Hypogonadotropic Hypogonadism and Cleft Lip and Palate Caused by A

666

LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1 HG Kim, S R Herrick, E Lemyre, S Kishikawa, J A Salisz, S Seminara, M E MacDonald, G A P Bruns, C C Morton, B J Quade, J F Gusella ......

J Med Genet 2005;42:666–672. doi: 10.1136/jmg.2004.026989

e have established the Developmental Genome Anatomy Project (DGAP; //dgap.harvard.edu) to Key points Wtake advantage of the unique opportunity to locate genes of developmental importance provided by apparently N Kallmann’s syndrome (KS), characterised by hypogo- balanced chromosomal rearrangements associated with nadotropic hypogonadism and anosmia, can be phenotypic abnormalities. By positional cloning at or near caused by inactivating mutations of the X linked KAL1 the breakpoints, we aim to identify the crucial disease genes gene, but these mutations account for less than 15% of 1 whose functions have been disrupted by rearrangement. KS patients. The remaining cases, as well as cases of Kallmann’s syndrome (KS) is a developmental disorder hypogonadotropic hypogonadism without anosmia, characterised by anosmia resulting from agenesis of the are believed to be caused by mutations at two or olfactory lobes and hypogonadism secondary to deficiency of more autosomal loci, including a segment of 8p hypothalamic gonadotropin releasing hormone (GnRH). Its heterozygous for a microdeletion in one KS patient. prevalence has been estimated at 1/10 000 in males and 1/ 50 000 in females. In a minority of cases there are N Recently, mutation in FGFR1, the 8p gene encoding inactivating mutations of KAL1, an X linked gene encoding fibroblast growth factor receptor 1, has been shown to a putative adhesion molecule thought to mediate embryonic cause autosomal dominant KS. We report positional neuronal migration.23Constitutional autosomal chromosome cloning of the genomic breakpoints of the balanced translocations associated with KS have been reported, but the reciprocal translocation t(7;8)(p12.3;p11.2) from a disrupted genes have not been identified.4–6 male patient with hypogonadotropic hypogonadism We have studied a white male subject with a de novo and cleft lip and palate. The translocation disrupts balanced translocation between chromosomes 7, in band FGFR1 (MIM 136350) between exons 2 and 3 and p12.3, and 8, in band p11.2 (fig 1A), who was diagnosed on predicts a novel fusion gene product. http://jmg.bmj.com/ clinical examination to have hypogonadotropic hypogonad- N Although various FGFR1 translocations producing ism (infantile testes), azoospermia, and cleft lip and palate, fusion proteins have been reported as causes of without frank anosmia. As a KS patient with a microdeletion myeloproliferative disorders, this is the first case in involving the same 8p11.2 region had been reported, we which a constitutional FGFR1 translocation is asso- sought to identify the chromosome 8 gene disrupted in this ciated with a developmental disorder. reciprocal translocation as a likely candidate for the cause of autosomal KS as well as of isolated hypogonadotropic hypogonadism.7 While this breakpoint in FGFR1 was being on September 30, 2021 by guest. Protected copyright. characterised, Dode´ et al identified FGFR1 mutations in of anosmia. He was prescribed a regimen of testosterone several patients, establishing that disruption of FGFR1 can injections, which successfully induced secondary sexual cause autosomal dominant KS.8 characteristics. At the age of 31, he was seen by a different physician for azoospermia and infertility, and cytogenetic METHODS analysis was ordered for the possibility of Klinefelter’s This study was approved by the Institutional Review Board of syndrome. The analysis revealed an apparently balanced Partners Healthcare Inc, encompassing both the chromosomal translocation with the karyotype, Massachusetts General Hospital and the Brigham and 46,XY,t(7;8)(p12.3;p11.2). Informed consent for the genera- Women’s Hospital. tion of a lymphoblastoid cell line was obtained in accordance with institutional policies.9 Case report The subject is a white man who was aged 24 years at the time Fluorescent in situ hybridisation analysis of initial diagnosis. He had a history of cleft palate, corrected Breakpoint mapping on chromosome 8 was initiated using by surgery. He had no outstanding medical problems other clones placed on the cytogenetic map by fluorescent in situ than delayed sexual development and a feminine sounding hybridisation (FISH) analysis and on the sequence map by voice. He had his growth spurt at age 18–19 years, developed sequence tagged sites.10 Metaphase chromosomes from the sparse armpit hair at age 20, and penile hair at 16–17, but no patient cell line were prepared for analysis by GTG banding or penile or testicular enlargement. He displayed child-like FISH using standard protocols. Briefly, clones for FISH were facial hair, sparse axillary adult appearing hair, and prepubertal chest hair. Based on the presence of cleft palate Abbreviations: FGF, fibroblast growth factor; FISH, fluorescent in situ and hypogonadism, a tentative diagnosis of Kallmann’s hybridisation; KS, Kallmann’s syndrome; SSCP, single strand syndrome was reached, though the subject did not complain conformation polymorphism; UCSC, University of California Santa Cruz

www.jmedgenet.com Letter to JMG 667 J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from

Figure 1 Fluorescent in situ hybridisation (FISH) mapping of the chromosome 8 breakpoint. (A) Ideogram illustrating the balanced t(7;8)(p12.3;p11.2) in the patient. (B) FISH mapping with RP11-100B16, labelled with SpectrumOrange, resulted in hybridisation to the normal chromosome 8, and the der(8) and der(7) derivative chromosomes. The insets present the derivative chromosomes at higher magnification. selected using genome maps provided by the National Center 59GCAAGCTGTGCTGGAAGCA39;59CCAGCTTCACAGGTG for Biotechnology Information and the University of TTTTC39+59CCAGCATTTGAAGAGGGAGT39. California Santa Cruz (UCSC) Genomics Bioinformatics Group.10 11 Bacterial artificial chromosome (BAC) clones were Fusion transcript amplification obtained from CITB-D and RP11 libraries (Invitrogen, San Total RNA was isolated from patient and control lympho- Diego, California, and the Children’s Hospital of Oakland blastoid cell lines with the RNeasy Mini Kit (Qiagen, Research Institute) and directly labelled with Valencia, California, USA). Reverse transcription of total SpectrumOrange or Green-dUTP (Vysis) by nick translation. RNA (1 mg) was undertaken by using either random Hybridisations were carried out according to manufacturers’ hexanucleotide priming and Superscript II (Gibco BRL, protocols. Metaphase chromosomes were counterstained Gaithersburg, Maryland, USA) or the SMART–PCR cDNA with 4,6-diamino-2-phenylindole-dihydrochloride (DAPI), synthesis kit (Clontech, Palo Alto, California, USA) according and at least 10 metaphases were analysed using a Zeiss to the protocols provided. In each experiment, DNA Axioskop microscope. Images were captured with the contamination was excluded by the absence of a PCR product CytoVision system (Applied Imaging, San Jose´, California, in the sample without reverse transcriptase, amplified under USA). The karyotype, 46,XY,t(7;8)(p12.3;p11.2), was recon- the same conditions as the reverse transcribed RNA sample. firmed by GTG banding before breakpoint mapping by FISH. Nested PCR was carried out using Pfu polymerase (Gibco

BRL) with the following primer sets, annealing at 56˚C for 30 http://jmg.bmj.com/ seconds with an extension for one minute 40 seconds: Mapping and cloning of breakpoints TENS1-FGFR1:59CTGAGAAAGCCCTCAGTGTCC39+59CAAG Southern blot analysis of patient lymphoblast genomic DNA ATCTGGACATAAGGCAGG39,59GGCAGAGCAGCTACTCC with probes D011-A, D011-B, and D011-C to search for ACA39+59GTCACTGTACACCTTACACATGAACTC39; FGFR1- altered restriction fragments was carried out using standard TENS1:59CCTCTTGCGGCCACAGGC39+59CCTTCAACATGGC protocols. For each lane, 10 mg of genomic DNA from the GATGG39,59GCAGCGCGCGGAG39+59CCTTGTACCAGAACTT patient and control were digested with an appropriate GGAAGTG39. restriction enzyme. Fragments were separated on a 1.0% on September 30, 2021 by guest. Protected copyright. agarose gel and transferred to Hybond-N membrane Mutation analysis (Amersham, Arlington Heights, Illinois, USA). Filters were Mutation analysis of the second allele of FGFR1 was done by ultraviolet cross linked, baked at 80˚C, and hybridised with single strand conformation polymorphism (SSCP). In all, 24 32 probes labelled with P-dCTP by random priming. genomic fragments including the entire coding region, UTR, Hybridisation of labelled fragments was done in the presence and intron–exon boundaries were amplified from 18 exons of of excess herring sperm competitor DNA, and hybridised FGFR1 by PCR with [32P]-dCTP. Primers were designed to membranes were washed at 60˚C with 0.15 M NaCl/0.015 M amplify genomic fragments with the size of 200 to 300 base sodium citrate/0.1 % sodium dodecyl sulphate (SDS) for 30 pairs (bp) (primer sequences and amplification conditions minutes. Autoradiography took place for 16 hours at –70˚C are available on request). PCR products were applied on non- using two intensifying screens. Three hybridisation probes denaturing 8% glycerol gels with electrophoresis overnight at were amplified by the following primer sets: room temperature and 8W constant power. PCR products D011-A: 59CTGTCAGGGTTTCCATCACC39+59CCTAGAAACC that displayed a banding pattern different from control TCCGTGTTGC39; D011-B: 59GTGGCTCTGTTCTATCCCTC39+ samples were sequenced by an ABI Prism 377/XL DNA 59CACCAGTCATGGGAACCATC39; D011-C: 59GCACCTAGAG sequencer (Applied Biosystems, Foster City, California, USA). CCTGTAATAG39+59TGTCCAAGTCTCTCCTCGGA39. A 1.6 kb BamHI junction fragment from der(8) was RESULTS amplified by suppression polymerase chain reaction (PCR) Delineation of the breakpoint region on 8p11.2 using the following primer sets: 59CCTAATACGACTCAC To identify the genes potentially disrupted in the patient, we TATAGG39+59GCAATGCACTGTTAACACATG39;59CTATAGG first mapped the translocation breakpoints using FISH. Two GCTCGAGCGGC39+59CCTAGAGCCTGTAATAGTGAA39.12 Then, BAC clones selected from the UCSC map as starting clones for the der(7) junction fragment was amplified by nested PCR FISH—GS1-211B7 and GS1-165D4 from 8p12 and 8p11.2— using the primer sets: 59GGATCATTAGAGGGATTCGAA39+ mapped telomeric and centromeric to the breakpoint,

www.jmedgenet.com 668 Letter to JMG J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from http://jmg.bmj.com/ on September 30, 2021 by guest. Protected copyright.

Figure 2 (A) Schematic presentation of positional cloning on chromosome 8. The 24 kb breakpoint region determined by fluorescent in situ hybridisation (FISH) was further narrowed to 1.6 kb by Southern blot hybridisation, which detected junction fragments with five different restriction enzymes. The breakpoint is located between exons 2 and 3 of FGFR1. The FGFR1 gene is not to scale. (B) Southern blot hybridisation of genomic DNA from the translocation patient with 877 bp probe D011-C from intron 2 of FGFR1. Note the detection of five altered fragments caused by the translocation junction, generated by enzymes BamHI, DraI, EcoRV, HindIII, and SspI. C, genomic DNA from karyotypically normal control; P, patient genomic DNA. respectively, showing that the chromosome 8 breakpoint was which eight were proximal to the breakpoint and nine distal. contained in a 12 Mb region. Subsequent experiments were The final BAC, RP11-100B16, hybridised to the normal carried out using BACs chosen from within this region to chromosome 8, and both der(7) and der(8) chromosomes, narrow the candidate region until a breakpoint crossing BAC indicating that it spans the translocation breakpoint clone was identified. Seventeen BACs were examined, of (fig 1B). Additionally two BAC clones that partially

www.jmedgenet.com Letter to JMG 669 J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from

Figure 3 Genomic DNA sequence at two breakpoints from two junction fragments. The breakpoint on chromosome 7 is located between nucleotides 64702 and 64703 of AC073341, while on chromosome 8 it occurs between nucleotides 77382 and 77383 of AC087623. Note no gain or loss of nucleotides at the two breakpoints of the derivative chromosomes, showing a perfectly balanced reciprocal translocation. overlap with RP11-100B16—RP11-265K5 and RP11- Fusion transcript amplification 359P11—mapped distal and proximal to the breakpoint, The location of the translocation breakpoint predicts two respectively (fig 2A). Based on the sequence of these BACs, putative reciprocal in-frame fusion transcripts TENS1/FGFR1 the location of the breakpoint region was confined to ,24 kb and FGFR1/TENS1 (fig 4A). On the derivative chromosome 7, of DNA. exons 1–15 of TENS1 are predicted to join with exons 3–18 of FGFR1 isoform 1 and to form a 5891 bp TENS1Dex16-26/ FGFR1Dex1-2 transcript that spans 31 exons and encodes Southern blot hybridisation and cloning of the 1675 amino acids without frameshift, from the normal TENS1 breakpoints on 8p11.2 initiation codon (ATG) in exon 1 to the termination codon To localise the breakpoint region in 8p11.2 further, three (TGA) in exon 31 (corresponding to the normal stop codon in DNA fragments—D011-A, D011-B, and D011-C—were FGFR1 exon 18). The putative fusion protein would consist of amplified by PCR from the narrowed 24 kb region (fig 2A) the first 883 amino acids of TENS1 joined to the final 792 and used to probe patient DNA on genomic blots. D011-B and amino acids of FGFR1 (fig 4, panels A and B). D011-C both detected altered restriction fragments due to the On the derivative chromosome 8, exons 1-2 of FGFR1 are translocation (fig 2B), narrowing the breakpoint to 1557 bp joined to exons 16–26 of TENS1, predicting a 2546 bp on the BAC restriction map and suggesting that the break- FGFR1Dex3-18/TENS1Dex1-15 transcript that comprises 13 point is between exons 2 and 3 of FGFR1 isoform 1 (fig 2A). exons and encodes 592 amino acids. Again there is no We cloned and sequenced junction fragments spanning the frameshift, as the start codon and stop codon occur at exon 2 breakpoints from both derivative chromosomes, which and exon 13, respectively, at the same positions as the revealed that the translocation is perfectly balanced, without corresponding exon 2 of FGFR1 and exon 26 of TENS1. The the gain or loss of any sequence. The sequences of the predicted FGFR1-TENS1 fusion protein would contain the breakpoint regions for the der(7) and der(8) chromosomes first 30 amino acids of FGFR1 followed by the final 562 http://jmg.bmj.com/ are given in fig 3. amino acids of TENS1 (fig 4, panels A and B). To establish whether either fusion transcript is expressed Delineation of the breakpoint region on 7p12.3 in a lymphoblastoid cell line from the patient, we carried out BAC clones RP11-183O1 from 7p22.1 and RP11-34J24 from reverse transcriptase PCR (RT-PCR). Only the TENS1-FGFR1 7p11.2 were used as starting clones for FISH, and mapped fusion transcript was detected (fig 5), but sequencing distal and proximal to the breakpoint, respectively, indicating revealed the skipping of FGFR1 exon 3, an alternative splicing

that the chromosome 7 breakpoint was contained in a 49 Mb pattern also seen in several native FGFR1 encoded isoforms. on September 30, 2021 by guest. Protected copyright. region. Using randomly selected BACs, the breakpoint region The 5624 bp TENS1Dex16-26/FGFR1Dex1-3 transcript encodes was narrowed to ,1.3 Mb, flanked by RP11-126K7 and a fusion protein of 1586 amino acids comprising the first 883 RP11-271O10, which map telomeric and centromeric to the amino acids of TENS1 joined to the final 703 amino acids of breakpoint, respectively. After the breakpoint was cloned and FGFR1 (fig 4, panels A and B). sequenced, on the basis of the chromosome 8 findings (see below) the junction sequence was found to be located in Mutation analysis of the non-translocated FGFR1 RP11-549I23. This was confirmed by FISH, showing three allele signals, one each on chromosome 7 and both derivative Mutation analysis of the second non-translocated FGFR1 chromosomes (data not shown). allele from the patient, done by SSCP and direct sequencing, identified only a heterozygous nucleotide difference, 345 TENS1 in 7p12 and FGFR1 in 8p11 are disrupted CRT in exon 3, a known SNP (NCBI reference SNP ID: The chromosome 7 breakpoint lies in intron 15 of TENS1 rs2915665) which does not alter the Ser amino acid encoded (AF417489, 1445 amino acids, between nucleotides 64702 at this site. Thus the presence of the translocated allele of the and 64703 of GenBank entry AC073341, 15665 bp down- FGFR1 results in a disease phenotype without a correspond- stream of exon 15), while the breakpoint on chromosome 8 is ing coding sequence mutation in the alternate FGFR1 allele. in intron 2 of FGFR1 (NM_000604, 822 amino acids, between nucleotides 77382 and 77383 of GenBank entry AC087623, DISCUSSION 22414 bp downstream of exon 2). The chromosome 8 The TENS1 locus encodes tensin-like SH2 domain-containing breakpoint maps within a SINE/Alu repetitive sequence protein 1 (also known as tumour endothelial marker 6, tensin while the breakpoint in TENS1 occurs in unique intronic 3), a 1445 amino acid protein named for its similarity with sequence with no apparent homology to the chromosome 8 tensin, an actin filament crosslinking protein found in focal breakpoint region. adhesions.13 14 TENS1 protein contains a protein tyrosine

www.jmedgenet.com 670 Letter to JMG

Figure 4 (A) Disruption of genes J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from FGFR1 and TENS1 by t(7;8), resulting in two in-frame fusion genes. White boxes indicate 59 and 39 untranslated regions of exons. TENS1 and FGFR1 coding exons are shown as grey boxes and blue boxes, respectively, numbered above the gene in the same colour, whereas exons of fusion genes are numbered in orange below the gene. Note that the stop codons of the two fusion genes are at the same exon locations as in the corresponding wild- type genes, as there is no frameshift. In the amplified TENS1-FGFR1 fusion transcript, exon 3 of FGFR1 is skipped. Notable exons are numbered and the direction of gene transcription is indicated by arrows. The sizes of exons and introns is not to scale. (B) TENS1, FGFR1, FGFR1-TENS1, and TENS1- FGFR1 protein domains. In the amplified fusion protein TENS1-FGFR1, the transmembrane domain (TM), and tyrosine kinase domain (TK) of FGFR1 are not affected by the translocation, but the signal peptide (SP) of FGFR1 and the first immunoglobulin (Ig) like domain are absent. The translocation does not directly disrupt the amino terminal protein tyrosine phosphatase domain (PTP) or the carboxyl terminal Src homology 2 (SH2) and phosphotyrosine binding (PTB) domains of TENS1, but does segregate the coding sequences for these domains to different fusion transcripts. http://jmg.bmj.com/ on September 30, 2021 by guest. Protected copyright.

phosphatase domain in the amino-terminal region and Src However, the related KS phenotype in a patient hemizygous homology 2 (SH2) and phosphotyrosine binding domains for 8p due to the deletion region suggests that the near its carboxyl-terminus. FGFR1 encodes several different translocation produces hypogonadotropic hypogonadism as isoforms of a transmembrane protein, the extracellular a result of haploinsufficiency for FGFR1.7 Consistent with this moiety of which interacts with fibroblast growth factors view, there was no evidence for an FGFR1 mutation on the (FGFs), setting in motion a cascade of downstream signals, second allele in SSCP/sequence analysis in any of 18 exons ultimately influencing mitogenesis and differentiation; it is and splice junctions. The apparent functional hemizygosity characterised by two or three extracellular immunoglobin- for FGFR1 in the translocation patient probably reflects a like loops (depending on inclusion of exon 3), a transmem- failure to direct the FGFR1 functional domains to the proper brane domain, and an intracellular tyrosine kinase domain. location in the plasma membrane owing to the absence of the The predicted TENS1/FGFR1 fusion protein lacks the appropriate signal peptide and the presence of the large FGFR1 signal peptide and the first Ig-like domain, but TENS1 moiety. While this work was being completed, Dode´ et contains Ig-like domains 2 and 3, which are sufficient for al, and subsequently Sato et al, reported several truncating specific FGF binding, and an intact tyrosine kinase domain and missense FGFR1 mutations in KS patients, some with region, suggesting the potential for functionality (fig 3B).15 cleft lip and palate, consistent with the haploinsufficiency in

www.jmedgenet.com Letter to JMG 671

receptor dimerisation that also requires heparan sulphate J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from proteoglycan binding.19 Indeed, FGF2 ligand and FGFR1 have Control Patient been co-crystallised with heparin, and the structure of the complex defined.20 The common association with heparan sulphates and the similar effects of KAL1 and FGFR1 inactivating mutations support the suggestion that the FGFR1 signalling pathway participates directly in mediating anosmin 1 function.821 The translocation patient reported here and the KS patients reported by others also support the view that haploinsufficiency for FGFR1 is a cause of cleft lip and palate.7816 Interestingly, FGFR1 gain of function mutations have previously been associated with the craniosynostosis of Pfeiffer’s syndrome and in the Jackson–Weiss syndrome.22 23 These syndromes can also be caused by mutations in FGFR2, which has also been associated with cleft palate in Apert’s syndrome, indicating that the two receptors may function in the same signalling pathway.24 This suggests that FGFR2, 2.0 kb located at 10q26, may be an excellent candidate for an additional KS or idiopathic hypogonadotropic hypogonadism locus. Hence it would be of interest to determine whether FGFR2 is disrupted by translocation in a KS patient with a de 1.5 kb novo unbalanced der(1)t(1;10)(q44;q26).4 It is noteworthy that a variety of fusion proteins involving FGFR1 underlie the 8p11 myeloproliferative syndrome (EMS)/stem cell leukaemia–lymphoma syndrome, presum- 1.0 kb ably because of constitutive activity of the tyrosine kinase domain.25–29 However, neither Pfeiffer’s syndrome nor the Jackson–Weiss syndrome shows a myeloproliferation defect, suggesting that the gain of function in these cases is insufficient or inappropriate to transform target cells. The constitutional translocation reported here creates a predicted fusion protein that has not produced a myeloid disorder, despite being likely to mislocalise a portion of FGFR1 containing the tyrosine kinase domain. This reinforces the view that both the fusion partner and the site of the breakpoint are likely to be critical in producing constitutive tyrosine kinase activity in a manner that leads to malignancy. This is the first demonstration that constitutional translocation of FGFR1 can lead to abnormal development rather than http://jmg.bmj.com/ Figure 5 Expression of the fusion gene TENS1?ex16-26/FGFR1?ex1- to myeloid disorder, and provides a basis for more detailed 3. Nested RT–PCR was performed by using forward primers in exon 15 structure–function comparison of the respective fusion of TENS1 and reverse primers in exon 7 of FGFR1. Reverse transcribed proteins. t(7;8) patient RNA, but not RNA from a normal individual (control), resulted in amplification of a fusion transcript of 1.4 kb smaller than the expected size of 1.7 kb. The sequence analysis of this amplified fusion ELECTRONIC DATABASE INFORMATION gene from the patient confirmed the skipping of exon 3 of FGFR1. GenBank accession numbers: FGFR1, AC087623, NM_000604; TENS1, AC073341, AF417489. on September 30, 2021 by guest. Protected copyright. the patient reported here.816 However, the absence of frank dbSNP information: rs2915665. anosmia in the current patient indicates that sufficient FGFR1 function may have been maintained to prevent the ACKNOWLEDGEMENTS degree of agenesis of the olfactory lobes typical in KS. We are indebted to Carolyne Rooryck and Robert E Eisenman for As the translocation patient displays no obvious pheno- technical assistance, Amy Bosco and Heather L Ferguson for types distinct from those seen in patients with KS associated obtaining informed consent and clinical information, Wenqi Zeng FGFR1 point mutations, the disruption of TENS1 does not and Jo-Chen Chou for technical advice, Tammy Gillis, Michelle Flores, and the MGH Genomics Core Facility for DNA sequence seem to contribute to the patient’s abnormalities. This analysis and Francesca Puglisi for cell culture and genomic DNA suggests that heterozygous inactivation of TENS1 is without extraction. This work was supported by USPHS grants GM061354 dramatic consequence, but the possibility that the predicted (Developmental Genome Anatomy Project) and HD28138. fusion proteins effectively provide normal TENS1 function cannot be excluded...... The X linked form of KS is associated with inactivating Authors’ affiliations mutation of the KAL1 gene, encoding anosmin 1, a secreted HG Kim, S Kishikawa, M E MacDonald, J F Gusella, Molecular proteoglycan binding protein with similarities to neuronal Neurogenetics Unit, Center for Human Genetic Research, Massachusetts cell adhesion molecules.317 Anosmin 1 interacts with General Hospital/Department of Genetics, Harvard Medical School, heparan and chondroitin sulphates to promote cell adhesion Boston, Massachusetts, USA S R Herrick, B J Quade, Department of Pathology, Brigham and and neuronal outgrowth, and has been implicated in the Women’s Hospital/Harvard Medical School migration of gonadotropin releasing hormone (GnRH) E Lemyre, Medical Genetics Service, Hoˆpital Ste Justine, University of producing neurones and olfactory axonal fibres, though the Montreal, Montreal, Canada receptor system through which it acts remains uncertain.18 J A Salisz, West Shore Urology, Mercy Drive, Muskegon, Michigan, Notably, FGFR1 activation by binding to FGF ligands involves USA

www.jmedgenet.com 672 Letter to JMG

11 Karolchik D, Baertsch R, Diekhans M, Furey TS, Hinrichs A, Lu YT, Roskin KM, S Seminara, Reproductive Endocrine Unit, Massachusetts General J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from Hospital Schwartz M, Sugnet CW, Thomas DJ, Weber RJ, Haussler D, Kent WJ. The UCSC Genome Browser Database. Nucleic Acids Res 2003;31:51–4. G A P Bruns, Genetics Division, Children’s Hospital/Department of 12 Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA. An Pediatrics, Harvard Medical School improved PCR method for walking in uncloned genomic DNA. Nucleic Acids C C Morton, Departments of Obstetrics, Gynecology and Reproductive Res 1995;23:1087–8. Biology and Pathology, Brigham and Women’s Hospital/Harvard 13 Carson-Walter EB, Watkins DN, Nanda A, Vogelstein B, Kinzler KW, St Medical School Croix B. Cell surface tumor endothelial markers are conserved in mice and humans. Cancer Res 2001;61:6649–55. Conflicts of interest: none declared. 14 Chen H, Ishii A, Wong WK, Chen LB, Lo SH. Molecular characterization of human tensin. Biochem J 2000;351:403–11. Correspondence to: Dr James F Gusella, Molecular Neurogenetics Unit, 15 Plotnikov AN, Schlessinger J, Hubbard SR, Mohammadi M. Structural basis Center for Human Genetic Research, Massachusetts General Hospital/ for FGF receptor dimerization and activation. Cell 1999;98:641–50. Department of Genetics, Harvard Medical School, CNY149-6214, 13th 16 Sato N, Katsumata N, Kagami M, Hasegawa T, Hori N, Kawakita S, Street, Boston, Massachusetts 02129, USA; [email protected]. Minowada S, Shimotsuka A, Shishiba Y, Yokozawa M, Yasuda T, Nagasaki K, Hasegawa D, Hasegawa Y, Tachibana K, Naiki Y, Horikawa R, Tanaka T, edu Ogata T. Clinical assessment and mutation analysis of Kallmann syndrome 1 (KAL1) and fibroblast growth factor receptor 1 (FGFR1, or KAL2) in five families and 18 sporadic patients. J Clin Endocrinol Metab REFERENCES 2004;89:1079–88. 1 Collins FS. Positional cloning moves from perditional to traditional. Nat Genet 17 Hardelin JP. Kallmann syndrome: towards molecular pathogenesis. Mol Cell 1995;9:347–50. Endocrinol 2001;179:75–81. 2 Oliveira LM, Seminara SB, Beranova M, Hayes FJ, Valkenburgh SB, 18 Cariboni A, Pimpinelli F, Colamarino S, Zaninetti R, Piccolella M, Rumio C, Schipani E, Costa EM, Latronico AC, Crowley WF, Vallejo M. The importance Piva F, Rugarli EI, Maggi R. The product of X-linked Kallmann’s syndrome of autosomal genes in Kallmann syndrome: genotype–phenotype correlations gene (KAL1) affects the migratory activity of gonadotropin-releasing hormone and neuroendocrine characteristics. J Clin Endocrinol Metab (GnRH)-producing neurons. Hum Mol Genet 2004;13:2781–91. 2001;86:1532–8. 19 Ornitz DM. FGFs, heparan sulfate and FGFRs: complex interactions essential 3 Franco B, Guioli S, Pragliola A, Incerti B, Bardoni B, Tonlorenzi R, Carrozzo R, for development. Bioessays 2000;22:108–12. Maestrini E, Pieretti M, Taillon-Miller P, Brown C, Willard H, Lawrence C, 20 Schlessinger J, Plotnikov AN, Ibrahimi OA, Eliseenkova AV, Yeh BK, Yayon A, Persico M, Camerino G, Ballabio A. A gene deleted in Kallmann’s syndrome Linhardt RJ, Mohammadi M. Crystal structure of a ternary FGF-FGFR-heparin shares homology with neural cell adhesion and axonal path-finding complex reveals a dual role for heparin in FGFR binding and dimerization. molecules. Nature 1991;353:529–36. Mol Cell 2000;6:743–50. 4 Schinzel A, Lorda-Sanchez I, Binkert F, Carter NP, Bebb CE, Ferguson- 21 Dode C, Hardelin JP. Kallmann syndrome: fibroblast growth factor signaling Smith MA, Eiholzer U, Zachmann M, Robinson WP. Kallmann syndrome in a insufficiency? J Mol Med 2004;82:725–34. boy with a t(1;10) translocation detected by reverse chromosome painting. 22 Muenke M, Schell U, Hehr A, Robin NH, Losken HW, Schinzel A, Pulleyn LJ, J Med Genet 1995;32:957–61. Rutland P, Reardon W, Malcolm S, et al. A common mutation in the fibroblast 5 Kikuchi I, Nagamine M, Ueda A, Mihara K, Seita M, Minoda M. growth factor receptor 1 gene in Pfeiffer syndrome. Nat Genet Chromosomal translocation t(13;16) in a patient with idiopathic 1994;8:269–74. hypogonadotropic hypogonadism. Intern Med 1993;32:465–7. 23 Roscioli T, Flanagan S, Kumar P, Masel J, Gattas M, Hyland VJ, Glass IA. 6 Best LG, Wasdahl WA, Larson LM, Sturlaugson J. Chromosome abnormality Clinical findings in a patient with FGFR1 P252R mutation and comparison with in Kallmann syndrome. Am J Med Genet 1990;35:306–9. the literature. Am J Med Genet 2000;93:22–8. 7 Vermeulen S, Messiaen L, Scheir P, De Bie S, Speleman F, De Paepe A. 24 Wilkie AO, Morriss-Kay GM. Genetics of craniofacial development and Kallmann syndrome in a patient with congenital spherocytosis and an malformation. Nat Rev Genet 2001;2:458–68. interstitial 8p11.2 deletion. Am J Med Genet 2002;108:315–18. 25 Xiao S, Nalabolu SR, Aster JC, Ma J, Abruzzo L, Jaffe ES, Stone R, 8 Dode C, Levilliers J, Dupont JM, De Paepe A, Le Du N, Soussi-Yanicostas N, Weissman SM, Hudson TJ, Fletcher JA. FGFR1 is fused with a novel zinc- Coimbra RS, Delmaghani S, Compain-Nouaille S, Baverel F, Pecheux C, Le finger gene, ZNF198, in the t(8;13) leukaemia/lymphoma syndrome. Nat Tessier D, Cruaud C, Delpech M, Speleman F, Vermeulen S, Amalfitano A, Genet 1998;18:84–7. Bachelot Y, Bouchard P, Cabrol S, Carel JC, Delemarre-van de Waal H, 26 Popovici C, Adelaide J, Ollendorff V, Chaffanet M, Guasch G, Jacrot M, Goulet-Salmon B, Kottler ML, Richard O, Sanchez-Franco F, Saura R, Young J, Leroux D, Birnbaum D, Pebusque MJ. Fibroblast growth factor receptor 1 is Petit C, Hardelin JP. Loss-of-function mutations in FGFR1 cause autosomal fused to FIM in stem-cell myeloproliferative disorder with t(8;13). Proc Natl Acad Sci USA 1998;95:5712–17.

dominant Kallmann syndrome. Nat Genet 2003;33:463–5. http://jmg.bmj.com/ 9 Anderson MA, Gusella JF. Use of cyclosporin A in establishing Epstein-Barr 27 Popovici C, Zhang B, Gregoire MJ, Jonveaux P, Lafage-Pochitaloff M, virus-transformed human lymphoblastoid cell lines. In Vitro 1984;20:856–8. Birnbaum D, Pebusque MJ. The t(6;8)(q27;p11) translocation in a stem cell 10 Cheung VG, Nowak N, Jang W, Kirsch IR, Zhao S, Chen XN, Furey TS, myeloproliferative disorder fuses a novel gene, FOP, to fibroblast growth Kim UJ, Kuo WL, Olivier M, Conroy J, Kasprzyk A, Massa H, Yonescu R, factor receptor 1. Blood 1999;93:1381–9. Sait S, Thoreen C, Snijders A, Lemyre E, Bailey JA, Bruzel A, Burrill WD, 28 Guasch G, Mack GJ, Popovici C, Dastugue N, Birnbaum D, Rattner JB, Clegg SM, Collins S, Dhami P, Friedman C, Han CS, Herrick S, Lee J, Pebusque MJ. FGFR1 is fused to the centrosome-associated protein CEP110 in Ligon AH, Lowry S, Morley M, Narasimhan S, Osoegawa K, Peng Z, Plajzer- the 8p12 stem cell myeloproliferative disorder with t(8;9)(p12;q33). Blood Frick I, Quade BJ, Scott D, Sirotkin K, Thorpe AA, Gray JW, Hudson J, 2000;95:1788–96. Pinkel D, Ried T, Rowen L, Shen-Ong GL, Strausberg RL, Birney E, Callen DF, 29 Demiroglu A, Steer EJ, Heath C, Taylor K, Bentley M, Allen SL, Koduru P, Cheng JF, Cox DR, Doggett NA, Carter NP, Eichler EE, Haussler D, Brody JP, Hawson G, Rodwell R, Doody ML, Carnicero F, Reiter A, on September 30, 2021 by guest. Protected copyright. Korenberg JR, Morton CC, Albertson D, Schuler G, de Jong PJ, Trask BJ. Goldman JM, Melo JV, Cross NC. The t(8;22) in chronic myeloid leukemia Integration of cytogenetic landmarks into the draft sequence of the human fuses BCR to FGFR1: transforming activity and specific inhibition of FGFR1 genome. Nature 2001;409:953–8. fusion proteins. Blood 2001;98:3778–83.