Hypogonadotropic Hypogonadism and Cleft Lip and Palate Caused by A

Total Page:16

File Type:pdf, Size:1020Kb

Load more

666 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1 HG Kim, S R Herrick, E Lemyre, S Kishikawa, J A Salisz, S Seminara, M E MacDonald, G A P Bruns, C C Morton, B J Quade, J F Gusella ............................................................................................................................... J Med Genet 2005;42:666–672. doi: 10.1136/jmg.2004.026989 e have established the Developmental Genome Anatomy Project (DGAP; //dgap.harvard.edu) to Key points Wtake advantage of the unique opportunity to locate genes of developmental importance provided by apparently N Kallmann’s syndrome (KS), characterised by hypogo- balanced chromosomal rearrangements associated with nadotropic hypogonadism and anosmia, can be phenotypic abnormalities. By positional cloning at or near caused by inactivating mutations of the X linked KAL1 the breakpoints, we aim to identify the crucial disease genes gene, but these mutations account for less than 15% of 1 whose functions have been disrupted by rearrangement. KS patients. The remaining cases, as well as cases of Kallmann’s syndrome (KS) is a developmental disorder hypogonadotropic hypogonadism without anosmia, characterised by anosmia resulting from agenesis of the are believed to be caused by mutations at two or olfactory lobes and hypogonadism secondary to deficiency of more autosomal loci, including a segment of 8p hypothalamic gonadotropin releasing hormone (GnRH). Its heterozygous for a microdeletion in one KS patient. prevalence has been estimated at 1/10 000 in males and 1/ 50 000 in females. In a minority of cases there are N Recently, mutation in FGFR1, the 8p gene encoding inactivating mutations of KAL1, an X linked gene encoding fibroblast growth factor receptor 1, has been shown to a putative adhesion molecule thought to mediate embryonic cause autosomal dominant KS. We report positional neuronal migration.23Constitutional autosomal chromosome cloning of the genomic breakpoints of the balanced translocations associated with KS have been reported, but the reciprocal translocation t(7;8)(p12.3;p11.2) from a disrupted genes have not been identified.4–6 male patient with hypogonadotropic hypogonadism We have studied a white male subject with a de novo and cleft lip and palate. The translocation disrupts balanced translocation between chromosomes 7, in band FGFR1 (MIM 136350) between exons 2 and 3 and p12.3, and 8, in band p11.2 (fig 1A), who was diagnosed on predicts a novel fusion gene product. http://jmg.bmj.com/ clinical examination to have hypogonadotropic hypogonad- N Although various FGFR1 translocations producing ism (infantile testes), azoospermia, and cleft lip and palate, fusion proteins have been reported as causes of without frank anosmia. As a KS patient with a microdeletion myeloproliferative disorders, this is the first case in involving the same 8p11.2 region had been reported, we which a constitutional FGFR1 translocation is asso- sought to identify the chromosome 8 gene disrupted in this ciated with a developmental disorder. reciprocal translocation as a likely candidate for the cause of autosomal KS as well as of isolated hypogonadotropic hypogonadism.7 While this breakpoint in FGFR1 was being on September 30, 2021 by guest. Protected copyright. characterised, Dode´ et al identified FGFR1 mutations in of anosmia. He was prescribed a regimen of testosterone several patients, establishing that disruption of FGFR1 can injections, which successfully induced secondary sexual cause autosomal dominant KS.8 characteristics. At the age of 31, he was seen by a different physician for azoospermia and infertility, and cytogenetic METHODS analysis was ordered for the possibility of Klinefelter’s This study was approved by the Institutional Review Board of syndrome. The analysis revealed an apparently balanced Partners Healthcare Inc, encompassing both the chromosomal translocation with the karyotype, Massachusetts General Hospital and the Brigham and 46,XY,t(7;8)(p12.3;p11.2). Informed consent for the genera- Women’s Hospital. tion of a lymphoblastoid cell line was obtained in accordance with institutional policies.9 Case report The subject is a white man who was aged 24 years at the time Fluorescent in situ hybridisation analysis of initial diagnosis. He had a history of cleft palate, corrected Breakpoint mapping on chromosome 8 was initiated using by surgery. He had no outstanding medical problems other clones placed on the cytogenetic map by fluorescent in situ than delayed sexual development and a feminine sounding hybridisation (FISH) analysis and on the sequence map by voice. He had his growth spurt at age 18–19 years, developed sequence tagged sites.10 Metaphase chromosomes from the sparse armpit hair at age 20, and penile hair at 16–17, but no patient cell line were prepared for analysis by GTG banding or penile or testicular enlargement. He displayed child-like FISH using standard protocols. Briefly, clones for FISH were facial hair, sparse axillary adult appearing hair, and prepubertal chest hair. Based on the presence of cleft palate Abbreviations: FGF, fibroblast growth factor; FISH, fluorescent in situ and hypogonadism, a tentative diagnosis of Kallmann’s hybridisation; KS, Kallmann’s syndrome; SSCP, single strand syndrome was reached, though the subject did not complain conformation polymorphism; UCSC, University of California Santa Cruz www.jmedgenet.com Letter to JMG 667 J Med Genet: first published as 10.1136/jmg.2004.026989 on 1 August 2005. Downloaded from Figure 1 Fluorescent in situ hybridisation (FISH) mapping of the chromosome 8 breakpoint. (A) Ideogram illustrating the balanced t(7;8)(p12.3;p11.2) in the patient. (B) FISH mapping with RP11-100B16, labelled with SpectrumOrange, resulted in hybridisation to the normal chromosome 8, and the der(8) and der(7) derivative chromosomes. The insets present the derivative chromosomes at higher magnification. selected using genome maps provided by the National Center 59GCAAGCTGTGCTGGAAGCA39;59CCAGCTTCACAGGTG for Biotechnology Information and the University of TTTTC39+59CCAGCATTTGAAGAGGGAGT39. California Santa Cruz (UCSC) Genomics Bioinformatics Group.10 11 Bacterial artificial chromosome (BAC) clones were Fusion transcript amplification obtained from CITB-D and RP11 libraries (Invitrogen, San Total RNA was isolated from patient and control lympho- Diego, California, and the Children’s Hospital of Oakland blastoid cell lines with the RNeasy Mini Kit (Qiagen, Research Institute) and directly labelled with Valencia, California, USA). Reverse transcription of total SpectrumOrange or Green-dUTP (Vysis) by nick translation. RNA (1 mg) was undertaken by using either random Hybridisations were carried out according to manufacturers’ hexanucleotide priming and Superscript II (Gibco BRL, protocols. Metaphase chromosomes were counterstained Gaithersburg, Maryland, USA) or the SMART–PCR cDNA with 4,6-diamino-2-phenylindole-dihydrochloride (DAPI), synthesis kit (Clontech, Palo Alto, California, USA) according and at least 10 metaphases were analysed using a Zeiss to the protocols provided. In each experiment, DNA Axioskop microscope. Images were captured with the contamination was excluded by the absence of a PCR product CytoVision system (Applied Imaging, San Jose´, California, in the sample without reverse transcriptase, amplified under USA). The karyotype, 46,XY,t(7;8)(p12.3;p11.2), was recon- the same conditions as the reverse transcribed RNA sample. firmed by GTG banding before breakpoint mapping by FISH. Nested PCR was carried out using Pfu polymerase (Gibco BRL) with the following primer sets, annealing at 56˚C for 30 http://jmg.bmj.com/ seconds with an extension for one minute 40 seconds: Mapping and cloning of breakpoints TENS1-FGFR1:59CTGAGAAAGCCCTCAGTGTCC39+59CAAG Southern blot analysis of patient lymphoblast genomic DNA ATCTGGACATAAGGCAGG39,59GGCAGAGCAGCTACTCC with probes D011-A, D011-B, and D011-C to search for ACA39+59GTCACTGTACACCTTACACATGAACTC39; FGFR1- altered restriction fragments was carried out using standard TENS1:59CCTCTTGCGGCCACAGGC39+59CCTTCAACATGGC protocols. For each lane, 10 mg of genomic DNA from the GATGG39,59GCAGCGCGCGGAG39+59CCTTGTACCAGAACTT patient and control were digested with an appropriate GGAAGTG39. restriction enzyme. Fragments were separated on a 1.0% on September 30, 2021 by guest. Protected copyright. agarose gel and transferred to Hybond-N membrane Mutation analysis (Amersham, Arlington Heights, Illinois, USA). Filters were Mutation analysis of the second allele of FGFR1 was done by ultraviolet cross linked, baked at 80˚C, and hybridised with single strand conformation polymorphism (SSCP). In all, 24 32 probes labelled with P-dCTP by random priming. genomic fragments including the entire coding region, UTR, Hybridisation of labelled fragments was done in the presence and intron–exon boundaries were amplified from 18 exons of of excess herring sperm competitor DNA, and hybridised FGFR1 by PCR with [32P]-dCTP. Primers were designed to membranes were washed at 60˚C with 0.15 M NaCl/0.015 M amplify genomic fragments with the size of 200 to 300 base sodium citrate/0.1 % sodium dodecyl sulphate (SDS) for 30 pairs (bp) (primer sequences and amplification conditions minutes. Autoradiography took place for 16 hours at –70˚C are available on request). PCR products were applied on non- using two intensifying
Recommended publications
  • Frequent Multiplication of the Long Arm of Chromosome 8 in Hepatocellular Carcinoma1

    Frequent Multiplication of the Long Arm of Chromosome 8 in Hepatocellular Carcinoma1

    [CANCER RESEARCH 53. 857-860. February 15. 1993] Frequent Multiplication of the Long Arm of Chromosome 8 in Hepatocellular Carcinoma1 Yoshiyuki Fujiwara, Monto Monden, Takesada Mori, Yusuke Nakamura,2 and Mitsuru Emi Department of Biochemistry ¡Y.F., Y. N.. M. E.l. Cancer Institute. 1-37-1 Kaini-lkebukuro. Tiishinia-ku. Tokyo 170. and the Second Department of Surgen' ¡Y.F.. M. M., T. M.], Osaka University MédiraiSellimi. 1-1-50 Fukushima. Fukushima, Osaka 53}, Japan ABSTRACT normal and tumor DNAs enabled visualization of subtle changes that had occurred in tumor DNAs. Frequent allelic losses at loci on several chromosomes have been de We initiated a systematic RFLP analysis of paired DNAs from tected in human hepatocellular carcinomas, but other types of chromo HCCs and their corresponding normal tissues to examine whether somal abnormalities have not been characterized well. Using eight poly multiplication of chromosomal segments may take place during de morphic DNA markers on chromosome 8, we examined 120 primary hepatocellular carcinomas for abnormalities in the copy number of these velopment of HCC. In this paper, we present results of RFLP analysis loci in tumor cells. A 2- to 6-fold increase in intensities of bands repre at loci on chromosome 8, and we demonstrate that multiplication of senting single alíeleswas observed in 32 of the 78 tumors that were single alíeleson part or all of the long arm of chromosome 8 has informative for one or more of the markers, indicating an increase in copy occurred in a large proportion of HCCs. number ("multiplication") of alíeleson8q.
  • A Study on Acute Myeloid Leukemias with Trisomy 8, 11, Or 13, Monosomy 7, Or Deletion 5Q

    A Study on Acute Myeloid Leukemias with Trisomy 8, 11, Or 13, Monosomy 7, Or Deletion 5Q

    Leukemia (2005) 19, 1224–1228 & 2005 Nature Publishing Group All rights reserved 0887-6924/05 $30.00 www.nature.com/leu Genomic gains and losses influence expression levels of genes located within the affected regions: a study on acute myeloid leukemias with trisomy 8, 11, or 13, monosomy 7, or deletion 5q C Schoch1, A Kohlmann1, M Dugas1, W Kern1, W Hiddemann1, S Schnittger1 and T Haferlach1 1Laboratory for Leukemia Diagnostics, Department of Internal Medicine III, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich, Germany We performed microarray analyses in AML with trisomies 8 aim of this study to investigate whether gains and losses on the (n ¼ 12), 11 (n ¼ 7), 13 (n ¼ 7), monosomy 7 (n ¼ 9), and deletion genomic level translate into altered genes expression also in 5q (n ¼ 7) as sole changes to investigate whether genomic gains and losses translate into altered expression levels of other areas of the genome in AML. genes located in the affected chromosomal regions. Controls were 104 AML with normal karyotype. In subgroups with trisomy, the median expression of genes located on gained Materials and methods chromosomes was higher, while in AML with monosomy 7 and deletion 5q the median expression of genes located in deleted Samples regions was lower. The 50 most differentially expressed genes, as compared to all other subtypes, were equally distributed Bone marrow samples of AML patients at diagnosis were over the genome in AML subgroups with trisomies. In contrast, 30 and 86% of the most differentially expressed genes analyzed: 12 cases with trisomy 8 (AML-TRI8), seven with characteristic for AML with 5q deletion and monosomy 7 are trisomy 11 (AML-TRI11), seven with trisomy 13 (AML-TRI13), located on chromosomes 5 or 7.
  • 8 Translocation in Burkitt Lymphoma Interrupts the VK Locus (Gene Localization/Immunoglobulin Genes/Genetics of B-Cell Neoplasia/In Situ Hybridization) BEVERLY S

    8 Translocation in Burkitt Lymphoma Interrupts the VK Locus (Gene Localization/Immunoglobulin Genes/Genetics of B-Cell Neoplasia/In Situ Hybridization) BEVERLY S

    Proc. Natl. Acad. Sci. USA Vol. 81, pp. 2444-2446, April 1984 Genetics The 2p breakpoint of a 2;8 translocation in Burkitt lymphoma interrupts the VK locus (gene localization/immunoglobulin genes/genetics of B-cell neoplasia/in situ hybridization) BEVERLY S. EMANUEL*, JULES R. SELDENt, R. S. K. CHAGANTIt, SURESH JHANWARt, PETER C. NOWELL, AND CARLO M. CROCEt§ *Departments of Pediatrics and of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, and tThe Wistar Institute of Anatomy and Biology, 36th Street at Spruce, Philadelphia, PA 19104; and MLaboratory of Cancer Genetics and Cytogenetics, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021 Contributed by Peter C. Nowell, January 3, 1984 ABSTRACT The majority of chromosomal rearrange- have demonstrated translocation from 8q24 to 14q32 and ments observed in Burkitt lymphomas involve a translocation deregulation of transcription of the c-myc oncogene (18, 20). between 8q and 14q, while the remaining minority carry vari- Close proximity between immunoglobulin heavy chain and ant translocations between chromosome 8 and either 2 or 22. c-myc DNA sequences on the 14q+ chromosome are a result We have studied the JI Burkitt lymphoma cell line carrying of the translocation (15-18, 20). In Burkitt lines with the 8;22 the variant 2;8 chromosome translocation using a combination rearrangement, there is evidence for translocation of X se- of high-resolution and molecular cytogenetic techniques. We quences to the 8q+ chromosome (9, 10), resulting in tran- have determined that the chromosome 2 breakpoint of the 2;8 scriptional activation of the c-myc that remains on the in- translocation in these cells is in the distal portion of 2pll.2.
  • The Cytogenetics of Hematologic Neoplasms 1 5

    The Cytogenetics of Hematologic Neoplasms 1 5

    The Cytogenetics of Hematologic Neoplasms 1 5 Aurelia Meloni-Ehrig that errors during cell division were the basis for neoplastic Introduction growth was most likely the determining factor that inspired early researchers to take a better look at the genetics of the The knowledge that cancer is a malignant form of uncon- cell itself. Thus, the need to have cell preparations good trolled growth has existed for over a century. Several biologi- enough to be able to understand the mechanism of cell cal, chemical, and physical agents have been implicated in division became of critical importance. cancer causation. However, the mechanisms responsible for About 50 years after Boveri’s chromosome theory, the this uninhibited proliferation, following the initial insult(s), fi rst manuscripts on the chromosome makeup in normal are still object of intense investigation. human cells and in genetic disorders started to appear, fol- The fi rst documented studies of cancer were performed lowed by those describing chromosome changes in neoplas- over a century ago on domestic animals. At that time, the tic cells. A milestone of this investigation occurred in 1960 lack of both theoretical and technological knowledge with the publication of the fi rst article by Nowell and impaired the formulations of conclusions about cancer, other Hungerford on the association of chronic myelogenous leu- than the visible presence of new growth, thus the term neo- kemia with a small size chromosome, known today as the plasm (from the Greek neo = new and plasma = growth). In Philadelphia (Ph) chromosome, to honor the city where it the early 1900s, the fundamental role of chromosomes in was discovered (see also Chap.
  • Rapid Molecular Assays to Study Human Centromere Genomics

    Rapid Molecular Assays to Study Human Centromere Genomics

    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Method Rapid molecular assays to study human centromere genomics Rafael Contreras-Galindo,1 Sabrina Fischer,1,2 Anjan K. Saha,1,3,4 John D. Lundy,1 Patrick W. Cervantes,1 Mohamad Mourad,1 Claire Wang,1 Brian Qian,1 Manhong Dai,5 Fan Meng,5,6 Arul Chinnaiyan,7,8 Gilbert S. Omenn,1,9,10 Mark H. Kaplan,1 and David M. Markovitz1,4,11,12 1Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan 48109, USA; 2Laboratory of Molecular Virology, Centro de Investigaciones Nucleares, Facultad de Ciencias, Universidad de la República, Montevideo, Uruguay 11400; 3Medical Scientist Training Program, University of Michigan, Ann Arbor, Michigan 48109, USA; 4Program in Cancer Biology, University of Michigan, Ann Arbor, Michigan 48109, USA; 5Molecular and Behavioral Neuroscience Institute, University of Michigan, Ann Arbor, Michigan 48109, USA; 6Department of Psychiatry, University of Michigan, Ann Arbor, Michigan 48109, USA; 7Michigan Center for Translational Pathology and Comprehensive Cancer Center, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA; 8Howard Hughes Medical Institute, Chevy Chase, Maryland 20815, USA; 9Department of Human Genetics, 10Departments of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan 48109, USA; 11Program in Immunology, University of Michigan, Ann Arbor, Michigan 48109, USA; 12Program in Cellular and Molecular Biology, University of Michigan, Ann Arbor, Michigan 48109, USA The centromere is the structural unit responsible for the faithful segregation of chromosomes. Although regulation of cen- tromeric function by epigenetic factors has been well-studied, the contributions of the underlying DNA sequences have been much less well defined, and existing methodologies for studying centromere genomics in biology are laborious.
  • Trisomy 8 Mosaicism

    Trisomy 8 Mosaicism

    Trisomy 8 Mosaicism rarechromo.org Sources Trisomy 8 Mosaicism Trisomy 8 mosaicism (T8M) is a chromosome disorder caused by and the presence of a complete extra chromosome 8 in some cells of References the body. The remaining cells have the usual number of 46 The information in chromosomes, with two copies of chromosome 8 in each cell. this guide is Occasionally T8M is called Warkany syndrome after Dr Josef drawn partly from Warkany, the American paediatrician who first identified the published medical condition and its cause in the 1960s. Full trisomy 8 – where all cells literature. The have an extra copy of chromosome 8 - is believed to be incompatible first-named with survival, so babies and children in whom an extra chromosome author and 8 is found are believed to be always mosaic (Berry 1978; Chandley publication date 1980; Jordan 1998; Karadima 1998). are given to allow you to look for the Genes and chromosomes abstracts or The human body is made up of trillions of cells. Most of the cells original articles contain a set of around 20,000 different genes; this genetic on the internet in information tells the body how to develop, grow and function. Genes PubMed are carried on structures called chromosomes, which carry the (www.ncbi.nlm. genetic material, or DNA, that makes up our genes. nih.gov/pubmed). If you wish, you Chromosomes usually come in pairs: one chromosome from each can obtain most parent. Of these 46 chromosomes, two are a pair of sex articles from chromosomes: XX (a pair of X chromosomes) in females, and XY Unique.
  • Supernumerary Chromosome 8 FTNW

    Supernumerary Chromosome 8 FTNW

    Supernumerary chromosome 8 rarechromo.org Supernumerary chromosome 8 Supernumerary chromosome 8 means that there is a tiny extra part of a chromosome in all or some of the cells of the body. In addition to the 46 chromosomes that everyone has, people with a supernumerary chromosome 8 have a small extra chromosome made from chromosome 8 material. The small extra chromosome can have different possible shapes. It can also have different names. The most common names are: small supernumerary marker chromosome (sSMC ) supernumerary ring chromosome (SRC ), if it’s in the form of a ring Other names you might find in the medical literature include: small accessory chromosome (SAC ) extra structurally abnormal chromosome (ESAC ). Genes and chromosomes Our bodies are made up of billions of cells. Most of the cells contain a complete set of tens of thousands of genes which act like a set of instructions, controlling our growth and development and how our bodies work. Genes are carried on microscopically small, thread-like structures called chromosomes. There are usually 46 chromosomes, 23 inherited from our mother and 23 inherited from our father, so we have two sets of 23 chromosomes in ‘pairs’. Apart from two sex chromosomes (two Xs for a girl and an X and a Y for a boy) the chromosomes are numbered 1 to 22, generally from largest to smallest. Sources & references The information in this leaflet is drawn partly from published medical research where there are reports of around 40 cases. The first-named author and publication date are given to allow you to look for the abstracts or original articles on the internet in PubMed (at www.ncbi.nlm/ nih.gov/pubmed ).
  • Gene Mapping and Medical Genetics Human Chromosome 8

    Gene Mapping and Medical Genetics Human Chromosome 8

    J Med Genet: first published as 10.1136/jmg.25.11.721 on 1 November 1988. Downloaded from Gene mapping and medical genetics Journal of Medical Genetics 1988, 25, 721-731 Human chromosome 8 STEPHEN WOOD From the Department of Medical Genetics, University of British Columbia, 6174 University Boulevard, Vancouver, British Columbia, Canada V6T IWS. SUMMARY The role of human chromosome 8 in genetic disease together with the current status of the genetic linkage map for this chromosome is reviewed. Both hereditary genetic disease attributed to mutant alleles at gene loci on chromosome 8 and neoplastic disease owing to somatic mutation, particularly chromosomal translocations, are discussed. Human chromosome 8 is perhaps best known for its In an era when complete sequencing of the human involvement in Burkitt's lymphoma and as the genome is being proposed, it is appropriate for location of the tissue plasminogen activator gene, medical geneticists to accept the challenge of defining by copyright. PLAT, which has been genetically engineered to the set of loci that have mutant alleles causing provide a natural fibrinolytic product for emergency hereditary disease. The fundamental genetic tool of use in cardiac disease. Since chromosome 8 repre- linkage mapping can now be applied, owing largely sents about 5% of the human genome, we may to progress in defining RFLP markers.3 4 This expect it to carry about 5% of human gene loci. This review will focus on genetic disease associated with would correspond to about 90 of the fully validated chromosome 8 loci and the status ofthe chromosome 8 phenotypes in the MIM7 catalogue.' The 27 genes linkage map.
  • 8P23 Duplication Syndrome

    8P23 Duplication Syndrome

    8p23 duplication syndrome rarechromo.org 8p23.1 duplication syndrome An 8p23.1 duplication is a very rare genetic condition in which there is a tiny extra piece from one of the 46 chromosomes – chromosome 8. Chromosomes are made up mostly of DNA and are the structures in the nucleus of the body’s cells that carry genetic information (known as genes), telling the body how to develop, grow and function. Chromosomes usually come in pairs: one chromosome from each parent. Of these 46 chromosomes, two are a pair of sex chromosomes: XX (a pair of X chromosomes) in females and XY (one X chromosome and one Y chromosome) in males. The remaining 44 chromosomes are grouped in 22 pairs, numbered 1 to 22 approximately from the largest to the smallest. Each chromosome has a short (p) arm (shown on the left in the diagram below) and a long (q) arm (on the right). Generally speaking, for correct development the right amount of genetic material is needed – not too little and not too much. However, a child’s other genes and personality also help to determine future development, needs and achievements. Looking at chromosome 8p23.1 You can’t see chromosomes with the naked eye, but if you stain them and magnify them under a microscope, you can see that each one has a distinctive pattern of light and dark bands (see diagram below). Band 8p23.1 contains around 6.5 million base pairs. This sounds like a lot, but it is actually quite small and is only 0.2 per cent of the DNA in each cell and only four per cent of the DNA on chromosome 8.
  • Human Demography in the Pleistocene: Do Mitochondrial and Nuclear Genes Tell the Same Story?

    Human Demography in the Pleistocene: Do Mitochondrial and Nuclear Genes Tell the Same Story?

    Evolutionary Anthropology 81 Issues Human Demography in the Pleistocene: Do Mitochondrial and Nuclear Genes Tell the Same Story? raditionally, research on mod- genomic region of interest is selec- stable. The expected pattern under ern human origins has centered tively neutral, the amount and pattern selective neutrality and constant popu- Ton questions of the time and of nucleotide variation is expected to lation size10,17 is represented by the geographical place of origin, with less be proportional to the population size,9 hatched bars in Figure 2. The left- attention given to the complex popula- and to track changes in the population shifted distribution of mtDNA poly- tion dynamics of our evolutionary his- over time.10-12 Another simplifying as- morphism is consistent with an ini- tory. Recently, however, a focus has sumption that is often valid for the tially small population that recently emerged within molecular anthropol- nuclear genome (and less so for the has undergone a dramatic increase in ogy that concentrates on the demo- mitochondrial genome) is that muta- size. But, on the other hand, the pat- graphic aspects of the origin of mod- tions are rare at any one base position. tern could have been the result of a 1-3 ern humans. A popular hypothesis For example, a common assumption history dominated by natural selec- proposes that modern human popula- that greatly facilitates the develop- tion on the mitochondria. tions passed through a bottleneck (or ment of mathematical theory is the If the demographic story told on the episodic reduction in size) in the late infinite-sites model whereby muta- basis of the mtDNA variation is accu- Middle or early Late Pleistocene, at tions are assumed to have occurred rate and represents the actual history which time there existed perhaps only only once per polymorphic site.13 of modern humans, then we expect a several thousand breeding individu- One way in which nucleotide varia- similar pattern of variation across most als, and that this was followed by a tion can be described is by the fre- other loci.
  • Human C-Mnc One Gene Is Located on the Region of Chromosome 8

    Human C-Mnc One Gene Is Located on the Region of Chromosome 8

    Proc. Natl. Acad. Sci. USA Vol. 79, pp. 7824-7827, December 1982 Genetics Human c-mnc one gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells (somatic cell hybrids/Southern blotting technique/recombination/cancer) RICCARDO DALLA-FAVERA*, MARCO BREGNI*, JAN ERIKSONt, DAVID PATTERSONf, ROBERT C. GALLO*, AND CARLO M. CROCEt *Laboratory of Tumor Cell Biology, National Cancer Institute, Bethesda, Maryland 20205; tThe Wistar Institute ofAnatomy and Biology, 26th and Spruce Street, Philadelphia, Pennsylvania 19104; and MThe Eleanor Roosevelt Institute for Cancer Research, Departments of Biochemistry, Biophysics, and Genetics and Medicine, University ofColorado Health Science Center, University ofColorado Health Center, Denver, Colorado 80262 Communicated by Hilary Koprowski, September 20, 1982 ABSTRACT Human sequences related to the transforming this hypothesis by studying the location and regulation of gene (v-myc) of avian myelocytomatosis virus (MC29) are repre- expression of the c-myc gene in selected groups of tumors dis- sented by atleast one gene and several related sequences that may playing specificcytogenetic abnormalities. Moreover, the study represent pseudogenes. By using a DNA probe that is specific for of the mechanism of c-myc amplification in human malignant the complete gene (c-myc), different somatic cell hybrids possess- cells may be facilitated by the analysis of the genetic environ- ing varying numbers of human chromosomes were analyzed by ment from which the amplification event supposedly origi- the Southern blotting technique. The results indicate that the hu- nated. In the present study we have mapped the human c-myc man c-myc gene is located on chromosome 8.
  • Aneusomies of Chromosomes 8 and Y Detected by Fluorescence in Situ Hybridization Are Prognostic Markers for Pathological Stage C (Pt3nom O) Prostate Carcinoma I

    Aneusomies of Chromosomes 8 and Y Detected by Fluorescence in Situ Hybridization Are Prognostic Markers for Pathological Stage C (Pt3nom O) Prostate Carcinoma I

    Vol. 2, 137-145, January 1996 Clinical Cancer Research 137 Aneusomies of Chromosomes 8 and Y Detected by Fluorescence in Situ Hybridization Are Prognostic Markers for Pathological Stage C (pT3NoM o) Prostate Carcinoma I Satoru Takahashi, Antonio Alcaraz, (P < 0.001), respectively. These results demonstrate that James A. Brown, Thomas J. Borell, aneuploidy and specific aneusomies detected by FISH are potential markers for a poor prognosis in histological high- John F. Herath, Erik J. Bergstralh, grade pathological stage C (pT3NoMo) prostate carcinoma. Michael M. Lieber, and Robert B. Jenkins 2 Departments of Urology [S. T., A. A., J. A. B., M. M. L.] and INTRODUCTION Laboratory Medicine and Pathology [T. J. B., J. F. H., R. B. J.] and Section of Biostatistics [E. J. B.], Mayo Clinic and Foundation, Prostate adenocarcinoma has extensive variability in clin- Rochester, Minnesota 55905 ical behavior. Accurate prediction of individual tumor progres- sion probability and patient survival is a major goal of current prostate cancer research. Parameters such as clinical and patho- ABSTRACT logical stage, histological grade, and pretreatment serum PSA 3 In an attempt to identify new prognostic markers, we are conventionally used to help predict the prognosis for indi- performed fluorescence in situ hybridization (FISH) ploidy vidual patients with clinically localized prostate carcinoma (1). analysis of tumor tissue from patients with a targeted stage Newer factors, such as DNA content ploidy analysis using FCM and histological grade of prostate carcinoma. We identified or static image analysis, can help refine prognostic risks (2). all 227 patients from the Mayo Clinic radical prostatectomy However, it is recognized that FCM or static image ploidy data base who had a high histological grade pathological analysis cannot detect small changes in DNA content or chro- stage C (PT3NoM o) tumor removed between 1966 and 1987.