DOCSLIB.ORG

ALCAM/CD166 Is a TGF-B–Responsive Marker and Functional Regulator of Prostate Cancer Metastasis to Bone

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ALCAM/CD166 Is a TGF-B–Responsive Marker and Functional Regulator of Prostate Cancer Metastasis to Bone Published OnlineFirst January 2, 2014; DOI: 10.1158/0008-5472.CAN-13-1296 Cancer Molecular and Cellular Pathobiology Research ALCAM/CD166 Is a TGF-b–Responsive Marker and Functional Regulator of Prostate Cancer Metastasis to Bone Amanda G. Hansen1,2, Shanna A. Arnold1, Ming Jiang3, Trenis D. Palmer1, Tatiana Ketova1, Alyssa Merkel5,6, Michael Pickup2, Susan Samaras1, Yu Shyr4, Harold L. Moses2, Simon W. Hayward2,3, Julie A. Sterling2,5,6, and Andries Zijlstra1,2 Abstract The dissemination of prostate cancer to bone is a common, incurable aspect of advanced disease. Prevention and treatment of this terminal phase of prostate cancer requires improved molecular under- standing of the process as well as markers indicative of molecular progression. Through biochemical analyses and loss-of-function in vivo studies, we demonstrate that the cell adhesion molecule, activated leukocyte cell adhesion molecule (ALCAM), is actively shed from metastatic prostate cancer cells by the sheddase ADAM17 in response to TGF-b. Not only is this posttranslational modification of ALCAM a marker of prostate cancer progression, the molecule is also required for effective metastasis to bone. Biochemical analysis of prostate cancer cell lines reveals that ALCAM expression and shedding is elevated in response to TGF-b signaling. Both in vitro and in vivo shedding is mediated by ADAM17. Longitudinal analysis of circulating ALCAM in tumor-bearing mice revealed that shedding of tumor, but not host-derived ALCAM is elevated during growth of the cancer. Gene-specific knockdown of ALCAM in bone-metastatic PC3 cells greatly diminished both skeletal dissemination and tumor growth in bone. The reduced growth of ALCAM knockdown cells corresponded to an increase in apoptosis (caspase-3) and decreased proliferation (Ki67). Together, these data demonstrate that the ALCAM is both a functional regulator as well as marker of prostate cancer progression. Cancer Res; 74(5); 1404–15. Ó2014 AACR. Introduction surveillance, which avoids the morbidity associated with sur- Morbidity and mortality among patients with prostate gery. However, without a better understanding of the mechan- cancer are frequently a result of metastatic dissemination to isms that drive progression and biomarkers to predict the risk bone. To date, there is no curative treatment of skeletal of progression, many patients and physicians are not comfort- metastasis and survival from the time of diagnosis is merely able pursuing this option, and instead opt for more invasive fi 3 to 5 years (1). Moreover, skeletal events are associated with "de nitive" interventions. Thus, clinical intervention would fi high morbidity in the form of bone loss, fractures, and pain (2). greatly bene t from further understanding of the molecular Even for patients with organ-confined disease, the risk of mechanisms that drive skeletal metastasis as well as molecular disease progression drives the rigor of clinical intervention. indicators that identify patients at risk of disease progression. Patients have been shown to do well on a regimen of active Because cell motility is an important contributor to metastasis, the activation state of migratory mechanisms could be suitable for both therapeutic intervention as well as a biomarker of metastatic behavior. Authors' Affiliations: Departments of 1Pathology, Microbiology and 2 3 4 Tumor cell metastasis to distant sites, including bone, is a Immunology, Cancer Biology, and Urologic Surgery, Division of Cancer fi Biostatistics, Vanderbilt University; 5Department of Medicine, Division of multistep process. Cancer cells must rst detach from the Clinical Pharmacology, Vanderbilt Center for Bone Biology; and 6Depart- primary tumor site and migrate locally to invade blood vessels. ment of Veterans Affairs, Tennessee Valley Healthcare System, Nashville, Thereafter, tumor cells intravasate into the bloodstream and Tennessee are attracted to preferred sites of metastasis through site- Note: Supplementary data for this article are available at Cancer Research specific cellular and microenvironmental interactions (3, 4). Online (http://cancerres.aacrjournals.org/). Activated leukocyte cell adhesion molecule (ALCAM) is a cell Current address for M. Jiang: Laboratory of Nuclear Receptors and Cancer adhesion molecule that engages in homotypic and heterotypic Research, Center for Medical Research, Nantong University School of Medicine, 19 Qixiu Road, Nantong City, Jiangsu Province 226001, China. cell adhesion in a calcium-independent manner (5). It has been implicated in a number of adhesive and migratory Corresponding Author: Andries Zijlstra, Vanderbilt University Medical Center, C-2102c MCN, 1161 21st Avenue S., Nashville, TN 37232-2561. behaviors including axonal guidance, leukocyte homing, and Phone: 615-322-3295; Fax: 615-936-7040; E-mail: cancer metastasis. ALCAM can be proteolytically cleaved at [email protected] the cell surface by ADAM17 causing the ectodomain to be doi: 10.1158/0008-5472.CAN-13-1296 shed. This shedding can be induced by ionomycin, phorbol Ó2014 American Association for Cancer Research. 12-myristate 13-acetate (PMA), and EGFs (6). Proteolytic 1404 Cancer Res; 74(5) March 1, 2014 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst January 2, 2014; DOI: 10.1158/0008-5472.CAN-13-1296 ALCAM Is a Marker and Regulator of Skeletal Metastasis cleavage/shedding of cell surface proteins is a common reg- acid (BCA) assay (Bio-Rad). Conditioned media samples were ulatory mechanism that can alter the function and localiza- concentrated with Microcon centrifugal filters (Millipore) tion of transmembrane proteins such as cell adhesion mole- following the manufacturer's protocol, which were eluted cules, growth factors, and growth factor receptors. This directly in 5Â sample buffer for Western blot analysis. Protein regulation can weaken cell adhesion and destabilize adherens loading for conditioned medium samples for Western blot junctions as in the case of E-cadherin, through the loss of analysis was adjusted according to the total protein in cell homotypic cell adhesion molecular interactions (7). The sol- lysates. Conditioned media and total protein was subjected uble shed ectodomain can act as a soluble antagonist, thereby to SDS-PAGE and electrophoretic transfer to polyvinylidene competing for membrane-bound receptors or cell adhesion difluoride membranes (Immobilon P, Millipore, Inc.). Immu- molecules. Although these processes are important in devel- nodetection was done by conventional chemiluminescence. opment, they have also been associated with tumorigenesis. Functionally, expression of the truncated, trans-membrane Quantitative PCR fragment of ALCAM in BLM melanoma cells results in The mRNA samples were prepared from tumor cells lysed in increased lung metastasis in vivo, whereas overexpression of TRI Reagent (Ambion) and purified using phenol extraction, a soluble extracellular ligand-binding fragment diminished followed by real-time PCR (RT-PCR). The following quantita- metastases (for review see refs. 8 and 9). Previous studies from tive PCR (qPCR) primers were used ALCAM, TCAAGGTGTT- our laboratory and others have investigated the clinical rel- CAAGCAACCA (forward) and CTGAAATGCAGTCACCCAAC evance of ALCAM expression and shedding in a variety of (reverse); ADAM17, ATGTTTCACGTTTGCAGTCTCCA (for- human malignancies, including colorectal, breast, ovarian, ward) and CATGTATCTGTAGAAGCGATGATCTG (reverse); thyroid, and prostate cancer (10–16). However, its molecular and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), contribution to disease progression remains unclear. ATCTTCTTTTGCGTCGCCAG (forward) and TTCCCCATGG- Elevated ALCAM expression in aggressive prostate cancer TGTCTGAGC (reverse). (17) together with its putative role in cell adhesion/migration (8, 18) suggested that ALCAM is a molecular participant in shRNA knockdown prostate cancer metastasis to bone. On the basis of our own To establish cell lines in which ALCAM expression is stably work in colorectal cancer (10) and concomitant work in breast knocked down, cells were transduced with ALCAM-specific (19) as well as ovarian cancer (11), we hypothesized that Mission short hairpin RNA (shRNA; Sigma) lentivirus. Follow- ectodomain shedding of ALCAM is likely to correspond with ing transduction, cells were selected in 10 mg/mL of puromycin. prostate cancer progression. Furthermore, considering the Transduced cells were flow sorted for ALCAM expression and dominant role of TGF-b in driving skeletal metastasis of ALCAM knockdown cells were cultured and maintained in 5 prostate cancer (20, 21), we postulated that this cytokine could mg/mL of puromycin. influence ALCAM expression and/or shedding. The present study investigates ALCAM expression and shedding during Migration assay prostate cancer progression, evaluates the influence of TGF-b Two-dimensional gap closure assays (formerly known as stimulation, and determines the contribution of ALCAM to scratch assays) were conducted by using magnetically attach- skeletal metastasis in a series of orthotopic, and experimental able stencils attached to culture plates (22). In short, 250,000 metastasis models. cells were seeded in 6-well plates and allowed to recover overnight to form a confluent monolayer. Stencils were Materials and Methods removed with tweezers, after which cells were rinsed with Reagents, cell culture PBS to remove detached cells. Culture medium was re-added Full-length purified
Load more

Recommended publications
  • ALCAM Regulates Mediolateral Retinotopic Mapping in the Superior Colliculus
    15630 • The Journal of Neuroscience, December 16, 2009 • 29(50):15630–15641 Development/Plasticity/Repair ALCAM Regulates Mediolateral Retinotopic Mapping in the Superior Colliculus Mona Buhusi,1 Galina P. Demyanenko,1 Karry M. Jannie,2 Jasbir Dalal,1 Eli P. B. Darnell,1 Joshua A. Weiner,2 and Patricia F. Maness1 1Department of Biochemistry and Biophysics, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599, and 2Department of Biology, University of Iowa, Iowa City, Iowa 52242 ALCAM [activated leukocyte cell adhesion molecule (BEN/SC-1/DM-GRASP)] is a transmembrane recognition molecule of the Ig superfamily (IgSF) containing five Ig domains (two V-type, three C2-type). Although broadly expressed in the nervous and immune systems, few of its developmental functions have been elucidated. Because ALCAM has been suggested to interact with the IgSF adhesion molecule L1, a determi- nant of retinocollicular mapping, we hypothesized that ALCAM might direct topographic targeting to the superior colliculus (SC) by serving as a substrate within the SC for L1 on incoming retinal ganglion cell (RGC) axons. ALCAM was expressed in the SC during RGC axon targeting and on RGC axons as they formed the optic nerve; however, it was downregulated distally on RGC axons as they entered the SC. Axon tracing with DiI revealedpronouncedmistargetingofRGCaxonsfromthetemporalretinahalfofALCAMnullmicetoabnormallylateralsitesinthecontralateral SC, in which these axons formed multiple ectopic termination zones. ALCAM null mutant axons were
    [Show full text]
  • L1 Cell Adhesion Molecule in Cancer, a Systematic Review on Domain-Specific Functions
    International Journal of Molecular Sciences Review L1 Cell Adhesion Molecule in Cancer, a Systematic Review on Domain-Specific Functions Miriam van der Maten 1,2, Casper Reijnen 1,3, Johanna M.A. Pijnenborg 1,* and Mirjam M. Zegers 2,* 1 Department of Obstetrics and Gynaecology, Radboud university medical center, 6525 GA Nijmegen, The Netherlands 2 Department of Cell Biology, Radboud Institute for Molecular Life Sciences, Radboud university medical center, 6525 GA Nijmegen, The Netherlands 3 Department of Obstetrics and Gynaecology, Canisius-Wilhelmina Hospital, 6532 SZ Nijmegen, The Netherlands * Correspondence: [email protected] (J.M.A.P); [email protected] (M.M.Z.) Received: 24 June 2019; Accepted: 23 August 2019; Published: 26 August 2019 Abstract: L1 cell adhesion molecule (L1CAM) is a glycoprotein involved in cancer development and is associated with metastases and poor prognosis. Cellular processing of L1CAM results in expression of either full-length or cleaved forms of the protein. The different forms of L1CAM may localize at the plasma membrane as a transmembrane protein, or in the intra- or extracellular environment as cleaved or exosomal forms. Here, we systematically analyze available literature that directly relates to L1CAM domains and associated signaling pathways in cancer. Specifically, we chart its domain-specific functions in relation to cancer progression, and outline pre-clinical assays used to assess L1CAM. It is found that full-length L1CAM has both intracellular and extracellular targets, including interactions with integrins, and linkage with ezrin. Cellular processing leading to proteolytic cleavage and/or exosome formation results in extracellular soluble forms of L1CAM that may act through similar mechanisms as compared to full-length L1CAM, such as integrin-dependent signals, but also through distinct mechanisms.
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • And MUC1 in Mammary Epithelial Cells
    Linköping University Post Print Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells Stina Petersson, E. Shubbar, M. Yhr, A. Kovacs and Charlotta Enerbäck N.B.: When citing this work, cite the original article. The original publication is available at www.springerlink.com: Stina Petersson, E. Shubbar, M. Yhr, A. Kovacs and Charlotta Enerbäck, Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells, 2011, Breast Cancer Research and Treatment, (125), 1, 13-25. http://dx.doi.org/10.1007/s10549-010-0820-4 Copyright: Springer Science Business Media http://www.springerlink.com/ Postprint available at: Linköping University Electronic Press http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-63954 1 Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells Petersson S1, Shubbar E1, Yhr M1, Kovacs A2 and Enerbäck C3 Departments of 1Clinical Genetics and 2Pathology, Sahlgrenska University Hospital, SE-413 45 Gothenburg, Sweden; 3Department of Clinical and Experimental Medicine, Division of Cell Biology and Dermatology, Linköping University, SE-581 85 Linköping, Sweden E-mail: [email protected] E-mail: maria.yhr@ clingen.gu.se E-mail: [email protected] E-mail: [email protected] Correspondence: Stina Petersson, Department of Clinical Genetics, Sahlgrenska University Hospital, SE-413 45 Gothenburg, Sweden E-mail: [email protected] 2 Abstract Psoriasin (S100A7), a member of the S100 gene family, is highly expressed in high-grade comedo ductal carcinoma in situ (DCIS), with a higher risk of local recurrence. Psoriasin is therefore a potential biomarker for DCIS with a poor prognosis.
    [Show full text]
  • Dual Role of ALCAM in Neuroinflammation and Blood–Brain
    Dual role of ALCAM in neuroinflammation and PNAS PLUS blood–brain barrier homeostasis Marc-André Lécuyera, Olivia Saint-Laurenta, Lyne Bourbonnièrea, Sandra Larouchea, Catherine Larochellea, Laure Michela, Marc Charabatia, Michael Abadierb, Stephanie Zandeea, Neda Haghayegh Jahromib, Elizabeth Gowinga, Camille Pitteta, Ruth Lyckb, Britta Engelhardtb, and Alexandre Prata,c,1 aNeuroimmunology Research Laboratory, Centre de Recherche du Centre Hospitalier de l’Université de Montréal (CRCHUM), Montreal, QC, Canada H2X 0A9; bTheodor Kocher Institute, University of Bern, 3012 Bern, Switzerland; and cDepartment of Neurosciences, Faculty of Medicine, Université de Montréal, Montreal, QC, Canada H3T 1J4 Edited by Lawrence Steinman, Stanford University School of Medicine, Stanford, CA, and approved December 9, 2016 (received for review August 29, 2016) Activated leukocyte cell adhesion molecule (ALCAM) is a cell adhesion Although the roles of ICAM-1 and VCAM-1 during leukocyte moleculefoundonblood–brain barrier endothelial cells (BBB-ECs) that transmigration in most vascular beds have been extensively was previously shown to be involved in leukocyte transmigration studied (8–10), additional adhesion molecules have also been across the endothelium. In the present study, we found that ALCAM shown to partake in the transmigration process of encephalito- knockout (KO) mice developed a more severe myelin oligodendrocyte genic immune cells, including activated leukocyte cell adhesion glycoprotein (MOG)35–55–induced experimental autoimmune enceph- molecule (ALCAM/CD166) (11, 12), melanoma cell adhe- alomyelitis (EAE). The exacerbated disease was associated with a sig- sion molecule (MCAM) (13–15), mucosal vascular addressin cell nificant increase in the number of CNS-infiltrating proinflammatory adhesion molecule 1 (MAdCAM-1) (16, 17), vascular adhesion leukocytes compared with WT controls.
    [Show full text]
  • Tetraspanin CD9: a Key Regulator of Cell Adhesion in the Immune System
    MINI REVIEW published: 30 April 2018 doi: 10.3389/fimmu.2018.00863 Tetraspanin CD9: A Key Regulator of Cell Adhesion in the Immune System Raquel Reyes1, Beatriz Cardeñes1, Yesenia Machado-Pineda1 and Carlos Cabañas 1,2* 1 Departamento de Biología Celular e Inmunología, Centro de Biología Molecular Severo Ochoa (CSIC-UAM), Madrid, Spain, 2 Departamento de Inmunología, Oftalmología y OTR (IO2), Facultad de Medicina, Universidad Complutense, Madrid, Spain The tetraspanin CD9 is expressed by all the major subsets of leukocytes (B cells, CD4+ T cells, CD8+ T cells, natural killer cells, granulocytes, monocytes and macrophages, and immature and mature dendritic cells) and also at a high level by endothelial cells. As a typical member of the tetraspanin superfamily, a prominent feature of CD9 is its propensity to engage in a multitude of interactions with other tetraspanins as well as with different transmembrane and intracellular proteins within the context of defined membranal domains termed tetraspanin-enriched microdomains (TEMs). Through these associations, CD9 influences many cellular activities in the different subtypes of leuko- cytes and in endothelial cells, including intracellular signaling, proliferation, activation, survival, migration, invasion, adhesion, and diapedesis. Several excellent reviews have Edited by: already covered the topic of how tetraspanins, including CD9, regulate these cellular Manfred B. Lutz, processes in the different cells of the immune system. In this mini-review, however, we Universität Würzburg, Germany will focus particularly on describing and discussing the regulatory effects exerted by CD9 Reviewed by: on different adhesion molecules that play pivotal roles in the physiology of leukocytes José Mordoh, and endothelial cells, with a particular emphasis in the regulation of adhesion molecules Leloir Institute Foundation (FIL), Argentina of the integrin and immunoglobulin superfamilies.
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • Cell Adhesion Molecules in Normal Skin and Melanoma
    biomolecules Review Cell Adhesion Molecules in Normal Skin and Melanoma Cian D’Arcy and Christina Kiel * Systems Biology Ireland & UCD Charles Institute of Dermatology, School of Medicine, University College Dublin, D04 V1W8 Dublin, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +353-1-716-6344 Abstract: Cell adhesion molecules (CAMs) of the cadherin, integrin, immunoglobulin, and selectin protein families are indispensable for the formation and maintenance of multicellular tissues, espe- cially epithelia. In the epidermis, they are involved in cell–cell contacts and in cellular interactions with the extracellular matrix (ECM), thereby contributing to the structural integrity and barrier for- mation of the skin. Bulk and single cell RNA sequencing data show that >170 CAMs are expressed in the healthy human skin, with high expression levels in melanocytes, keratinocytes, endothelial, and smooth muscle cells. Alterations in expression levels of CAMs are involved in melanoma propagation, interaction with the microenvironment, and metastasis. Recent mechanistic analyses together with protein and gene expression data provide a better picture of the role of CAMs in the context of skin physiology and melanoma. Here, we review progress in the field and discuss molecular mechanisms in light of gene expression profiles, including recent single cell RNA expression information. We highlight key adhesion molecules in melanoma, which can guide the identification of pathways and Citation: D’Arcy, C.; Kiel, C. Cell strategies for novel anti-melanoma therapies. Adhesion Molecules in Normal Skin and Melanoma. Biomolecules 2021, 11, Keywords: cadherins; GTEx consortium; Human Protein Atlas; integrins; melanocytes; single cell 1213. https://doi.org/10.3390/ RNA sequencing; selectins; tumour microenvironment biom11081213 Academic Editor: Sang-Han Lee 1.
    [Show full text]
  • Human ALCAM/CD166 Antibody
    Human ALCAM/CD166 Antibody Monoclonal Mouse IgG1 Clone # 105902 Catalog Number: MAB6561 DESCRIPTION Species Reactivity Human Specificity Detects human ALCAM/CD166 in Western blots. Shows approximately 50% cross­reactivity with recombinant mouse OCAM and no cross­reactivity with recombinant human (rh) BCAM, rhEpCAM, rhMCAM, or rhNCAM­L1. Source Monoclonal Mouse IgG1 Clone # 105902 Purification Protein A or G purified from ascites Immunogen Mouse myeloma cell line NS0­derived recombinant human ALCAM/CD166 Trp28­Ala526 Accession # Q13740 Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. *Small pack size (­SP) is supplied either lyophilized or as a 0.2 μm filtered solution in PBS. APPLICATIONS Please Note: Optimal dilutions should be determined by each laboratory for each application. General Protocols are available in the Technical Information section on our website. Recommended Sample Concentration Western Blot 1 µg/mL Recombinant Human ALCAM/CD166 Fc Chimera (Catalog # 656­AL) under non­reducing conditions only Flow Cytometry 2.5 µg/106 cells Human peripheral blood lymphocytes Human ALCAM/CD166 Sandwich Immunoassay Reagent ELISA Capture 2­8 µg/mL Human ALCAM/CD166 Antibody (Catalog # MAB6561) ELISA Detection 0.1­0.4 µg/mL Human ALCAM/CD166 Biotinylated Antibody (Catalog # BAF656) Standard Recombinant Human ALCAM/CD166 Fc Chimera (Catalog # 656­AL) CyTOF­ready Ready to be labeled using established conjugation methods. No BSA or other carrier proteins that could interfere with conjugation. PREPARATION AND STORAGE Reconstitution Reconstitute at 0.5 mg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below.
    [Show full text]
  • CD6-ALCAM Pathway Is Elevated in Patients with Severe Asthma
    CD6-ALCAM Pathway is Elevated in Patients with Severe Asthma 1Manali Mukherjee, 1Nan Zhao, 1Katherine Radford, 2Sole Gatto, 2Adam Pavlicek, 3Jeanette Ampudia, 3Cherie Ng, 3Stephen Connelly & 1Parameswaran Nair 1Division of Respirology, Department of Medicine, McMaster University & St Joseph’s Healthcare Hamilton, Ontario, Canada; 2Monoceros Biosystems LLC, San Diego, CA USA; 3Equillium, Inc, La Jolla, CA USA Introduction Figure 1 Figure 3 Clinical Need: 6 1.5 • A subset of severe asthma patients have persistent airway inflammation despite high dose A *** B *** Eos (%) Non-eos (%) p-value *** n *** n o n 11 11 ---- o inhaled and/or oral corticosteroid therapy i 1.0 ) ) i 4 s s M M s s K K Sex (M) 7 (63) 5 (45) 0.3 • e Steroid insensitivity in a portion of these patients may be driven by non-classical T2 e r r P P p p F F 0.5 x x 2 inflammatory pathways. 2 Atopic (n,%) 8 (72.7) 5 (45.4) 0.4 2 e e g g e o o 6 l l 3 ( ( The CD6-ALCAM pathway: D Age 53.55 (15.6) 56.00 (18.6) 0.74 D 0.0 C • CD6 is a co-stimulatory receptor on T-cells and certain innate lymphoid cells that binds 0 C BMI 28.10 (3.7) 27.27 (7.2) 0.74 activated leukocyte cell adhesion molecule (ALCAM) on antigen presenting cells and -0.5 FEV1% 76.67 (17.5) 71.87 (23.8) 0.6 y te re y te re h a e h a e endothelial and epithelial tissues 6 lt r v 8 lt r v a e e a e e FEV1/FVC 0.65 (0.036) 0.67 (0.04) 0.71 C e d * S D e d **** S H o * H o • M M ** The CD6-ALCAM pathway plays an integral role in modulating T cell activation and n n Blood eosinophil 0.55 (0.44) 0.28 (0.29) 0.11 o i o 6 ) ) i s s trafficking and is central to immune mediated inflammation.
    [Show full text]
  • Cluster Analysis" Service
    3607 Parkway Ln, Suite 200 1-888-494-8555 Norcross GA 30092 www.raybiotech.com EXAMPLE REPORT Biostatistics & Bioinformatics Services "Cluster Analysis" Service biomarker 3 2 1 0 −1 −2 EXAMPLE S2T2 S3T2 S1T2 S1T1 S3T1 S2T1 Bioinformatics Team, RayBiotech November 30, 2018 3607 Parkway Ln, Suite 200 1-888-494-8555 Norcross GA 30092 www.raybiotech.com Contents 1 Introduction 2 2 Methods 2 2.1 Data filtration . .2 2.2 Data scaling . .2 2.3 Principal component analysis (PCA) . .2 2.4 Heatmap with hierarchical clustering . .2 2.5 Software . .2 3 Results 3 3.1 Data filtration . .3 3.2 Data scaling . .3 3.3 Principal component analysis . .4 3.4 Heatmap with hierarchical clustering . .7 References 11 EXAMPLE 1 3607 Parkway Ln, Suite 200 1-888-494-8555 Norcross GA 30092 www.raybiotech.com 1 Introduction The “Cluster Analysis” service performs a preliminary exploration of the data profile. It filters and scales the data before it clusters sample data based on hierarchical clustering and principal component analysis (PCA). Need help understanding how the statistical analyses were performed in layman’s terms? Please visit our website. 2 Methods 2.1 Data filtration Samples with missing data were identified and excluded from the analysis. Biomarkers showing no variation across all the subjects (i.e., zero-variance), were excluded from the analysis. 2.2 Data scaling The original biomarker values were first centered and scaled by subtracting the mean of each biomarker from the data and then dividing it by the standard deviation, respectively. Centering and scaling results in a uniform mean and scale across all the biomarkers, but leaves their distribution unchanged.
    [Show full text]
  • Activated Leukocyte Cell Adhesion Molecule (ALCAM/CD166/MEMD), a Novel Actor in Invasive Growth, Controls Matrix Metalloproteinase Activity
    Research Article Activated Leukocyte Cell Adhesion Molecule (ALCAM/CD166/MEMD), a Novel Actor in Invasive Growth, Controls Matrix Metalloproteinase Activity Pim C. Lunter,1 Jeroen W.J. van Kilsdonk,1 Hanneke van Beek,1,2 Ine M.H.A. Cornelissen,3 Mieke Bergers,2 Peter H.G.M. Willems,4 Goos N.P. van Muijen,3 and Guido W.M. Swart1 1Department of Biochemistry 161, Nijmegen Center of Molecular Life Sciences, Radboud University Nijmegen and Departments of 2Dermatology 802, 3Pathology 437, and 4Biochemistry 160, University Medical Center Nijmegen, Nijmegen, the Netherlands Abstract inhibitor of metalloproteinases-2 (TIMP-2) recruits pro–MMP-2 Activated leukocyte cell adhesion molecule (ALCAM/CD166/ from the extracellular milieu to the cell surface. Subsequent MEMD) could function as a cell surface sensor for cell activation requires an additional molecule of active MT1-MMP and density, controlling the transition between local cell prolif- autocatalytic cleavage steps (7–11). eration and tissue invasion in melanoma progression. We Interactions between extracellular matrix components and have tested the hypothesis that progressive cell clustering their cognate membrane receptors play an important role in the activation of the MT1-MMP/MMP-2 cascade in tumor cells. Clus- controls the proteolytic cascade for activation of gelatinase h A/matrix metalloproteinase-2 (MMP-2), which involves for- tering of integrin 1 chains or fibronectin binding promotes mation of an intermediate ternary complex of membrane activation of MMP-2 (12, 13). Culturing metastatic melanoma type 1 MMP (MT1-MMP/MMP-14), tissue inhibitor of metal- cell lines in three-dimensional collagen lattices activates MT1- a h loproteinase-2 (TIMP-2), and pro–MMP-2 at the cell surface.
    [Show full text]