diversity (Oliver et al. 2009; Rosauer et al. 2016) and public aversion (Keller 1993). There are still many reptile species to be described, and Meiri (2016) predicts that Africa will be the hotspot for future species descriptions. For these reasons, studies like the present are essential, since only what is known can be preserved.

Trachylepis adamastor (Fig. 6) was recently described by Ceríaco (2015) based on eight specimens from the collections of the Instituto de Investigação Científica e Tropical (IICT), collected in the early 1970’s in Tinhosa Grande islet. According to the author, the newly described species could be easily distinguished from all other Trachylepis species by differences in color, size and lepidosis – large and robust body

size, up to at least 112.0 mm (SVL); dorsal brown-dark coloration, with subtle black and white speckles in the dorsum and a grayish venter; 31-34 midbody scale rows, 49- 54 longitudinal dorsal scales, 63-66 scales across the venter, 5 to 6 keels in the dorsal, smooth scales on sole of feet and hands, having only one pretemporal scale and very small ear opening.

FIGURE 6. Trachylepis adamastor in life from Tinhosa Grande islet (Photo: Luis Ceríaco).

Due to the presence of some synapomorphies, Ceríaco (2015) suggested that T. adamastor belongs to the same evolutionary lineage of the complex T. maculilabris existing in São Tomé and Príncipe - T. thomensis and T. principensis, respectively. There are several examples in the Gulf of Guinea oceanic islands of amphibians (Drewes & Wilkinson 2004) and reptiles (Jesus et al. 2007) species who colonized the different island through "island hopping", so it is possible that this is a similar case. However, according to Ceríaco (2015) it is still necessary to analyze the possibility of the isolation of this population due to changes in sea level that separated the island from Príncipe island, since there is evidence that Príncipe island has been much more extensive in the past.

T. adamastor is one of the larger species of the genus (Ceríaco 2015). Size related adaptations, as gigantism and dwarfism, are common in reptiles populations

inhabiting isolated areas such as oceanic islands (Case 1978; Andreone & Gavetti 1998; Andreone 2000; Barahona et al. 2000; Carranza et al. 2001; Filin & Ziv 2004; Keogh et al. 2005; Meik et al. 2010). In fact, the characteristic that most quickly tends to change on islands is the body size (Case 1978). Actually, according to Mertens (1934), some groups of lizards including Scincidae show a general trend toward larger body size on islands.

Foster (1964) was the first to quantify differences in body size between islands and mainland mammal’s populations. Later, in 1973 van Valen interpreted his results and hypothesized whereby small species tendency toward larger body size and large species toward smaller body size and named “the island rule”. Although some taxa do not follow this pattern (rodents, Lawlor 1982; mammalian carnivores, Meiri et al. 2004, 2006, 2008; ungulates, Raia & Meiri 2006; lizards, Meiri 2007; turtles, Itescu et al. 2014), many vertebrate taxa exhibit “the island rule” (birds, Clegg & Owens 2002; snakes, Boback & Guyer 2003; bats, Lomolino 2005; primates, Bromham & Cardillo 2007). In addition, this theory has been used to support evolutionary concepts such as optimal body size (Brown et al. 1993; Boback 2006). Most recently, Meiri et al. (2011) concluded that although mammals tend to follow the "island rule", birds and lizards did not show this trend in neither at a gender or family levels.

Despite the various assumptions about changing body size on islands, the most common explanations for these shifts in relation to gigantism are the relaxation of predation (Case 1978, 1982; Lomolino 1985; Grant 1998), such as the absence of mammalian predators (Szarski 1962; Case 1978, 1982; Pregill 1986; Greer 2001; Meiri 2008), competition pressures and large prey or abundant food sources (Case 1978, 1982; Lomolino 1985; Case & Schwaner 1993; Grant 1998; Lomolino 2005; Raia & Meiri 2006; Meiri 2007; Pafilis et al. 2009). In addition to these conjectures it is also said that the presence of seabirds conditions the density of populations and the body size of many vertebrates (Sanchez-Piñero & Polis 2000; Bonnet et al. 2002b) due to the accumulation of fecal matter, food remains and carcasses to increase the availability of nutrients in the islands (Polis & Hurd 1996). Thus, T. adamastor body size may be related to the presence of tens of thousands of seabirds on the islet.

According to Fisher & Owens (2004) and Meiri (2008), large body size animals are often associated with an increased risk of extinction. Considering the previous

aspects, body size studies are very important due to its influence on organisms morphology, physiology and ecology.

Many populations of squamate reptiles have distinct color morphs, being melanism the most frequent (Luiselli 1992; Forsman 1995). Melanism typically occurs with relatively high frequency in cooler climates, such as foggy coastlines or at higher elevations and latitudes, and on islands (Mouton & Oelofsen 1988; Badenhorst et al. 1992; Luiselli 1992; Ortiz 1994; Forsman 1995; Monney et al. 1995). Furthermore, Badenhorst (1990) established the relationship between lowland melanistic populations with zones of upwelling of cold water in the Atlantic Ocean. There have been several studies on evolutionary adaptations on color polymorphisms, especially on melanism (Norris & Lowe 1964; Wiens 1999; Cox & John-Alder 2005; Jansen van Rensburg et al. 2009).

Melanism has implicated several physiological functions such as: thermoregulation, dark animals are able to warm up faster and maintain higher body temperatures (Kettlewell 1973; Kingsolver & Wiernasz 1991; Vences et al. 2002; Clusella-Trullas et al. 2007); protection from ultraviolet (UV) radiation (Kollias et al. 1991; Setlow et al. 1993; Gunn 1998; Hofer & Mokri 2000; Callaghan et al. 2004; Calbó et al. 2005); immune function (Mackintosh 2001; Wilson et al. 2001); pleiotropic effect of selection on other functions of melanin, melanocortins, immunocompetence, stress resistance, and energy balance (Hoekstra 2006; Ducrest et al. 2008). Moreover, other functions such as cryptic coloration (Kettlewell 1973; Endler 1984), aposematism (Turner 1977), disease resistance (Wilson et al. 2001) and intraspecific communication (sexual selection) (Wiernasz 1989) are associated with melanism.

According to Bergmann’s rule, it is expected that endothermic species inhabiting colder environments are generally larger than species inhabiting in warmer regions (Bergmann 1847; Blackburn et al. 1999). This rule was analyzed also in ectothermic species (Ray 1960; Lindsey 1966; Ashton & Feldman 2003; Olalla-Tárraga & Rodríguez 2007; Pincheira-Donoso & Meiri 2013), but had contradictory results by showing different trends among different groups.

There are two hypotheses which are complementary and explain the reason of larger ectotherms may occur in colder environments. The first is the thermal melanism hypothesis (TMH; Gates 1980), which predicts that darker animals may be favored

more than lighter animals because they potentially gain heat faster (Lusis 1961; Kettlewell 1973; Clusella-Trullas et al. 2007). The second, proposed by Olalla-Tárraga & Rodríguez (2007), is the “heat balance hypothesis” (HBH) for small ectotherms, predicts that larger animals will be favored in cold environments because of their greater heat conservation potential.

Although melanism has many functions, it may have some associated costs, such as a high risk of predation by being more visually exposed (Andrén & Nilson 1981). However, when dark animals inhabit environments with a dark background, such as lava flow, the risk of predation is lower when compared to colored animals, favoring the melanistic individuals (van Damme et al. 1989; Sinervo et al. 1991).

Considering the small size of the Tinhosa Grande islet, and consequently poor habitat and low food availability in relation to the larger islands or the mainland, it seems that T. adamastor experienced a radical adaptation. Its giant form may be related to the exposed environment, the lack of shelter and an adaptation to periods of low food (Ceríaco 2015). However, the scarcity of food and the adverse habitat conditions suggests that this species has an opportunistic and generalist diet. T. adamastor was also observed feeding on split eggs of nesting birds in Tinhosa Grande (Ceríaco 2015), which may corroborate this hypothesis. A study on the diet of another Scincid species (Mabuya agilis), in an insular habitat in Brazil, recorded 11 types of prey in their diet, characteristic of an opportunistic predator (Rocha et al. 2004), the same can happen with T. adamastor.

The description of T. adamastor is also intimately linked to museum collections. While the environment has been changing steadily over the last years, many species have become extinct due to climate change but also to anthropogenic activities (Rocha et al. 2014). Many authors have hypothetized that the collection of specimens for museums may also have been a threat to the world’s biodiversity (Fuller 1999; Collar 2000; Hume & Walters 2012). It has been suggested that instead of collecting individuals, information should be collected through photographs, audio recordings, molecular data, and non-lethal tissue samples (Cheng et al. 2011; Minteer et al. 2014). However, the isolated application of these resources becomes problematic, and even when applied together they do not give us enough information to identify or describe a species or genus, both animal and plant (Rocha et al. 2014). Collecting is currently regulated and follows strict ethics guidelines, so that population demography is not

affected (Collar 2000; Winker et al. 2010). Museum specimens however play a much bigger role in conservation than usually is considered. A practical example corroborating that is the case of the negative effects of climate changes in animals, in which the reduction of the body size of these animals was only discovered through the analysis of the morphology of museum specimens (Gardner et al. 2011). Cheng et al. (2011) also shows the need to collect specimens for propagation studies of the chytrid fungus infection in amphibians. Porter & Wiemeyer (1969), through the thinning of egg shells from birds collected over a period have decided to ban DDT and other environmental pollutants. Another example that aims to prove that the collection of specimens is not invasive is the case of the endemic species Micrathene whitneyi graysoni, which was common when samples were collected between 1896 and 1932, and the most probable reasons for their extinction (in 1970), were habitat degradation and predation by invasive species, and not the collection of specimens made by humans as previously thought (Hume & Walters 2012). In addition to these examples, to estimate the risk of species extinction, especially for widely distributed species, the IUCN Red List criteria require specific and detailed information on life history and biology (such as longevity and growth rate), and for this the collection of species is crucial (Sadovy de Mitcheson et al. 2013).

Sometimes, the specimens are not collected for a particular purpose, and can be used in many ways by several scientists. Nowadays, with modern technologies, the biological collections are the most important for conservation, ecology and evolution studies (Bi et al. 2013). Furthermore, natural history collections contribute to taxonomic and community levels studies (Johnson et al. 2011) such as biogeographic range changes (Boakes et al. 2010), phenological shifts (Robbirt et al. 2011) and evolutionary change (Inger & Bearhop 2008). It is estimated that about 86% of the planet's species remain unknown (Mora et al. 2011). Thus, it is of extreme importance to document biodiversity as rigorously as possible, so that management and conservation decisions can be made both now and in the future. Yet, to do this it is vital that the collections and their samples are well planned and preserved (Winker et al. 2010; Rocha et al. 2014).

The case of T. adamastor is an excellent example that portrays the importance of museum collections. The description of this species was based on the eight specimens that were forgotten in the IICT. It is important that more attention be paid to collections like this to prevent extinction of species before we know them. The IICT which includes

the collection of this study is a very important repository of the biodiversity of Africa, since there are few collections in the world that include this area. It is essential to preserve unique collections of natural history of this type and not to let them be forgotten (Ceríaco 2015).

Due to its recent description, a lot is still unknown regarding T. adamastor, such its phylogenetic and phylogeographic placement within the genus, or its population density. Phylogeography is a growth field of evolutionary biology, interested in the study of genetic lineages with the purpose of perceiving the geographic and demographic history within and between closely related species (Avise 2009). This can be accomplished by genomic approaches through molecular markers, as mitochondrial or nuclear DNA, associated with morphological data (Brito & Edwards 2009; Portik & Bauer 2012), giving us important tools for the interpretation of current species distributions in an evolutionary context.

Reptiles have been used as model organisms for ecological and evolutionary studies from individual to community levels, and many species have been studied and incorporated into phylogeographic studies worldwide, being common in many regions of Europe (e.g. Harris & Sá-Sousa 2002; Podnar et al. 2005; Carranza et al. 2006; Vaconcelos et al. 2006; Ursenbacher et al. 2006; Ursenbacher et al. 2008; Fonseca et al. 2009), North America (e.g. Burbrink 2002; Wiens & Penkrot 2002; Feldman & Spicer 2006; Leaché & Mulcahy 2007), Australia (Rawlings & Donnellan 2003; Chapple & Keogh 2004; Dolman et al. 2006; Pepper et al. 2006; Hodges et al. 2007; Lukoschek et al. 2007; Moussalli et al. 2009), among others. Other countries with highly diverse herpetofauna as Africa remain poorly studied with the majority of studies only focused in areas within Southern Africa (Makokha 2006; Tolley et al. 2006; Daniels et al. 2007; Tolley et al. 2008; Portik & Bauer 2012; Swart et al. 2009).

The use of reptiles as models on phylogeographic studies, is partly explained due to their low to moderate levels of movement and dispersion when compared with vertebrate groups, such as birds and mammals, which help to maintain historical patterns (e.g. genetic and geological events). They also exhibit highly morphological and genetic variability, and are widely distributed geographically, occupying a wide range of habitats (Camargo et al. 2010) as well as easy to collect, promoting behavioral and ecological studies. Population density is one of the most helpful tool used for

innumerable ecological purposes (Efford & Fewster 2013) and it is of particular importance to conservation and management of populations.

The species richness is affected by habitat diversity (Williams 1964; Connor & McCoy 1979), more habitats in a given area will have more species inhabiting there. On islands a positive association between area and species richness has been noted (Preston 1948; Williams 1964; MacArthur 1972; Simberloff 1974; Williamson 1981, 1988; Rosenzweig 1995). However, population density of a species fluctuates depending on available resources and with the interactions with other species in the area where it inhabits (Damuth 1981, 1987; Tilman 1994). The environmental and ecological limitations equilibrium on population density are greatly changed on islands (Buckley & Jetz 2007). Population densities tend to be higher on islands species when compared with mainland (MacArthur et al. 1972; Rodda & Dean-Bradley 2002; Buckley & Jetz 2007), the lower number of species on small or isolated island may lead to this and to ecological release. MacArthur et al. (1972) reported that although birds have high population densities on islands, they exhibit lower species richness. This phenomenon is nominated density compensation, and has been well verified on lizards (Case 1975; Case & Bolger 1991; Rodda & Dean-Bradley 2002). Insular species may have an increasing population density due to the lower interspecific competition and predation risk (MacArthur et al. 1972; Adler & Levins 1994). Despite this, species may suffer variations in their real density due to environmental aspects and body size as example (MacArthur et al. 1972; Novosolov et al. 2013). Numerous studies support density compensation and the high population densities on islands (Buckley & Jetz 2007; Novosolov et al. 2013). Knowing the abundance of animals is crucial to understand their ecology, nevertheless, many estimates of population density are untrustworthy because they are not representative (Rodda et al. 2001). Population density has to be evaluated mostly indirectly, since the direct and exhaustive counting of animals is very difficult and sometimes impossible (Efford & Fewster 2013). The lizards perform a relevant component in food chain in several environments, thus, many ecological studies included this group as a model, especially on islands. There are some estimate population density studies with lizards (e.g. Ruibal & Philibosian 1974; Gorman & Harwood 1977; Bullock & Evans 1990; Rodda et al. 2001; Pérez-Mellado et al. 2008; Efford & Fewster 2013; Anton et al. 2014; Novosolov et al. 2015) for different species and purposes.

Main Objectives

The only available exemplars of T. adamastor correspond to eight specimens from the collection of IICT, from early 1970’s. Despite the available molecular data between the Trachylepis species of the Gulf of Guinea there is no information regarding T. adamastor. Only recent morphological data where published regarding T. adamastor. Considering the current knowledge of T. adamastor, and the lack of information about their relationship with T. principensis and T. thomensis, and their morphological differences (size, coloration and scale numbers), as well the Tinhosa Grande islet conditions (isolation, habitat and limited area), this dissertation aims to provide the first genetic and ecological (population density and diet) data to the scientific community, in order to try to understand the phylogenetic relationships between the three species, the ecological habits of T. adamastor, as well the most effective conservation strategies to be applied.

Given that, it is expected to: 1) Provide the first study the phylogenetic and phylogeographic relationships of Trachylepis adamastor; 2) Estimate the population density of Trachylepis adamastor in Tinhosa Grande islet; 3) Understand the trophic ecology and ecological relations of Trachylepis adamastor.

To achieve the proposed objectives, an expedition was conducted in São Tomé and Príncipe islands and Tinhosa Grande islet, with the intention of collecting new fresh material to combine with the available data found at museum collections to analyze and compare all material though molecular, morphological and ecological methods.

Paper I: Phylogeography of the Adamastor skink Trachylepis adamastor on the Tinhosa Grande islet, Gulf of Guinea.

Abstract

Six species of the genus Trachylepis occur in the Gulf of Guinea - T. maculilabris, T. ozorii, T. affinis, T. thomensis, T. principensis and T. adamastor. This paper aims to present the first phylogenetic and phylogeographic analysis regarding the position of T. adamastor among its congeners. Morphological data show striking phenotypic differences between T. adamastor, T. thomensis and T. principensis, such as body size and coloration. Although phylogenetic analyzes using the 16S and ND2 mitochondrial genes and the RAG-1 nuclear gene, showed that the species T. principensis and T. adamastor are genetically conspecific. This study discusses the taxonomic and nomenclatural implications of these findings, analyze the different taxonomic approaches, and review the impact that the potential taxonomical rearrangement may have on conservation.

Key words: São Tomé & Príncipe, Tinhosa Grande, Trachylepis adamastor, Trachylepis principensis, Phylogeny, Phylogeography, Taxonomy.

Resumo

São atualmente conhecidas para o Golfo da Guiné seis espécies do género Trachylepis - T. maculilabris, T. ozorii, T. affinis, T. thomensis, T. principensis e T. adamastor. Este artigo pretende fornecer a primeira análise filogenética e filogeográfica da espécie T. adamastor e dos seus congéneres. Os dados morfológicos exibem diferenças fenotípicas muito acentuadas entre a espécie T. adamastor e as espécies T. thomensis e T. principensis, como por exemplo no tamanho do corpo e na coloração. Apesar disto, através de análises filogenéticas utilizando os genes mitocondriais 16S e ND2 e o gene nuclear RAG-1, observou-se que as espécies T. principensis e a T. adamastor são coespecíficas. Neste estudo discutem-se as implicações taxonómicas e nomenclaturais destes resultados, ao mesmo tempo que se analisam as diferentes possíveis abordagens taxonómicas, e o seu potencial impacto para a conservação.

Palavras chave: São Tomé e Príncipe, Tinhosa Grande, Trachylepis adamastor, Trachylepis principensis, Filogenia, Filogeografia, Taxonomia.

Introduction

Trachylepis Fitzinger, 1843 is one of the most speciose genera of scincidae and currently contains about 78 species (Uetz & Hošek 2016), however new species are constantly being described, as is the case of T. gonwouoi described in May 2017 (Allen et al. 2017). The genus Trachylepis have a wide distribution throughout Africa, from the mainland, to the islands of the Comores, Madagascar, Seychelles, Gulf of Guinea, and Fernando Noronha, an archipelago in Brazil (Mausfeld et al. 2000; Bauer 2003; Uetz & Hošek 2016). In the Gulf of Guinea oceanic islands, the genus is one of the richest in terms of species diversity, with five Trachylepis species inhabiting on these islands: the endemic Trachylepis thomensis Ceríaco, Marques & Bauer, 2016, on São Tomé island and Rolas Islet (Ceríaco et al. 2016); Trachylepis principensis Ceríaco, Marques & Bauer, 2016, endemic to Príncipe island (Ceríaco et al. 2016); T. adamastor Ceríaco, 2015, endemic to Tinhosa Grande islet off the coast of Príncipe (Ceríaco 2015); T. affinis (Gray, 1838) on Príncipe island; and the T. ozorii (Bocage, 1893) endemic to Annobon island (Manaças 1958, 1973; Jesus et al. 2003, 2005a).

The islands of the Gulf of Guinea are one of the biodiversity hotspots of the world, biogeographically part of the rainforest zone of West Africa (Myers et al. 2000; Drewes 2002; Measey et al. 2007; Jesus et al. 2009). They are a part of the Cameroon volcanic line, having an extension of at least 1600 km (Lee et al. 1994). Bioko is the largest island (2017 km2) and the only one that has ever been linked to the mainland, being the one closest to the African continent, by only 32 km (Lee et al. 1994; Marzoli et al. 2000). The other three islands, all of them oceanic, have never been connected to the mainland, have volcanic origin, and were formed at different years. Príncipe is the oldest, formed 31 My ago, followed by São Tomé 14 My ago and finally the most recent Annobon 4.8 My ago (Lee et al. 1994). Príncipe (128 km2) is the closest island to the African continent, only 250 km away, followed by São Tomé (836 km2) at 280 km and Annobon (17 km2) at 375 km (Lee et al. 1994; Marzoli et al. 2000). The isolation and the geographic characteristics promoted the divergence and speciation of the species, giving origin to high rates of endemism (Dutton 1994; Jones 1994; Drewes 2002; Measey et al. 2007; Uyeda et al. 2007; Vaz & Oliveira 2007; Melo et al. 2011). Regarding herpetofauna, with the exceptions of Trachylepis affinis in Príncipe, Pelusios castaneus (Schweigger, 1812) in São Tomé, and Hemidactylus mabouia (Moreau de Jonnès, 1818) and Hemidactylus longicephalus Bocage, 1873 on both islands (Manaças

1958), all species of reptiles appear to be endemic (Ceríaco et al. in press), while for the amphibians the rate of endemism is 100% (Ceríaco et al. in press). These islands have been the subject of many recent studies (e.g. Drewes & Stoelting 2004; Jesus 2005; Jesus et al. 2005a,b, 2006; Jones & Tye 2006; Measey et al. 2007, Jesus et al. 2007, 2009; Dallimer et al. 2009; Melo et al. 2011; Valle et al. 2014; Lima et al. 2015, 2016) leading to the identification and description of several new vertebrate species (e.g. Measey et al. 2007; Uyeda et al. 2007; Miller et al. 2012; Ceríaco 2015; Ceríaco et al. 2015; Bell 2016; Ceríaco et al. 2016, 2017).

The phylogenetic and phylogeographic relationships of the Gulf of Guinea islands Trachylepis were analyzed first at molecular level by Jesus et al. (2005a,b) and more recently at molecular and morphological level by Ceríaco et al. (2016). T. maculilabris (Gray, 1845) and T. affinis species include several highly divergent evolutionary lineages belonging to intricate complexes (Mausfeld et al. 2004; Rocha et al. 2010). Jesus et al. (2005a) showed that T. affinis had a high degree of differentiation (15%) between the Príncipe and Guinea-Bissau populations. The same study revealed that the two populations of T. maculilabris from São Tomé and Príncipe diverge 10.8% based on the cytochrome b and both have different lineages of unknown continental lineage (Jesus et al. 2005a). In a sequential study, Jesus et al. (2005b) obtained little or almost no gene flow between the two populations, showing a degree of geographic population substructuring within T. maculilabris consistent with the known geology of the island. This study contradicts the previous one (Jesus et al. 2005a) assuming that the populations of São Tomé and Príncipe are sister taxa and it assumes that the origin of all T. maculilabris lineages in São Tomé were about 800,000 ya. Later, Rocha et al. (2010) through molecular data again distinguished the populations of the two islands, and found that they do not form a monophyletic group. Recently, Ceríaco et al. (2016) through molecular and morphological data showed that the populations of São Tomé (T. thomensis) and Príncipe (T. principensis) are different from each other and from the continental population of T. maculilabris. It is possible that T. thomensis and T. principensis have the same ancestor and it is probable that Trachylepis colonized the two islands separately and not by island-hopping (Jesus et al. 2005a). Although there are few studies of T. ozorii, Jesus et al. (2005a) showed a high level of divergence (10.8% for cytochrome b) between T. ozorii and the other species of the genus, suggesting that this species is unrelated to the other Trachylepis species on the Gulf of

Guinea oceanic islands, proposing that the ancestors colonized Annobon directly from the continent, rather than “island-hopping”. Despite the lack of available molecular data for T. adamastor, Ceríaco (2015) hypothesizes that this belongs to the same monophyletic lineage of T. maculilabris due to several synapomorphic characters. Either one of São Tomé or Príncipe populations may have given origin to the species of Tinhosa Grande, through the "island-hopping " colonization, a pattern known in the area by other reptile (Jesus et al. 2007) and amphibian species (Drewes & Wilkinson 2004). Considering this, there are still questions regarding the phylogeographic origin that need to be answered, since the hypothesis put forward by Ceríaco (2015) was formed only based on morphological data. To test this hypothesis, in February 2016 two field trips to Tinhosa Grande were held by the author, with the objective of investigating the presence of T. adamastor in the islet, knowing its habitat and collecting specimens and tissues. This study will focus on this question using mitochondrial, 16S (e.g. Mausfeld et al. 2000; Jesus et al. 2005a,b, 2007; Rocha et al. 2010; Ceríaco et al. 2016; Allen 2015; Allen et al. 2017) and ND2 (e.g. Portik et al. 2010, 2011; Portik & Bauer 2012; Allen 2015; Allen et al. 2017), and nuclear, RAG-1 (e.g. Portik et al. 2010, 2011; Portik & Bauer 2012; Allen 2015) genes, which are common in studies of this type for this genus.

Material and methods

Sampling

Fourteen individuals of T. adamastor were collected from the Tinhosa Grande islet, in 16 and 19 February 2017. For morphological and morphometric comparisons were also collected four T. principensis from Príncipe. Capture and handling of specimens were carried out with permission of the Regional Government of Príncipe and the direction of Obô National Park. The specimens were euthanized and preserved in 10% buffered formalin in the field and transferred to 70% ethanol after expedition. Liver tissue was removed before formalin fixation and preserved in 95% ethanol. The specimens collected were appropriately identified with labels for each one with a field number, associated with information such as coordinates, name of the collection site, collector (s), and date. The eighteen individuals collected were deposited in the Herpetological Collection of Museu Nacional de História Natural e da Ciência

(MUHNAC) (Lisbon, Portugal), with a new collection number, and their tissue samples were deposited in the Tissue and DNA Collection of MUHNAC. For mensural, merisitic, but also molecular comparisons were also included in the analysis the available data on T. thomensis (13 specimens), T. principensis (13 specimens) and T. adamastor (8 specimens), available on the collections of MUHNAC, California Academy of Sciences (CAS) (San Francisco, USA), Muséum d'Histoire Naturelle Genève (MHNG), (Switzerland), and Instituto de Investigação Científica Tropical (IICT) (Lisbon, Portugal) used in former papers (Ceríaco 2015; Ceríaco et al. 2016).

Morphological methods

The morphological analysis of the fourteen individuals of T. adamastor was performed, with three males, six females and five sub adults. For comparison, data from Ceríaco et al. (2016) were used, where specimens of T. thomensis and T. principensis (thirteen each) were examined; and also the data from Ceríaco (2015) for the T. adamastor (eight specimens). Specimens were measured only by the author with a digital caliper, lepidosis was observed with the help of binocular magnifiers. Scale nomenclature, scales counts and measurements used in the description follow Broadley (2000). The following characters were measured: snout-vent length (SVL), from the snout to the vent; tail length (TL), from cloaca to tip of tail, measured only in specimens with complete original tails; head width (HW); head length (HL), from tip of snout to anterior tympanum border; head height (HH), from the base of the maxilla to the top of head; eye-snout distance (ES), from the front of the eye to the tip of the snout; eye- nostril distance (EN), from the front of the eye to the nostril; inter-nostril distance (IN), minimum distance between the nostrils; number of scale rows at midbody (MSR); number of scales dorsally (SAD), from the nuchal (excluded from count) to base of the tail; number of scales ventrally (SAV), from the mental (excluded from count) to the anal plate (excluded); number of subdigital lamellae under Finger-IV (LUFF); number of subdigital lamellae under Toe-IV (LUFT); number of supralabials (SL), with those widened in subocular position indicated between brackets; number of supraciliaries (SC); number of supraoculars (SO); number of nuchal scales (NS); number of keels on dorsal scales (KDS); kind of contact between parietals (CP); kind of contact between frontoparietals (CFP); kind of contact between supranasals (CSN); kind of contact between prefrontals (CPF).

Molecular methods

During field work the liver tissue was removed from the specimens and preserved in the 1.5ml alcohol tube. This tube was identified with the field number of the specimen. The tissue was thus used to extract mitochondrial DNA according to protocol E.Z.N.A. ® Tissue DNA Kit Protocol - Tissue, in the Zoology Corridor genetics laboratory at MUHNAC. Two mitochondrial markers (mtDNA) were used, the 16S ribosomal unit and the NADH dehydrogenase subunit 2 (ND2), and one nuclear marker the RAG-1 (Table 1), for having been proven to be useful for identifying species level divergences in the genus Trachylepis (Mausfeld et al. 2000; Jesus et al. 2005a; Portik et al. 2010; Rocha et al. 2010; Ceríaco et al. 2016; Allen et al. 2017).

TABLE 1. Primers used in this study for the amplification of 16S, ND2 and RAG-1. Number of cycles, annealing temperatures and references of original primer publication.

cycles/ temp Gene Primer Primer Sequences (5’–3’) Reference (˚C) Palumbi 16SAR-L CGCCTGTTTATCAAAAACAT 35/52 1996 16S Palumbi 16SBR-H CCGGTCTGAACTCAGATCACGT 35/20 1996 Macey et al. Metf1 AAGCTTTCGGGCCCATACC 34/50 1997 Sequencing Macey et al. L5002 AACCAAACCCAACTACGAAAAAT primer 1997 ND2 Arèvalo et CO1R1 AGRGTGCCAATGTCTTTGTGRTT 34/50 al. 1994 Weisrock et CO1R8 GCTATGTCTGGGGCTCCAATTAT 32/52 al. 2001 Portik et al. Rag1SkinkF2 TTCAAAGTGAGATCGCTTGAAA 34/50 2010 RAG-1 Portik et al. Rag1SkinkR1200 CCCTTCTTCTTTCTCAGCAAAA 34/50 2010

Polymerase chain reaction (PCR) for 16S (PCT; 16 μl) consisted of 1x PCR

Buffer 80 µl, 40 µl MgCl2, 32 µl dNTP, 192.8 µl of H2O, 8 µl primer16SAR-L and 8 µl 16SBR-H, 4 µl BSA (bovine albumin), 3.2 µl of Taq polymerase, and 1 µl of extracted DNA. Thermal cycling was as follows: initial denaturation step: 5 min at 85 °C; 35 cycles: denaturation 35 s at 94 °C, primer annealing for 3 s at 52 °C; extension for 1 min at 72 °C; and a final step of 5 min at 72 °C (Table 1). PCR reactions for ND2 and RAG-

1 were performed with a final volume of 22.5 µl containing: 9.9 µl sterile H2O, 0.1 µl of Taq DNA polymerase (New England BioLabs, Ipswich, MA, USA), and 2.5 µl each of

forward primer (8 ppm), reverse primer (8 ppm), 10x standard buffer (New England BioLabs), 5X-Q solution (Qiagen, Germantown, MD, USA), and dNTP mix. All PCR reactions were carried with an initial 2 min denaturation at 95˚C, followed by 32–34 cycles [35 s DNA denaturation at 95˚C, 35 s primer annealing at 50–52˚C, 1 min 35 s extension at 72˚C (Table 1)], and a final extension at 5˚C for 1 min. PCR products were tested for successful amplification using gel electrophoresis on 1.5% agarose gels. PCR products were cleaned using the protocol enonuclease I/FastAPTM Thermosensitive Alkaline Phosphatase. The samples were sent to a Macrogen company (Amsterdam, The Netherlands) for the sequencing. The obtained DNA sequences were individually aligned using the Squencher 4.8 software (Gene Codes, Ann Arbor, MI, USA) and manually analyzed for stop codons due to sequencing errors.

Phylogenetic analysis

Sequences were aligned using the ClustalW alignment tool in MEGA 6.06 (Tamura et al. 2013). A Maximum Likelihood (ML) analysis was performed on the 16S, ND2 and RAG1 dataset, using MEGA 6.06 (Tamura et al. 2013). Optimum substitution models were selected by ModelTest 3.7 (Posada & Crandall 1998) using the Akaike informative criterion. The analyses were performed with a random starting tree under the K2 + G model. Phylogenetic robustness was estimated in the ML analyses by running 1000 random addition bootstrap replicates (Felsenstein 1985). This study regarded tree topologies with bootstrap values (bs) of 70% or greater as well supported (Huelsenbeck & Hillis 1993). Pairwise comparisons of uncorrected sequence divergences (p-distance) were computed in MEGA 6.06 (Tamura et al. 2013). The specimens and sequences used for the genetic analysis and also their location are presented in the Appendix I.

Results

Morphology

Mensural and meristic data of the fourteen specimens T. adamastor are presented in Table 2. The general comparison between T. adamastor from Tinhosa Grande islet, T. principensis from Príncipe island and T. thomensis from São Tomé island are present in Table 3. The data of T. adamastor includes the specimens collected

on the expedition and also specimens already present at IICT collection from Ceríaco (2015). The data of T. principensis and T. thomensis was taken from Ceríaco (2015) and Ceríaco et al. (2016). The three species differ from each other, T. adamastor appears to have a much larger average of body size compared to the other two species (Maximum SVL T. adamastor: 112,04 mm, T. principensis: 88,30 mm, T. thomensis: 92,10 mm). Other characters such as head width (Maximum HW T. adamastor: 15,85 mm, T. principensis: 13,10 mm, T. thomensis: 13,5 mm), head length (Maximum HL T. adamastor: 22,37 mm, T. principensis: 19,90 mm, T. thomensis: 21,00 mm), head height (Maximum HH T. adamastor: 13,00 mm, T. principensis: 9,30 mm, T. thomensis: 11,10 mm), inter-nostril distance (Maximum IN T. adamastor: 4,18 mm, T. principensis: 2,80 mm, T. thomensis: 3,70 mm), eye-nostril distance (Maximum EN T. adamastor: 7,42 mm, T. principensis: 6,10 mm, T. thomensis: 6,20 mm), eye-snout distance (Maximum ES T. adamastor: 10,08 mm, T. principensis: 7,60 mm, T. thomensis: 8,80 mm) also have a higher average in T. adamastor specimens. T. adamastor (Fig. 1) is a more robust species when compared to the other two. Its coloration is also quite different from T. principensis (Fig. 2) and T. thomensis (Fig. 3), presenting a melanic coloration.

FIGURA 1. Trachylepis adamastor in life from Tinhosa Grande islet (Photo: Luis Ceríaco).

FIGURA 2. Trachylepis principensis in life from Príncipe island (Photo: Luis Ceríaco).

FIGURA 3. Trachylepis thomensis in life from São Tomé island (Photo: Luis Ceríaco).

MB03 001050 ♂ 108,00 95,00 13,48 18,82 10,51 3,75 7,21 10,07 17,43 53,51 55,84 71,63 87,96 14 17 34 48 58 3

MB03 001049 ♀ 104,00 65,00 12,72 17,48 9,37 3,78 7,11 9,04 16,81 51,72 53,60 72,77 62,50 13 17 34 48 59 3

,03 -

MB03 001048 ♂ 107,00 96,00 15,00 17,99 10,01 4 6,98 9,44 16,81 52,47 55,64 83,38 89,72 13 16 35 50 59 5

MB03 001047 Subadult 105,00 129,00 13,65 17,17 10,12 3,61 6,08 9,63 16,35 56,09 58,94 79,50 122,86 14 15 35 50 60 3

MB03 001046 Subadult 107,00 95,00 15,85 18,20 11,52 4,18 7,42 9,78 17,0 53,74 63,30 87,09 88,79 13 15 34 50 58 3

MB03 001045 Subadult 108,00 23,00 13,64 16,93 11,93 4,06 6,54 9,76 15,68 57,65 70,47 80,57 21,30 14 17 34 51 58 3

07,48

MB03 001044 Subadult 107,00 115,00 14,15 17,12 10,57 3,97 6,31 9,00 16,00 52,57 61,74 82,65 1 14 16 33 50 58 3

MB03 001043 Subadult 103,00 99,00 14,76 18,08 10,92 4,08 6,70 10,08 17,55 55,75 60,40 81,64 96,12 13 15 34 48 58 3

MB03 001020 ♀ 105,00 121,00 13,29 17,80 8,89 3,39 6,60 10,02 16,95 56,29 49,94 74,66 115,24 13 15 34 50 59 3

. Abbreviations are the same as Methods.and those Materials same in described the . are Abbreviations

MB03 001019 ♀ 104,00 134,00 13,19 17,04 9,68 3,52 6,60 9,09 16,38 53,35 56,81 77,41 128,85 13 15 33 49 60 3

MB03 001018 ♂ 102,00 123,00 14,88 18,59 9,32 3,78 7,27 9,78 18,23 52,61 50,13 80,04 120,59 14 17 34 51 60 3

Trachylepis adamastor Trachylepis

MB03 001017 ♀ 104,00 145,00 12, 17,22 8,59 3,82 6,51 9,02 16,56 52,38 49,88 74,68 139,42 14 17 34 48 58 3

MB03 001016 ♀ 110,00 132,00 14,57 17,05 10,62 3,34 6,68 9,49 15,50 55,66 62,29 85,45 120,00 14 16 34 51 60 3

MB03 001015 ♀ 72,00 76,00 9,49 12,15 5,44 2,82 4,34 6,71 16,88 55,23 44,77 78,11 105,56 13 17 33 48 56 3

L (%)L

. Measurements and scale counts of scale and . Measurements

(%)

Sex SVL TL HW HL HH IN EN ES HL/SV ES/HL (%) HH/HL HW/HL (%) (%)TL/SVL LUFT LUFF MSR SAD SAV KDS TABLE TABLE

TABLE 3. General comparison between Trachylepis species from Tinhosa Grande islet, Príncipe and São Tomé islands. Data present as "min-max (mean ± standard deviation)". Abbreviations are the same as those described in Material and Methods.

T. adamastor (n=22) T. principensis (n=13) T. thomensis (n=13) Geographic distribution Tinhosa Grande islet Príncipe island São Tomé island 72,00-112,04 (103,96 ± SVL (mm) 10,03) 69,50-88,30 (81,75 ± 5,55) 74,00-92,10 (81,88 ± 6,54) 23,00-175,64 (114,56 ± 140,00-184,10 (157,06 ± 116,3-180,00 (137,65 ± TL 10,03) 15,34) 17,14) HW 9,49-15,85 (13,45 ± 1,74) 8,80-13,10 (10,87 ± 1,13) 9,00-13,5 (11,18 ± 1,25) HL 12,15-22,37 (18,09 ± 2,36) 14,50-19,90 (17,56 ± 1,36) 15,30-21,00 (17,46 ± 1,58) HH 5,44-13,00 (9,79 ± 1,84) 6,60-9,30 (8,12 ± 0,75) 6,30-11,10 (8,77 ± 1,48) IN 2,50-4,18 (3,52 ± 0,49) 1,90-2,80 (2,38 ± 0,26) 1,50-3,70 (2,69 ± 0,60) EN 4,34-7,42 (6,39 ± 0,82) 3,30-6,10 (4,87 ± 0,67) 3,90-6,20 (4,92 ± 0,80) ES 6,71-10,08 (8,91 ± 1,06) 6,00-7,60 (6,82 ± 0,55) 6,10-8,80 (7,02 ± 0,85) HL/SVL (%) 15,50-20,63 (17,40 ± 1,39) 20,10-24,10 (21,50 ± 1,44) 19,20-24,20 (21,35 ± 1,45) ES/HL (%) 39,24-57,65 (49,65 ± 6,56) 36,10-41,60 (38,83 ± 1,88) 37,10-49,30 (40,22 ± 3,09) HH/HL (%) 43,87-70,47 (54,10 ± 7,62) 41,80-81,40 (57,69 ± 16,18) 41,30-62,00 (49,91 ± 5,32) HW/HL (%) 58,15-87,09 (74,64 ± 8,27) 55,30-65,90 (61,72 ± 2,75) 56,60-78,90 (63,91 ± 5,24) 21,30-164,95 (111,19 ± 167,10-228,10 (198,44 ± 145,20-205,10 (167,10 ± TL/SVL (%) 39,42) 22,73) 21,27) LUFT 13-20 20-23 15-20 LUFF 15-17 16-18 15-22 MSR 31-35 31-33 31-35 SAD 48-56 47-51 55-59 SAV 56-66 57-64 58-64 KDS 3-6 5-6 4-6 CP Always in contact, or in Always in contact, or in Usually in contact, or in contact in a single point contact in a single point contact in a single point CFP Always in contact Always in contact Always in contact CPF Variable Variable Variable Always in contact forming Always in contact Always in contact CSN a suture Coloration Background color of the Back uniformly brownish and Back brownish, with some flanks and the upper side of belly light bluish on alcohol dark and white speckles and head, neck, back, legs and preserved specimens, and belly light orange-yellow in tail are dark-brown, with bluish to greenish in life alcohol preserved specimens, many subtle white speckles specimens. pinkish-yellow in live on the dorsum starting on specimens. A thin horizontal the neck and running line composed by through the entire dorsum approximately seven to eight to the base of tail. Subtle white speckles from the back darker lateral band, starting of the eye to the top of the on the extremities of the tympanum. nuchals continues until the arm insertion. Lateral area of the body greyish, with some brown stains. Venter uniformly whitish. Supralabials with a whithish area on the base, black on the top.

Phylogeny

The aligned dataset contains 3248 (572 16S; 1488 ND2; 1188 RAG1) molecular characters. Contrary to what was expected, at molecular levels T. adamastor does not differ from the Príncipe population, appearing to be conspecific. For the phylogenetic analysis of the different Trachylepis species using the mitochondrial marker 16S the following results were obtained. T. thomensis have a genetic distance of 2.6% from T. principensis, 3.5% from T. affinis, and 2.72% from T. maculilabris. T. principensis have a genetic distance of 4.17% from T. affinis and 2.56% from T. maculilabris. T. affinis is separated from T. maculilabris by a genetic distance of 3.97%. T. adamastor have a genetic distance of 2.6% from T. thomensis, 4.17% from T. affinis, 2.58% from T. maculilabris. T. adamastor have a genetic distance of only 0.02% from T. principensis. Using the mitochondrial marker ND2 the results were as follows: T. thomensis have a genetic distance of 3.2% from T. principensis, 3.7% from T. affinis, and 2.8% from T. maculilabris. T. principensis have a genetic distance of 3.69% from T. affinis and 2.9% from T. maculilabris. T. affinis is separated from T. maculilabris by a genetic distance of 4.13%. T. adamastor have a genetic distance of 3.2% from T. thomensis, 3.67% from T. affinis, 2.89% from T. maculilabris. T. adamastor have a genetic distance of only 0.3% from T. principensis. The results for the nuclear marker RAG-1 were: T. thomensis have a genetic distance of 1.2% from T. principensis, 2.96% from T. affinis, and 0.8% from T. maculilabris. T. principensis have a genetic distance of 3.2% from T. affinis and 1% from T. maculilabris. T. affinis is separated from T. maculilabris by a genetic distance of 2.65%. T. adamastor have a genetic distance of 1.15% from T. thomensis, 3.28% from T. affinis, 1.1% from T. maculilabris. T. adamastor have a genetic distance of only 0.4% from T. principensis. All values, for both mitochondrial and nuclear markers, are greater than the maximum divergence found within the same species, except for T. adamastor and T. principensis. Trachylepis affinis was used as outgroup because it was clear its separation and distance from the group under analysis. Phylogenetic analysis for 16S mitochondrial gene shows that the monophyletic group of T. maculilabris complex contains within itself a considerable cryptic diversity (Fig. 4). Considering that T. maculilabris was originally described from West Africa (Gray 1845), it is assumed that this lineage represents the topotypic population. Outside the topotypic population are two other T. cf. maculilabris, T. cf. maculilabris 1 from Socotra Archipelago, Yemen (JQ598785-1) and T. cf. maculilabris 2 from Tanzania

(AY070356.1). The presence of these second lineage and potential cryptic species had already been reported by other authors (Mausfeld et al. 2000; Mausfeld et al. 2004; Rocha et al. 2010). Besides this second lineage, two other lineages are of interest and potentially represent species candidates: T. cf. maculilabris 3 from Burundi (CAS250828) and T. cf. maculilabris 4 from Gabon (CAS258254). The lineages of the São Tomé and Príncipe and its islets populations fall within the expanded T. maculilabris complex. These results confirm those of Ceríaco et al. (2016), which show two different species for the two islands, T. thomensis (São Tomé) and T. principensis (Príncipe). However, although the results for T. adamastor confirm the hypothesis presented by Ceríaco (2015), in which the author noted that T. adamastor would belong to the T. maculilabris species complex and with close affinities to either T. principensis or T. thomensis, the tree shows that T. adamastor and T. principensis belong to the same branch, presenting only a very small structure that reflects the isolation of the populations but does not allow to affirm that they are different species. Although for the mitochondrial ND2 gene some of the T. maculilabris populations are not available, the topology of the tree (Fig. 5) reflects the same relationships as the 16S gene. The T. principensis and T. adamastor appear conspecific, sister of T. maculilabris West Africa, while T. thomensis appears as sister of these two. The nuclear gene RAG-1, despite lacking as much taxonomic and population coverage as the latter genes still presents the same topology (Fig. 6) as that of the mitochondrial genes.

FIGURE 4. Maximum-likelihood phylogeny of 16S gene dataset of Trachylepis.

FIGURE 5. Maximum-likelihood phylogeny of ND2 gene dataset of Trachylepis.

FIGURE 6. Maximum-likelihood phylogeny of RAG-1 gene dataset of Trachylepis.

Discussion

Based on the two mitochondrial (16S and ND2) and one nuclear (RAG-1) genes, T. adamastor and T. principensis belong to the same clade. These results partly agree with the initial findings of Ceríaco (2015) and Ceríaco et al. (2016) regarding the relationship between the São Tomé and Príncipe species, but contradicts the hypothesis that T. adamastor represents a separate species from the Príncipe species. However, both Ceríaco (2015) and Ceríaco et al. (2016) and this study found consistent morphological differences between the three populations. Morphologically T. adamastor is very different from T. principensis, with a more robust body and with a melanic coloration. However molecular data show that the population of Príncipe island (T. principensis) and Tinhosa Grande islet (T. adamastor) are conspecific, and share the same ancestral of the sister species T. thomensis and T. maculilabris. The colonization of T. principensis and T. thomensis probably occurred separately and not by island- hopping, and possibly these two populations have a common ancestor (Jesus et al. 2005a).

Two similar cases to that of adamastor/principensis are known in the Gallotia Boulenger, 1916 and Podarcis Wagler, 1830 genera. The species Gallotia simonyi (Steindachner, 1889) endemic from Canary island, which was for a long period of time considered to be extinct from the small island Roque Chico of Salmor by the scientific community (Carranza et al. 1999), contains two subspecies which were described based on morphological differences - the extinct subspecies Gallotia simonyi simonyi (Steindachner 1889) of the small island Roque Chico of Salmor and the subspecies G. s. machadoi López-Jurado 1989 of the island El Hierro. These differences were related to the size, robustness, shape of the pileus, head and number of temporal scales (Machado 1985; López-Jurado 1989). Despite these morphological differences Carranza et al. (1999) found no genetic differentiation between both subspecies. The other case is that of Podarcis bocagei berlengensis Vicente, 1985 from the Berlengas islands off the western coast of Portugal, which was initially described by Vicente (1985) as a new subspecies, due to its relatively larger form and coloration patters. However, this subspecies was also found near the adjacent coast in Peniche (Sá-Sousa 1992 in Sá- Sousa et al. 2000). Later, Harris & Sá-Sousa (2001) using the CO1 mitochondrial gene did not find genetic differences between Podarcis b. berlengensis and P. carbonelli Pérez Mellado, 1981 (from the mainland), then changed the name to P. c. berlengensis (see also Sindaco & Jeremčenko 2008). During the last glacial maximum (LGM) (occurring between 19,000 to 21,000 years ago (Mix et al. 2001; Clark et al. 2009)) Príncipe island extended considerably to south, covering the region where today Tinhosas islets are, and only became separated again after the rise of the sea levels following the LGM. Thus, it is possible that the Tinhosa population (T. adamastor) represent an isolated population from the once larger Principe island that underwent a rapid adaptation, which was much faster phenotypically than genetically. With the passing of the years of separation between the Príncipe and the Tinhosas, the Tinhosa Grande islet suffered erosion and was devoid of any vegetation. T. adamastor had to adapt to this inhospitable habitat, which its giant form may be due to the relaxation of predation (Case 1978, 1982; Lomolino 1985; Grant 1998), such as the absence of mammal predators (Szarski 1962; Case 1978, 1982; Pregill 1986; Greer 2001; Meiri 2008) or due to the presence of ten thousand seabirds in the island (Sanchez-Piñero & Polis 2000; Bonnet et al. 2002), the accumulation of fecal matter, food remains and carcasses increase the availability of nutrients (Polis & Hurd 1996), or both. The melanic coloration of T. adamastor can be a protection against ultraviolet (UV)

radiation (Kollias et al. 1991; Setlow et al. 1993; Gunn 1998; Hofer & Mokri 2000; Callaghan et al. 2004; Calbó et al. 2005), since it is very exposed to sunlight, a resistance against diseases (Wilson et al. 2001), or an immune function (Mackintosh 2001; Wilson et al. 2001), among others. The origin of new morphologies and species are closely related to adaptive radiations, rapid divergence and phenotypic diversification (Simpson 1953; Givnish & Systma 1997; Schluter 2000; Glor 2010; Losos & Mahler 2010), and the present case falls under the main conditions of any classical case of adaptive radiation, that includes the Darwin’s finches on the Galápagos islands (Grant & Grant 2002; Grant et al. 2004; Petren et al. 2005), Anolis lizards on Caribbean islands (Losos 1992; Irschick et al. 1997; Pinto et al. 2008), cichlids of the East African Great Lakes (Sturmbauer 1998; Seehausen 2006) and Hawaiian silverswords (Baldwin 1997; Barrier et al. 1999), among others (Givnish & Systma 1997; Schluter 2000).

The results of phylogenetic relationships between Príncipe and Tinhosa Grande populations should be considered, despite genetically conspecific, they are in fact very different from each other morphologically. Furthermore, it is important to see this case in the light of species concept in similar cases, since these concepts are still currently surrounded by considerable controversy, leading to the fact that there are no fixed or established limits to define what it is or what is not a species. Besides this, many authors consider the subspecies concept among species, an even more debatable concept and without consensus among the scientific community.

For this particular case, there are two possible solutions. The first one, would be to consider both populations conspecific. According to the Code (ICZN 1999) article 23 (Principle of Priority), the valid name of the population from Príncipe and from Tinhosa Grande is the oldest available name, which in this case it would be T. adamastor, and therefore T. principensis would be sunk into adamastor synonymy. The second option, would be to consider each island population as a subspecies, T. adamastor adamastor for the population of Tinhosa Grande islet and T. adamastor principensis of the Príncipe island, given their striking morphological differences and its allopatry. This option was that followed by Sá-Sousa et al. (2000), Harris & Sá-Sousa (2001) and Sá-Sousa & Harris (2002) for the case of the Berlengas Wall lizard already mentioned above. The choice between any of these options bears consequences, since it will critically affect the way decisions are going to be made regarding their conservation. In the case of the

adoption of the second option, each population would be considered an operational taxonomic unit (OTU). A given OTU groups and classifies different species populations, groups or closely related individuals, and can also have different designation, as for example evolutionarily significant units (ESUs) (Ryder 1986; Moritz 1994), operational units (Diniz-Filho & Telles 2002) and management units (MUs) (Moritz 1994). More recently, for standard taxonomic and ecological surveys were proposed by Blaxter et al. (2005) the molecular operational taxonomic units (MOTUs). These classifications help to prioritize in several domains, in effective way, taxa that are related.

Considering the results of the phylogeny and the relationships of the three populations of the São Tomé and Príncipe islands and Tinhosa Grande islet it is suggested, until new data are available, that T. adamastor be subdivided into two subspecies, T. adamastor adamastor for Tinhosa Grande population and T. adamastor principensis for Príncipe population. This suggestion is due to the fact that T. adamastor has undergone an allopatric speciation, the two populations are geographically separated by the ocean, so this isolation makes their contact difficult. Furthermore, the Tinhosa Grande population clearly had a radical adaptation, which resulted in very pronounced morphological differences, suggesting that these two populations are diverging. The islet conditions and isolation make T. adamastor adamastor vulnerable when submitted to different pressures and more susceptible to external events as predation and competition of introduced animals, environmental issues as climate change or any other stochastic events. Considering these issues, the risk of local extinction is possibly high, and given its small distribution area, more investigation is need not only to deepen knowledge of this population, but also to considerer suitable conservation plans focused on this population in particular. Following the option of dividing the two populations into subspecies, T. adamastor adamastor remains one of the most threatened animals on the planet due to its limited distribution, and for this reason two conservation plans must be considered (on for T. adamastor adamastor and other for T. adamastor principensis). T. adamastor adamastor is in a very vulnerable situation, so the national authorities should take action as soon as possible to protect this unique and endemic subspecies.

References

Allen, K.E. (2015). Phylogenetics and phylogeography of Central and West African Trachylepis skinks. Thesis (M.S.), Villanova University, Villanova, USA.

Allen, K.E., Tapondjou, W.P., Welton, L.J. & Bauer, A.M. (2017). A new species of Trachylepis (Squamata: Scincidae) from Central Africa and a key to the Trachylepis of West and Central Africa. Zootaxa, 4268(2), 255–269.

Arèvalo, E., Davis, S.K. & Sites Jr, J.W. (1994). Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Systematic Biology, 43(3), 387–418.

Baldwin, B.G. (1997). Adaptive radiation of the Hawaiian silversword alliance: congruence and conflict of phylogenetic evidence from molecular and non- molecular investigations. Molecular evolution and adaptive radiation, 103(128), 1840–1843.

Barrier, M., Baldwin, B.G., Robichaux, R.H. & Purugganan, M.D. (1999). Interspecific hybrid ancestry of a plant adaptive radiation: allopolyploidy of the Hawaiian silversword alliance (Asteraceae) inferred from floral homeotic gene duplications. Molecular biology and evolution, 16(8), 1105–1113.

Bauer, A.M. (2003). On the identity of Lacerta punctata Linnaeus, 1758, the type species of the genus Euprepis Wagler, 1830, and the generic assignment of Afro– Malagasy skinks. African Journal of Herpetology, 52, 1–7.

Bell, R.C. (2016). A New Species of Hyperolius (Amphibia: Hyperoliidae) from Príncipe Island, Democratic Republic of São Tomé and Príncipe. Herpetologica, 72(4), 343–351.

Blaxter, M., Mann, J., Chapman, T., Thomas, F., Whitton, C., Floyd, R. & Abebe, E. (2005). Defining operational taxonomic units using DNA barcode data. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 360(1462), 1935–1943.

Bonnet, X., Pearson, D., Ladyman, M., Lourdais, O. & Bradshaw, D. (2002). ‘Heaven’for serpents? A mark–recapture study of tiger snakes (Notechis scutatus) on Carnac Island, Western Australia. Austral Ecology, 27(4), 442–450.

Broadley, D.G. (2000). A review of the genus Mabuya in southeastern Africa (Sauria: Scincidae). African Journal of Herpetology, 49(2), 87–110.

Calbó Angrill, J., Pagès, D. & González Gutiérrez, J.A. (2005). Empirical studies of cloud effects on UV radiation: A review. Reviews of Geophysics, 43(2), RG2002.

Callaghan, T.V., Björn, L.O., Chernov, Y., Chapin, T., Christensen, T.R., Huntley, B., Ims, R.A., Johansson, M., Jolly, D., Jonasson, S., Matveyeva, N., Panikov, N., Oechel, W., Shaver, G., Elster, J., Jónsdóttir, I.S., Laine, K., Taulavouri, K., Taulavouri, E. & Zockler, C. (2004). Responses to projected changes in climate and UV-B at the species level. Amblo, 33, 418–435.

Carranza, S., Arnold, E.N., Thomas, R.H., Mateo, J.A. & López-Jurado, L.F. (1999). Status of the extinct giant lacertid lizard Gallotia simonyi simonyi (Reptilia: Lacertidae) assessed using mtDNA sequences from museum specimens. Herpetological Journal, 9, 83–86.

Case, T.J. (1978). A general explanation for insular body size trends in terrestrial vertebrates. Ecology, 59, 1–18.

Case, T.J. (1982). Ecology and evolution of the insular gigantic chuckawallas, Sauromalus hispidus and Sauromalus varius. Iguanas of the World, 184–212.

Ceríaco, L.M.P., Marques, M., Jacquet, F., Nicolas, V., Colyn, M., Denys, C., Sardinha, P.C. & Bastos-Silveira, C. (2015). Descritption of Crocidura fingui, a new endemic species of shrew (Mammalia, Soricomorpha) from Príncipe Island (Gulf of Guinea). Mammalia, 79(3), 325–341.

Ceríaco, L.M.P., Marques, M.P. & Bauer, A.M. (2016). A review of the genus Trachylepis (Sauria: Scincidae) from the Gulf of Guinea, with descriptions of two new species in the Trachylepis maculilabris (Gray, 1845) species complex. Zootaxa, 4109(3), 284–314.

Ceríaco, L.M.P., Marques, M.P., Schmitz, A. & Bauer, A.M. (2017). The “Cobra-preta” of São Tomé Island, Gulf of Guinea, is a new species of Naja Laurenti, 1768 (Squamata: Elapidae). Zootaxa, 4324(1), 121–141.

Ceríaco, L.M.P., Marques, M.P. & Bauer, A.M. (in press). Miscellanea Herpetologica Sanctithomae, with a provisional checklist of the terrestrial herpetofauna of São Tomé, Príncipe and Annobon islands. Zootaxa.

Clark, P.U., Dyke, A.S., Shakun, J.D., Carlson, A.E., Clark, J., Wohlfarth, B., Mitrovica, J.X. & McCabe, A.M. (2009). The last glacial maximum. Science, 325(5941), 710–714.

Dallimer, M., King, T. & Atkinson, R.J. (2009). Pervasive threats within a protected area: conserving the endemic birds of São Tomé, West Africa. Animal Conservation, 12, 209–219.

Diniz-Filho, J.A.F. & Telles, M.P.C. (2002). Spatial autocorrelation analysis and the identification of operational units for conservation in continuous populations. Conservation biology, 16(4), 924–935.

Drewes, R.C. (2002). Islands at the center of the world. California Wild, 55(2), 8–19.

Drewes, R.C. & Stoelting, R.E. (2004). The California Academy of Sciences Gulf of Guinea Expedition (2001). II. Additions and corrections to our knowledge of the endemic amphibians of São Tomé and Príncipe. Proceedings – California Academy of Sciences, 55, 573–587.

Drewes, R.C. & Wilkinson, J.A. (2004). The California Academy of Sciences Gulf of Guinea Expedition (2001) I. The taxonomic status of the genus Nesionixalus Perret, 1976 (Anura: Hyperoliidae), treefrogs of São Tomé and Príncipe, with comments on the genus Hyperolius. Proceedings of the California Academy of Sciences, 55(20), 395–407.

Dutton, J. (1994). Introduced mammals in São Tomé and Príncipe: possible threats to biodiversity. Biodiversity and Conservation, 3, 927–938.

Felsenstein, J. (1985). Phylogenies and the Comparative Method. The American Naturalist, 125(1), 1–15.

Givnish, T.J. & Systma, K.J. (1997). Molecular Evolution and Adaptive Radiation. Cambridge University Press, Cambridge, UK. 638 pp.

Glor, R.E. (2010). Phylogenetic insights on adaptive radiation. Annual Review of Ecology, Evolution, and Systematics, 41, 251–270.

Grant, P.R. (1998). Evolution on islands. Oxford University Press, USA. 348 pp.

Grant, P.R. & Grant, B.R. (2002). Adaptive radiation of Darwin's finches: Recent data help explain how this famous group of Galapagos birds evolved, although gaps in our understanding remain. American scientist, 90(2), 130–139.

Grant, P.R., Grant, B.R., Markert, J.A., Keller, L.F. & Petren, K. (2004). Convergent evolution of Darwin's finches caused by introgressive hybridization and selection. Evolution, 58(7), 1588–1599.

Gray, J.E. (1845). Catalogue of the Specimens of Lizards in the Collection of the British Museum. Trustees of die British Museum/Edward Newman, London, UK. 289 pp.

Greer, A.E. (2001). Distribution of maximum snout-vent length among species of scincid lizards. Journal of Herpetology, 35, 383–395.

Gunn, A. (1998). The determination of larval phase coloration in the African armyworm, Spodoptera exempta and its consequences for thermoregulation and protection from UV light. Entomologia experimentalis et applicata, 86(2), 125– 133.

Harris, D.J. & Sá-Sousa, P. (2001). Species distinction and relationships of the western Iberian Podarcis lizards (Reptilia, Lacertidae) based on morphology and mitochondrial DNA sequences. Herpetological Journal, 11, 129–136.

Hofer, R. & Mokri, C. (2000). Photoprotection in tadpoles of the common frog, Rana temporaria. Journal of Photochemistry and Photobiology B: Biology, 59(1), 48– 53.

Huelsenback, J.P. & Hillis, D.M. (1993). Success of phylogenetic methods in the four- taxon case. Systematic Biology, 42, 247–264.

International Commission on Zoological Nomenclature (ICZN) (1999). International Code of Zoological Nomenclature. Fourth edition. International Trust for Zoological Nomenclature, London, UK. 306 pp.

Irschick, D.J., Vitt, L.J., Zani, P.A. & Losos, J.B. (1997). A comparison of evolutionary radiations in mainland and Caribbean Anolis lizards. Ecology, 78(7), 2191–2203.

Jesus. J. (2005). Filogeografia e sistemática molecular de répteis de alguns arquipélagos africanos do Atlântico oriental. Thesis (PhD), Universidade da

Madeira, Madeira, Portugal. 394 pp. Retrieved from http://hdl.handle.net/10400.13/218

Jesus, J., Brehm, A. & Harris, D.J. (2003). The herpetofauna of Annobón island, Gulf of Guinea, West Africa. Herpetological Bulletin, 86, 375–394.

Jesus, J., Brehm, A. & Harris, D.J. (2005a). Relationships of scincid lizards (Mabuya spp.) from the islands of the Gulf of Guinea based on mtDNA sequence data. Amphibia-Reptilia, 26(4), 467–473.

Jesus, J., Harris, D.J. & Brehm, A. (2005b). Phylogeography of Mabuya maculilabris (Reptilia) from São Tomé island (Gulf of Guinea) inferred from mtDNA sequences. Molecular phylogenetics and evolution, 37(2), 503–510.

Jesus, J., Harris, D.J. & Brehm, A. (2006). Phylogenetic relationships of Lygodactylus geckos from the Gulf of Guinea Islands: rapid rates of mitochondrial DNA sequence evolution? The Herpetological Journal, 16, 291–295.

Jesus, J., Harris, D.J. & Brehm, A. (2007). Relationships of Afroablepharus Greer, 1974 skinks from the Gulf of Guinea islands based on mitochondrial and nuclear DNA: Patterns of colonization and comments on taxonomy. Molecular Phylogenetics and Evolution, 45(3), 904–914.

Jesus, J., Nagy, Z.T., Branch, W.R., Wink, M., Brehm, A. & Harris, D.J. (2009). Phylogenetic relationships of African green snakes (genera Philothamnus and Hapsidophrys) from São Tomé, Príncipe and Annobon islands based on mtDNA sequences, and comments on their colonization and taxonomy. The Herpetological Journal, 19(1), 41–48.

Jones, P.J. (1994). Biodiversity in the Gulf of Guinea: an overview. Biodiversity and conservation, 3(9), 772–784.

Jones, P.J. & Tye, A. (2006). The birds of São Tomé and Príncipe with Annobón: islands of the Gulf of Guinea. British Ornithologists’ Union, Oxford, UK. 172 pp.

Kollias, N., Sayre, R.M., Zeise, L. & Chedekel, M.R. (1991). New trends in photobiology: Photoprotection by melanin. Journal of Photochemistry and Photobiology B: Biology, 9(2), 135–160.

Lee, D., Halliday, A., Fitton, J. & Poli, G. (1994). Isotopic variations with distances and time in the volcanic islands of the Cameroon line. Earth and Planetary Science Letters, 123, 119–139.

Lima, R.F., Maloney, E., Simison, W.B. & Drewes, R. (2015). Reassessing the conservation status of the shrew Crocidura thomensis, endemic to São Tomé Island. Oryx, 50, 360–363.

Lima, R.F., Sampaio, H., Dunn, J.C., Cabinda, G., Fonseca, R., Oquiongo, G., Oquiongo, J., Samba, S., Santana, A., Soares, E., Viegas, L., Ward-Francis, A., Costa, L.T., Palmeirim, J.M. & Buchanan, G.M. (2016). Distribution and habitat associations of the critically endangered bird species of São Tomé Island (Gulf of Guinea). Bird Conservation International, 1–15.

Lomolino, M.V. (1985). Body size of mammals on islands – the island rule reexamined. The American Naturalist, 125, 310–316.

López-Jurado, L.F. (1989). A new Canarian lizard subspecies from Hierro Island (Canarian archipelago). Bonner zoologische Beiträge, 40, 265–272.

Losos, J.B. (1992). The evolution of convergent structure in Caribbean Anolis communities. Systematic biology, 41(4), 403–420.

Losos, J.B. & Mahler, D.L. (2010). Adaptive radiation: the interaction of ecological opportunity, adaptation, and speciation. In: Bell, M.A., Futuyma, D.J., Eanes, W.F. & Levinton, J.S. (eds.). Evolution since Darwin: the first. Sinauer Associates, Sunderland, Massachussets, USA. 381–420 pp.

Macey, J.R., Larson, A., Ananjeva, N.B. & Papenfuss, T.J. (1997). Evolutionary shifts in three major structural features of the mitochondrial genome among iguanian lizards. Journal of Molecular Evolution, 44(6), 660–674.

Machado, A. (1985). New data concerning the Hierro Giant lizard and the Lizard of Salmor (Canary Islands). Bonner zoologische Beiträge, 36(3-4), 429–470.

Mackintosh, J.A. (2001). The antimicrobial properties of melanocytes, melanosomes and melanin and the evolution of black skin. Journal of theoretical biology, 211(2), 101–113.

Manaças, S. (1958). Anfíbios e Répteis das ilhas de São Tomé e do Príncipe e do Ilhéo das Rolas. In: Anonymous (eds.). Conferência Internacional dos Africanistas

Ocidentais - 4º Volume. Junta Investigação do Ultramar, Lisboa, Portugal. 179– 192 pp.

Manaças, S. (1973). Alguns dos anfíbios e répteis da província de S. Tomé e Príncipe. In: Livro de Homenagem ao Prof. Fernando Frade. Junta Investigação do Ultramar, Lisboa, Portugal. 219–230 pp.

Marzoli, A., Picirillo, E.M., Renne, P.R., Bellieni, G., Iacumin, M., Nyobe, J.B. & Tongwa, A.T. (2000). The Cameroon Volcanic Line revisited: petrogenesis of continental basaltic magmas from lithosperic and asthenospheric mantle sources. Journal of Petrology, 41(1), 87–109.

Mausfeld, P., Vences, M., Schmitz, A. & Veith, M. (2000). First data on the molecular phylogeography of scincid lizards of the genus Mabuya. Molecular Phylogenetics and Evolution, 17(1), 11–14.

Mausfeld, P., Schmitz, A., Ineich, I. & Chirio, L. (2004). Genetic variation in two African Euprepis Species (Reptilia, Scincidae), based on Maximum–Likelihood and Bayesian Analyses: Taxonomic and Biogeographic conclusions. Bonner zoologische Beiträge, 52, 159–177.

Measey, G.J., Vences, M., Drewes, R.C., Chiari, Y., Melo, M. & Bourles, B. (2007). Freshwater paths across the ocean: molecular phylogeny of the frog Ptychadena newtoni gives insights into amphibian colonization of oceanic islands. Journal of Biogeography, 34, 7–20.

Meiri, S. (2008). Evolution and ecology of lizard body sizes. Global Ecology and Biogeography, 17, 724–734.

Melo, M., Warren, B.H. & Jones, P.J. (2011). Rapid parallel evolution of aberrant traits in the diversification of the Gulf of Guinea white-eyes (Aves, Zosteropidae). Molecular Ecology, 20, 4953–4967.

Miller, E.C., Sellas, A.B. & Drewes, R.C. (2012) A new species of Hemidactylus (Squamata: Gekkonidae) from Príncipe Island, Gulf of Guinea, West Africa with comments on the African–Atlantic clade of Hemidactylus geckos. African Journal of Herpetology, 61(1), 40–57.

Mix, A.C., Bard, E. & Schneider, R. (2001). Environmental processes of the ice age: land, oceans, glaciers (EPILOG). Quaternary Science Reviews, 20(4), 627–657.

Moritz, C. (1994). Defining ‘evolutionarily significant units’ for conservation. Trends in ecology & evolution, 9(10), 373–375.

Myers, N., Mittmeier, R.A., Mittmeier, C.G., Da Fonseca, G.A. & Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature, 403, 853–858.

Palumbi, S.R. (1996). Nucleic acids. II. The polymerase chain reaction. In: Hillis D.M., Moritz, C. & Mable, B.K. (eds.). Molecular systematics. Sinauer Associates, Sunderland, Massachussets, USA. 205–248 pp.

Petren, K., Grant, P.R., Grant, B.R. & Keller, L.F. (2005). Comparative landscape genetics and the adaptive radiation of Darwin's finches: the role of peripheral isolation. Molecular Ecology, 14(10), 2943–2957.

Pinto, G., Mahler, D.L., Harmon, L.J. & Losos, J.B. (2008). Testing the island effect in adaptive radiation: rates and patterns of morphological diversification in Caribbean and mainland Anolis lizards. Proceedings of the Royal Society of London B: Biological Sciences, 275(1652), 2749–2757.

Polis, G.A. & Hurd, S.D. (1996). Linking marine and terrestrial food webs: allochthonous input from the ocean supports high secondary productivity on small islands and coastal land communities. The American Naturalist, 147(3), 396–423.

Portik, D.M., Bauer, A.M. & Jackman, T.R. (2010). The phylogenetic affinities of Trachylepis sulcata nigra and the intraspecific evolution of coastal melanism in the western rock skink. African Zoology, 45(2), 147–159.

Portik, D.M., Bauer, A.M. & Jackman, T.R. (2011). Bridging the gap: western rock skinks (Trachylepis sulcata) have a short history in South Africa. Molecular Ecology, 20(8), 1744–1758.

Portik, D.M. & Bauer, A.M. (2012). Untangling the complex: molecular patterns in Trachylepis variegata and T. punctulata (Reptilia: Scincidae). African journal of herpetology, 61(2), 128–142.

Posada, D. & Crandall, K.A. (1998). MODELTEST: testing the model of DNA substitution. Bioinformatics, 14(9), 817–818.

Pregill, G.K. (1986). Body size of insular lizards: a pattern of Holocene dwarfism. Evolution, 40, 997–1008.

Rocha, S., Carretero, M.A. & Harris, D.J. (2010). Genetic diversity and phylogenetic relationship of Mabuya spp. (Squamata: Scincidae) from western Indian Ocean islands. Amphibia–Reptilia, 31, 375–385.

Ryder, O.A. (1986). Species conservation and systematics: the dilemma of subspecies. Trends in Ecology and Evolution, 1, 9–10.

Sá-Sousa, P. (1992). The populations of lizards (Podarcis) at Peniche. In: Valakos, E. (ed.). Abstracts of First International Congress on the Lacertids of the Mediterranean Basin. Mytilini, Greece. 13-17 April. Mytilini: Hellenic Zoological Society. 28 pp.

Sá‐Sousa, P., Almeida, A.P., Rosa, H., Vicente, L. & Crespo, E.G. (2000). Genetic and morphological relationships of the Berlenga wall lizard (Podarcis bocagei berlengensis: Lacertidae). Journal of Zoological Systematics and Evolutionary Research, 38(2), 95–102.

Sá-Sousa, P. & Harris, D.J. (2002). Podarcis carbonelli Pérez-Mellado, 1981 is a distinct species. Amphibia-Reptilia, 23(4), 459–468.

Sanchez-Piñero, F. & Polis, G.A. (2000). Bottom‐up dynamics of allochthonous input: direct and indirect effects of seabirds on islands. Ecology, 81(11), 3117–3132.

Schluter, D. (2000). The ecology of adaptive radiation. Oxford University Press, Oxford UK. 296 pp.

Seehausen, O. (2006). African cichlid fish: a model system in adaptive radiation research. Proceedings of the Royal Society of London B: Biological Sciences, 273(1597), 1987–1998.

Setlow, R.B., Grist, E., Thompson, K. & Woodhead, A.D. (1993). Wavelengths effective in induction of malignant melanoma. Proceedings of the National Academy of Sciences, 90(14), 6666–6670.

Simpson, G.G. (1953). The Major features of evolution. Columbia University Press, New York, USA. 434 pp.

Sindaco, R. & Jeremčenko, V.K. (2008). The reptiles of the Western Palearctic. Annotated Checklist and Distributional Atlas of the Turtles, Crocodiles, Amphisbaenians and Lizard of Europe, North Africa, Middle East and Central Asia. Volume 1. Edizioni Belvedere, Latina, Italy. 579 pp.

Sturmbauer, C. (1998). Explosive speciation in cichlid fishes of the African Great Lakes: a dynamic model of adaptive radiation. Journal of Fish Biology, 53(sA), 18–36.

Szarski, H. (1962). Some remarks on herbivorous lizards. Evolution, 16, 529.

Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0.. Molecular Biology and Evolution, 30, 2725–2729.

Uetz, P. & Hošek, J. (2016). The Reptile Database. Available from: http://www.reptile– database.org (accessed 2 May 2017).

Uyeda, J.C., Drewes, R.C. & Zimkus, B.M. (2007). The California Academy of Sciences Gulf of Guinea Expeditions (2001, 2006) VI. A new species of Phrynobatrachus from the Gulf of Guinea Islands and reanalysis of Phrynobatrachus dispar and P. feae (Anura: Phrynobatrachidae). Proceedings of the California Academy of Sciences, 58, 367–385.

Valle, S., Barros, N. & Wanless, R.M. (2014). Status and Trends of The Seabirds Breeding at Tinhosa Grande Island, São Tomé e Príncipe. BirdLife International, Cambridge, UK. 27 pp.

Vaz, H. & Oliveira, F. (2007). Relatório Nacional do Estado Geral da Biodiversidade de S. Tomé e Príncipe. República Democrática de S.Tomé e Príncipe, Ministério de Recursos Naturais e Meio Ambiente, Direcção Geral de Ambiente. 115 pp.

Vicente, L.A. (1985). Description d’une nouvelle sousespèce de Podarcis bocagei (Seoane, 1884) (Sauria, Lacertidae) de l’île de Berlenga: Podarcis bocagei berlengensis. Bulletin du Muséum National d’Histoire Naturelle Paris, 4ª série 7(A), 267–274.

Weisrock, D.W., Macey, J.R., Ugurtas, I.H., Larson, A. & Papenfuss, T.J. (2001). Molecular phylogenetics and historical biogeography among salamandrids of the “true” salamander clade: rapid branching of numerous highly divergent lineages in Mertensiella luschani associated with the rise of Anatolia. Molecular phylogenetics and evolution, 18(3), 434–448.

Wilson, K., Cotter, S.C., Reeson, A.F. & Pell, J.K. (2001). Melanism and disease resistance in insects. Ecology Letters, 4(6), 637–649.

Appendix I - Specimens and sequences used for the genetic analysis. Name on trees Specimens and/or Localization sequences Trachylepis cf. maculilabris 1 JQ598785-1 Socotra Archipelago, Yemen AF153574.1 N/A Trachylepis cf. maculilabris 2 AY070356.1 Tanzania Trachylepis cf. maculilabris 3 CAS250828 Burundi Trachylepis cf. maculilabris 4 CAS258254 Gabon LJW0386 LJW0387 LJW0207 LJW0208 LJW0332 LJW0446 LJW0218 LJW0331 LJW0101 LJW0217 LJW0603 Cameroon LJW0604 LJW0099 MCZ184557 CAS249868 MNHN2000.5200 Trachylepis maculilabris CAS-HERP-253882 CAS253881 CAS249859 AB057397-1 CAS-HERP-256792 MNHN2000.5199 MVZ245343 MVZ249747 MVZ249748 MVZ249749 MVZ249750 Ghana UWBM6045 MVZ249672 MVZ252621 MVZ245344 MVZ253443 Nigeria MVZ253443 MB03-001050-T MB03-001049-T MB03-001045-T MB03-001046-T MB03-001017-T MB03-001044-T MB03-001020-T Trachylepis adamastor Tinhosa Grande MB03-001016-T MB03-001019-T MB03-001043-T MB03-001047-T MB03-001048-T MB03-001018-T MB03-001015-T MB03-000956 Trachylepis principensis Príncipe MB03-000955

MB03-000957 CAS238898 MB03-000979 MB03-001005 MB03-001004A MB03_000952 MB03_000951 AY997721.1-539 AY997719.1-517 AY997723.1-729 EU 164496.1-562 AY997714.1-563 AY997717.1-511 AY997716.1-508 AY997722.1-503 AY997713.1-506 Trachylepis thomensis AY997720.1-525 São Tomé AY997718.1-512 AY997724.1-574 AY997725.1-543 MB03-000963 CAS218821 MB03-000961 MB03-000962 MB03-000960 AY997715.1-733 AB028819.1 CASHERP256707 CASHERP256856 CASHERP256857 Trachylepis affinis CAS253796 Príncipe CAS219357 MB03-000959 MB03-001024 MB03-001023

Paper II: Ecology and conservation status of an endemic Skink, Trachylepis (Squamata: Scincidae), from Tinhosa Grande islet, Gulf of Guinea.

Abstract

The population density of the Adamastor skink, Trachylepis adamastor adamastor, in Tinhosa islet is currently unknown. This is also true for the basic natural history and ecology of the subspecies. This study includes the first population density estimation and diet analysis of T. a. adamastor, in order to increase knowledge about the ecology of this species. The estimated population density of T. a. adamastor were 0.012 per m2 and the estimated population size were 2460 individuals on Tinhosa Grande islet. Regarding these results the IUCN Red List criteria classifies T. a. adamastor as “Critically Endangered”. The diet included 13 prey types, mostly Acari, Formicidae and Araneae were found. T. a. principensis and T. thomensis stomach contents were also analyzed for comparison.

Key words: Trachylepis, São Tomé & Príncipe, Tinhosa Grande, population density, diet, conservation.

Resumo

A densidade populacional da lagartixa Adamastor, T. adamastor adamastor, no ilhéu da Tinhosa é atualmente desconhecida. Assim como a sua história natural e ecologia. Este estudo inclui a primeira estimativa da densidade populacional e a análise da dieta de T. a. adamastor, a fim de aumentar o conhecimento sobre a ecologia desta espécie. A estimativa da densidade populacional de T. a. adamastor foi 0.012 por m2 e a estimativa do tamanho da população foi de 2460 indivíduos no ilhéu da Tinhosa Grande. De acordo com estes resultados os critérios da Lista Vermelha da IUCN classificam T. a. adamastor como “Criticamente em Perigo”. A dieta incluiu 13 tipos de presa e foram encontrados maioritariamente Acari, Formicidae e Araneae. Os conteúdos estomacais de T. a. principensis e T. thomensis também foram analisados para comparação.

Palavras chave: Trachylepis, São Tomé e Príncipe, Tinhosa Grande, densidade populacional, dieta, conservação.

Introduction

Wildlife management and conservation are one of the world’s most important concerns today. The development of effective management and conservation plans and measures for a specific species requires knowledge on about population levels, natural history, geographic distribution and ecological habits (IUCN 2001).

The current International Union for Conservation of Nature (IUCN) criteria for defining conservation status are profoundly based on data about the populations of the evaluated taxa (IUCN 2001). Population densities are dependent of the availability of resources (relative importance of environmental) and the distribution of these resource between the species that share the same distribution range (ecological constraints) (Damuth 1981, 1987; Tilman 1994). These constraints are particularly important on islands, given their extinction and colonization dynamics, isolation, reduced species diversity and the relatively small number of interactions across species, all of which modify the environmental equilibrium and ecological control on population dynamics (MacArthur & Wilson 1967; Wright 1980). The success of survival and reproduction is directly related with morphology, physiology and with the capability to find and capture preys, this is also influenced by prey abundance, type of habitats, distribution, predators and competitors (Eifler & Eifler 1999).

Reptile populations are especially difficult to quantify due to their small body size, habitat preferences, secretive behavior and fast unpredictable activity (Turner 1977). Sampling methods for the study of herpetofauna are a very variable and depedant of the different taxa that need to be sampled (e.g. Campbell & Christman 1982; Mengak & Guynn 1987; Pearman et al. 1995; Rodda et al. 2001; Doan 2003; Anton et al. 2014), but the most widely used methods involve either sighting animals in line transects (Buckland et al. 1993; Cassey & Ussher 1999; Anderson et al. 2001), capture-mark- recapture techniques (Ballinger & Congdon 1981; Pollock et al. 1990; Cassey & Ussher 1999; Kwiantkowski & Sullivan 2002; Grant & Doherty 2007; Kacoliris et al. 2009; Efford & Fewster 2013), live-trapping (Mengak & Guynn 1987; Efford 2004), quadrats (Sumner et al. 2001; Doan 2003), distance-sampling (Buckland et al. 2001; Rodda & Campbell 2002; Grant & Doherty 2007; Kacoliris et al. 2009; Smolensky & Fitzgerald 2010), and visual encounter survey (Crump & Scott 1994; Doan 2003).

Lizards populations that inhabit small islands presents some differences when compared with their relative of the continent, which are attributed to the different selective pressures on islands, since insular lizards populations have generally a relatively limited habitat heterogeneity, food resources and low predation or interspecific competition pressures (Rocha et al. 2009). On small islands lizards tend have a larger body size (Case 1978, 1982; Russel & Bauer 1986; Greer 2001), a small clutch and litter size, large eggs and neonate size (Fitch 1985; Galán & Vincent 2003) and a greater plant consumption (Cooper & Vitt 2002; Olesen & Valido 2003).

Among lizards, the skinks (family Scincidae) are an extraordinarily speciose group with about 1,613 species (Uetz & Hošek 2016), they are the most diverse lizards in the world characterized by their variety of body characteristics – as color morphs, sizes, presence/absence of limbs, etc. Also, they are known for their high ecological diversity (mainly in the tropic regions), due to their wide distributions, which includes huge diversity of different biomes and habitats (Pianka & Vitt 2003).

Trachylepis adamastor adamastor Ceríaco, 2015, is an endemic skink from the Tinhosa Grande islet (area approximately 20.5 ha) located approximately 20 km southwest of the Príncipe island (Ceríaco 2015). The Tinhosas are known by their important nesting site for several seabirds in West Africa, include in the RAMSAR convention (RAMSAR 2017) and integrated in the Biosphere Reserve of Príncipe. T. a. adamastor shares the Tinhosa Grande islet with an unknown species of Hemidactylus, whose identity is currently being studied (Ceríaco et al. in prep.). Data on ecology and trophic relations, population density, and conservation status for T. a. adamastor is presently unavailable (Ceríaco 2015).

T. a. adamastor seems to have experienced adaptive radiation after the isolation of Tinhosa islet from Príncipe island (see the first paper of this thesis), which from the trophic point of view suggests that the species should present a generalist and opportunistic diet. The limited data presented by Ceríaco (2015), which noted that some individuals were observed feeding on split eggs of nesting birds (Ceríaco 2015), seems to corroborate this hypothesis. Rocha et al. (2004) in a diet study of an insular population of the skink Brasiliscincus agilis (Raddi, 1823) (family Scincidae), observed 11 types of prey, which the authors characterized as an example opportunistic predator. It is possible that the same can happen with T. a. adamastor.

There are several studies regarding the diet of Scincidae species worldwide (James 1991; Twigg et al. 1996; Craig et al. 2007; Rocha et al. 2004; Rocha et al. 2009), but only few are related African species (but see Akani et al. 2002; Akani et al. 2009; Eniang et al. 2014). Considering their diversity of habitats and the seasonal regimes in Africa regions, dietary variations are expected within the same species and possibly in the same geographic region (Eniang et al. 2014).

Conservation-wise, given the small and isolated area of the Tinhosa Grande and the insular nature of T. a. adamastor, an unexpected perturbation, as species introduction, may endanger the population, given the typical lack of response capacity to unpredicted events of insular populations (Barahona et al. 2000; Ceríaco 2015). Despite Tinhosa Grande islet being part of RAMSAR convention and being in the highlight for Bird Conservation plans, effective protection of the reserve is the most important measure to ensure the survival of T. a. adamastor. However new data about T. a. adamastor, density, ecology and threats are crucial for designing any conservation plan. In this paper is present the first ecological and population size data for the species, as well as list potential conservation strategies based on these data.

Material and methods

Study area

The Tinhosas are two small rocky islets located to approximately 20 km to the southwest of Príncipe, the Tinhosa Grande (N: -1,34135556, E: -7,29151389; WGS84) has a surface area of about 20.5 ha and the Tinhosa Pequena (N: -1,38241667, E: - 7,28316944, WGS-84) has only 3.3 ha (Leventis & Olmos 2009). The Príncipe island belongs to the Democratic Republic of São Tomé and Príncipe, located in the Gulf of Guinea, have never been connected to the mainland (Jones 1994; Lee et al. 1994). The Tinhosas are classified as important area for birds (IBA) (BirdLife International 2017) and are also recognized as Wetlands of International Importance and official Waterfowl Habitat (RAMSAR 2017). Tens of thousands of breeding pairs of seabirds (Leventis & Olmos 2009; Valle et al. 2014; BirdLife International 2017) use the islets to nest (Fig. 1) being one of the most important seabird colonies in West Africa (Jones & Tye 2006). Land crabs, termites, spiders and other arthropods also inhabit the islet (pers. obs.).

FIGURE 1. Tinhosa Grande islet with tens of thousands seabirds of breeding pairs (Photo: Luis Ceríaco).

Specimen collecting

Fourteen individuals T. a. adamastor were collected on Tinhosa Grande. For morphological, morphometric and diet comparisons were also collected four T. a. principensis from Príncipe. Capture and handling of specimens were carried out with permission of the Regional Government of Príncipe and the direction of Obô National Park. The specimens were euthanized and preserved in 10% buffered formalin in the field and transferred to 70% ethanol after expedition. Liver tissue was removed before formalin fixation and preserved in 95% ethanol. The eighteen individuals collected were deposited in the Herpetological Collection of Museu Nacional de História Natural e da Ciência (MUHNAC), Lisbon (Portugal), and their tissue samples were deposited in the Tissue and DNA Collection of MUHNAC. For diet comparisons were also examined T. a. principensis and T. thomensis specimens from the collections of the MUNHAC and the eight T. a. adamastor specimens from the collections of the Instituto de Investigação Científica Tropical, Lisbon, Portugal (IICT).

Fieldwork and Population estimates

Sampling was performed using the quadrat sampling method. Given the homogeneous habitat of the islet, individuals were counted in 20 quadrats of 10x10 m (adapted from Valle et al. 2014) each day, randomly selected along a transect line. Quadrats were distanced at random distances. The samples are represented in Fig. 2.

FIGURE 2. Quadrats transect in the Tinhosa Grande islet. Yellow quadrats represent the survey conducted on February 16th of 2016, while the red quadrants represent the second day of prospections on February 19th of 2016.

The sampled area (4000 m2) represents 1,95% of the total area (20.5 ha=205000.0 m2). The harsh conditions of the islet, with irregular, rocky and loose terrain and steep boundaries, the limited prospecting time (only two days), combine with the seabird nesting height (resulting in thousands of nests and new born birds), created constrains that had complicated the sampling process. The population estimate was calculated using The Ratio Method (adapted from Krebs 1989), although this method is being used in census with aerial transects, for large mammals in areas of difficult access. This was the most adequate method due to the available data, found in the bibliography.

To calculate average density for the whole area the following formula was used:

Total individuals counted ∑ 푋푖 Average density = D̂= = Total area searched ∑ 푍푖 where 푋푖 = total individuals counted in quadrat 푖 푍푖 = area of quadrats 푖 푖 = sample number (1, 2, 3…n) n = total number of quadrats

And to estimate the total population the following:

푃̂ = 퐷̂A where A = total area 퐷̂ = average density per unit area

Stomach contents/diet

After the morphological and morphometric analysis, the 14 specimens of T. a. adamastor and 4 specimens of T. a. principensis were dissected for stomach content analysis. After excision, the stomachs were opened, and their contents were preserved in an alcohol tube (70% ethanol) identified with the number of the respective specimen. Only 11 of the 14 T. a. adamastor had contents. The stomach content of 1 specimen of T. a. principensis, 9 specimens of T. thomensis (5 from Rolas Islet and 4 from São Tomé island), from the IICT collection (already reviewed by Manaças 1958) were also analysed and used for the comparison. For the analysis, the contents were spread on a Petri dish and examined under a microscope. The samples were grouped by Trachylepis species, and the prey items were identified to the lowest taxonomic level possible and were grouped accordingly.

Results

Population estimates

A total of 48 individuals T. a. adamastor were counted, with a total area searched of 4000 m2 (Table 1).

TABLE 1. Number of Trachylepis a. adamastor records counted in the quadrats transect during the field trips in 16th and 19th February of 2016.

Date 16 February 19 February Site nº 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Number of T. adamastor 2 3 1 2 0 2 0 1 0 3 0 0 1 0 2 0 4 1 0 1 2 2 1 0 3 0 2 1 1 1 2 1 0 3 3 1 0 0 2 0 specimens counted

In relation to the study site, the average density was 0.012 T. a. adamastor per m2. Calculations using The Ratio Method (adapted from Krebs 1989) showed an estimated population size of 2460 individuals inhabitants in Tinhosa Grande islet.

Stomach contents/diet

The diet of T. a. adamastor, T. a. principensis and T. thomensis is presented in Table 2 (see also Appendix I). The majority of the prey items consisted of arthropods, with no plant material found. In addition to arthropods, egg shells, Acari seedlings, feathers, stones and undetermined arthropod remains (legs and wings), were also found. One hand of a T. a. adamastor was also found in the stomach contents of one individual (MB03-001017). Cumulatively, the most important prey items in the diet of the three Trachylepis species were Acari, Araneae, Coleoptera and Formicidae (Table 3). Although Acari have been the most numerous (145 items), only the Trachylepis a. adamastor presented it in his diet.

TABLE 2. Summary of dietary data, collected from stomach contents of the three Trachylepis species from Tinhosa Grande islet, Príncipe and São Tomé islands. Trachylepis Trachylepis a. Trachylepis Prey Type a. adamastor principensis thomensis Phylum Arthropoda 1 - - Chilopoda 4 1 - Class Symphyla 2 - - Subclass Acari 145 - - Araneae 10 6 4* Coleoptera 1 4 7* Coleoptera 1 - - larvae Collembola 1 - - Order larva Dermaptera - - - Diptera - 2 1 Diptera larvae - - 15 Hymenoptera - 9 2 Isopoda - 1 -

Lepidoptera 1 - - larvae Mantodea - - 1 Thysanoptera - - - Thysanura 1 - - Caelifera - 1 - Homoptera - 9 2 Suborder Homoptera 1 - - nymph Curculionidae - 1 - Family Formicidae 15 9 4 Tettigoniidae - 1 - Total 183 44 36 *- undetermined number

TABLE 3. Number total of items prey found, frequency of occurrence and relative frequency for each prey item for Trachylepis a. adamastor, Trachylepis a. principensis and Trachylepis thomensis species. Relative Items Number Frequency Frequency Phylum Arthropoda 1 1 1,49 Chilopoda 5 3 4,48 Class Symphyla 2 2 2,99 Subclass Acari 145 10 14,93 Araneae 20 10 14,93 Coleoptera 12 8 11,94 Coleoptera larvae 1 1 1,49 Collembola larvae 1 1 1,49 Dermaptera 3 1 1,49 Diptera 3 3 4,48 Order Diptera larvae 15 1 1,49 Hymenoptera 11 3 4,48 Isopoda 1 1 1,49 Lepidoptera larvae 1 1 1,49 Mantodea 1 1 1,49 Thysanoptera 1 1 1,49 Thysanura 1 1 1,49 Caelifera 1 1 1,49 Suborder Homoptera 11 3 4,48 Homoptera nymph 1 1 1,49 Curculionidae 1 1 1,49 Family Formicidae 28 11 16,42 Tettigoniidae 1 1 1,49 Total 267 67 100,00

Discussion

The data collected during the survey allowed a first input to the knowledge of the possible approximation of the T. a. adamastor population density. The estimated density for T. a. adamastor were 0.012 per m2 on the Tinhosa Grande islet. Comparing this case with other similar studies on islands (López-Victoria et al. 2013; Hughes et al. 2015; Williams et al. 2015), the average density of T. a. adamastor were very low (e.g. P. transversalis 0.12 per m2, on Malpelo Island, López-Victoria et al. 2013; P. pulcher 0.04 per m2, on Lesser Antillean island of Barbados, Williams et al. 2015; P. martini 0.02 per m2, on Curaçao Island, Hughes et al. 2015). However only about 2% of the islet was sampled, during a very limited time period. These limitations were a result of the short time available, the difficult logistics and the climacteric conditions of the islet and sea. Although these values are insufficient to obtain a more robust result, which would surely be achieved through a more extensive sampling, the presented data is of considerable importance. If these results are representative, T. a. adamastor should be classified as “Critically Endangered” following IUCN Red List criteria (IUCN 2001), according to it extent of occurrence (B1 - extent of occurrence estimated to be less than 100 km2, although it was not estimated, considering the total area of the islet, 0.2050000 km2, the extent of occurrence of T. adamastor will be lower than 100 km2) and area of occupancy (B2 - area of occupancy estimated to be less than 10 km2, 0.2050000 km2 total area of the Tinhosa Grande islet). Further surveys will be needed to corroborate these results.

The diet of the three Trachylepis species included a relatively wide range of prey items types (20 in total), which characterizes a generalist and opportunistic predator. The three species consumed basically arthropods with no ingestion plant material. Some studies with Trachylepis genus denote that predominantly insectivorous skinks have normally no or an irrelevant plant material in their diet (Huey & Pianka 1977; Castanzo & Bauer 1998; Wymann & Whiting 2002). The most abundant arthropods found, considering the total abundance in the three Trachylepis species studied, were Araneae (more than 20 items), Coleoptera (more than 13 items), Diptera (18 items), and Formicidae (28 items). The prey items include both relatively sedentary (e.g. larvae and nymph) and highly mobile preys (e.g. Araneae and Formicidae), being the last one the most recorded (see Schoener 1971; Huey & Pianka 1981; Rocha et al. 2009). The high number of ants present in the stomach contents of the three species is partially explained

by the fact that this arthropod may constitute an important source of food in small islands, due to its limited available prey according to Pérez-Mellado & Corti (1993). Furthermore, in mainland the feeding on ants is not considered by several authors a so important item (Huey & Pianka 1977; Castanzo & Bauer 1998; Wymann & Whiting 2002), since the availability and variety of food is higher. It was expected more records of Isopoda preys, only one was recorded, since they were one of the most referred in a similar diet studies with Trachylepis affinis, Trachylepis maculilabris and Lepidothyris fernandii (Akini et al. 2002; Eniang et al. 2014); in addition, isopods were observed in high quantities in the field trip (pers. obs.). Chilopoda was another arthropod observed in large numbers in the islands studied (pers. obs.), but was recorded in low quantities in the stomach contents analyzed. Other diet studies in African Scincidae show the low consumption of Chilopoda (e.g. Akini et al. 2002; Wymann & Whiting 2002; Eniang et al. 2014), which could mean that these arthropods are not the preferred food of the skinks. Contrary to what was expected, due to field observation the Isoptera order (e.g. termites) were not recorder in any of the species studied. Although, termites seem to be an important source of food for numerous African lizard species (Bauer et al. 1989; Mouton et al. 2000), Trachylepis species included (e.g. T. affinis: Akani et al. 2002; T. margaritifer: Wymann & Whiting 2002; T. atlantica: Rocha et al. 2009), and with other genus (e.g. Brasiliscincus agilis: Vrcibradic & Rocha 1995, 1996; Vrcibradic 2001; Mabuya striata wahlbergii: Heideman & Bates 1999), where these termites were a frequently consumed prey.

The Trachylepis a. adamastor diet included 13 prey types and the most important items were Acari (145 items; present only in this species), Formicidae (15 items) and Araneae (10 items). The high number of Acari can be explained by the abundance of bird nests in the Tinhosa Grande islet, and possibly were consumed opportunistically, however, further studies are needed to confirm this. Ineich et al. (2009) observed the presence of Acari in stomach contents of Trachylepis wrightii, which inhabit in the Fregate Island, also with a very dense number of nesting birds. Despite this, the consumption of Acari is not very common in reptiles, which gives the idea that they are consumed mainly by opportunistic species (McAllister 1987; Ineich et al. 2009), which seems to be the case of T. a. adamastor.

The hand of one T. a. adamastor found in the stomach contents of one individual may have been due to an event of cannibalism. Although cannibalism is not common, it

was already recorded in other lizard species as Trachylepis atlantica (Silva et al. 2005) and Hemidactylus mabouia (Zamprogno & Teixeira 1998; Bonfiglio et al. 2006). Other items as lizard skin were recorded in some studies (Craig et al. 2007) but these could represent the ingestion of its own sloughed skin rather than predation. Given the relative scarcity of information on factors that can induce cannibalism, this should be a subject to study in the future.

Trachylepis a. principensis presented 11 prey types in their contents, and the most recorded prey items were Hymenoptera (9 items), Homoptera (9 items), Formicidae (9 items) and Araneae (6 items). The low quantity of prey items is partially explained by the low amount of individuals of Trachylepis a. principensis used in this study. The Trachylepis thomensis has the lowest number of prey types, compared with the other two Trachylepis species. The arthropod groups most recorded prey of Trachylepis thomensis were Diptera (15 items), Coleoptera (7 items and several undetermined items), Araneae (4 items and several undetermined items) and Formicidae (4 items). More data is however needed to better understand the diversity and patterns of preys consumed by these species. The gathering of this new data should be done on a series of specimens collected over an extensive time frame in order to test for differences of prey consumption between different times of the year (see Rocha et al. 2004; Craig et al. 2007; Rocha et al. 2009) or also collect fecal material (see Williams et al. 2015).

Despite the islets are integrated in the Biosphere Reserve of Príncipe and considered a RAMSAR site, the Tinhosa Grande is visited occasionally by local fishermen for fishery and use the land to dry the fish (Nuno Barros pers. comm.). According to present knowledge, fishermen do not present a direct threat to T. a. adamastor (Ceríaco 2015). Although there were no known natural predators of T. a. adamastor in the Tinhosa Grande islet, the introduction of cats (Felis catus), dogs (Canis spp.) and/or rats (Rattus spp.) by local fishermen intentionally or not, can lead to declining population (Ceríaco 2015). Silva et al. (2005) reported the predation by introduced species like rats and domestic cats of T. atlantica. The introduction of these predators has caused drastic declines and extinctions of reptilian species endemic to islands (Iverson 1978; Case & Bolger 1991; Daltry et al. 2001; Powell & Henderson 2005). Given the limited nature of the data presented here new studies are necessary to better understand the size of the population using more adequate methods and longer

prospects, as well as the collection of more specimens for the analysis of the diet.

References

Anderson, D.R., Burnham, K.P., Lubow, B.C., Thomas, L.E.N., Corn, P.S., Medica, P.A. & Marlow, R.W. (2001). Field trials of line transect methods applied to estimation of desert tortoise abundance. The Journal of Wildlife Management, 65, 583–597.

Anton, J.R. de I., Rotger, A., Igual, J.M. & Tavecchia, G. (2014). Estimating lizard population density: an empirical comparison between line-transect and capture- recapture methods. Wildlife research, 40(7), 552–560.

Akani, G.C., Capizzi, D. & Luiselli, L. (2002). Community ecology of scincid lizards in a swamp rainforest of south-eastern Nigeria. Russian Journal of Herpetology, 9(2), 125–134.

Akani, G.C., Luiselli, L., Ogbeibu, A.E., Uwaegbu, M. & Ebere, N. (2009). Activity patterns and habitat selection in a population of the African fire skink (Lygosoma fernandi) from the Niger Delta, Nigeria. The Herpetological Journal, 19(4), 207– 211.

Ballinger, R.E. & Congdon, J.D. (1981). Population ecology and life history strategy of a montane lizard (Sceloporus scalaris) in southeastern Arizona. Journal of Natural History, 15(2), 213–222.

Barahona, F., Evans, S.E., Mateo, J.A., García-Márquez, M. & López-Jurado, L.F. (2000). Endemism, gigantism and extinction in island lizards: the genus Gallotia on the Canary Islands. Journal of Zoology, 250(3), 373–388.

Bauer, A.M., Russell, A.P. & Edgar, B.D. (1989). Utilization of the termite Hodotermes mossambicus (Hagen) by gekkonid lizards near Keetmanshoop, South West Africa. South African Journal of Zoology, 24(4), 239–243.

BirdLife International (2017). Important Bird Areas factsheet: Tinhosas islands. Available from: http:// www.birdlife.org (accessed 2 May 2017).

Bonfiglio, F., Balestrin, R.L. & Cappellari, L.H. (2006). Diet of Hemidactylus mabouia (Sauria, Gekkonidae) in urban area of southern Brazil. Biociências, 14(2), 107– 111.

Buckland, S.T., Anderson, D.R., Burnham, K.P. & Laake, J.L. (1993). Distance Sampling. Estimating Abundance of Biological Populations. Springer Netherlands, Netherlands. 446 pp.

Buckland, S.T., Anderson, D.R., Burnham, K.P., Laake, J.L., Borchers, D.L. & Thomas, L. (2001). Introduction to distance sampling estimating abundance of biological populations. Oxford University Press, Oxford, UK. 448 pp.

Campbell, H.W. & Christman, S.P. (1982). The herpetofaunal components of Florida sandhill and sand pine scrub associations. In: N.J. Scott Jr. (ed.). Herpetological Communities. U.S. Department of the Interior, Washington, DC, USA. 163–171 pp.

Case, T.J. (1978). A general explanation for insular body size trends in terrestrial vertebrates. Ecology, 59, 1–18.

Case, T.J. (1982). Ecology and evolution of the insular gigantic chuckawallas, Sauromalus hispidus and Sauromalus varius. Iguanas of the World, 184–212.

Case, T.J. & Bolger, D.T. (1991). The role of introduced species in shaping the distribution and abundance of island reptiles. Evolutionary Ecology, 5(3), 272– 290.

Cassey, P. & Ussher, G.T. (1999). Estimating abundance of tuatara. Biological Conservation, 88(3), 361–366.

Castanzo, R.A. & Bauer, A.M. (1998). Comparative aspects of the ecology of Mabuya acutilabris (Squamata: Scincidae), a lacertid-like skink from arid south western Africa. Journal of African Zoology, 112, 109–122.

Cooper Jr, W.E. & Vitt, L.J. (2002). Distribution, extent, and evolution of plant consumption by lizards. Journal of Zoology, 257(4), 487–517.

Craig, M., Withers, P. & Don Bradshaw, S. (2007). Diet of Ctenotus xenopleura (Reptilia: Scincidae) in the southern Goldfields of Western Australia. Australian Zoologist, 34(1), 89–91.

Crump, M.L. & Scott Jr, N.J. (1994). Visual en-counter surveys. In: Heyer, W.R., Donnelly, M.A., McDiarmid, R.W., Hayek, L.C. & Foster M.S. (eds.). Measuring and Monitoring Biological Diversity: Standard Methods for Amphibians. Smithsonian Institution Press, Washington, DC, USA. 84–92 pp.

Daltry, J.C., Bloxam, Q., Cooper, G., Day, M.L., Hartley, J., Henry, M., Lindsay, K. & Smith, B.E. (2001). Five years of conserving the ‘world’s rarest snake’, the Antiguan racer Alsophis antiguae. Oryx, 35(2), 119–127.

Damuth, J. (1981). Population density and body size in mammals. Nature, 290(5808), 699–700.

Damuth, J. (1987). Interspecific allometry of population density in mammals and other animals: the independence of body mass and population energy-use. Biological Journal of the Linnean Society, 31(3), 193–246.

Doan, T.M. (2003). Which methods are most effective for surveying rain forest herpetofauna?. Journal of herpetology, 37(1), 72–81.

Efford, M.G. (2004). Density estimation in live‐trapping studies. Oikos, 106(3), 598– 610.

Efford, M.G. & Fewster, R.M. (2013). Estimating population size by spatially explicit capture–recapture. Oikos, 122(6), 918–928.

Eifler, D.A. & Eifler, M.A. (1999). The influence of prey distribution on the foraging strategy of the lizard Oligosoma grande (Reptilia: Scincidae). Behavioral Ecology and Sociobiology, 45(6), 397–402.

Eniang, E.A., Amadi, N., Petrozzi, F., Vignoli, L., Akani, G.C. & Luiselli, L. (2014). Inter-seasonal and inter-habitat variations in the diet of the African fire skink, Lygosoma fernandi, from southern Nigeria. Amphibia-Reptilia, 35(3), 371–375.

Fitch, H.S. (1985). Clutch and litter size variation in New World reptiles. University of Kansas Museum of Natural History, Miscellaneous Publication, 76, 1–76.

Galán, P. & Vicente, L. (2003). Reproductive characteristics of the insular lacertid Teira dugesii. Herpetological Journal, 13(3), 149–154.

Grant, T.J. & Doherty Jr, P.F. (2007). Monitoring of the flat-tailed horned lizard with methods incorporating detection probability. Journal of Wildlife Management, 71(4), 1050–1056.

Greer, A.E. (2001). Distribution of maximum snout-vent length among species of scincid lizards. Journal of Herpetology, 383–395.

Heideman, N.J.L. & Bates, M.F. (1999). Diet as possible indicator of size‐related microhabitat partitioning in Mabuya striata wahlbergii (Peters 1869) (Reptilia: Scincidae). African Journal of Ecology, 37(1), 110–112.

Huey, R.B. & Pianka, E.R. (1977). Patterns of niche overlap among broadly sympatric versus narrowly sympatric Kalahari lizards (Scincidae: Mabuya). Ecology, 58(1), 119–128.

Hughes, D.F., Meshaka Jr, W.E. & van Buurt, G. (2015). The superior colonizing gecko Hemidactylus mabouia on Curaçao: conservation implications for the native gecko Phyllodactylus martini. Journal of Herpetology, 49(1), 6–63.

Ineich, I., Bérot, S. & Garrouste, R. (2009). Les reptiles terrestres ou comment survivre en devenant «vampires». In: Charpy, L. (ed.). Clipperton, environnement et biodiversité d’un microcosme océ anique. Mus. Natn. Hist. Nat., Paris, IRD, Marseille, Patrimoines naturels, 68. 347–380 pp.

IUCN (2001). IUCN Red List Categories and Criteria: Version 3.1. Gland, Switzerland and Cambridge, United Kingdom, IUCN Species Survival Commission.

Iverson, J.B. (1978). The impact of feral cats and dogs on populations of the West Indian rock iguana, Cyclura carinata. Biological Conservation, 14(1), 63–73.

James, C.D. (1991). Temporal variation in diets and trophic partitioning by coexisting lizards (Ctenotus: Scincidae) in central Australia. Oecologia, 85(4), 553–561.

Jones, P.J. (1994). Biodiversity in the Gulf of Guinea: an overview. Biodiversity and conservation, 3(9), 772–784.

Jones, P.J. & Tye, A. (2006). The birds of São Tomé and Príncipe with Annobón: islands of the Gulf of Guinea. British Ornithologists’ Union, Oxford, UK. 172 pp.

Kacoliris, F.P., Berkunsky, I. & Williams, J.D. (2009). Methods for assessing population size in sand dune lizards (Liolaemus multimaculatus). Herpetologica, 65(2), 219–226.

Krebs, C.J. (1989). Ecological methodology. Harper & Row, New York, USA. 654 pp.

Kwiatkowski, M.A. & Sullivan, B.K. (2002). Mating system structure and population density in a polygynous lizard, Sauromalus obesus (= ater). Behavioral Ecology, 13(2), 201–208.

Lee, D., Halliday, A., Fitton, J. & Poli, G. (1994). Isotopic variations with distances and time in the volcanic islands of the Cameroon line. Earth and Planetary Science Letters, 123, 119–139.

Leventis, A.P. & Olmos, F. (2009). As aves de São Tomé e Príncipe. Um Guia Fotográfico/ The Birds of São Tomé and Príncipe. A Photoguide. Aves & Fotos Editora. 142 pp.

López-Victoria, M., Jurczyk, M. & Wolters, V. (2013). Notes on the ecology of the Colombian Leaftoed Gecko (Phyllodactylus transversalis), endemic to Malpelo Island. Boletín de Investigaciones Marinas y Costeras, 42(2), 319–327.

MacArthur, R. & Wilson, E. (1967). The Theory of Island Biogeography. Princeton University Press, New Jersey, USA. 224 pp.

McAllister, C.T. (1987). Ingestion of spinose ear ticks, Otobius megnini (Acari: Argasidae) by a Texas spotted whiptail, Cnemidophorus gularis gularis (Sauria: Teiidae). The Southwestern Naturalist, 32(4), 511–512.

Mengak, M.T. & Guynn Jr, D.C. (1987). Pitfalls and snap traps for sampling small mammals and herpetofauna. American Midland Naturalist, 118, 284–288.

Mouton, P. le F.N., Geertsema, H. & Visagie, L. (2000). Foraging mode of a group- living lizard, Cordylus cataphractus (Cordylidae). African Zoology, 35(1), 1–7.

Olesen, J.M. & Valido, A. (2003). Lizards as pollinators and seed dispersers: an island phenomenon. Trends in ecology & evolution, 18(4), 177–181.

Pearman, P.B., Velasco, A.M. & López, A. (1995). Tropical amphibian monitoring: a comparison of methods for detecting inter-site variation in species' composition. Herpetologica, 51, 325–337.

Pérez-Mellado, V. & Corti, C. (1993). Dietary adaptations and herbivory in lacertid lizards of the genus Podarcis from western Mediterranean islands (Reptilia: Sauria). Bonner Zoologische Beiträge, 44(3-4), 193–220.

Pianka, E.R. & Vitt, L.J. (2003). Lizards. Windows to the evolution of diversity. University of California Press, Los Angeles, USA. 348 pp.

Pollock, K.H., Nichols, J.D., Brownie, C. & Hines, J.E. (1990). Statistical inference for capture-recapture experiments. Wildlife monographs, 3–97.

Powell, R. & Henderson, R.W. (2005). Conservaton status of Lesser Antillean reptiles. Iguana, 12(2), 63–77.

RAMSAR (2017). São Tomé and Príncipe. Available from http://www.ramsar.org/wetland/sao-tome-and-principe (accessed 2 May 2017).

Rocha, C.F.D., Vrcibradic, D. & van Sluys, M. (2004). Diet of the lizard Mabuya agilis (Sauria; Scincidae) in an insular habitat (Ilha Grande, RJ, Brazil). Brazilian Journal of Biology, 64(1), 135–139.

Rocha, C.F.D., Vrcibradic, D., Menezes, V.A. & Ariani, C.V. (2009). Ecology and natural history of the easternmost native lizard species in South America, Trachylepis atlantica (Scincidae), from the Fernando de Noronha Archipelago, Brazil. Journal of Herpetology, 43(3), 450–459.

Rodda, G.H., Campbell III, E.W. & Fritts, T.H. (2001). A high validity census technique for herpetofaunal assemblages. Herpetological Review, 32(1), 24–30.

Rodda, G.H. & Campbell, E.W. (2002). Distance sampling of forest snakes and lizards. Herpetological Review, 33(4), 271–274.

Russel, A.P. & Bauer, A.M. (1986). The giant gecko Hoplodactylus delcourti and its relations to gigantism and insular endemism in the Gekkonidae. Bulletin of Chicago Herpetological Society, 26, 26–30.

Schoener, T.W. (1971). Theory of feeding strategies. Annual Review of Ecology and Systematics, 2, 369–404.

Silva Jr, J.M., Pérez Jr, A.K. & Sazima, I. (2005). Natural History Notes Euprepis atlanticus (Noronha skink). Predation. Herpetological review, 36, 62–63.

Smolensky, N.L. & Fitzgerald, L.A. (2010). Distance sampling underestimates population densities of dune-dwelling lizards. Journal of Herpetology, 44(3), 372–381.

Sumner, J., Rousset, F., Estoup, A. & Moritz, C. (2001). ‘Neighbourhood’size, dispersal and density estimates in the prickly forest skink (Gnypetoscincus queenslandiae) using individual genetic and demographic methods. Molecular Ecology, 10(8), 1917–1927.

Tilman, D. (1994). Resource competition and community structure. Princeton university press, Princeton, USA. 296 pp.

Turner, F.B. (1977). The dynamics of populations of squamates, crocodilians and rhynchocephalians. Biology of the Reptilia, 7, 157–264.

Twigg, L.E., How, R.A., Hatherly, R.L. & Dell, J. (1996). Comparison of the diet of three sympatric species of Ctenotus skinks. Journal of Herpetology, 30(4), 561– 566.

Uetz, P. & Hošek, J. (2016). The Reptile Database. Available from: http://www.reptile– database.org (accessed 2 May 2017).

Valle, S., Barros, N. & Wanless, R.M. (2014). Status and Trends of The Seabirds Breeding at Tinhosa Grande Island, São Tomé e Príncipe. Birdlife International, Cambridge, UK. 27 pp.

Vrcibradic, D. (2001). Ecologia de cinco espécies de Mabuya (Lacertilia; Scincidae) no sudeste do Brasil: padrões reprodutivos, térmicos, tróficos e comunidades de nematódeos parasitas Associados. Thesis (PhD), Universidade Estadual de Campinas, Campinas, SP, Brasil. 197 pp.

Vrcibradic, D. & Rocha, C.F.D. (1995). Ecological observations of the scincid lizard Mabuya agilis in a Brazilian Restinga Habitat. Herpetological review, 26(3), 129– 131.

Vrcibradic, D. & Rocha, C.F.D. (1996). Ecological differences in tropical sympatric skinks (Mabuya macrorhyncha and Mabuya agilis) in southeastern Brazil. Journal of Herpetology, 30, 60–67.

Williams, R.J., Horrocks, J. & Pernetta, A. (2015). Natural history, distribution, and conservation status of the Barbados leaf-toed gecko, Phyllodactylus pulcher Gray, 1828 (Squamata, Gekkonidae). Herpetology Notes, 8, 197–204.

Wright, S.J. (1980). Density compensation in island avifaunas. Oecologia, 45(3), 385– 389.

Wymann, M.N. & Whiting, M.J. (2002). Foraging ecology of rainbow skinks (Mabuya margaritifer) in southern Africa. Copeia, 2002(4), 943–957.

Zamprogno, C. & Teixeira, R.L. (1998). Hábitos alimentares da lagartixa de parede Hemidactylus mabouia (Reptilia, Gekkonidae) da planície litorânea do norte do Espírito Santo, Brasil. Revista Brasileira de Biologia, 58(1), 143–150.

Appendix I - Number of arthropods found in the stomach contents of the specimens of T. a. adamastor, T. a. principensis and T. thomensis (N=26). Arthropods are ordered by the taxonomy, from left to right from highest to

lowest rank.

Class

Order

Family

Phylum

Subclass

Suborder

larvae

Arthropoda Chilopoda Symphyla Acari Araneae Coleoptera Coleoptera larvae Collembola larvae Dermaptera Diptera Diptera larvae Hymenoptera Isopoda Lepidoptera Mantodea Thysanoptera Thysanura Caelifera Homoptera Homoptera nymph Curculionidae Formicidae Tettigoniidae

MB03 -001015 103 1 MB03-001016 1 1 3 1

MB03-001017

MB03-001018 1 4 1 2

MB03-001019 1 2

MB03-001043 1 1 adamastor

MB03-001045 3 20 4 1 1 1 1 1 a. 2 1 2 T. MB03-001046 MB03-001047 4 8 MB03-001048 6 2 1 MB03-001049 1 2 MB03-001050 2 1 MB03-001003 5 1 1 1 1 8 1 MB03-001004 1 1 1 MB03-001005 9 9 principensis 1 1

a. a. MB03-001021

T. T. IICT73- 1955 2 1 IICT3- 1954 15 IICT4- 1954 3 1

IICT5- 1954 IICT6-1954 * 1 1 IICT7-1954 3 1 2

IICT13- 1954 * 1 T. thomensis IICT14- 1954 1 IICT15- 1954 3 1 1 IICT16- 1954 1 1

*- undetermined number

Conclusion

After the accomplishment of the field work and the analysis of the morphology, molecular and diet results it was possible to deepen the knowledge about the Adamastor skink and have a first understanding of its ecology and interspecific relationships with the surrounding populations. The molecular analysis with the two mitochondrial (16S and ND2) and one nuclear (RAG-1) genes, contrary to what was expected showed that the species T. adamastor and T. principensis are genetically conspecific. These results entail conservation issues due to the fragility of the Tinhosa Grande population and the morphological differences between the two populations. Given that and according to the Principle of Priority of the ICZN Code the name T. adamastor is therefore applicable for the two populations, since it was the first to be described, and the interpretation of each population as subspecies makes that the Tinhosa Grande population needs to be called T. adamastor adamastor, while the Príncipe population becomes T. adamastor principensis.

The current study is the first to provide important data regarding T. a. adamastor estimated population density as well its dietary composition and its interspecific relationships on the Tinhosa Grande islet. Due to the logistics implications, the obtained results are deficient to achieve a solid conclusion about the population density and ecology. Additional surveys, as well the collection of new and fresh data will be essential to have a substantial information about these issues.

This study also reinforces the importance of combination of morphological and molecular data for description of new species, in order to give certainty and eliminate doubts on relations between species and intra-population diversity.

Although the two populations are conspecific, its different morphology and the isolation and conditions of the Tinhosa Grande islet, it is crucial to consider T. adamastor adamastor a threatened population. These different populations should be treated differently, and it is fundamental that future studies of ecology, abundance and threats, especially of introduced species, be carried out in order to understand the status of threat so that adequate conservation plans can be drawn up. Considering this it is urgent that the national authorities take action for the conservation of this population, since it is vulnerable to external perturbations as introduction of predators, environmental issues as climate change or others problematic incidents.

References of Main Introduction

Adler, G.H. & Levins, R. (1994). The island syndrome in rodents. Quarterly Review of Biology, 69, 473–490.

Adsersen, H. (1995). Research on islands: recent, and prospective approaches. Introduction-why focus on islands?. In: Vitousek, P., Loope, L. & Adsersen, H. (eds.). Islands. Biological diversity and ecosystem function. Springer-Verlag Berlin Heidelberg, New York, USA. 7–21 pp.

American Bird Conservancy (2017). Available from: https://abcbirds.org/ (accessed 2 May 2017).

Andrén, C. & Nilson, G. (1981). Reproductive success and risk of predation in normal and melanistic color morphs of the adder, Vipera berus. Biological Journal of the Linnean Society, 15(3), 235–246.

Andreone, F. (2000). Herpetological observations on Cape Verde: a tribute to the Italian naturalist Leonardo Fea, with complementary notes on Macroscincus coctei (Duméril & Bibron, 1839) (Squamata: Scincidae). Herpetozoa, 13, 15–26.

Andreone, F. & Gavetti, E. (1998). Some remarkable specimens of the giant Cape Verde skink, Macroscincus coctei (Duméril and Bibron, 1839) with notes about its distribution and causes of its possible extinction. Italian Journal of Zoology, 65, 413–422.

Angus, G. (1994). The biogeography of land snails in the islands of the Gulf of Guinea. Biodiversity and Conservation, 3(9), 794–807.

Anton, J.R. de I., Rotger, A., Igual, J.M. & Tavecchia, G. (2014). Estimating lizard population density: an empirical comparison between line-transect and capture– recapture methods. Wildlife research, 40(7), 552–560.

Ashton, K.G. & Feldman, C.R. (2003). Bergmann’s rule in nonavian reptiles: turtles follow it, lizards and snakes reverse it. Evolution, 57, 1151–1163.

Avise, J.C. (2009). Phylogeography: retrospect and prospect. Journal of biogeography, 36(1), 3–15.

Badenhorst, N.C. (1990). An analysis of the Cordylus polyzonus complex (Reptilia: Cordylidae) in the south-western Cape. Thesis (PhD), University of Stellenbosch), Stellenbosch, South Africa. 96 pp.

Badenhorst, N.C., Mouton, P. le F.N. & van Wyk, J.H. (1992). Climates associated with melanistic cordylid populations (Reptilia: Sauria) in the southwestern Cape, South Africa. Journal of the Herpetological Association of Africa, 40(1), 70–70.

Báez, M. (1982a). Estudio biogeografico de la superfamilia Muscoidea en la Macaronesia con especial referencia a las islas Canarias (Insecta, Diptera). Boletim da Sociedade Portuguesa de Entomologia (Supl.A), 7, 257–273.

Báez, M. (1982b). Consideraciones sobre las caracterısticas zoogeográficas de la fauna de Canarias. Instituto de Estudios Canarios, 50º Aniversario, (1932–1982), 1, 22– 70.

Báez, M. (1993). Origins and affinities of the fauna of Madeira. Boletim do Museu Municipal do Funchal, Supl. 2, 9–40.

Bell, R.C. (2016). A New Species of Hyperolius (Amphibia: Hyperoliidae) from Príncipe Island, Democratic Republic of São Tomé and Príncipe. Herpetologica, 72(4), 343–351.

Bergmann, K.G.L.C. (1847). Über die verhältnisse der wärmeokönomie der thiere zu ihrer grösse. Göttinger Studien, 3, 595–708.

Bi, K., Linderoth, T., Vanderpool, D., Good, J.M., Nielsen, R. & Moritz, C. (2013). Unlocking the vault: next‐generation museum population genomics. Molecular ecology, 22(24), 6018–6032.

BirdLife International (2017). Important Bird Areas factsheet: Tinhosas islands. Available from: http:// www.birdlife.org (accessed 2 May 2017).

Blackburn, T.M., Gaston, K.J. & Loder, N. (1999). Geographic gradients in body size: a clarification of Bergmann's rule. Diversity and distributions, 5(4), 165–174.

Bland, L.M., Collen, B., Orme, C.D.L. & Bielby, J. (2012). Data uncertainty and the selectivity of extinction risk in freshwater invertebrates. Diversity and Distributions, 18(12), 1211–1220.

Boakes, E.H., McGowan, P.J., Fuller, R.A., Chang-qing, D., Clark, N.E., O'Connor, K. & Mace, G.M. (2010). Distorted views of biodiversity: spatial and temporal bias in species occurrence data. PLoS biology, 8(6), e1000385.

Boback, S.M. (2006). A morphometric comparison of island and mainland boas (Boa constrictor) in Belize. Copeia, 2006(2), 261–267.

Boback, S.M. & Guyer, C. (2003). Empirical evidence for an optimal body size in snakes. Evolution, 57, 345–351.

Böhm, M., Collen, B., Baillie, J.E.M., Bowles, P., Chanson, J., Cox, N., Hammerson, G., Hoffmann, M., Livingstone, S.R., Ram, M., Rhodin, A.G.J., Stuart, S.N., van Dijk, P.P., Young, B.E., Afuang, L.E., Aghasyan, A., García, A., Aguilar, C., Ajtic, R., Akarsu, F., Alencar, L.R.V., Allison, A., Ananjeva, N., Anderson, S., Andrén, C., Ariano-Sánchez, D., Arredondo, J.C., Auliya, M., Austin, C.C., Avci, A., Baker, P.J., Barreto-Lima, A.F., Barrio-Amorós, C.L., Basu, D., Bates, M.F., Batistella, A., Bauer, A., Bennett, D., Böhme, W., Broadley, D., Brown, R., Burgess, J., Captain, A., Carreira, S., Castañeda, M.D.R., Castro, F., Catenazzi, A., Cedeño- Vázquez, J.R., Chapple, D.G., Cheylan, M., Cisneros-Heredia, D. F., Cogalniceanu, D., Cogger, H., Corti, C., Costa, G.C., Couper, P.J., Courtney, T., Crnobrnja-Isailovic, J., Crochet, P.-A., Crother, B., Cruz, F., Daltry, J.C., Daniels, R.J.R., Das, I., de Silva, A., Diesmos, A.C., Dirksen, L., Doan, T.M., Dodd, C.K., Doody, J.S., Dorcas, M.E., Duarte de Barros Filho, J., Egan, V.T., El Mouden, E.H., Embert, D., Espinoza, R.E., Fallabrino, A., Feng, X., Feng, Z.-J., Fitzgerald, L., Flores-Villela, O., França, F.G.R., Frost, D., Gadsden, H., Gamble, T., Ganesh, S.R., Garcia, M.A., García-Pérez, J.E.,Gatus, J., Gaulke, M., Geniez, P., Georges, A., Gerlach, J., Goldberg, S., Gonzalez, J.-C.T., Gower, D.J., Grant, T., Greenbaum, E., Grieco, C., Guo, P., Hamilton, A.M., Hare, K., Hedges, S.B.,

Heideman, N., Hilton-Taylor, C., Hitchmough, R., Hollingsworth, B., Hutchinson, M., Ineich, I., Iverson, J., Jaksic, F.M., Jenkins, R., Joger, U., Jose, R., Kaska, Y., Kaya, U., Keogh, J.S., Köhler, G., Kuchling, G., Kumlutas, Y., Kwet, A., La Marca, E., Lamar, W., Lane, A., Lardner, B., Latta, C., Latta, G., Lau, M., Lavin, P., Lawson, D., LeBreton, M., Lehr, E., Limpus, D., Lipczynski, N., Lobo, A.S., López-Luna, M.A., Luiselli, L., Lukoschek, V., Lundberg, M., Lymberakis, P., Macey, R., Magnusson, W.E., Mahler, D.L., Malhotra, A., Mariaux, J., Maritz, B., Marques, O.A.V., Márquez, R., Martins, M., Masterson, G., Mateo, J.A., Mathew, R., Mathews, N., Mayer, G., McCranie, J.R., Measey, G.J., Mendoza-Quijano, F., Menegon, M., Métrailler, S., Milton, D.A., Montgomery, C., Morato, S.A.A., Mott, T., Muñoz-Alonso, A., Murphy, J., Nguyen, T.Q., Nilson, G., Nogueira, C., Núñez, H., Orlov, N., Ota, H., Ottenwalder, J., Papenfuss, T., Pasachnik, S., Passos, P., Pauwels, O.S.G., Pérez-Buitrago, N., Pérez-Mellado, V., Pianka, E.R., Pleguezuelos, J., Pollock, C., Ponce-Campos, P., Powell, R., Pupin, F., Quintero Díaz, G.E., Radder, R., Ramer, J., Rasmussen, A.R., Raxworthy, C., Reynolds, R., Richman, N., Rico, E. L., Riservato, E., Rivas, G., da Rocha, P.L.B., Rödel, M.- O., Rodríguez Schettino, L., Roosenburg, W.M., Ross, J.P., Sadek, R., Sanders, K., Santos- Barrera, G., Schleich, H.H., Schmidt, B.R., Schmitz, A., Sharifi, M., Shea, G., Shi, H.-T., Shine, R., Sindaco, R., Slimani, T., Somaweera, R., Spawls, S., Stafford, P., Stuebing, R., Sweet, S., Sy, E., Temple, H.J., Tognelli, M.F., Tolley, K., Tolson, P.J., Tuniyev, B., Tuniyev, S., Üzüm, N., van Buurt, G., Van Sluys, M., Velasco, A., Vences, M., Veselý, M., Vinke, S., Vinke, T., Vogel, G., Vogrin, M., Vogt, R.C., Wearn, O.R., Werner, Y.L., Whiting, M.J., Wiewandt, T., Wilkinson, J., Wilson, B., Wren, S., Zamin, T., Zhou, K. & Zug, G. (2013). The conservation status of the world’s reptiles. Biological Conservation, 157, 372– 385.

Bonnet, X., Shine, R. & Lourdais, O. (2002a). Taxonomic chauvinism. Trends in Ecology & Evolution, 17(1), 1–3.

Bonnet, X., Pearson, D., Ladyman, M., Lourdais, O. & Bradshaw, D. (2002b). ‘Heaven’for serpents? A mark–recapture study of tiger snakes (Notechis scutatus) on Carnac Island, Western Australia. Austral Ecology, 27(4), 442–450.

Brito, P. & Edwards, S.V. (2009). Multilocus phylogeography and phylogenetics using sequence-based markers. Genetica, 135, 439–455.

Bromham, L. & Cardillo, M. (2007). Primates follow the ‘island rule’: implications for interpreting Homo floresiensis. Biology letters, 3(4), 398–400.

Brooks, T.M., Mittermeier, R.A., da Fonseca, G.A.B., Gerlach, J., Hoffmann, M., Lamoreux, J.F., Mittermeier, C.G., Pilgrim, J.D. & Rodrigues, A.S.L. (2006). Global biodiversity conservation priorities. Science, 313(5783), 58–61.

Brown, J.H. & Lomolino, M.V. (1998). Biogeography. 2nd Edition. Sinauer Associates, Sunderland, USA. 691 pp.

Brown, J.H. & Lomolino, M.V. (2000). Concluding remarks: historical perspective and the future of island biogeography theory. Global Ecology and Biogeography, 9(1), 87–92.

Brown, J.H., Marquet, P.A. & Taper, M.L. (1993). Evolution of body size: consequences of an energetic definition of fitness. The American Naturalist, 142(4), 573–584.

Buckley, L.B. & Jetz, W. (2007). Insularity and the determinants of lizard population density. Ecology Letters, 10(6), 481–489.

Bullock, D.J. & Evans, P.G.H. (1990). The distribution, density and biomass of terrestrial reptiles in Dominica, West Indies. Journal of Zoology, 222(3), 421– 443.

Burbrink, F.T. (2002). Phylogeographic analysis of the cornsnake (Elaphe guttata) complex as inferred from maximum likelihood and Bayesian analyses. Molecular phylogenetics and evolution, 25(3), 465–476.

Burke, K. (2001). Origin of the Cameroon line of volcanocapped swells. Journal of Geology, 109, 349–362.

Butchart, S.H. & Bird, J.P. (2010). Data Deficient birds on the IUCN Red List: What don’t we know and why does it matter?. Biological Conservation, 143(1), 239– 247.

Calbó Angrill, J., Pagès, D. & González Gutiérrez, J.A. (2005). Empirical studies of cloud effects on UV radiation: A review. Reviews of Geophysics, 43(2), RG2002.

Callaghan, T.V., Björn, L.O., Chernov, Y., Chapin, T., Christensen, T.R., Huntley, B., Ims, R.A., Johansson, M., Jolly, D., Jonasson, S., Matveyeva, N., Panikov, N.,

Oechel, W., Shaver, G., Elster, J., Jónsdóttir, I.S., Laine, K., Taulavuori, K., Taulavuori, E., & Zockler, C. (2004). Responses to projected changes in climate and UV-B at the species level. Amblo, 33, 418–435.

Calsbeek, R. & Smith, T. (2003). Ocean currents mediate evolution in island lizards. Nature, 426, 552–555.

Camargo, A., Sinvervo, B. & Sites Jr, J. R. (2010). Lizards as model organisms for linking phylogeographic and speciation studies. Molecular Ecology, 19, 3250– 3270.

Carlquist, S. (1974). Island biology. Columbia University Press, New York & London. 660 pp.

Carranza, S., Arnold, E.N. & Pleguezuelos, J.M. (2006). Phylogeny, biogeography, and evolution of two Mediterranean snakes, Malpolon monspessulanus and Hemorrhois hippocrepis (Squamata, Colubridae), using mtDNA sequences. Molecular phylogenetics and evolution, 40(2), 532–546.

Carranza, S., Arnold, E.N., Mateo, J.A. & López-Jurado, F. (2001). Parallel gigantism and complex colonization patterns in the Cape Verde scincid lizards Mabuya and Macroscincus (Reptilia, Scincidae) revealed by mitochondrial DNA sequences. Proceedings of the Royal Society London B, 268, 1595–1603.

Case, T.J. (1975) Species numbers, density compensation, and colonizing ability of lizards on islands in Gulf of California. Ecology, 56, 3–18.

Case, T.J. (1978). A general explanation for insular body size trends in terrestrial vertebrates. Ecology, 59, 1–18.

Case, T.J. (1982). Ecology and evolution of the insular gigantic chuckawallas, Sauromalus hispidus and Sauromalus varius. Iguanas of the World, 184–212.

Case, T.J. & Bolger, D.T. (1991) The role of introduced species in shaping the distribution and abundance of island reptiles. Evolutionary Ecology, 5, 272–290.

Case, T.J. & Schwaner, T.D. (1993). Island mainland body size differences in Australian varanid lizards. Oecologia, 94, 102–109.

Ceríaco, L.M.P. (2015). Lost in the middle of the sea, found in the back of the shelf: A new giant species of Trachylepis (Squamata: Scincidae) from Tinhosa Grande islet, Gulf of Guinea. Zootaxa, 3973(3), 511–527. Ceríaco, L.M.P., Marques, M., Jacquet, F., Nicolas, V., Colyn, M., Denys, C., Sardinha, P.C. & Bastos-Silveira, C. (2015). Descritption of Crocidura fingui, a new endemic species of shrew (Mammalia, Soricomorpha) from Príncipe Island (Gulf of Guinea). Mammalia, 79(3), 325–341.

Chapple, D.G. & Keogh, J.S. (2004). Parallel adaptive radiations in arid and temperate Australia: molecular phylogeography and systematics of the Egernia whitii (Lacertilia: Scincidae) species group. Biological Journal of the Linnean Society, 83(2), 157–173.

Cheng, T.L., Rovito, S.M., Wake, D.B. & Vredenburg, V.T. (2011). Coincident mass extirpation of neotropical amphibians with the emergence of the infectious fungal pathogen Batrachochytrium dendrobatidis. Proceedings of the National Academy of Sciences, 108(23), 9502–9507.

Clegg, S.M. & Owens, P.F. (2002). The ‘island rule’ in birds: medium body size and its ecological explanation. Proceedings of the Royal Society of London B: Biological Sciences, 269(1498), 1359–1365.

Clusella-Trullas, S., van Wyk, J.H. & Spotila, J.R. (2007). Thermal melanism in ectotherms. Journal of Thermal Biology, 32(5), 235–245.

Collar, N.J. (2000). Opinion. Collecting and conservation: cause and effect. Bird Conservation International, 10(01), 1–15.

Connor, E.F. & McCoy, E.D. (1979). The statistics and biology of the species-area relationship. The American Naturalist, 113(6), 791–833.

Costello, M.J., May, R.M. & Stork, N.E. (2013). Can we name Earth’s species before they go extinct?. Science, 339, 413–416.

Cox, C. & Moore, P. (1993). Biogeography. An ecological and evolutionary approach. 5th Edition. Blackwell Scientific Publications, USA. 440 pp.

Cox, R.M. & John-Alder, H.B. (2005). Testosterone has opposite effects on male growth in lizards (Sceloporus spp.) with opposite patterns of sexual size dimorphism. Journal of Experimental Biology, 208(24), 4679–4687.

Cox, C.B., Moore, P.D. & Ladle, R. (2016). Biogeography: an ecological and evolutionary approach. 9th Wiley-Blackwell, USA. 496 pp.

Dallimer, M., King, T. & Atkinson, R.J. (2009). Pervasive threats within a protected area: conserving the endemic birds of São Tomé, West Africa. Animal Conservation, 12, 209–219.

Damuth, J. (1981). Population density and body size in mammals. Nature, 290(5808), 699–700.

Daniels, S.R., Hofmeyr, M.D., Henen, B.T. & Crandall, K.A. (2007). Living with the genetic signature of Miocene induced change: Evidence from the phylogeographic structure of the endemic angulate tortoise Chersina angulata. Molecular Phylogenetics and Evolution, 45, 915–926.

Darwin, C. (1845) The voyage of the Beagle. Smith, Elder and Co., London. Direcção Geral do Ambiente (DGA) (2006). Lei do Parque Natural do Obô (Lei n.6/2006). Ministério dos Recursos Naturais e Ambiente, São Tomé e Príncipe.

Dolman, G., Moritz, C. & Nachman, M. (2006). A multilocus perspective on refugial isolation and divergence in rainforest skinks (Carlia). Evolution, 60(3), 573–582.

Doody, J.S., Burghardt, G.M. & Dinets, V. (2013). Breaking the Social–Non‐social Dichotomy: A Role for Reptiles in Vertebrate Social Behavior Research?. Ethology, 119(2), 95–103.

Drewes, R.C. (2002). Islands at the center of the world. California Wild, 55(2), 8–19.

Drewes, R.C. & Wilkinson, J.A. (2004). Results of the California Academy of Sciences Gulf of Guinea Expedition (2001): I. The Taxonomic Status of the Genus Nesionixalus Perret, 1976 (Anura: Hyperoliidae), Treefrogs of Sao Tome and Principe, with Comments on the Genus Hyperolius. Proceedings California Academy of Sciences, 55, 395–407.

Ducrest, A.L., Keller, L. & Roulin, A. (2008). Pleiotropy in the melanocortin system, coloration and behavioural syndromes. Trends in ecology & evolution, 23(9), 502–510.

Dutton, J. (1994). Introduced mammals in São Tomé and Príncipe: possible threats to biodiversity. Biodiversity and Conservation, 3, 927–938.

Efford, M.G. & Fewster, R.M. (2013). Estimating population size by spatially explicit capture–recapture. Oikos, 122(6), 918–928.

Eisentraut, M. (1965). Rassenbildungb ei Saugetierenu nd Viigeln auf der Insel Fernando Poo. ZooIogischer Anzeiger, 174, 37–53.

Eliasson, U. (1995). Patterns of diversity in island plants. In: Vitousek, P., Loope, L. & Adsersen, H. (eds.). Islands. Biological diversity and ecosystem function. Springer-Verlag Berlin Heidelberg, New York, USA. 35–50 pp.

Endler, J.A. (1984). Progressive background in moths, and a quantitative measure of crypsis. Biological Journal of the Linnean Society, 22(3), 187–231.

Exell, A.W. (1973). Angiosperms of the islands of the Gulf of Guinea (Fernando Po, Principe, S. Tomé and Annobon). Bulletin of British Museum (Natural History), Botany, 4(8), 327–411.

Feiler, A. (1988). Die Säugetiere der Inseln im Golf von Guinea und ihre Beziehungen zur Säugetierfauna des westafrikanischen Festlandes. Zoologische Abhandlungen Staatliches Museum für Tierkunde Dresden, 44, 83–88.

Feiler, A., Haft, J. & Widmann, P. (1993). Beobachtungen und Untersuchungen an Säugetieren der Insel São Tomé (Golf von Guinea) (Mammalia). Faunistische Abhandlungen Staatliches Museum für Tierkunde Dresden, 19, 21–35.

Feldman, C.R. & Spicer, G.S. (2006). Comparative phylogeography of woodland reptiles in California: repeated patterns of cladogenesis and population expansion. Molecular Ecology, 15(8), 2201–2222.

Figueiredo, E. (1994). Diversity and endemism of angiosperms in the Gulf of Guinea islands. Biodiversity and Conservation, 3, 785–793.

Filin. I. & Ziv. Y. (2004). New theory of insular evolution: unifying the loss of dispersability and body-mass change. Evolutionary Ecology Research, 6, 115– 124.

Fisher, D.O. & Owens, I.P. (2004). The comparative method in conservation biology. Trends in Ecology & Evolution, 19(7), 391–398.

Fjeldså, J. (2013). The Discovery of New Species. In: Hoyo, J. (eds.). Handbook of Birds of the World. Lynx Edicions, Spain. 147–185 pp.

Fonseca, M.M., Brito, J.C., Paulo, O.S., Carretero, M.A. & Harris, D.J. (2009). Systematic and phylogeographical assessment of the Acanthodactylus erythrurus group (Reptilia: Lacertidae) based on phylogenetic analyses of mitochondrial and nuclear DNA. Molecular Phylogenetics and Evolution, 51(2), 131–142.

Forsman, A. (1995). Opposing fitness consequences of color pattern in male and female snakes. Journal of Evolutionary Biology, 8(1), 53–70.

Foster, J.B. (1964). Evolution of mammals on islands. Nature, 202, 234–235.

Frade, F. (1958). Aves e Mamíferos das Ilhas de São Tomé e do Príncipe – Notas de sistemática e de proteção à fauna. Conferência Internacional dos Africanistas Ocidentais Comunicações Zoologia e Biologia Animal IV. 137–150 pp.

Fuller, E. (1999). The great auk. Harry N Abrams Incorporated, New York, USA. 448 pp.

Gardner, J.L., Peters, A., Kearney, M.R., Joseph, L. & Heinsohn, R. (2011). Declining body size: a third universal response to warming?. Trends in ecology & evolution, 26(6), 285–291.

Gates, D.M. (1980). Biophysical ecology. Springer-Verlag, New York, USA. 611 pp.

Gorman, G.C. & Harwood, R. (1977). Notes on population density, vagility, and activity patterns of the Puerto Rican grass lizard, Anolis pulchellus (Reptilia, Lacertilia, Iguanidae). Journal of Herpetology, 11, 363–368.

Graff, D. (1996). Sea turtle nesting and utilization surveying São Tome. Marine Turtle Newsletter, 75, 8–12.

Grant, P.R. (1998). Evolution on islands. Oxford University Press, Oxford, USA. 348 pp.

Grant, P.R. (1998a). Patterns on islands and microevolution. In: Grant, P.R. (ed.). Evolution on Islands. Oxford University Press, Oxford, USA. 1–17 pp.

Greer, A.E. (2001). Distribution of maximum snout-vent length among species of scincid lizards. Journal of Herpetology, 35, 383–395.

Harris, D.J. & Sá-Sousa, P. (2002). Molecular phylogenetics of Iberian wall lizards (Podarcis): is Podarcis hispanica a species complex?. Molecular Phylogenetics and Evolution, 23(1), 75–81.

Heaney, L.R. (1978). Island area and body size of insular mammals: evidence from the tri-colored squirrel (Calliosciurus prevosti) of Southwest Africa. Evolution, 32, 29–44.

Hodges, K.M., Rowell, D.M. & Keogh, J.S. (2007). Remarkably different phylogeographic structure in two closely related lizard species in a zone of sympatry in south‐eastern Australia. Journal of Zoology, 272(1), 64–72.

Hoekstra, H.E. (2006). Genetics, development and evolution of adaptive pigmentation in vertebrates. Heredity, 97, 222–234.

Hofer, R. & Mokri, C. (2000). Photoprotection in tadpoles of the common frog, Rana temporaria. Journal of Photochemistry and Photobiology B: Biology, 59(1), 48– 53.

Hoffmann, M., Hilton-Taylor, C., Angulo, A., Böhm, M., Brooks, T.M., Butchart, S.H.M., Carpenter, K.E., Chanson, J., Collen, B., Cox, N.A., Darwall, W.R.T., Dulvy, N.K., Harrison, L.R., Katariya, V., Pollock, C.M., Quader, S., Richman, N.I., Rodrigues, A.S.L., Tognelli, M.F., Vié, J.-C., Aguiar, J.M., Allen, D.J., Allen, G.R., Amori, G., Ananjeva, N.B., Andreone, F., Andrew, P., Ortiz, A.L.A., Baillie, J.E.M., Baldi, R., Bell, B.D., Biju, S.D., Bird, J.P., Black-Decima, P., Blanc, J.J., Bolaños, F., Bolivar-G., W., Burfield, I.J., Burton, J.A., Capper, D.R., Castro, F., Catullo, G., Cavanagh, R.D.,Channing, A., Chao, N.L., Chenery, A.M., Chiozza, F., Clausnitzer, V., Collar, N.J., Collett, L.C., Collette, B.B., Fernandez, C.F.C., Craig, M.T., Crosby, M.J., Cumberlidge, N., Cuttelod, A., Derocher, A.E., Diesmos, A.C., Donaldson, J.S., Duckworth, J.W., Dutson, G., Dutta, S.K., Emslie, R.H., Farjon, A., Fowler, S., Freyhof, J., Garshelis, D.L., Gerlach, J., Gower, D.J., Grant, T.D., Hammerson, G.A., Harris, R.B., Heaney, L.R., Hedges, S.B., Hero, J.-M., Hughes, B., Hussain, S.A., Icochea, J.M., Inger, R.F., Ishii, N., Iskandar, D.T., Jenkins, R.K.B., Kaneko, Y., Kottelat, M., Kovacs, K.M., Kuzmin, S.L., Marca, E. La, Lamoreux, J.F., Lau, M.W.N., Lavilla, E.O., Leus, K., Lewison, R.L., Lichtenstein, G., Livingstone, S.R., Lukoschek, V., Mallon, D.P., McGowan, P.J.K., McIvor, A., Moehlman, P.D., Molur, S., Alonso, A.M., Musick, J.A., Nowell, K., Nussbaum, R.A., Olech, W., Orlov, N.L., Papenfuss, T.J., Parra-Olea, G., Perrin, W.F., Polidoro, B.A., Pourkazemi, M., Racey, P.A., Ragle, J.S., Ram, M., Rathbun, G., Reynolds, R.P., Rhodin, A.G.J., Richards, S.J., Rodríguez, L.O., Ron, S.R., Rondinini, C., Rylands, A.B., Mitcheson, Y.S. de, Sanciangco, J.C., Sanders, K.L., Santos-Barrera, G., Schipper, J., Self-Sullivan, C., Shi, Y., Shoemaker, A., Short, F.T., Sillero-Zubiri, C., Silvano, D.L., Smith, K.G., Smith, A.T., Snoeks, J., Stattersfield, A.J., Symes, A.J., Taber, A.B., Talukdar, B.K., Temple, H.J., Timmins, R., Tobias, J.A., Tsytsulina, K., Tweddle, D., Ubeda, C., Valenti, S.V., van Dijk, P.P., Veiga, L.M., Veloso, A., Wege, D.C., Wilkinson, M., Williamson, E.A., Xie, F., Young, B.E., Akçakaya, H.R., Bennun, L., Blackburn, T.M., Boitani, L., Dublin, H.T., Fonseca, G.A.B. da, Gascon, C., Lacher Jr., TE., Mace, G.M., Mainka, S.A., McNeely, J.A., Mittermeier, R.A., Reid, G.McG., Rodriguez, J.P., Rosenberg, A.A., Samways, M.J., Smart, J., Stein, B.A. & Stuart, S.N. (2010). The impact of conservation on the status of the world’s vertebrates. Science, 330(6010), 1503–1509.

Hooijer, D.A. (1976). Observations on the pygmy mammoths of the Channel Islands, California. In: Churcher, C.S. (ed.). Athlon. Essays on palaeontology in honor of Loris Shano Russell. Royal Ontario Museum, Canada. 220–225 pp.

Hume, J.P. & Walters, M. (2012). Extinct Birds. Poyser. 544 pp.

Inger, R. & Bearhop, S. (2008). Applications of stable isotope analyses to avian ecology. Ibis, 150(3), 447–461.

Itescu, Y., Karraker, N.E., Raia, P., Pritchard, P.C.H. & Meiri, S. (2014). Is the island rule general? Turtles disagree. Global Ecology and Biogeography, 23, 689–700.

Itow, S. (2003). Zonation patterns, succession process and invasion by aliens in species- poor insular vegetation of the Galápagos Islands. Global Environmental Research, 7, 39–58.

IUCN (2017). The IUCN Red List of Threatened Species. Version 2017-1. Available from: http://www.iucnredlist.org/ (accessed 20 August 2017).

Janse van Rensburg, D.A., Mouton, P. le F.N. & van Niekerk, A. (2009). Why cordylid lizards are black at the south‐western tip of Africa. Journal of Zoology, 278(4), 333–341.

Jesus. J. (2005). Filogeografia e sistemática molecular de répteis de alguns arquipélagos africanos do Atlântico oriental. Thesis (PhD), Universidade da Madeira, Madeira, Portugal. 394 pp. Retrieved from http://hdl.handle.net/10400.13/218

Jesus, J., Brehm, A. & Harris, D.J. (2003). The herpetofauna of Annobón island, Gulf of Guinea, West Africa. Herpetological Bulletin, 86, 375–394.

Jesus, J., Brehm, A. & Harris, D.J. (2005a). Phylogenetic relationships of Hemidactylus geckos from the Gulf of Guinea islands: patterns of natural colonizations and anthropogenic introductions estimated from mitochondrial and nuclear DNA sequences. Molecular Phylogenetics Evolution, 34, 480–485.

Jesus, J., Brehm, A. & Harris, D.J. (2005b). Relationships of scincid lizards (Mabuya spp.) from the islands of the Gulf of Guinea based on mtDNA sequence data. Amphibia-Reptilia, 26(4), 467–473.

100

Jesus, J., Nagy, Z.T., Branch, W.R., Wink, M., Brehm, A. & Harris, J. (2009). Phylogenetic relationships of African green snakes (genera Philothamnus and Hapsidophrys) from São Tomé, Príncipe and Annobon islands based on mtDNA sequences, and comments on their colonization and taxonomy. The Herpetological Journal, 19(1), 41–48.

Johnson, K.G., Brooks, S.J., Fenberg, P.B., Glover, A.G., James, K.E., Lister, A.M., Michel, E., Spencer, M., Todd, J.A., Valsami-Jones, E., Young, J.R. & Stewart, J.R. (2011). Climate change and biosphere response: unlocking the collections vault. BioScience, 61(2), 147–153.

Jones, P.J. (1994). Biodiversity in the Gulf of Guinea: an overview. Biodiversity and conservation, 3(9), 772–784.

Jones, P.J. & Tye, A. (2006). The birds of São Tomé and Príncipe with Annobón: islands of the Gulf of Guinea. British Ornithologists’ Union, Oxford, UK. 172 pp.

Juste, J. (1996). Trade in the gray parrot Psittacus erithacus on the Island of Príncipe (São Tomé and Príncipe, Central Africa): Initial assessment of the activity and its impact. Biological Conservation, 76, 101–104.

Juste, B.J. & Fa, J.E. (1994). Biodiversity and conservation in the Gulf of Guinea islands: faunal composition and origins. Biodiversity & Conservation, 3, 837–850.

Kellert, S.R. (1993). The biological basis for human values of nature. In: Kellert, S.R. & Wilson, E.O. (eds.). The Biophilia Hypothesis. Shearwater. 42–69 pp.

Keogh, J.S., Scott, I.A.W. & Hayes, C. (2005). Rapid and Repeated origin of insular gigantism and dwarfism in australian tiger snakes. Evolution, 59(1), 226–233.

101

Kettlewell, B. (1973). The Evolution of Melanism: The Study of a Recurring Necessity, with Special Reference to Industrial Melanism in the Lepidoptera. Oxford University Press. 448 pp.

Kingsolver, J.G. & Wiernasz, D.C. (1991). Seasonal polyphenism in wing-melanin pattern and thermoregulatory adaptation in Pieris butterflies. The American Naturalist, 137(6), 816–830.

Kollias, N., Sayre, R.M., Zeise, L. & Chedekel, M.R. (1991). New trends in photobiology: Photoprotection by melanin. Journal of Photochemistry and Photobiology B: Biology, 9(2), 135–160.

Lains & Silva, H. (1958). São Tomé e Príncipe e a cultura do café (Vol. 1). Memórias da Junta de Investigação do Ultramar. Lisboa. 2ª série. 499 pp.

Lawlor, T.E. (1982). The evolution of body size in mammals: evidence from insular populations in Mexico. The American Naturalist, 119(1), 54–72.

Leaché, A.D. & Mulcahy, D.G. (2007). Phylogeny, divergence times and species limits of spiny lizards (Sceloporus magister species group) in western North American deserts and Baja California. Molecular Ecology, 16(24), 5216–5233.

Leventis, A.P. & Olmos, F. (2009). As aves de São Tomé e Príncipe. Um Guia Fotográfico/ The Birds of São Tomé and Príncipe. A Photoguide. Aves & Fotos Editora. 142 pp.

Lee, D., Halliday, A., Fitton, J. & Poli, G. (1994). Isotopic variations with distances and time in the volcanic islands of the Cameroon line. Earth and Planetary Science Letters, 123, 119–139.

Lejoly, J. (1995). Suivi des programmes d'étude de la biodiversité végétale dans la Zona Ecologia de Sao Tomé: Projet ECOFAC-Composante Sao Tomé et Principe. AGRECO, Bruxelles. 122 pp.

Lindsey, C.C. (1966). Body sizes of poikilotherm vertebrates at different latitudes. Evolution, 20, 456–465.

Lima, R.F., Maloney, E., Simison, W.B. & Drewes, R. (2015). Reassessing the conservation status of the shrew Crocidura thomensis, endemic to São Tomé Island. Oryx, 50, 360–363.

102

Lomolino, M.V. (1983). Island biogeography, immigrant selection, and mammalian body size on islands. Thesis (PhD), State University of New York, Binghamton, USA.

Lomolino, M.V. (1985). Body size of mammals on islands – the island rule reexamined. The American Naturalist, 125, 310–316.

Lomolino, M.V. (2005). Body size evolution in insular vertebrates: generality of the island rule. Journal of Biogeography, 32, 1683–1699.

Lomolino, M.V., Brown, J.H. & Sax, D.F. (2010). Island biogeography theory. In: Losos, J.B. & Ricklefs, R.E. (eds.). The Theory of Island Biogeography Revisited. Princeton University Press, New Jersey, USA. 13–51 pp.

Luiselli, L. (1992). Reproductive success in melanistic adders: a new hypothesis and some considerations on Andren and Nilson's (1981) suggestions. Oikos, 64, 601– 604.

Lukoschek, V., Waycott, M. & Marsh, H. (2007). Phylogeography of the olive sea snake, Aipysurus laevis (Hydrophiinae) indicates Pleistocene range expansion around northern Australia but low contemporary gene flow. Molecular Ecology, 16(16), 3406–3422.

Lusis, J.J. (1961). On the biological meaning of color polymorphism of lady beetle Adalia bipunctata. Latvijas Entomologs, 4, 3–29.

MacArthur, R.H. (1972). Geographical Ecology. Patterns in the Distribution of Species. Princeton University Press, New Jersey, USA. 288 pp.

MacArthur, R. & Wilson, E. (1963). An equilibrium theory of insular zoogeography. Evolution, 17, 373–387.

MacArthur, R. & Wilson, E. (1967). The Theory of Island Biogeography. Princeton University Press, New Jersey, USA. 224 pp.

103

MacArthur, R., Diamond, J. & Karr, J. (1972). Density compensation in island faunas. Ecology, 53, 330–342.

Mackintosh, J.A. (2001). The antimicrobial properties of melanocytes, melanosomes and melanin and the evolution of black skin. Journal of theoretical biology, 211(2), 101–113.

Makokha, J.S. (2006). Molecular Phylogenetics and Phylogeography of Sand Lizards, Pedioplanis (Sauria: Lacertidae) in Southern Africa. Thesis (M.S.), University of Stellenbosch, Stellenbosch, South Africa. 86 pp.

Manaças, S. (1958). Anfíbios e Répteis das ilhas de São Tomé e do Príncipe e do Ilhéo das Rolas. In: Anonymous (eds.). Conferência Internacional dos Africanistas Ocidentais - 4º Volume. Junta Investigação do Ultramar, Lisboa, Portugal. 179– 192 pp.

Mausfeld, P., Vences, M., Schmitz, A. & Veith, M. (2000). First data on the molecular phylogeography of scincid lizards of the genus Mabuya. Molecular Phylogenetics and Evolution, 17(1), 11–14.

Mayr, E. (1967). The challenge of island faunas. Australian Natural History, 15, 369– 374.

Meik, J.M., Lawing, A.M. & Pires-daSilva, A. (2010). Body size evolution in insular speckled rattlesnakes (Viperidae: Crotalus mitchellii). PLoS One, 5(3), e9524.

104

Meiri, S. (2007). Size evolution in island lizards. Global Ecology and Biogeography, 16, 702–708.

Meiri, S. (2008). Evolution and ecology of lizard body sizes. Global Ecology and Biogeography, 17, 724–734.

Meiri, S. (2016). Small, rare and trendy: traits and biogeography of lizards described in the 21st century. Journal of Zoology, 299(4), 251–261.

Meiri, S., Dayan, T. & Simberloff, D. (2004). Body size of insular carnivores: little support for the island rule. The American Naturalist, 163(3), 469–479.

Meiri, S., Dayan, T. & Simberloff, D. (2006). The generality of the island rule reexamined. Journal of Biogeography, 33(9), 1571–1577.

Meiri, S., Cooper, N. & Purvis, A. (2008). The island rule: made to be broken? Proceedings of the Royal Society B: Biological Sciences, 275, 141–148.

Meiri, S., Raia, P. & Phillimore, A.B. (2011). Slaying dragons: limited evidence for unusual body size evolution on islands. Journal of Biogeography, 38, 89–100.

Mendes, L.F. & Bivar-de-Sousa, A. (2012). New account on the butterflies (Lepidoptera: Rhopalocera) of São Tomé e Príncipe. Boletín de la Sociedad Entomológica Aragonesa, 51, 157–186.

Mertens, R. (1934). Die Insel Reptilian. Zoologica, 84, 1–205.

Minteer, B.A., Collins, J.P., Love, K.E. & Puschendorf, R. (2014). Avoiding (re) extinction. Science, 344(6181), 260–261.

Monney, J.C., Luiselli, L. & Capula, M. (1995). Correlates of melanism in a population of adders (Vipera berus) from the Swiss Alps and comparisons with other alpine populations. Amphibia–Reptilia, 16, 323–330.

105

Mora, C., Tittensor, D.P., Adl, S., Simpson, A.G. & Worm, B. (2011). How many species are there on Earth and in the ocean?. PLoS Biol, 9(8), e1001127.

Moreau, K.E. (1966). The Bird Faunas of Africa and its Islands. Academic Press, London, UK. 424 pp.

Mouton, P. le F.N. & Oelofsen, B.W. (1988). A model explaining patterns of geographic character variation in Cordylus cordylus (Reptilia; Cordylidae) in the south-western Cape, South Africa. African Zoology, 23(1), 20–31.

Moussalli, A., Moritz, C., Williams, S.E. & Carnaval, A.C. (2009). Variable responses of skinks to a common history of rainforest fluctuation: concordance between phylogeography and palaeo‐distribution models. Molecular Ecology, 18(3), 483– 499.

Myers, N., Mittmeier, R.A., Mittmeier, C.G., Da Fonseca, G.A. & Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature, 403, 853–858.

Norris, K.S. & Lowe, C.H. (1964). An analysis of background color-matching in amphibians and reptiles. Ecology, 45, 565–580.

Novosolov, M., Raia, P. & Meiri, S. (2013) The island syndrome in lizards. Journal of Global Ecology and Biogeography, 22, 184–191.

Olalla-Tárraga, M.A. & Rodríguez, M.A. (2007). Energy and interspecific body size patterns of amphibian faunas in Europe and North America: anurans follow Bergmann’s rule, urodeles its converse. Global Ecology and Biogeography, 16(5), 606–617.

Oliver, P.M., Adams, M., Lee, M.S., Hutchinson, M.N. & Doughty, P. (2009). Cryptic diversity in vertebrates: molecular data double estimates of species diversity in a radiation of Australian lizards (Diplodactylus, Gekkota). Proceedings of the Royal Society of London B: Biological Sciences, 276(1664), 2001–2007.

Ortiz, J.C. (1994). A new species of high Andean lizard of the genus Liolaemus (Sauria, Tropiduridae). Boletin de la Sociedad de Biologia de Concepcion, 65, 191–195.

Pafilis, P., Meiri, S., Foufopoulos, J. & Valakos, E. (2009). Intraspecific competition and high food availability are associated with insular gigantism in a lizard. Naturwissenschaften, 96, 1107–1113.

106

Pepper, M., Doughty, P. & Keogh, J.S. (2006). Molecular phylogeny and phylogeography of the Australian Diplodactylus stenodactylus (Gekkota; Reptilia) species-group based on mitochondrial and nuclear genes reveals an ancient split between Pilbara and non-Pilbara D. stenodactylus. Molecular Phylogenetics and Evolution, 41(3), 539–555.

Pérez-Mellado, V., Hernández-Estévez, J.Á., García-Díez, T., Terrassa, B., Ramón, M.M., Castro, J., Picornell, A., Martín-Vallejo, J. & Brown, R. (2008). Population density in Podarcis lilfordi (Squamata, Lacertidae), a lizard species endemic to small islets in the Balearic Islands (Spain). Amphibia-Reptilia, 29(1), 49-60.

Pincheira-Donoso, D., Bauer, A.M., Meiri, S. & Uetz, P. (2013). Global taxonomic diversity of living reptiles. PLoS One, 8(3), e59741.

Pincheira-Donoso, D. & Meiri, S. (2013). An intercontinental analysis of climate-driven body size clines in reptiles: no support for patterns, no signals of processes. Evolutionary Biology, 40(4), 562–578.

Podnar, M., Mayer, W. & Tvrtković, N. (2005). Phylogeography of the Italian wall lizard, Podarcis sicula, as revealed by mitochondrial DNA sequences. Molecular Ecology, 14(2), 575–588.

Porter, R.D. & Wiemeyer, S.N. (1969). Dieldrin and DDT: effects on sparrow hawk eggshells and reproduction. Science, 165(3889), 199–200.

Portik, D.M. & Bauer, A.M. (2012). Untangling the complex: molecular patterns in Trachylepis variegate and T. punctulata (Reptilia: Scincidae). African Journal of Herpetology, 61(2), 128–142.

Pregill, G.K. (1986). Body size of insular lizards: a pattern of Holocene dwarfism. Evolution, 40, 997–1008.

Preston, F.W. (1948). The commonness, and rarity, of species. Ecology, 29(3), 254– 283.

Pyrez, T. (1992). Provisional checklist of the butterflies of São Tomé and Príncipe islands. Lambillionea, 92(1), 48–52.

107

Raia, P. & Meiri, S. (2006). The island rule in large mammals: palaeontology meets ecology. Evolution, 60, 1731–1742.

RAMSAR (2017). São Tomé and Príncipe. Available from http://www.ramsar.org/wetland/sao-tome-and-principe (accessed 2 May 2017).

Rawlings, L.H. & Donnellan, S.C. (2003). Phylogeographic analysis of the green python, Morelia viridis, reveals cryptic diversity. Molecular phylogenetics and evolution, 27(1), 36–44.

Ray, C. (1960). The application of Bergmann's and Allen's rules to the poikilotherms. Journal of morphology, 106(1), 85–108.

Reyment, R.A. (1983). Palaeontological aspects of island biogeography: colonization and evolution of mammals on Mediterranean islands. Oikos, 41, 299–306.

Robbirt, K.M., Davy, A.J., Hutchings, M.J. & Roberts, D.L. (2011). Validation of biological collections as a source of phenological data for use in climate change studies: a case study with the orchid Ophrys sphegodes. Journal of Ecology, 99(1), 235–241.

Rocha, L.A., Aleixo, A., Allen, G., Almeda, F., Baldwin, C.C., Barclay, M.V.L., Bates, J.M., Bauer, A.M., Benzoni, F., Berns, C.M, Berumen, M.L., Blackburn, D.C., Blum, S., Bolaños, F., Bowie, R.C.K., Britz, R., Brown, R.M., Cadena, C.D., Carpenter, K., Ceríaco, L.M.P., Chakrabarty, P., Chaves, G., Choat, J.H., Clements, K.D., Collette, B.B., Collins, A., Coyne, J., Cracraft, J., Daniel, T., Carvalho, M.R. de, Queiroz, K. de, Dario, F. Di, Drewes, R., Dumbacher, J.P., Engilis Jr., A., Erdmann, M.V., Eschmeyer, W., Feldman, C.R., Fisher, B.L., Fjeldså, J., Fritsch, P.W., Fuchs, J., Getahun, A., Gill, A., Gomon, M., Gosliner, T., Graves, G.R., Griswold, C.E., Guralnick, R., Hartel, K., Helgen, K.M., Ho, H., Iskandar, D.T., Iwamoto, T., Jaafar, Z., James, H.F., Johnson, D., Kavanaugh, D., Knowlton, N., Lacey, E., Larson, H.K., Last, P., Leis, J.M., Lessios, H., Liebherr, J., Lowman, M., Mahler, D.L., Mamonekene, V., Matsuura, K., Mayer, G.C., Mays Jr., H., McCosker, J., McDiarmid, R.W., McGuire, J., Miller, M.J., Mooi, R., Mooi, R.D., Moritz, C., Myers, P., Nachman, M.W., Nussbaum, R.A., Foighil,

108

D. Ó, Parenti, L.R., Parham, J.F., Paul, E., Paulay, G., Pérez-Emán, J., Pérez- Matus, A., Poe, S., Pogonoski, J., Rabosky, D.L., Randall, J.E., Reimer, J.D., Robertson, D.R., Rödel, M.-O., Rodrigues, M.T., Roopnarine, P., Rüber, L., Ryan, M.J., Sheldon, F., Shinohara, G., Short, A., Simison, W.B., Smith-Vaniz, W.F., Springer, V.G., Stiassny, M., Tello, J.G., Thompson, C.W., Trnski, T., Tucker, P., Valqui, T., Vecchione, M., Verheyen, E., Wainwright, P.C., Wheeler, T.A., White, W.T., Will, K., Williams, J.T., Williams, G., Wilson, E.O., Winker, K., Winterbottom, R. & Witt, C.C. (2014). Specimen collection: An essential tool. Science, 344(6186), 814–815.

Rodda, G.H. & Dean-Bradley, K. (2002) Excess density compensation of island herpetofaunal assemblages. Journal of Biogeography, 29, 623–632.

Rodda, G.H., Perry, G.A.D., Rondeau, R.J. & Lazell, J. (2001). The densest terrestrial vertebrate. Journal of Tropical Ecology, 17(2), 331–338.

Rosauer, D.F., Blom, M.P.K., Bourke, G., Catalano, S., Donnellan, S., Gillespie, G., Mulder, E., Oliver, P.M., Potter, S., Pratt, R.C., Rabosky, D.L., Skipwith, P.L. & Moritz, C. (2016). Phylogeography, hotspots and conservation priorities: an example from the Top End of Australia. Biological Conservation, 204, 83–93.

Rosenzweig, M.L. (1995). Species diversity in space and time. Cambridge University Press, Cambridge, UK. 436 pp.

Ruibal, R. & Philibosian, R. (1974) The population ecology of the lizard Anolis acutus. Ecology, 55, 525–537.

Sadovy de Mitcheson, Y., Craig, M.T., Bertoncini, A.A., Carpenter, K. E., Cheung, W.W., Choat, J.H., Cornish, A.S., Fennessy, S.T., Ferreira, B.P., Heemstra, P.C., Liu, M., Myers, R.F., Pollard, D.A., Rhodes, K.L., Rocha, L.A., Russell, B.C., Samoilys, M.A. & Sanciangco, J. (2013). Fishing groupers towards extinction: a global assessment of threats and extinction risks in a billion dollar fishery. Fish and fisheries, 14(2), 119–136.

Sanchez-Piñero, F. & Polis, G.A. (2000). Bottom‐up dynamics of allochthonous input: direct and indirect effects of seabirds on islands. Ecology, 81(11), 3117–3132.

Schluter, D. (2001). The Ecology of Adaptive Radiation. Oxford University Press, Oxford, UK. 300 pp.

109

Setlow, R.B., Grist, E., Thompson, K. & Woodhead, A.D. (1993). Wavelengths effective in induction of malignant melanoma. Proceedings of the National Academy of Sciences, 90(14), 6666–6670.

Simberloff, D.S. (1974). Equilibrium theory of island biogeography and ecology. Annual review of Ecology and Systematics, 5(1), 161–182.

Sinervo, B., Hedges, R. & Adolph, S.C. (1991). Decreased sprint speed as a cost of reproduction in the lizard Sceloporus occidentalis: variation among populations. Journal of Experimental Biology, 155(1), 323–336.

Sondaar, P.Y. (1977). Insularity and Its Effect on Mammal Evolution. In: Hecht, M.K., Goody, P.C. & Hecht, B.M. (eds.) Major Patterns in Vertebrate Evolution. Springer, Boston, USA. 671–707 pp.

Sousa-Baena, M.S., Garcia, L.C. & Peterson, A.T. (2014). Knowledge behind conservation status decisions: data basis for “Data Deficient” Brazilian plant species. Biological conservation, 173, 80–89.

Speybroeck, J., Beukema, W., Bok, B., Voort van Der, J. & Velikov, I. (2016). Field Guide to Amphibians and Reptiles of Britain and Europe. Christopher Helm. 432 pp.

Swart, B.L., Tolley, K.A. & Matthee, C.A. (2009). Climate change drives speciation in the southern rock agama (Agama atra) in the Cape Floristic Region, South Africa. Journal of Biogeography, 36, 78–87.

Szarski, H. (1962). Some remarks on herbivorous lizards. Evolution, 16, 529.

Tilman, D. (1994) Resource Competition and Community Structure. Princeton University Press, Princeton, USA. Tolley, K.A., Chase, B.M. & Forest, F. (2008). Speciation and radiations track climate transitions since the Miocene Climatic Optimum: a case study of southern African chameleons. Journal of Biogeography, 35, 1402–1414.

Tolley, K.A., Burger, M., Turner, A.A. & Matthee, C.A. (2006). Biogeographic patterns and phylogeography of dwarf chameleons (Bradypodion) in an African biodiversity hotspot. Molecular Ecology, 15, 781–793.

Trape, J.F., Trape, S. & Chirio, L. (2012). Lézards, crocodiles et tortues d'Afrique occidentale et du Sahara. IRD Éditions, Marseille, France. 503 pp.

110

Turner, J.R.G. (1977). Butterfly mimicry: the genetical evolution of an adaptation. Evolutionary biology, 10, 163–206.

Uetz, P. & Hošek, J. (2016). The Reptile Database. Available from: http://www.reptile– database.org (accessed 2 May 2017).

Ursenbacher, S., Carlsson, M., Helfer, V., Tegelström, H. & Fumagalli, L. (2006). Phylogeography and Pleistocene refugia of the adder (Vipera berus) as inferred from mitochondrial DNA sequence data. Molecular Ecology, 15(11), 3425–3437.

Ursenbacher, S., Schweiger, S., Tomović, L., Crnobrnja-Isailović, J., Fumagalli, L. & Mayer, W. (2008). Molecular phylogeography of the nose-horned viper (Vipera ammodytes, Linnaeus (1758)): evidence for high genetic diversity and multiple refugia in the Balkan peninsula. Molecular Phylogenetics and Evolution, 46(3), 1116–1128.

Vaconcelos, R., Carretero, M.A. & Harris, D.J. (2006). Phylogeography of the genus Blanus (worm lizards) in Iberia and Morocco based on mitochondrial and nuclear markers – preliminary analysis. Amphibia-Reptilia, 27(3), 339–346.

Valle, S., Barros, N. & Wanless, R.M. (2014). Status and Trends of The Seabirds Breeding at Tinhosa Grande Island, São Tomé e Príncipe. BirdLife International, Cambridge, UK. 27 pp. van Damme, R., Bauwens, D. & Verheyen, R.F. (1989). Effect of relative clutch mass on sprint speed in the lizard Lacerta vivipara. Journal of Herpetology, 23(4), 459–461. van Valen, L. (1973). Patterns and the balance of nature. Evolutionary Theory, 1, 31– 49.

111

Vences, M., Galán, P., Vieites, D.R., Puente, M., Oetter, K. & Wanke, S. (2002). Field body temperatures and heating rates in a montane frog population: the importance of black dorsal pattern for thermoregulation. Annales Zoologici Fennici, 39, 209– 220.

Vitousek, P., Loope, L.L. & Adsersen, H. (2013). Islands. Biological Diversity and Ecosystem Function. Springer-Verlag Berlin Heidelberg, New York, USA. 238 pp.

Wallace, A.R. (1902). Island Life or The Phenomena and Causes of Insular Faunas and Floras Including a Revision and Attempted Solution of the Problem of Geological Climates. Macmillan, London, UK. 563 pp.

Whittaker, R.J. (1998). Island biogeography. Oxford University Press, Oxford, UK. 285 pp.

Whittaker, R.J. & Fernández-Palacios, J.M. (2007). Island biogeography. Ecology, Evolution, and Conservation. Oxford University Press, Oxford, UK. 416 pp.

Wiens, J.J. (1999). Phylogenetic evidence for multiple losses of a sexually selected character in phrynosomatid lizards. Proceedings of the Royal Society of London B: Biological Sciences, 266(1428), 1529–1535.

Wiens, J.J. & Penkrot, T.A. (2002). Delimiting species using DNA and morphological variation and discordant species limits in spiny lizards (Sceloporus). Systematic biology, 51(1), 69–91.

Wiernasz, D.C. (1989). Female choice and sexual selection of male wing melanin pattern in Pieris occidentalis (Lepidoptera). Evolution, 43, 1672–1682.

Williams, C. (1964). Patterns in the balance of nature and related problems of quantitative ecology. Academic Press, London and New York. 324 pp.

Williamson, M. (1981). Island populations. Oxford University Press, New York, USA. 200 pp.

Williamson, M. (1988). Relationship of species number to area, distance and other variables. In: Myers, A.A. & Giller, P.S. (eds.). Analytical biogeography. An Integrated Approach to the Study of Animal and Plant Distributions. Springer Netherlands, Netherlands. 91–115 pp.

112

Wilson, K., Cotter, S.C., Reeson, A.F. & Pell, J.K. (2001). Melanism and disease resistance in insects. Ecology Letters, 4(6), 637–649.

Winker, K., Reed, J.M., Escalante, P., Askins, R.A., Cicero, C., Hough, G.E. & Bates, J. (2010). The importance, effects, and ethics of bird collecting. The Auk, 127(3), 690–695.

World Wild Life (WWF) (2017). Available from: https://www.worldwildlife.org/ecoregions/at0127 (accessed 11 July 2017).

113