DOCSLIB.ORG

Attempted Molecular Detection of the Thermally Dimorphic Human Fungal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Attempted Molecular Detection of the Thermally Dimorphic Human Fungal Medical Mycology, 2018, 56, 510–513 doi: 10.1093/mmy/myx065 Advance Access Publication Date: 9 September 2017 Brief Report Downloaded from https://academic.oup.com/mmy/article-abstract/56/4/510/4108733 by Instituut Voor Tropische Geneeskunde, Bibliotheek user on 22 July 2020 Brief Report Attempted molecular detection of the thermally dimorphic human fungal pathogen Emergomyces africanus in terrestrial small mammals in South Africa Nadine Cronje´ 1,†, Ilan S. Schwartz2,3,∗,†,LiezlRetief4, Armanda D. S. Bastos4, Sonja Matthee5, Wolfgang Preiser1,6, Nigel C. Bennett4, Tsidiso Maphanga7, Nelesh P.Govender7,8, Robert Colebunders2 and Chris Kenyon9,10 1Division of Medical Virology, Department of Pathology, Faculty of Medicine and Health Sciences, Stel- lenbosch University, Cape Town, South Africa, 2Global Health Institute, Faculty of Medicine and Health Sciences, University of Antwerp, Antwerp, Belgium, 3Department of Medical Microbiology and Infectious Diseases, University of Manitoba, Winnipeg, Canada, 4Mammal Research Institute, Department of Zoology & Entomology, University of Pretoria, South Africa, 5Department of Conservation Ecology and Entomology, Faculty of AgriSciences, Stellenbosch University, Stellenbosch, South Africa, 6National Health Laboratory Service Tygerberg, Cape Town, South Africa, 7National Institute for Communicable Diseases, Centre for Healthcare-associated Infections, Antimicrobial Resistance and Mycoses, Johannesburg, South Africa, 8Division of Medical Microbiology, University of Cape Town, Cape Town, 9Department of Medicine, Uni- versity of Cape Town and 10Sexually Transmitted Infection Unit, Institute of Tropical Medicine, Antwerp, Belgium ∗To whom correspondence should be addressed. Ilan S. Schwartz, MD, Department of Medical Microbiology and Infectious Diseases, Room 543 - 745 Bannatyne Avenue, University of Manitoba, Winnipeg, Manitoba R3E 0J9, Canada. E-mail: [email protected] †These authors contributed equally to this work. Received 19 January 2017; Revised 1 June 2017; Accepted 8 August 2017; Editorial Decision 28 June 2017 Abstract The ecological niche of Emergomyces africanus (formerly Emmonsia species),adimor- phic fungus that causes an AIDS-related mycosis in South Africa, is unknown. We hy- pothesized that natural infection with E. africanus occurs in wild small mammals. Using molecular detection with primers specific for E. africanus, we examined 1402 DNA sam- ples from 26 species of mole-rats, rodents, and insectivores trapped in South Africa that included 1324 lung, 37 kidney, and 41 liver specimens. DNA of E. africanus was not detected in any animals. We conclude that natural infection of wild small mammals in South Africa with E. africanus has not been proven. Key words: emmonsiosis, emmonsia, emergomycosis, animal, ecology. 510 C The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: [email protected] Cronjeetal.´ 511 Emergomyces africanus is a recently described thermally di- using a 22-gauge needle. Samples were then centrifuged and morphic fungal pathogen (formerly an Emmonsia species)1 the cell-free supernatant was used as starting material as per responsible for emergomycosis (formerly disseminated em- the manufacturer’s protocol. To extract total nucleic acids, monsiosis), an AIDS-related systemic mycosis with a high the DNase treatment step in the protocol was omitted. case-fatality rate in southern Africa.2,3 A conventional polymerase chain reaction (PCR) Downloaded from https://academic.oup.com/mmy/article-abstract/56/4/510/4108733 by Instituut Voor Tropische Geneeskunde, Bibliotheek user on 22 July 2020 The geographic range of E. africanus is currently being protocol using TrueStart Hot Start DNA Taq poly- defined, but to date human cases have been reported from merase (Thermo Fisher Scientific, Waltham, Massachusetts, six of nine South African provinces (Western Cape, East- USA) was used to screen samples for the pres- ern Cape, Gauteng, Free State, Mpumalanga,3 KwaZulu- ence of E. africanus. Primers, NEF (forward) 5 Natal4) and from the Kingdom of Lesotho.2 CGGGGACACCGTAGAAAACACT 3 and NER (reverse) The ecological niche of E. africanus in southern Africa 5GAGATCCGTTGTTGAAAAGTTTTAACT 3, were de- is unknown, although soil is presumed to be the reservoir.5 signed targeting an 80 bp fragment of the internal tran- The presence of an alternative mammalian host has been scribed spacer (ITS) region of ribosomal RNA specific for E. proposed as a possible explanation for the restricted geo- africanus. Briefly, 20 μl reactions consisted of nuclease-free 6 graphic range of E. africanus. For some other medically im- water, PCR reaction buffer, MgCl2 at a final concentration portant dimorphic fungi with restricted geographic ranges, of 1.25 mM, primers at a final concentration of 0.4 μM particular mammals frequently are naturally infected, and each, dNTPs at 250 μM final concentration each, 1.25 U may serve as sentinel species which help to map out the Taq polymerase with 2 μl template DNA. Thermocycling geographic range.7 For instance, Talaromyces marneffei conditions consisted of 5 minutes at 95 ◦C, followed by (formerly Penicillium marneffei),8 the cause of talaromy- 35 cycles of 94 ◦C for 30 seconds, 55 ◦C for 1 minute, cosis, and Paracoccidioides spp., the causes of paracoccid- and 72 ◦C for 2 minutes, with a final extension time of 7 ioidomycosis, are restricted to southeast Asia and South minutes at 72 ◦C. America, respectively. Both are difficult to detect in the PCR sensitivity was previously assessed on extracted environment, but relatively easy to detect via microscopy, DNA from an E. africanus cultured isolate. The extracted culture and molecular testing of samples from bamboo DNA concentration was determined spectrophotometri- rats (Rhizomys species and Cannomys badious) and ar- cally and following a series of dilutions, the lowest con- madillos (Dasypus novemcinctus and Camasses centralis), centration detected by PCR was 20 pg/ml. respectively.7 Alongside each run, positive controls were used. For test- In this study, we used molecular detection to screen (pre- ing of mole-rats, the positive control was a clinical strain dominantly) the lungs of mole-rats, rodents, and insecti- of E. africanus (provided by NICD, GenBank accession: vores from various regions in South Africa to elucidate the JX398296) cultured on malt extract agar medium at 25 ◦C. ecological niche of E. africanus. Extracted DNA from rodent lung samples spiked with ei- Samples originated from small mammals previously ther the mould or yeast phase of E. africanus prior to ho- trapped for unrelated studies. Mole-rats were trapped mogenization and extraction was used as positive control across natural, semi-natural, and urban sites in the North- material. For the mould phase, clinical isolates were pro- ern and Western Cape provinces. The other rodents and vided by NICD (GenBank: JX398291 and JX398293) and insectivores were sampled from natural and semi-natural for the yeast phase, a clinical isolate was provided by the localities in the Western Cape, Eastern Cape, Free-State, National Health Laboratory Services at Tygerberg General KwaZulu-Natal, Northern Cape, North West, and Gaut- Hospital. eng Province of South Africa. Animal trapping, handling, We tested 1402 animals, including lung, kidney, and and euthanasia were performed with approval from the liver samples from 1324, 37, and 41 animals, respectively. research ethics committees of Stellenbosch University and The animals comprised 26 species (Table 1). For all samples University of Pretoria (see Supplemental Digital Content S1 screened, only positive controls produced the amplicon size for animal ethics approval and permit details). of interest. All other samples were negative by PCR. Nucleic acids had been extracted previously9 from ho- In summary, we screened a wide range of small mammals mogenized pieces of lung, liver, and kidney samples using throughout South Africa for clues to the ecological niche of the RNeasyR Mini kit (Qiagen, Germany) following the E. africanus. We failed to detect E. africanus in the lungs spin protocol on the QIAcubeR automated extraction plat- and other tissues of 26 small mammal species from areas form. Tissue samples were homogenized in lysis buffer (con- where human disease caused by E. africanus infection is taining β-mercaptoethanol) with either the TissueLyser LT endemic. homogeniser (Qiagen, Germany) or by repeatedly passing There are several possible limitations of this study. First, the tissue sample, finely chopped, through a 2-ml syringe the possibility exists that our protocol for processing tissue 512 Medical Mycology, 2018, Vol. 56, No. 4 Ta b l e 1 . Geographic and species distribution of mole-rat, rodent, and insectivore samples screened for Emergomyces africanus infection. Species Common name Province WC NC FS G EC KZN NW Total Downloaded from https://academic.oup.com/mmy/article-abstract/56/4/510/4108733 by Instituut Voor Tropische Geneeskunde, Bibliotheek user on 22 July 2020 Family Batdyergidae Bathyergus suillus Cape dune mole-rat 86 86 Cryptomys hottentotus hottentotus common mole-rat 6 39 45 Fukomys damarensis Damaraland mole-rat 50 50 Georychus capensis Cape mole-rat 53 53 Family Muridae Aethomys sp. rock rats, bush rats 8 8 Aethomys chrysophilus redrockrat 4 4 Gerbillurus paeba hairy-footed gerbil 16 16 Lemniscomys rosalia single-striped grass mouse 1 13 14 Mastomys
Load more

Recommended publications
  • Freshwater Fishes
    WESTERN CAPE PROVINCE state oF BIODIVERSITY 2007 TABLE OF CONTENTS Chapter 1 Introduction 2 Chapter 2 Methods 17 Chapter 3 Freshwater fishes 18 Chapter 4 Amphibians 36 Chapter 5 Reptiles 55 Chapter 6 Mammals 75 Chapter 7 Avifauna 89 Chapter 8 Flora & Vegetation 112 Chapter 9 Land and Protected Areas 139 Chapter 10 Status of River Health 159 Cover page photographs by Andrew Turner (CapeNature), Roger Bills (SAIAB) & Wicus Leeuwner. ISBN 978-0-620-39289-1 SCIENTIFIC SERVICES 2 Western Cape Province State of Biodiversity 2007 CHAPTER 1 INTRODUCTION Andrew Turner [email protected] 1 “We live at a historic moment, a time in which the world’s biological diversity is being rapidly destroyed. The present geological period has more species than any other, yet the current rate of extinction of species is greater now than at any time in the past. Ecosystems and communities are being degraded and destroyed, and species are being driven to extinction. The species that persist are losing genetic variation as the number of individuals in populations shrinks, unique populations and subspecies are destroyed, and remaining populations become increasingly isolated from one another. The cause of this loss of biological diversity at all levels is the range of human activity that alters and destroys natural habitats to suit human needs.” (Primack, 2002). CapeNature launched its State of Biodiversity Programme (SoBP) to assess and monitor the state of biodiversity in the Western Cape in 1999. This programme delivered its first report in 2002 and these reports are updated every five years. The current report (2007) reports on the changes to the state of vertebrate biodiversity and land under conservation usage.
    [Show full text]
  • Terrestrial Biodiversity Compliance Report for The
    TERRESTRIAL BIODIVERSITY COMPLIANCE REPORT FOR THE PROPOSED DE AAR 2 SOUTH WEF ON-SITE SUBSTATION, BATTERY ENERGY STORAGE SYSTEM (BESS) AND ANCILLARY INFRASTRUCTURE, NEAR DE AAR IN THE NORTHERN CAPE PROVINCE. For Mulilo De Aar 2 South (Pty) Ltd July 2020 Prepared By: Arcus Consultancy Services South Africa (Pty) Limited Office 607 Cube Workspace Icon Building Cnr Long Street and Hans Strijdom Avenue Cape Town 8001 T +27 (0) 21 412 1529 l E [email protected] W www.arcusconsulting.co.za Registered in South Africa No. 2015/416206/07 Terrestrial Biodiversity Compliance Report De Aar 2 South WEF Substation TABLE OF CONTENTS 1 INTRODUCTION ........................................................................................................ 3 1.1 Background .................................................................................................... 3 1.2 Scope of Study ................................................................................................ 3 1.3 Assumptions and Limitations ......................................................................... 4 2 METHODOLOGY ......................................................................................................... 4 2.1 Desk-top Study ............................................................................................... 4 2.2 Site Visit ......................................................................................................... 5 3 RESULTS AND DESCRIPTION OF THE AFFECTED ENVIRONMENT ............................ 5 3.1 Vegetation
    [Show full text]
  • Flora and Fauna Specialist Assessment Report for the Proposed De Aar 2 South Grid Connection Near De Aar, Northern Cape Province
    FLORA AND FAUNA SPECIALIST ASSESSMENT REPORT FOR THE PROPOSED DE AAR 2 SOUTH GRID CONNECTION NEAR DE AAR, NORTHERN CAPE PROVINCE On behalf of Mulilo De Aar 2 South (Pty) Ltd December 2020 Prepared By: Arcus Consultancy Services South Africa (Pty) Limited Office 607 Cube Workspace Icon Building Cnr Long Street and Hans Strijdom Avenue Cape Town 8001 T +27 (0) 21 412 1529 l E [email protected] W www.arcusconsulting.co.za Registered in South Africa No. 2015/416206/07 Flora & Fauna Impact Assessment Report De Aar 2 South Transmission Line and Switching Station TABLE OF CONTENTS 1 INTRODUCTION ........................................................................................................ 4 1.1 Background .................................................................................................... 4 1.2 Assessment Philosophy .................................................................................. 4 1.3 Scope of Study ................................................................................................ 5 1.4 Assumptions and Limitations ......................................................................... 5 2 METHODOLOGY ......................................................................................................... 5 3 RESULTS .................................................................................................................... 5 3.1 Vegetation ...................................................................................................... 6 3.1.1 Northern Upper
    [Show full text]
  • JJ De Klerk Thesis UFS
    Investigating Small Mammal community structure as a possible indicator of improved habitat integrity in an area cleared of alien vegetation. by Jean J. de Klerk (2011144413) Mini-dissertation (MOB791) submitted in the partial fulfillment of the requirements for the degree MAGISTER IN ENVIRONMENTAL MANAGEMENT In the faculty of Natural and Agricultural Sciences Centre for Environmental Management University of the Free State Bloemfontein January 2014 ABSTRACT Small mammal communities have been identified as possible indicators of the ecological integrity of different areas. Small mammal species are adapted to micro habitats and therefore can be affected by small-scale changes, which can be monitored to assist in biodiversity studies. Alien vegetation eradication programs have been ongoing across many areas of South Africa. These eradicated areas are believed to be able to restore to the original condition and therefore improving the biodiversity of the area. However, many ways of assessing ecological integrity are time consuming and expensive. By assessing the small mammal diversity and community structure in eradicated areas, judgments could be made about the success of implemented eradication programs. As small mammal surveys can be done readily, the ability to use them as indicators allows them to be implemented in all eradicated areas to indicate conditions of area over various time periods and can be utilized on a continual basis. This study investigates to which extent small mammal community structure (including the specific species present and the species richness) could indicate improved habitat integrity in areas cleared of alien vegetation. Small mammal communities in three areas, (i) area infested with Black Wattle (Acacia mearnsii), (ii) area cleared of Black Wattle and (iii) a control area which have no records of alien vegetation, were assessed.
    [Show full text]
  • 19. Animal Species.Pdf
    TERRESTRIAL ANIMAL SPECIES SPECIALIST ASSESSMENT FOR THE PROPOSED MULILO TOTAL HYDRA STORAGE PROJECT: GRID CONNECTION NEAR DE AAR, NORTHERN CAPE PROVINCE For Mulilo Total Hydra Storage (Pty) Ltd February 2021 Prepared By: Arcus Consultancy Services South Africa (Pty) Limited Office 607 Cube Workspace Icon Building Cnr Long Street and Hans Strijdom Avenue Cape Town 8001 T +27 (0) 21 412 1529 l E [email protected] W www.arcusconsulting.co.za Registered in South Africa No. 2015/416206/07 Terrestrial Animal Species Specialist Assessment Mulilo Total Hydra Storage Project: Grid Interconnection TABLE OF CONTENTS 1 SPECIALIST DETAILS ................................................................................................ 3 2 STATEMENT OF INDEPENDENCE ............................................................................... 3 3 INTRODUCTION ........................................................................................................ 3 3.1 Background .................................................................................................... 3 3.2 Scope of Study ................................................................................................ 5 3.3 Assumptions and Limitations ......................................................................... 5 3.4 Legislative Context ......................................................................................... 6 4 METHODOLOGY ......................................................................................................... 6 4.1
    [Show full text]
  • Appendix C1: Ecological Impact Assessment
    APPENDIX C1: ECOLOGICAL IMPACT ASSESSMENT Ecological Assessment Vredenburg Windfarm (PTY) Ltd ECOLOGICAL IMPACT ASSESSMENT Prepared for: Vredenburg Windfarm (Pty) Ltd 18 Cavendish Street Claremont, Cape Town, 7708 South Africa Prepared by: CES Cape Town Suite 408, 4th Floor, The Point, 76 Regent Road Sea Point Cape Town 8000 South Africa www.cesnet.co.za January 2020 Ecological Impact Assessment Report REVISIONS TRACKING TABLE CES Report Revision and Tracking Schedule Document Title: Ecological Assessment for the Vredenburg Windfarm Powerline Client Name & Vredenburg Windfarm (Pty) Ltd, 18 Cavendish Street, Address: Claremont, Cape Town, 7708, South Africa Status: Final Issue Date: January 2020 Lead Author: Ms Tarryn Martin CES Reviewer: Dr Greer Hawley (Internal) CES Ms Leigh-Ann De Wett (External) Independent Specialist Study Leader/ Registered Dr Ted Avis CES Environmental Assessment Practitioner – Approval: No. of hard No. electronic Report Distribution Circulated to copies copies DEFF 2 1 DEADP 0 1 Report Version: Final Date Draft May 2020 Final January 2020 This document has been prepared in accordance with the scope of CES’s appointment and contains intellectual property and proprietary information that is protected by copyright in favour of CES. The document may therefore not be reproduced, used or distributed to any third party without the prior written consent of CES. This document is prepared exclusively for use by CES’s client. CES accepts no liability for any use of this document other than by its client and only for the purposes for which it was prepared. No person other than the client may copy (in whole or in part) use or [email protected] rely on the contents of this document, without the prior written www.cesnet.co.za permission of CES.
    [Show full text]
  • A Revised Systematic Checklist of the Extant Mammals in the SA
    DURBAN MUS. NOVIT. 28 SYSTEMATIC CHECKLIST OF SOUTHERN AFRICAN MAMMALS 56 A revised systematic checklist of the extant mammals of the southern African subregion BRONNER, G.N.12, HOFFMANN, M. , TAYLOR, P.J.34, CHIMIMBA, C.T. , BEST, P.B.45, MATTHEE, C.A. & ROBINSON, T.J.5 1Small Mammal Research Unit, Department of Zoology, University of Cape Town, P/Bag Rondebosch 7701, South Africa E-mail: [email protected] 2Centre for Applied Biodiversity Science, Conservation International, 1919 M St NW, Suite 600, Washington DC 20036, USA 3Durban Natural Science Museum, P.O. Box 4085, Durban 4000, South Africa 4Mammal Research Institute, Department of Zoology & Entomology, University of Pretoria, Pretoria 0002, South Africa 5Department of Zoology, Stellenbosch University, Private Bag X1, Stellenbosch 7602, South Africa Article available at: www.durban.gov.za/naturalscience/ Summary Bronner, G.N., Hoffmann, M., Taylor, P.J., Chimimba, C.T., Best, P.B., Matthee, C.A. & Robinson, T.J. 2003. A revised systematic checklist of the extant mammals of the southern African subregion. Durban Museum Novitates 28: 56-106. The current paper presents a revised, annotated, systematic checklist of 351 extant mammal species, in 190 genera, currently known to occur in southern Africa (south of the Zambezi and Cunene Rivers) and its coastal waters. The checklist includes each species' scientific and English common name, details concerning original description, occurrence or possible occurrence in each of the seven countries falling within the Subregion, and, where relevant, the IUCN global Category of Threat. Taxonomic notes, together with the relevant literature, are provided to justify the proposed classification adopted at each hierarchical level.
    [Show full text]
  • Impact Assessment (EIA) Regulations (As Amended), for Decision- Making in Terms of Regulation 20 of the 2014 NEMA EIA Regulations
    Basic Assessment for the Proposed Construction of Electrical Grid Infrastructure to support the Sutherland 2 Wind Energy Facility (WEF), Northern and Western Cape Provinces (Sutherland 2 WEF – Electrical Grid Infrastructure): BASIC ASSESSMENT REPORT Basic Assessment Process Basic Assessment for the Proposed Construction of Electrical Grid Infrastructure to support the Sutherland 2 Wind Energy Facility (WEF), Northern and Western Cape Provinces (Sutherland 2 WEF – Electrical Grid Infrastructure) BASIC ASSESSMENT REPORT CSIR Report Number: CSIR/IU/021SE/ER/2017/0011/B August 2017 Prepared for: South Africa Mainstream Renewable Power Developments (Pty) Ltd Prepared by: CSIR P. O. Box 17001, Congella, Durban, 4013, South Africa PO Box 320, Stellenbosch, 7599, South Africa Tel: +27 31 242 2300 and +27 21 888 2400 Fax: +27 31 261 2509 and +27 21 888 2693 Lead Authors: Paul Lochner, Surina Laurie, Rohaida Abed and Andile Dludla Mapping: Surina Laurie (CSIR) © CSIR 2017. All rights to the intellectual property and/or contents of this document remain vested in the CSIR. This document is issued for the sole purpose for which it is supplied. No part of this publication may be reproduced, stored in a retrieval system or transmitted, in any form or by means electronic, mechanical, photocopying, recording or otherwise without the express written permission of the CSIR. It may also not be lent, resold, hired out or otherwise disposed of by way of trade in any form of binding or cover than that in which it is published. Basic Assessment for the Proposed
    [Show full text]
  • Introduced Black Rhinoceros Population on the Great Fish River Reserve, Eastern
    THE DEMOGRAPHY AND POPULAnON DYNAMICS OF A RE- INTRODUCED BLACK RHINOCEROS POPULATION ON THE GREAT FISH RIVER RESERVE, EASTERN CAPE PROVINCE A thesis submitted in fulfillment of the requirements for the degree of MASTER OF SCIENCE of RHODES UNIVERSITY by Bradley Fike January 2011 ABSTRACT The re-introduction of black rhinoceros onto the Great Fish River Reserve in the Eastern Cape, following the species absence for over a century, created an opportunity to study this species in the thicket biome, and in particular the succulent thicket of the Great Fish River valley. The thicket biome is quite different from the habitats in which other extant populations of these animals are found and where studies of their demography have been undertaken. Data collection occurred from May 1986, with the arrival of the first four animals to December 2008, when the population was estimated to be 144 individuals. A variety of monitoring techniques were used including direct ground observations, aerial helicopter census, aerial monitoring by microlight aircraft, camera traps and opportunistic observations, each with its own advantages and disadvantages. The combination of methods and effort has resulted in the population being recognized as completely known with up to 97% of the animals being located at least once per year with a mean frequency of sightings of 11.5 per animal per year. In 2008, the population was about 20% juvenile, 36% sub-adult and 44% adult with a female biased sex ratio of 1.3 females per male. Mean age at first birth was about 80 months and this increased significantly with increasing density of black rhinoceroses.
    [Show full text]
  • Molecular Characterization of Rodent-And-Shrew-Borne
    MOLECULAR CHARACTERIZATION OF RODENT-AND-SHREW-BORNE VIRUSES AND THE PREVALENCE AND INTENSITY OF INFESTATION OF SMALL MAMMAL FLEAS, IN NAMIBIA A thesis submitted in fulfilment of the requirements for the degree of Master of Science of The University of Namibia By Julia Hoveka 200515527 April 2015 Main Supervisor: Dr. J. K.E. Mfune Co-supervisor: Professor P. M. Chimwamurombe i ABSTRACT Small mammals host diverse communities of both ectoparasites (e.g. fleas and ticks) and endoparasites (e.g. bacteria and viruses). Some parasites are vectors of diseases that infect both humans and wildlife. The main objective of the study was to discover and molecularly characterize novel Hantaviruses and Arenaviruses and to determine the prevalence and intensity of fleas on small mammals in selected areas of Namibia. Small mammals were trapped from six different regions and screened for both Hantavirus and Arenavirus. The regions are, namely, Hardap, Khomas, Kunene, Okavango, Omaheke, and Otjozondjupa. Nucleotide sequence analysis of PCR of the partial large segments of both a Hantavirus and Arenavirus were amplified from RNA extracted from the lungs of small mammal hosts. Hantaviruses were not prevalent in any of the small mammals trapped. However, two new Arenaviruses, not previously recorded in Namibia were both isolated from the Namaqua rock mouse, Micaelamys namaquensis, trapped in Okahandja and Mariental. The Arenavirus isolated from rodents trapped in Okahandja and Mariental respectively, is closely related to the Merino Walk virus isolated from the Bush vlei rat, Myotomys unisulcatus, captured in South Africa and Luna virus discovered in Zambia in the host, the Natal multimammate mouse, Mastomys natalensis.
    [Show full text]
  • Round Or Seasonally. at the Global Level, a Set of Four Categories and Criteria Are Used to Assess the Significance of the Site
    Volume 1: Environmental Scoping Report – Description of the Environment round or seasonally. At the global level, a set of four categories and criteria are used to assess the significance of the site. The global IBA criteria are as follows: A1. Globally threatened species Criterion: The site is known or thought to hold significant numbers of a globally threatened species, or other species of global conservation concern. The site qualifies if it is known, estimated or thought to hold a population of a species categorized by the IUCN Red List as Critically Endangered (CR), Endangered (EN) or Vulnerable (VU). In general, the regular presence of a Critical or Endangered species, irrespective of population size, at a site may be sufficient for a site to qualify as an IBA. For VU species, the presence of more than threshold numbers at a site is necessary to trigger selection. A2. Restricted-range species Criterion: The site is known or thought to hold a significant component of a group of species whose breeding distributions define an Endemic Bird Area (EBA) or Secondary Area (SA). This category is for species of EBAs. EBAs are defined as places where two or more species of restricted range, i.e. with world distributions of less than 50 000 km2, occur together. More than 70% of such species are also globally threatened. Also included here are species of SAs. A3. Biome-restricted species Criterion: The site is known or thought to hold a significant component of the group of species whose distributions are largely or wholly confined to one biome.
    [Show full text]
  • 1 Attempted Molecular Detection of the Thermally Dimorphic Human Fungal
    Attempted molecular detection of the thermally dimorphic human fungal pathogen Emergomyces africanus in terrestrial small mammals in South Africa Short title: Emergomyces africanus in small mammals Nadine Cronjé*1, Ilan S. Schwartz*2,3, Liezl Retief4, Armanda D.S. Bastos4, Sonja Matthee5, Wolfgang Preiser1,6, Nigel C. Bennett4, Tsidiso Maphanga7, Nelesh P. Govender7,8, Robert Colebunders2, Chris Kenyon9,10 *These authors contributed equally to this work. Affiliations: 1Division of Medical Virology, Department of Pathology, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa; 2Global Health Institute, Faculty of Medicine and Health Sciences, University of Antwerp, Antwerp, Belgium; 3Department of Medical Microbiology and Infectious Diseases, University of Manitoba, Winnipeg, Canada; 4Mammal Research Institute, Department of Zoology & Entomology, University of Pretoria, South Africa; 5Department of Conservation Ecology and Entomology, Faculty of AgriSciences, Stellenbosch University, Stellenbosch, South Africa; 1 6National Health Laboratory Service Tygerberg, Cape Town, South Africa; 7National Institute for Communicable Diseases, Centre for Healthcare-associated Infections, Antimicrobial Resistance and Mycoses, Johannesburg, South Africa; 8Division of Medical Microbiology, University of Cape Town, Cape Town; 9Department of Medicine, University of Cape Town; 10Sexually Transmitted Infection Unit, Institute of Tropical Medicine, Antwerp, Belgium. Corresponding author: [email protected] Keywords:
    [Show full text]