1-S2.0-S1055790317302348-Main

Molecular Phylogenetics and Evolution 116 (2017) 172–181 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev The confounding effects of hybridization on phylogenetic estimation in the MARK New Zealand cicada genus Kikihia ⁎ Sarah E. Bankera,b, , Elizabeth J. Wadea,c, Chris Simona a University of Connecticut, Department of Ecology and Evolutionary Biology, 75 North Eagleville Road, Unit 3043, Storrs, CT 06269, USA b University of California, Department of Integrative Biology, 3101 Valley Life Sciences Building, Berkeley, CA 94720, USA c United States Department of Agriculture-Agricultural Research Service, Center for Medical, Agricultural, and Veterinary Entomology, 1600 SW 23rd Dr., Gainesville, FL 32608, USA ARTICLE INFO ABSTRACT Keywords: Phylogenetic studies of multiple independently inherited nuclear genes considered in combination with patterns Habitat heterogeneity of inheritance of organelle DNA have provided considerable insight into the history of species evolution. In Cicadidae particular, investigations of cicadas in the New Zealand genus Kikihia have identified interesting cases where Gene trees mitochondrial DNA (mtDNA) crosses species boundaries in some species pairs but not others. Previous phylo- Biogeography genetic studies focusing on mtDNA largely corroborated Kikihia species groups identified by song, morphology Species tree methods and ecology with the exception of a unique South Island mitochondrial haplotype clade—the Westlandica group. Concatenation fi fi ff Nuclear-mitochondrial discordance This newly identi ed group consists of diverse taxa previously classi ed as belonging to three di erent sub- generic clades. We sequenced five nuclear loci from multiple individuals from every species of Kikihia to assess the nuclear gene concordance for this newly-identified mtDNA lineage. Bayes Factor analysis of the constrained phylogeny suggests some support for the mtDNA-based hypotheses, despite the fact that neither concatenation nor multiple species tree methods resolve the Westlandica group as monophyletic. The nuclear analyses suggest a geographic distinction between clearly defined monophyletic North Island clades and unresolved South Island clades. We suggest that more extreme habitat modification on South Island during the Pliocene and Pleistocene resulted in secondary contact and hybridization between species pairs and a series of mitochondrial capture events followed by subsequent lineage evolution. 1. Introduction In the present study, we investigate gene trees from multiple nuclear loci to infer the validity of an unexpected clade of NZ cicada species Discordance between individual gene trees and the underlying reconstructed using mitochondrial DNA (Arensburger et al., 2004b; species tree is a well-documented obstacle to understanding evolu- Marshall et al., 2008, 2011). Kikihia is a large endemic genus of cicadas tionary history. Gene-tree discordance can be caused by a variety of that evolved in concert with a rapidly changing New Zealand (NZ) evolutionary processes, including gene duplication and extinction, landscape. Following the typical pattern of island biodiversity, the an- horizontal gene transfer, hybridization, and incomplete lineage sorting cestral species of Kikihia, is estimated to have diversified into three (Maddison, 1997; Avise et al., 1990; Maddison and Knowles, 2006; genera ∼10 Ma, shortly after colonization of NZ in the mid Miocene Carstens and Knowles, 2007; Sullivan et al., 2014; Warnow, 2015). To ∼14 Ma. (Arensburger et al., 2004a; Buckley et al., 2002; Marshall overcome this hurdle, recent studies have focused both on using a et al., 2016). Increased habitat heterogeneity caused by Pliocene era multi-gene approach and developing methods that explicitly account mountain building events triggered a species radiation ∼3–5Ma for gene-tree-species tree discord (Tonini et al., 2015 for list). However, (Arensburger et al., 2004b; Marshall et al., 2008; Williams et al., 2015; the results of empirical and theoretical studies assessing the perfor- Wood et al., 2017) and the genus experienced relatively constant di- mance of these methods versus traditional supermatrix or concatenated versification since that time (Marshall et al., 2008, 2011; Ellis et al., data analyses have varied depending on the data analyzed (Thompson 2015). Given the wealth of ecological, behavioral and mtDNA genetic et al., 2014; Tonini et al., 2015; Warnow, 2015; Edwards et al., 2016; data, the low dispersal rates of these species, and the dramatic geolo- Gatesy and Springer, 2014, 2016). gical history of New Zealand, the genus Kikihia is an excellent model Abbreviations: New Zealand, NZ; mitochondrial DNA, mtDNA; Maximum Likelihood, ML; Bayesian Inference, BI; North Island, NI; South Island, SI ⁎ Corresponding author at: University of California, Department of Integrative Biology, 3101 Valley Life Sciences Building, Berkeley, CA 94720, USA. E-mail addresses: [email protected] (S.E. Banker), [email protected] (E.J. Wade), [email protected] (C. Simon). http://dx.doi.org/10.1016/j.ympev.2017.08.009 Received 24 March 2017; Received in revised form 4 August 2017; Accepted 17 August 2017 Available online 19 August 2017 1055-7903/ © 2017 Elsevier Inc. All rights reserved. S.E. Banker et al. Molecular Phylogenetics and Evolution 116 (2017) 172–181 Fig. 1. (A) “Intuitive tree” of Fleming and Dugdale based on ecology and morphology, redrawn from the Dugdale papers of the Archives of the NZ Arthropod Collection, Landcare Research, NZ. Triangles right of branch tips represent current distribution with upwards facing triangles for North Island, downwards facing for South Island, and “O” for restricted distribution on an offshore island. Blue circles to the right of taxa names = individuals belonging to the mtDNA “Westlandica” clades in Fig. 1C*=K. “westlandica north” and K. “westlandica south” were not separated from K. muta muta by Fleming and Dugdale. (B) Map of sample collection. Taxon and colors correspond to the mtDNA groups shown in Fig. 1C, sample ID labels indicate taxon name, district code (Crosby et al., 1998), collection locality (Simon Lab code), and year collected (C) Partitioned Bayesian phylogeny (post-burnin consensus phylogram) of the genus Kikihia based on 2152 bp of mtDNA sequence redrawn from Marshall et al., 2008. Bayesian posterior probabilities (left) and maximum likelihood bootstraps (right). 173 S.E. Banker et al. Molecular Phylogenetics and Evolution 116 (2017) 172–181 system with which to examine the effects of landscape and climate et al., 2004b) have consistently placed the shade singer taxa, K. scu- change on speciation. The New Zealand entomologist John Dugdale and tellaris and K. cauta as sister to the main Kikihia species radiation, geologist/naturalist Charles Fleming described six of the 13 currently therefore all phylogenies were rooted with K. scutellaris. recognized Kikihia species. Their cladogram (Archives of the NZ Na- Cicadas were collected in the field by hand and with insect nets. tional Insect Collection, Landcare Research, Auckland) of Kikihia spe- Whenever possible, songs were recorded. Specimens were preserved in cies contains four major clades: shade singers (forest understory), Green 95% ethanol either as whole bodies or leg-only samples, kept re- Foliage (evergreen shrub and forest), Muta (grass and shrub) and Rosea frigerated in the field and stored in ethanol at −20 to −80°C in the (dry scrub) (Fig. 1A). These groupings were created based on dis- Simon Lab at the University of Connecticut. Identification of all speci- tributions, morphology/color pattern, male calling songs, and ecology mens used for molecular sequencing was based on song, location, and with an emphasis on habitat preference. morphology. Genomic DNA was extracted from 1 to 2 legs using the Molecular analyses (Arensburger et al., 2004b; Marshall et al., 2008; Qiagen DNeasy Blood & Tissue kit (Qiagen, 2006) or Clontech Nu- Ellis et al., 2015) based largely on mtDNA support the major patterns of cleospin Tissue kits (Clontech, Mountain View, CA, USA) according to Kikihia relationships hypothesized by Dugdale and Fleming, including manufacturer’s instructions, except that the digestion was conducted the early divergence of the two shade singer taxa and a later radiation over 8–18 h at 54 °C. of several species groups that seem to be organized by habitat type. One striking difference between the Dugdale and Fleming cladogram and 2.2. Gene selection and sequencing the mtDNA phylogeny is the presence of a fourth mtDNA group in the major species radiation, nicknamed the Westlandica group by Marshall Genes were amplified using previously published PCR methods et al. (2008) (Fig. 1C). While the three other groups (Green Foliage, (Marshall et al., 2011). The mitochondrial cytochrome oxidase I (COI) Muta, and Rosea) seem to be patterned by habitat type, the Westlandica gene was sequenced to ensure that species were identified correctly and group contains grass species (K. “westlandica north” and “K. westlan- that the patterns of mitochondrial evolution (Marshall et al., 2008) dica south” previously considered to be K. muta muta and placed in the were consistent in this set of specimens. A touchdown program with Muta group by Dugdale and Fleming, Fig. 1A), a tussock specialist (K. annealing temperatures of 55–45 °C was used with the primers C1-J- angusta, Muta group) and two shrub-inhabiting taxa (K. “tasmani”–wet 1513 (5′CATTTTTGGTATTTGATCAGG

Load more