The Role of T and Tbx6 During Gastrulation and Determination of Left/Right Asymmetry Daniel Concepcion Submitted in Partial Fulf

The role of T and Tbx6 during gastrulation and determination of left/right asymmetry

Daniel Concepcion

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences

COLUMBIA UNIVERSITY 2013

Abstract The role of T and Tbx6 in gastrulation and determination of left/right asymmetry

Daniel Concepcion

T and Tbx6 belong to the T-box family of transcription factors. T homozygous null

mutants lack posterior somites after the seventh pair, have no distinguishable

notochord, have a convoluted neural tube and die at E.10.5. In this study we

investigate the phenotype of a dominant negative allele of T, TWis. Like homozygous

embryos carrying the null allele of T, TWis homozygous mutants have left/right asymmetry defects. We demonstrate that left/right specific genes Cer2, Nodal, and

Gdf1 are not expressed in TWis mutants and that the Notch signaling pathway, a pathway necessary for expression of left/right specific genes, is severely perturbed.

We find, through the use of confocal and scanning electron microscopy, that TWis

homozygous mutants have severe node morphological defects. Molecular analysis

shows that TWis mutants have altered expression of the genes Shh, Foxa2 and Gsc, that not only mark structures of the midline and node, but whose expression is essential for the formation and patterning of these structures.

Tbx6 homozygous null mutants have enlarged tail buds and ectopic neural tubes in place of posterior somites. Tbx6 homozygous null mutants also have irregular development of anterior somites and left/right asymmetry defects that lead to

randomization of heart looping. In this study we made use of a microarray to find

transcriptional regulators that are potentially directly regulated by Tbx6 in order to find

genes that govern the establishment of presomitic mesoderm identity. Tbx6

homozygous mutant embryos were used to investigate how Tbx6 affects multiple

processes in the establishment of left-right asymmetry, which include node and node cilia development and the expression of genes necessary for nodal signal transduction from the perinodal region to the left lateral plate mesoderm (LPM). We saw that the expression of transcription factors involved in node and node cilia development and genes involved in the non-canonical Wnt signaling pathway are not affected in Tbx6 homozygous mutants. We also examined whether the left-right asymmetry defects in

Tbx6 homozygous mutants are due to a role for Tbx6 to directly regulate the perinodal expression of Gdf1. We show that perinodal expression of Gdf1 is lost in Tbx6 homozygous mutants at the stage in which Gdf1 is hypothesized to help shuttle Nodal from the perinodal region to the left lateral plate mesoderm. We saw that Tbx6 does not regulate expression of Gdf1 through putative binding sites located in its promoter region and did not detect a genetic interaction between the two genes in determining left/right asymmetry. Finally we saw that addition of a transgene that expresses Gdf1 in Tbx6 homozygous mutants leads to rescue of asymmetric expression of Pitx2 in the left LPM.

Table of Contents

Chapter 1: Introduction to gastrulation, somitogenesis and T-box genes 1

Mouse embryonic development from conception to the primitive streak stage 1

Establishment of left-right asymmetry 4

Axial elongation and somitogenesis 9

T-box genes in vertebrate development 11

Chapter 2: The role of Brachyury in node and midline development 16

INTRODUCTION 16

RESULTS 18

Heart looping and embryo turning defects in TWis homozygous mutants at E9.5-E10.5 18

Expression of left/right-specific genes in TWis homozygous mutants at E8.0-E8.5 19

Characterization of the node of TWis homozygous mutants 20

Expression of midline markers in TWis homozygous mutants 22

Expression of components of the canonical Wnt and Notch signaling pathways in wild type and TWis homozygous mutant at E8.0 22

DISCUSSION 23

MATERIALS AND METHODS 27

Chapter 3: Search for Tbx6 targets 37

INTRODUCTION 37

RESULTS 39

Identification of potentially direct transcription factor targets of Tbx6 39

Genes whose expression is lost in the PSM of Tbx6 homozygous mutants at E9.5 40

Genes with reduced expression in Tbx6 homozygous mutants at E9.5 42

Genes with ectopic expression in Tbx6 homozygous mutants at E9.5 43

DISCUSSION 44

MATERIALS AND METHODS 47

Chapter 4: The role of Tbx6 in determination or L/R asymmetry 57

INTRODUCTION 57

RESULTS 60

Expression of transcription factors that affect laterality, node and nodal cilia development in Tbx6 homozygous mutants 60

Expression of components of the non-canonical Wnt signaling pathway in wild type and Tbx6 mutants between E7.5-E8.5 62

Expression of Gdf1 in wild type and Tbx6 homozygous mutants between E8.0-E8.5 63

Regulation of Gdf1 expression by Tbx6 63

Investigating a possible genetic interaction between Tbx6 and Gdf1 in determination of left-right asymmetry 65

Rescue of Gdf1 perinodal expression in Tbx6-/- mutants results in asymmetric express Pitx2 in the left LPM 65

DISCUSSION 66

MATERIAL AND METHODS 70

Chapter 5: Discussion 87

T and Tbx6 during gastrulation 87

T and Tbx6 play different roles in the determination of left/right asymmetry 89

Future perspectives 91

References 94

Appendix: Additional Publication 104

iii

List of tables and figures

Figure 1: Model for molecular establishment of left/right asymmetry 15

Table 1: Heart looping and embryo turning in wild type and TWis/ TWis 30 homozygous mutants at E9.5-E10.5.

Figure 2: Heart looping and embryo turning in TWis/TWis mutant and 31 wild type embryos at E9.5

Figure 3: Expression of left/right specific genes in TWis/TWis mutant 33 and wild type embryos at E8.0

Figure 4: Confocal and scanning electron microscopy of TWis/TWis mutant 33 and wild type embryos at E8.0

Figure 5: Markers of the node and midline in TWis/TWis mutant and 35 wild type embryos at E8.0

Figure 6: Expression of Wnt3a and Dll1 in TWis/TWis mutant and 36 wild type embryos at E8.0

Table 2: Validation of gene lists using genes known or predicted to be altered in 49 PSM in Tbx6 -/- mutants

Table 3: Subtracted gene list of putative direct Tbx6 targets that play 49 a role in transcriptional regulation with the expression fold change from the microarray analysis and the number of putative Tbx6 binding sites in their promoters.

Figure 7: Venn diagram of differentially expressed genes in three 52 genotypes from Tbx6-expressing E9.5 tailbud tissues.

Figure 8: Expression of Mox1, Paraxis, Eya1 and Nkd2 in 53 wild type and Tbx6 homozygous mutant embryos at E9.5.

Figure 9: Expression of Six1 and Cxcl12 in Tbx6 homozygous 55 mutants as E9.5

Figure 10: Expression of Foxn3 and Hoxa7 in Tbx6 homozygous 56 mutants at E9.5

Table 4. Sequences of Tbx6 putative bindings sites with 2kb of the Gdf1 75 transcriptional start site and EMSA DNA probes

Figure 11: Expression of Noto in wild type and Tbx6 homozygous 76 mutants from midstreak through head fold stages between E7.5-E8.0

Figure 12: Expression of Foxj1 in wild type andTbx6 homozygous 77 mutants from streak to somite stages between E7.5-E8.5

Figure 13. Expression of Rfx3 in wild type and Tbx6 homozygous 78 mutants from bud and head fold stages between E7.5-E8.0

Figure 14. Expression of non-canonical Wnt signaling ligands in 79 wild type and Tbx6 homozygous mutants from early bud and late head fold stages between E7.5-E8.0

Figure 15. Left view of expression of non-canonical Wnt 80 signaling receptors from streak to somite stages in wild type and Tbx6 homozygous mutants between E7.5 and E.8.5

Figure 16. Expression of Gdf1 in wild type and Tbx6 homozygous 82 mutant embryos between LHF and 7 somite stages

Figure 17: Characterization of Tbx6 putative binding sites in the 83 Gdf1 promoter region by electrophoretic mobility shift (EMSA) and luciferase assays in 3T3 cells

Figure 18. Expression of Pitx2 in wild type, Tbx6-/- and 85 Tbx6-/-; node-Tg embryos.

Table 5: Primer sequences used for genotyping mice and embryos 86

Figure 19: Multiple roles of T and Tbx6 during gastrulation and 93 determination of left/right asymmetry

List of Abbreviations

LPM, lateral plate mesoderm ICM, inner cell mass AVE, anterior visceral endoderm EGO, early gastrula organizer MGO, mid-gastrula organizer PSM, presomitic mesoderm SEM, scanning electron microscopy ZO1, zona occulance 1 PBS, phosphate buffered saline PL, placenta VV, vitelline vessels YS, yolk sac Al, allantois Hf, headfolds H, heart COTRASIF, Conservation-aided Transcription-factor Binding Site Finder, DAVID, Database for Annotation, Visualization and Integrated Discovery S, somites N, neural tube EN ectopic neural tube IM, intermediate mesoderm PCP, planar cell polarity EMSA, Electrophoretic mobility shift assays PVDF, polyvinylidene difluoride PMSF, phenylmethylsulfonyl fluoride MS, midstreak LS, late streak EB, early bud LB, late bud EHF, early headfold LHF, late headfold Som, somite

Acknowledgements

I would like to thank my mentor, Dr. Virginia Papaioannou for giving me the opportunity

to work in her lab and for countless hours of scientific mentoring and discussion. She

gave me the tools to explore scientific questions and taught me how to think about the

complexities of developmental biology. I thank her for her open door policy even though

it sometimes led discussions of the most outrageous ideas and for teaching me to write

like a scientist. Most of all I thank her for guidance, because of her I know I will be able

to tackle any problems that come my way in the future.

This experience would not mean as much to me if it not were for the past and present

members of the Papaioannou lab. No other place that I worked in has felt more like a

family. I would like to thank Lana Gavrilov and Salma Begum for fantastic

conversations. Thank you to Andy Washkowitz and Nataki Douglas for hours of

laughter and amazing scientific discussions, both of you are wonderful examples of how

to correctly juggle being great scientists and great parents. Thank you so much to Ripla

Arora, for everything. Thank you for all the birthday celebrations, secret Santas, floor

meetings and moving extravaganzas. Thank you for all the scientific conversations and

arguments and for recommending I rotate in the Papaioannou lab. I would like to thank

my students Ally Castillejos for countless hours of singing and mouse maintenance and

Jason Yang for many hours discussing Columbia academic and recreational activities.

I would like to thank past and present members of the Genetics and Development department and in particular the administrative staff: Nina Steinberg, Pascale Jean-

vii

Louis, Stacy Warren, Celia Marie Morales for always being there to answer questions

and being very helpful throughout my graduate career.

I would also like to thank my thesis advisory committee members Dr. Lori Sussel and Dr.

Michael Shen for providing me with scientific mentoring and insight. I would also like to

that Dr. Frank Costantini and Dr. Kat Hadjantonakis for being part of my Thesis

committee.

Special thanks goes to my friends Joydeep Banerjee and Ross Gabrielson who

showed me that the title of brother can be earned through friendship. Thanks to my

brother, Joel Concepcion and all my cousins. They were my first friends and taught me

that being part of a family is a privilege that you must cherish. Thank you Santos

Concepcion for being a loving father who always wanted to put a smile on my face and

for teaching me the values of fair play and sportsmanship. I especially would like to

thank my mother, Generosa Rodriguez, for being my first teacher. Thank you for

teaching me to always work for a better future and to reach beyond my wildest dreams.

I would be lost if not for your love and guidance. Finally I would like to thank the love of my life, Dr. Katherine Lelli, for your love, intellect and for believing in me.

viii

I dedicate this to my mother, who is both my inspiration and my hero. Gracias por todo

ix 1

Introduction

Mouse embryonic development from conception to the primitive streak stage

Mouse embryological development commences when the sperm fertilizes the oocyte. At the cleavage stage, cells of the embryo divide and begin to compact to form the morula. Restriction of developmental potential and the formation of a fluid filled cavity, the blastocoel, mark the blastocyst stage. The blastocyst has three distinct populations of cells: the inner cell mass (ICM), located on the inside of the embryo, gives rise to the embryo proper, and trophectoderm gives rise to the extraembryonic portion of the embryo (Rossant and Pedersen, 1988; Arnold and Robertson, 2009).

Cells of the ICM situated next to the blastocoel are known as the primitive endoderm, and cells located between the polar trophectoderm and the primitive endoderm make up the epiblast. The primitive endoderm gives rise to the extraembryonic visceral and parietal endoderm of the visceral and parietal yolk sac surrounding the embryo. Cells of the epiblast proliferate rapidly into the blastocoel cavity. They will give rise to the ectoderm, mesoderm, definitive endoderm and extraembryonic mesoderm through the process of gastrulation (Gardner and Rossant, 1979; Gardner, 1982; Arnold and

Robertson, 2009; Nowotschin and Hadjantonakis, 2010).

Gastrulation begins at embryonic day (E) 6.5 and is the process by which the three germ layers, ectoderm, mesoderm and definitive endoderm, are formed.

Gastrulation is characterized by an extensive series of coordinated morphogenetic movements that result in the establishment of the primitive body plan. Different cell populations, before and throughout gastrulation, as marked by gene expression or morphology, act as embryonic organizers to pattern the embryo.

The formation of the primitive streak, in the area of the epiblast adjacent to the

embryonic/extraembryonic junction, marks the beginning of gastrulation and is the first

morphological indication of the primary anterior/posterior axis. Epiblast cells migrate or

delaminate through the streak to arise as a new layer of mesoderm. Though molecular

factors that govern the development of the primitive streak are largely unknown, findings

point to secreted factors, Wnt3 and Nodal, and Smad2 as necessary for the proper

positioning and formation of the primitive streak (Conlon et al., 1994; Waldrip et al.,

1998; Liu et al., 1999; Arnold and Robertson, 2009).

The visceral endoderm of the prestreak embryo is molecularly heterogeneous

along the anterior/posterior axis. The cells that make up the anterior visceral endoderm

(AVE) are identified in the distal tip of the embryo by the expression of Hesx1 and Hhex.

These cells are hypothesized to migrate proximally and form the AVE (Thomas and

Beddington, 1996; Thomas et al., 1998; Nowotschin and Hadjantonakis, 2010). The

AVE is hypothesized to restrict the activity of signals produced at the primitive streak to

the posterior side of the embryo. Cells of the AVE express TGF-beta antagonists, Cer1

and Lefty1 (Perea-Gomez et al., 2001). The AVE has been previously hypothesized to be the embryonic organizer of the head process, however transplantation studies show that the AVE does not induce axis formation by itself. The AVE acts as a modulator in combination with other gastrula organizers to pattern the early streak embryo (Tam and

Steiner, 1999; Robb and Tam, 2004; Arnold and Robertson, 2009).

In the posterior epiblast at the anterior end of the primitive streak is a group of cells known as the early gastrula organizer (EGO). The EGO was identified by a series of transplantation experiments, mutational analyses and expression studies of Foxa2

and Lhx1 (Tam et al., 1997; Kinder et al., 1999; Kinder et al., 2001). EGO cells, as

characterized in transplantation experiments, can induce secondary axis formation that can give rise to the floor plate, axial and paraxial mesoderm, and endoderm; however, cells do not contribute to anterior neural structures (Beddington, 1994; Tam et al., 1997).

Lineage tracing experiments show that epiblast cells anterior and lateral to the EGO

contribute to the anterior axial mesoderm (Kinder et al., 2001). Thus the organizing

activity of the EGO does not encompass all the cells at the streak stage that pattern the

embryo. As the embryo develops, the EGO gets incorporated into the anterior end of

the primitive streak and lineage tracing studies demonstrate that cells that make up the

axial mesoderm arise from the anterior end of the EGO (Kinder et al., 2001).

The midstreak stage embryo is marked by the extension of the primitive streak towards the distal tip and the maturation of the EGO into the mid-gastrula organizer

(MGO) at the anterior end of the primitive streak. Like the EGO, the MGO was identified by gene expression and transplantation experiments. The MGO expresses a large set of genes associated with organizer activity such as Foxa2, required for axial mesoderm, and Brachyury (T), Noggin and Chordin, required for notochord development (Camus and Tam, 1999; Bachiller et al., 2000; Davidson and Tam, 2000;

Arnold and Robertson, 2009). The cells of the MGO can induce a secondary embryonic axis with both anterior and posterior characteristics and cell lineage studies show that it contains precursor cells that will give rise to most of the notochord and anterior axial mesoderm (Kinder et al., 2001).

The embryonic node arises from the anterior end of the primitive streak at the distal tip of the late streak embryo. Unlike both the EGO and MGO, the node is a

4 morphologically identifiable gastrula organizer. It is an epithelial bilaminar structure derived from epiblast cells. The dorsal layer is made up of ectoderm and the indented ventral layer is made up of compact definitive endoderm. Fate mapping studies indicate that at the midstreak stage, cells that make up the node arise from the MGO

(Beddington and Robertson, 1999). Transplantation studies show that cells of the embryonic node induce an embryonic axis that lacks anterior structures (Beddington,

1994). The contribution the node makes to anterior/posterior patterning has not been fully investigated. Ablation studies show that embryos lacking a node have dorsal/ventral and left/right patterning defects (Davidson et al., 1999). Foxa2 homozygous null mutants do not have a morphologically distinct node; however, these mutants have mostly normal patterning of the anterior/posterior axis as well as neural tube formation (Ang and Rossant, 1994). The correct development of the anterior/posterior axis despite the loss of the node suggests that the EGO and MGO at earlier stages provided the necessary signals to pattern the anterior/posterior axis of the embryo (Robb and Tam, 2004; Arnold and Robertson, 2009).

Establishment of left-right asymmetry

About twelve hours after the streak stage, at the early head fold stage the embryo is bilaterally symmetrical. This bilateral symmetry is broken when gene expression patterns begin to show asymmetric expression in the perinodal region.

Incorrect establishment of left-right asymmetry can lead to congenital cardiac malformations, vascular anomalies and serious health problems in the adult mouse, as well as in humans (Peeters and Devriendt, 2006). A number of mutations have been

discovered that result in complete reversal of laterality (situs inversus), bilateral development of either the left or right side (isomerism), or randomization of the situs of different organs (heterotaxia). The study of mouse mutants has led to the hypothesis that the determination of left-right asymmetry involves two main steps. The first is the initial breaking of bilateral symmetry by the generation of an asymmetric signal at the embryonic node (Figure 1A). The second is the transfer of the asymmetric perinodal signal to the left lateral plate mesoderm (LPM) where it initiates the expression of the gene Nodal (Figure 1B). Nodal governs developmental processes that lead to asymmetric development of organ systems (Hamada et al., 2002; Raya and Izpisua

Belmonte, 2004; Shiratori and Hamada, 2006; Takaoka et al., 2007).

The cells of the embryonic node contain motile monocilia that are essential to the

establishment of left/right asymmetry. Previous work demonstrates these cilia beat

rotationally in a clockwise direction when viewed from the posterior/ventral aspect of the

embryo. Because they have a posterior tilt with respect to the anterior/posterior axis of

the embryo, the nodal cilia create a directional flow of extracellular fluid which leads to

asymmetric perinodal expression of Nodal (Figure 1A) (Nonaka et al., 1998; Okada et

al., 1999; Takeda et al., 1999; Nonaka et al., 2005; Okada et al., 2005).

Currently there are two models that explain how nodal flow establishes left/right

asymmetry: the morphogen gradient model and the two-cilia model. The morphogen

gradient model postulates that an extracellular morphogen is released from microvilli on

the surface of nodal cells, packaged in membrane bound vesicles and then transported

by the nodal flow to the left side of the embryo where they liberate the morphogens and

activate Ca2+ signaling. Retinoic acid and Sonic Hedgehog may act as morphogens in

the node as both are secreted molecules that are expressed in the node. Both Retinoic

acid and Sonic Hedgehod are also necessary for correct establishment of left/right asymmetry (Hamada et al., 2002; Tanaka et al., 2005). Presently, however, there is no evidence to support asymmetric Hedgehog signaling in the mouse embryonic node and

Retinoic Acid seems to be necessary for the expression of Lefty1 at the midline after asymmetric perinodal signaling is established. It is therefore hypothesized that Shh and

Retinoic Acid are acting to maintain the midline after the asymmetric signal generated at the node is transferred to the left LPM (Zhang et al., 2001; Hamada et al., 2002;

Schlueter and Brand, 2007). The two-cilia model proposes that the flow generated by motile cilia is sensed by mechanosensory cilia at the periphery of the node. The mechanosensory cilia induce an increase in intracellular Ca2+ on one side of the

periphery of the node, which then causes a succession of asymmetric gene expression events (McGrath et al., 2003). Support for this model comes from the mutant analysis of Pkd2, a protein that stimulates an increase in intracellular calcium in response to fluid flow in the kidney (Nauli et al., 2003). Pkd2 mutants have bilateral expression of asymmetric genetic markers such as Lefty1, Lefty2, and Pitx2, while mice with mutations in cilia motility genes show a randomization of laterality markers (McGrath et al., 2003; Nauli et al., 2003). Recently it was shown that Pkd2 is required specifically in the perinodal crown cells for sensing nodal flow and activating intracellular Ca2+

signaling. Embryos that had rescue of Pkd2 expression specifically in the crown cells

of the node had correct asymmetric expression of left/right specific genes. The study

also demonstrated that embryos that only contain cilia in the crown cells of the node

and in which flow is restored artificially have correct asymmetric expression of Pitx2

(Yoshiba et al., 2012). These results provide strong evidence for the two-cilia model of

establishment of left/right asymmetry.

Homozygous embryos with a mutation for inversus viscerum or iv have left/right situs inversus. The iv gene codes for left-right dynein, an essential component of cilia motility. The iv homozygous mutants do not generate an asymmetric flow of extra cellular fluid at the node and this leads to randomization of asymmetrically expressed genes in the LPM (Supp et al., 1997). Homozygous mutants for genes necessary for node ciliogenesis, kif3a, kif3b, and Polaris (Ift88) also show heterotaxia and situs inversus. The Polaris gene codes for a protein involved in both cilia assembly and intraflageller transport (Murcia et al., 2000). Through these analyses it is clear that node cilia play an essential role in generation of the asymmetric signal in the node.

The asymmetric signal generated at the node leads to left perinodal expression of Nodal. Gdf1 and Cer2 regulate the perinodal activity of Nodal. Nodal signaling is transferred to the left lateral plate mesoderm, where it regulates expression of Lefty2 and Pitx2 in the left LPM. Lefty 2 acts as a negative regulators of Nodal in the left LPM and Pitx2 directs heart looping direction (Figure 1) (Collignon et al., 1996; Lowe et al.,

1996; Lowe et al., 2001; Brennan et al., 2002b; Saijoh et al., 2003a).

Gdf1 is a member of the TGF beta family of proteins and is expressed bilaterally in the perinodal region and LPM between E8.0 and E8.5 (Figure 1A). Homozygous mutants carrying a null mutation of Gdf1 do not express Nodal in the lateral plate mesoderm and show heterotaxia and situs inversus (Rankin et al., 2000). Previous studies demonstrate that perinodal Gdf1 perinodal expression is essential for the left

LPM expression of Nodal. Gdf1 is hypothesized to bind and enhance the activity of

Nodal protein as well as shuttle Nodal from the perinodal region to the left LPM (Tanaka

et al., 2007).

On the other hand, in addition to promoting Nodal activity on the left side, Cer2

acts as a Nodal antagonist to limit Nodal activity on the right side of the perinodal region.

At the early headfold stage, Cer2 is asymmetrically expressed in the perinodal region with higher expression on the right side. The fluid flow generated by node cilia initiates asymmetric decay of Cer2 mRNA on the left side of the perinodal region (Figure 1A).

The asymmetric perinodal expression of Cer2 is maintained by Wnt3-Cer2 interlinked feedback loops in which Wnt3 promotes the degradation of Cer2 mRNA on the left side of the node and Cer2 inhibits Wnt3 on the right side of the node (Nakamura et al., 2012).

There are several cell signaling pathways that impinge on perinodal signaling.

The canonical Notch and Wnt signaling pathways regulate perinodal expression of

Nodal. Homozygous Dll1 mutants have randomized situs and do not express Nodal in

the perinodal region. Dll1 homozygous null mutants also do not express Nodal, Lefty2,

and Pitx2 in the left lateral plate mesoderm. Previous studies have demonstrated that

Wnt3 is necessary for asymmetric expression of Cer2. Homozygous mutant embryos

carrying a null mutation of the canonical Wnt ligand, Wnt3a, have randomized laterality

of organs and show a decrease in perinodal and lateral plate mesoderm expression of

Nodal. Wnt3a homozygous mutants also show a decrease in Dll1 expression in the

perinodal region, which has been hypothesized to account for the observed decrease in

perinodal Nodal expression (Nakaya et al., 2005b).

Fgf8 is a member of the fibroblast growth factor signaling family. Homozygous

null mutants for Fgf8 do not undergo gastrulation as cells ingress through the primitive

9 streak but fail to migrate (Sun et al., 1999). Fgf8 hypomorphic mutants display a variable hypomorphic phenotype. Embryos have a wide range of developmental abnormalities, which include defects in neural development, cardiac malformations and failure of posterior development. Fgf8 hypomorphs also have left-right asymmetry defects and do not express Nodal in the perinodal region. Thus, Fgf8 functions to regulate perinodal expression of Nodal (Meyers et al., 1998; Meyers and Martin, 1999).

Recent findings have shown that definitive endoderm gap junction mediated signaling plays a role in determination of left/right asymmetry. Sox17 homozygous mutants have an irregular expression pattern of Nodal in the LPM and show an absence of Pitx2 expression in the left lateral plate mesoderm. They also have definitive endoderm defects, which includes the absence of Cx43, a protein necessary for gap- junction-mediated signal transfer. Normal embryos that are cultured in media that inhibit signaling through gap junctions do not express Lefty1 and Lefty 2 in the midline and left LPM respectively (Viotti et al., 2012). Previous studies have focused on the idea that Nodal is physically shuttled to the left LPM; these studies provide an alternate to the secreted model, in which the asymmetric signal generated at the node is transferred through the endoderm to the left LPM (Viotti et al., 2012).

Axial elongation and somitogenesis

Between E8.0 and E9.5, the mouse embryo establishes left/right asymmetry and continues to elongate its anterior/posterior axis. The cells of the epiblast continue to ingress through the regressing primitive streak. The embryo then undergoes the process of turning, reversing its previous topography such that the ectoderm is now on

the outside and the definitive endoderm is on the inside and enveloping itself in its embryonic and extraembryonic membranes. Prior to and during this period, paraxial

mesoderm is undergoing a mesenchymal to epithelial transition and differentiates into

paired epithelized blocks called somites. At E10.0 the primitive streak is replaced by a

population of mesodermal cells at the distal tip of the tailbud. The tail bud gives rise to

neural tube, notochord, gut endoderm, somitic and lateral mesoderm tissue of the tail

region as axis elongation continues. Therefore, the tail bud is hypothesized to be a late gastrula organizer that patterns the posterior structures of the embryo (Tam, 1984; Tam

and Beddington, 1992). Though the tail bud organizer properties of the mouse embryo

have not been characterized, experiments in zebrafish point to an organizer in the tail

bud that can induce ectopic tail formation of its host with the requirement of BMP, Wnt,

and Nodal signaling (Agathon et al., 2003). The tail bud of the mouse embryo also expresses components of the BMP and Wnt signaling pathway along with others such

as Fgf and Noggin, which are critical for organizing the streak stage embryo. The

ventral ectodermal ridge of the embryonic tailbud has been shown to be a source of

BMP and Fgf signaling that is critical for the viability and proliferation of tail bud mesenchyme (Goldman et al., 2000). It is hypothesized that Noggin may act as a BMP

antagonist, similar to the EGO to pattern the tissues that arise from the tailbud (Robb

and Tam, 2004).

Somitogenesis occurs between E8.0 and E14.5. New somites develop

periodically in a cranial to caudal manner. Somite segmentation relies on a molecular

oscillator called the segmentation clock, which describes the oscillating rhythmic

expression of genes in the presomitic mesoderm (PSM). Many of these cyclically

expressed genes are linked to the Notch signaling pathway and play a role in the

anterior/posterior patterning of somites. The dynamic temporal and spatial expression

sequence of these genes is described in three phases of expression: phase 1, gene

expression is localized to the caudal end of the PSM, phase 2 describes broad

expression in the middle region of the PSM, and phase 3 is discrete gene expression in

structures about to undergo segmentation (Pourquié and Tam, 2001).

Somites can be divided into different regions along the dorsal/ventral axis: the

dermatome provides cells that make up the dermis of the trunk and tail and the

sclerotome provides precursors to the vertebrae and ribs, the myotome gives rise to the

muscles of the vertebrae, back, body wall and limbs (Brand-Saberi and Christ, 2000).

Studies of Hoxc8 homozygous mutants show homeotic transformation of posterior

somites to give rise to anterior structures (Le Mouellic et al., 1992). This suggests that

Hox genes help to specify the anterior/posterior identities of somites. The neural tube

and notochord provide patterning signals for the dorsal/ventral identity of somites.

Removal of the neural tube from embryos causes a defect in axial muscle development

(Christ et al., 1992). Shh signaling, which first arises from the notochord, also plays a

role in the dorsal/ventral patterning of somites (Rong et al., 1992; Borycki et al., 1998).

T-box genes in early mesoderm development and somitogenesis

T-box proteins are a family of transcription factors defined by a common DNA binding motif (Agulnik et al., 1996). Orthologs of T-box genes among vertebrates have highly conserved expression patterns as well as functions. Study of both spontaneous and induced mutations has led to the conclusion that T-box genes act as regulators of

development and differentiation for a large range of tissues and organs (Papaioannou,

2001; Naiche et al., 2005).

The earliest characterized developmental role for T-box genes is that of

Eomesodermin (Eomes) in the development of the trophectoderm and mesoderm

formation. Eomes is first expressed in the trophectoderm at E3.5 and later on at E5.0 in

the extra embryonic ectoderm. At the start of gastrulation, at E5.75, Eomes is

expressed in the extra embryonic ectoderm and primitive streak and later in the

primitive streak, mesodermal wings and chorionic ectoderm. Homozygous null mutants

for Eomes arrest at the blastocyst stage and trophectoderm does not differentiate into trophoblast. Chimeric rescue mutant embryos that avoid the trophectoderm defect fail to develop mesoderm (Russ et al., 2000).

Brachyury (T) is first expressed in the epiblast in the prestreak embryo and, as

the embryo develops, expression is in the primitive streak and the embryonic node. T

plays a major role in the development of posterior structures. Mice heterozygous for a

T null allele are viable and fertile but have shortened tails; homozygous embryos lack

posterior somites after the seventh pair, have no distinguishable notochord, have a

convoluted neural tube and die at midgestation (Gruneberg, 1958; Beddington et al.,

1992). T homozygous null mutants also have left/right asymmetry defects (King et al.,

1998).

Tbx6 is first expressed in the primitive streak. As the embryo develops, Tbx6 expression is localized to the presomitic mesoderm and later, the tailbud. Tbx6 homozygous null mutants have enlarged tail buds and ectopic neural tubes in place of posterior somites. Tbx6 homozygous null mutants also have irregular development of

13 anterior somites and left/right asymmetry defects that lead to randomization of heart looping. Work with a hypomorphic allele of Tbx6 reveals a role in anterior/posterior somite patterning (Chapman et al., 1996; Chapman and Papaioannou, 1998; Watabe-

Rudolph et al., 2002; Hadjantonakis et al., 2008).

Several other T-box genes are segmentally expressed in the somites and presomitic mesoderm. Tbx18 and Tbx22 are closely related members of the Tbx1 subfamily. Both Tbx18 and Tbx22 have overlapping expression in the presomitic mesoderm and somites (Bush et al., 2002; Farin et al., 2007). However, only Tbx18 homozygous mutants show defects in maintenance of anterior/posterior polarity of the somites (Bussen et al., 2004). Tbx18 has been hypothesized to repress Dll1 and

Uncx4.1 in anterior somites downstream of Mesp2 and Notch signaling (Bussen et al.,

2004; Farin et al., 2007).

The mechanism by which the T-box genes, T and Tbx6 affect determination of left/right asymmetry is still unknown. In this study we investigated the role of T in determination of left/right asymmetry by characterizing the defects of a dominant negative allele of T, TWis. We looked at the expression of left/right specific genes and node morphology in TWis mutants to determine how T normally functions to regulate determination of left/right asymmetry. We investigated whether T also plays a role in specifying structures of the midline in addition to the notochord.

Tbx6 affects determination of left/right asymmetry, establishing mesoderm identity of presomitic mesoderm and somite patterning. We investigated the function of

Tbx6 in determination of left/right asymmetry by looking at the expression of transcription factors necessary for node and node cilia formation, components of non-

14 canonical Wnt signaling pathway, and a component of the Nodal signal transduction pathway, Gdf1 in Tbx6 homozygous null mutants. We investigated the role of Tbx6 in presomitic mesoderm by looking for possible direct targets for Tbx6 and then characterizing their expression in Tbx6 homozygous mutants. Investigation of these two related factors elucidated multiple roles for these two genes during gastrulation and determination of left/right asymmetry.

Figure 1: Model for molecular establishment of left/right asymmetry A. Cer2 is asymmetrically expressed in the perinodal region with higher expression on the right side. Cer2 right asymmetric perinodal expression directs asymmetric left perinodal expression of Nodal. Gdf1 is bilaterally expressed in the perinodal region. B. Nodal is shuttled from the perinodal region to the left lateral plate mesoderm where it regulates expression of itself, Pitx2 and Lefty2.

Chapter 2: The role of Brachyury in node and midline development

Introduction

The embryonic node is a transient structure present between E7.5 and E9.5.

Lineage tracing studies demonstrate that the node arises from cells of the anterior portion of the primitive streak (Kinder et al., 2001). The node is located at the anterior end of the primitive streak and is made up of a bilayer of epithelial cells. The node gives rise to the notochord and floor plate and is an essential structure in the correct establishment of left/right asymmetry (Tam and Beddington, 1987; Hamada et al., 2002).

The ventral node cells contain motile monocilia located at the posterior pole of each cell.

These cilia beat in a clockwise direction to create a flow of extracellular fluid from the right side of the node to the left. The correct position, morphology and motility of these cilia are all essential to create a unidirectional flow of extra cellular fluid (Watanabe et al.,

2003). This flow directs the asymmetric expression of genes in the perinodal region such as the TGF-beta family member Nodal, and its antagonist Cer2 (Nakamura et al.,

2012), which creates an asymmetric cascade of gene expression that leads to asymmetric organogenesis (Saijoh et al., 2003b; Nakamura et al., 2012).

Brachyury (T) was the first T-box gene identified in mice (Dobrovolskaia-

Zavadskaia, 1927). It is first expressed in the epiblast in the prestreak embryo and, as the embryo develops, is expressed later in the primitive streak and embryonic node.

Mice heterozygous for a T null allele are viable and fertile but have shortened tails; homozygous embryos lack posterior somites after the seventh pair, have no distinguishable notochord, have a convoluted neural tube and die between E10.5 and

E11.5 (Gruneberg, 1958; Beddington et al., 1992). T homozygous null embryos also

17 have severe left/right asymmetry defects. Embryos show ventral heart looping defects and lack of expression of Nodal at stages when the gene is normally expressed in the perinodal region and left lateral plate mesoderm (LPM). There is abnormal expression of

Lefty-1, a marker of the left floor plate, and Lefty-2, a marker of the left LPM.

Homozygous T mutants also have defects in both node and neural tube formation

(Beddington et al., 1992; King et al., 1998). However in T mutants, node cilia have not been examined and the expression of genes necessary for the development of the node and its derivatives is unknown.

TWis is a spontaneous mutation of T that comprises an insertion of a transposon-

like element into the 3’ end of the seventh exon. The insertion creates a mutated splice

site that results in the loss of wild type T mRNA. TWis produces transcripts that bypass the mutated exon 7 splice site but contain the T-box binding domain. Mutant proteins are hypothesized to compete with wild type T for DNA binding sites thus producing a dominant negative phenotype that is more severe than the null allele (Goldin and

Papaioannou, 2003). TWis heterozygous mice have no tails and homozygous mutant embryos, have no notochord and lack all somites (Shedlovsky et al., 1988). In TWis

homozygous mutants, precursors of the notochord are present, as seen by double

labeling experiments with T antibody and Shh. However, precursor cells do not survive

and no distinguishable notochord is formed, as seen by the lack of Shh expression in

the midline at the 9-somite stage. The lack of a notochord leads to neural tube defects.

TWis homozygous mutants die between E10.5 and E11.5 (Shedlovsky et al., 1988;

Conlon et al., 1995). The morphology of the node and node cilia and the left/right

asymmetry phenotype of TWis mutants have not been previously characterized.

In this study we investigated the left/right asymmetry phenotype of the TWis

homozygous mutant including the expression of left/right specific genes as well as

components of the Wnt and Notch signaling pathways. We also examined the node

and its derivatives in TWis homozygous mutants.

Results

Heart looping and embryo turning defects in TWis /TWis mutants at E9.5-E10.5

To investigate left/right asymmetry defects, we crossed TWis heterozygotes, collected embryos between E9.5 and E10.5 and determined the direction of heart looping and embryo turning. Homozygous TWis mutant embryos are evident by a severe

axial elongation defect that results in a loss of posterior structures. Analysis of heart

looping in +/+ and TWis/+ embryos, showed that 98% of embryos (97/99) undergo

dextral looping, the normal asymmetric process in which the inflow and outflow tract are

on the left and right side of the embryo, respectively, and the ventricles are

perpendicular to the rostral/caudal axis (Table 1; Figure 1A,B). Ninety seven percent of

wild type embryos (90/93) showed normal leftward direction of embryo turning, which

results in the asymmetric placement of the placenta and tail on the right side of the

embryo and vitelline vessels exiting to the left side of the embryo (Table 1; Figure 1K).

As the heterozygous embryos are included in the wild type category, these results

indicate that TWis/+ embryos do not have a left/right asymmetry defect and thus can be

referred to as wild type for the purpose of this study.

Among TWis/TWis embryos, 6% (2/32) showed normal dextral looping (Table1;

Figure 1C,D); 13% (4/32) had dextral/ventral looped hearts (Table1; Figure 1E,F), in

19 which there is correct placement of the inflow and outflow tracts while the right and left ventricles are aligned on the rostral-caudal rather than the left-right axis. Three TWis/TWis mutants (9%) showed hearts that were ventrally looped, in which the ventricles as well as the inflow and outflow tracts aligned on the rostral-caudal axis (Table 1) and 22%

(7/32) showed sinestral/ventral looped hearts, where the right-left position of the inflow and outflow tract was reversed (Table 1; Figure 1G,H). In 50% of TWis homozygous mutants we observed sinestral looped or “J” shaped hearts (Table 1; Figure 1I,J), which indicates a complete reversal of heart looping.

Among TWis/TWis mutants, 52% (12/23) showed reversal of embryo turning in which the placenta was located on the left side of the embryo and vitelline vessels exited from the right side of the embryo (Table 1 Figure 1L). Among embryos that were scored for both heart looping and embryo turning, 97% (90/93) of wild type embryos and 17%

(4/23) of TWis/TWis mutants showed normal heart looping and embryo turning while 43%

(10/23) of mutants showed situs inversus, in which both the direction of heart looping and embryo turning were reversed, and 39% (9/23) showed heterotaxia, in which the direction of heart looping did not correlate with direction of embryo turning (Table 1).

TWis/TWis mutants therefore have an increased incidence of situs inversus and heterotaxia compared with wild type embryos.

Expression of left/right-specific genes in wild type and TWis/TWis mutants at E8.0-

E8.5

Nodal is first expressed in the perinodal region in wild type embryos (n=12) at

E8.0 and by the 3-somite stage is seen in the perinodal region, with higher expression on

20 the left, and in the left LPM (Figure 2A,B) (Brennan et al., 2002b). TWis/TWis mutant embryos show a complete absence of nodal expression at comparable stages (n=5;

Figure 2C,D). Gdf1, a Nodal agonist, is expressed bilaterally in the perinodal region at

E8.0, as well as bilaterally in the LPM in wild type embryos (n=8; Figure 2E,F) (Rankin et al., 2000). In TWis/TWis mutant embryos, Gdf1 expression is absent in the perinodal region; however, bilateral LPM expression is maintained (n=5; Figure 2G,H). Cer2, a

Nodal antagonist, shows bilateral perinodal expression in wild type embryos at E8.0 with higher expression on the right side (n=8; Figure 2I, J) (Nakamura et al., 2012). In

TWis/TWis mutant embryos there is no expression of Cer2 (n=6; Figure 2K, L). Pitx2, a downstream target of Nodal, is asymmetrically expressed in the left LPM and regulates the direction of heart looping; its expression is used as a molecular readout for correct establishment of left/right asymmetry. In wild type embryos at E8.5, Pitx2 expression is observed in the left inflow tract of the heart, as well as the head folds (n=11; Figure 2M,

N) (Lin et al., 1999). In TWis/TWis mutants, Pitx2 expression is present in the head folds but absent from the left inflow tract (n=5; Figure 2O,P). These findings indicate that the

Nodal signal transduction pathway is severely perturbed in TWis/TWis mutants.

Characterization of the node of wild type and TWis homozygous mutants at E8.0

To detect differences in node morphology between TWis mutants and wild type embryos, we used scanning electron microscopy (SEM) and immunofluorescence with confocal microscopy at E.8. By SEM, wild type embryonic nodes (n=6) appear oval shaped at the early headfold stage (EHF) (Figure 3A) and shield shaped at the late headfold stage (LHF) (Figure 3B). The nodes have a distinct border distinguishing the

21 smaller, cobblestone-like node cells from the larger surrounding endoderm cells.

Monocilia are present on the node cells (Figure 3A,B insets). Three out of four nodes of

TWis homozygous mutants lacked a distinct border and cells of all mutant nodes were less distinct, lacking the cobblestone appearance, and less regular in size than in wild type embryos. Normal appearing cilia were present (Figure 3C,D insets) as confirmed by confocal microscopy and immunofluorescence with antibodies against acetylated tubulin, a marker of tubulin and node cilia (Figure 3E). However, wild type embryos contained a significantly larger number of nodal cilia on average (138 ± 22) than TWis homozygous mutants (35 ± 8 cilia) as measured by a Mann Whitney U non-parametric statistical test

(p=0.009).

The size of the node at the headfold stage was estimated in two ways. From confocal z-stacks of embryos stained with antibodies against acetylated tubulin and ZO1, a gap junction marker, the surface area was estimated by first identifying the node as a bilaminar epithelial cell structure second, measuring the xy length of the bilayer in each optical section, third, multiplying by the interval step of the z-stack and finally, summing all the resulting areas. In two of the five TWis homozygous mutants no defined embryonic node could be identified and were counted as zero (Figure 3A). TWis homozygous mutants had a significantly smaller node surface area (n=5) than wild type embryos

(n=6) as measured by a Mann Whitney U test (p <.01, Figure 3A). A second approach to calculate surface area was to measure it directly from the SEM pictures. Wild type nodes have a significantly greater surface area (n=6, 4001μm2 ± 324μm2) than TWis homozygous mutants (n=4, 1307 μm2 ± 440μm2) as measured by a Mann Whitney U test

(p <.01).

Expression of midline markers in wild type and TWis homozygous mutants at E8.0

To determine whether the morphological abnormalities of the node in TWis

homozygous mutants affect node derivatives, we looked at the expression of genes at

E8.0 that mark the node and tissues known to arise from the node. Foxa2 marks the

prospective floor plate and the node in wild type embryos (Figure 4A,B) (Kinder et al.,

2001). Expression was not detected in the floorplate in TWis homozygous mutants (n=4),

but was present in the node at the distal tip of the embryo at a lower level than wild type

controls (Figure 4C,D). Shh is expressed in the prechordal plate, notochordal plate and

embryonic node in wild type embryos (Figure 4E,F) (Jeong and Epstein, 2003). No Shh expression was observed in three TWis homozygous mutants (Figure 4G,H), whereas a

fourth showed Shh expression in the prechordal plate, but not in the rest of the midline

or the node (data not shown). Gsc, which is expressed in the anterior foregut endoderm,

prechordal plate and midline neuroectoderm, in both wild type and TWis homozygous mutants (n=4) (Chu et al., 2005). However Gsc is expressed at a lower level in TWis

homozygous mutants (n=4) when compared to wild type controls (Figure 4I-L).

Expression of components of the canonical Wnt and Notch signaling pathways in wild type and TWis homozygous mutants at E8.0

TWis/TWis mutants lack expression of Nodal as well as other genes involved in the

Nodal signal transduction pathway (Figure 2). Therefore an upstream regulator of these

genes may be affected in TWis/TWis mutants. The canonical Wnt signaling pathway

regulates perinodal expression of Nodal by regulating Notch signaling (Nakaya et al.,

2005a). Mutations in Notch signaling components lead to a loss of perinodal Nodal

expression (Krebs et al., 2003b).

In wild type embryos at E8.0, Wnt3a is expressed throughout the primitive streak (n=5, Figure 5A-C) (Nakaya et al., 2005a). Stage matched TWis/TWis mutants showed no difference compared to their wild type littermates (n=5; Figure 5D-F). Dll1 is an essential ligand in the Notch pathway and in wild type embryos at E8.0 is expressed in the primitive streak and the presomitic mesoderm (n=5; Figure 5G-I) (Krebs et al.,

2003a). Stage matched TWis/TWis mutant embryos show an absence of Dll1 expression in most of the presomitic mesoderm while maintaining some level of bilateral Dll1 expression at the distal tip of the embryo (n=5; Figure 5J-L).

Discussion

Previous studies with the T homozygous null embryos showed that they have

left-right asymmetry defects including in heart looping and do not show any specific expression of Nodal in the perinodal region or left LPM. Homozygous mutants of T also do not express Lefty1 in the floorplate or Lefty2 in the left LPM (King et al., 1998). T homozygous mutants also have defects in node morphology as seen under light microscopy (Beddington et al., 1992; Conlon et al., 1995; King et al., 1998). Work with homozygous mutants that contain the dominant negative allele of T, TWis, shows that mutants do not develop a notochord, a derivative of the node, and fail to express Shh, a marker of the notochord and ventral neural tube, at nine somites (Beddington et al.,

1992; Conlon et al., 1995).

Our study of the left-right asymmetry defect of TWis homozygous mutants confirms and extends how T plays a role in determination of left/right asymmetry. Like T, homozygous TWis mutants have morphological left/right asymmetry defects and TWis

heterozygous embryos did not show any left/right asymmetry defects. The TWis allele

does not seem to be acting as a dominant negative allele in determination of left/right

asymmetry as heterozygous embryos show no left/right asymmetry defects. TWis

heterozygous embryos may still have enough functional T protein to correctly establish

left/right asymmetry. Unlike the T null, we observed instances of dextral and sinestral

looped hearts in TWis homozygous mutants most likely due to a larger sample size within

a wider developmental range than in the previous study (King et al., 1998). TWis

homozygous mutants have no expression of Nodal, Cer2, and Gdf1 in the perinodal

region. As asymmetric left LPM expression of Nodal is dependent on Cer2 and Gdf1

perinodal expression and Nodal regulates the expression of other asymmetrically

expressed genes such as Pitx2 in the left LPM and left inflow tract, the loss of perinodal

expression of Nodal, Cer2 and Gdf1 explains why TWis homozygous mutants have no

expression of Pitx2 in the left inflow tract.

In our study TWis homozygous mutants showed severe node morphological defects that range from lack of a distinguishable node to a smaller node with defects in cellular morphology and organization. In addition, TWis/TWis mutant nodes have fewer cilia. The expression pattern of markers for the midline, Shh, Foxa2 and Gsc, is altered in TWis homozygous mutants. Shh expression is lost at E8.0 in TWis homozygous mutants, which agrees with previous work (Conlon et al., 1995). TWis homozygous mutants do not express Foxa2 in the prospective floor plate and have reduced expression in the node. T

25 is therefore regulating the expression of Foxa2 in these areas at E8.0. Both TWis and

Foxa2 homozygous mutants have node morphology defects and fail to form a notochord

(Kinder et al., 2001). Foxa2 also regulates Shh expression in the notochord and floor plate (Jeong and Epstein, 2003). At the early streak stage both T and Foxa2 are expressed in precursors of the mouse organizer located at the posterior end of the epiblast (Beddington et al., 1992; Ang and Rossant, 1994). T may directly regulate the expression of Foxa2 at the early streak stage. Defects in TWis homozygous mutant node morphological could be a result of a loss of Foxa2 expression at the early streak stage, which would lead to a patterning defect of node precursor cells. A detailed expression analysis of Foxa2 at the streak stages in TWis homozygous mutants would address this issue. Chimera experiments show that cells that do not have any T protein do not ingress through the primitive streak and accumulate at the midline (Wilson et al., 1993).

Thus an alternative explanation for TWis homozygous mutants not expressing Foxa2 is that posterior epiblast cells have problems migrating away from the primitive streak.

A previous study suggested that precursor cells of the node are unaffected in

TWis homozygous mutants as Gsc expression is not affected at the early streak stage

(Conlon et al., 1995). However, since Gsc homozygous null mutants have no node or

midline defects (Rivera-Pérez et al., 1995) its gene expression is not an accurate

marker for assessing whether or not node precursors cells are affected in TWis

homozygous mutants. Along with investigation of Foxa2 expression in TWis homozygous mutants at streak stages, expression of other genes necessary for node and notochord formation and specification such as Noto and Chordin, would address whether T

regulates the formation and differentiation of precursors of the node.

We investigated the expression of genes involved in cell signaling pathways

known to regulate perinodaly-expressed genes. Expression of the canonical Wnt

signaling pathway gene, Wnt3a, is unaffected in TWis homozygous mutants. This result

agrees with published work which show Wnt3a acting upstream of T (Hofmann et al.,

2004a). Expression of Dll1, a co-receptor of the Notch signaling pathway, was absent

from the primitive streak, posterior end of the embryo and node in TWis homozygous mutants, while some bilateral expression was still observed in the distal tip. This loss of

Dll1 in is in agreement with a previous study that reports that canonical Wnt signaling and T-box genes such as T and Tbx6 cooperate to regulate the Notch signaling pathway during development (Hofmann et al., 2004a). The alteration in Dll1 expression may account for the defects observed in TWis homozygous mutants. Dll1 homozygous

mutant embryos show no expression of Nodal in the perinodal region. Mutants also

have node and notochord morphological defects along with improper pattering of the

floorplate. The morphological defects in Dll1 mutant embryos are hypothesized to be

the cause of the observed left/right asymmetry phenotype (Przemeck et al., 2003).

Further investigation would clarify whether T regulates other components of the Notch

signaling pathway such as Notch 1, which has an overlapping expression with T in the

primitive streak and the node. Investigating if Notch signaling is involved in regulating

the expression of Foxa2, and Chordin at early streak stages would address how it may function with T to pattern the node and its derivatives. Our observations agree with previous work and provide a more detailed analysis of the specific morphological and molecular defects in TWis homozygous mutant embryos.

Materials and Methods

Mice and embryo collection

The TWis mutant allele (Shedlovsky et al., 1988) was maintained on a mixed

genetic background including A/J, C57,129 and ICR (Taconic). TWis heterozygous mice,

which are viable and fertile, were mated together to obtain +/+, TWis/+, and TWis/TWis

embryos between E8.0-E9.5 (E0.5 denotes noon of the day a vaginal plug was

observed). Embryos were removed from the uterus and dissected out of the decidua

leaving the yolk sac and placenta intact. Placement of the tail, placenta and vitelline

vessels was recorded. The yolk sac was then removed and heart morphology and the

direction of heart looping was recorded. At E8.0-E8.5, TWis/TWis mutant embryos were

identified based on the lack of an allantois. At E9.5-E10.5 TWis/TWis mutant embryos

were identified based on axial truncation defects. TWis/+ and +/+ embryos were

indistinguishable at this early age and were considered together as wild type controls.

Wild type embryos were staged by somite number and TWis/TWis mutant embryos were

staged by morphology of the head.

In situ hybridization

Embryos were dissected in phosphate buffered saline (PBS) containing 0.2%

albumin bovine serum (Sigma), fixed overnight in 4% paraformaldehyde (PFA) in PBS

at 4°C, dehydrated in 100% methanol and stored at -20°C. Whole mount in situ hybridization using antisense RNA probes was performed as described previously

(Wilkinson, 1998).

Immunofluorescence and confocal microscopy

Embryos were dissected in PBS and fixed in fresh prechilled (4°C) PBS with

0.5% PFA overnight at 4°C. Embryos were blocked in cold 1% BSA and 10% goat

serum (heat inactivated and filtered, 22µM), 0.5 Triton X-100 (Sigma) in PBS from 45

min to overnight at 4°C. Primary antibody incubation was carried out in 1% BSA, 2%

Goat serum and 0.5% Triton X-100 in PBS overnight at 4°C. Embryos were incubated in secondary antibody in 1% BSA, 2% Goat serum, and 0.5% Triton X-100 in PBS

overnight at 4°C. Embryos were mounted in vectashield (Vector Labs) between two

coverslips in a well cut out from several layers of electrical tape. ZO1 (Zymed) was

used at a 1:200 and mouse anti-acetylated tubulin (Invitrogen) was used at a concentration of 1:400.

Embryos were imaged using a Nikon A1RMP two-photon microscope. Optical z sections of mounted embryos were taken at .5μm intervals using a Nikon 25x/1.1NA water immersion objective. Optical sections were compiled into z-stacks for individual embryos. NIS-elements AR 4.0 software was used for acquisition and analysis of z- stacks. Surface area analysis was done using ImageJ (http://rsbweb.nih.gov/ij/).

Scanning Electron Microscopy

Embryos were dissected in prechilled PBS with 0.05% Triton X-100 (Fisher) and

fixed in 2.5% PFA, 2.5% gluteraldehyde in 0.075M sodium cacodylate buffer, pH 7.4

(Scanning Electron Microscopy Sciences) rocking overnight at 4°C. Embryos are placed in 100% ethanol for critical point drying using a Denton JCP-1 critical point dryer.

Critical point dried embryos are placed on a piece of carbon tape and plated with

Gold/Palladium in a Denton Vacuum 1V Sputter/Dryer. Embryos are then imaged on a

Zeiss Field Emission Scanning Electron microscope Supra 25.

Table 1: Heart looping and embryo turning in wild type and TWis/ TWis homozygous mutants at E9.5-E10.5.

Direction of Heart Looping Embryo Turning Situs Dextral/ Sinestral/ N Dextral Ventral Sinestral N Normal Reversed N Normal Inversus Heterotaxia ventral ventral Genotype

1 97 90 Wild type 99 0 0 0 2 (2%) 93 3 (3%) 93 90 (97%) 1 (1%) 2 (2%) (98%) (97%)

Wis Wis 11 10 T /T 32 2 (6%) 4 (13%) 3 (9%) 7 (22%) 16 (50%) 23 12 (52%) 23 4 (17%) 9 (39%) (48%) (43%)

1Wildtype includes both +/+ and TWis/+ embryos. 30

Figure 2: Heart looping and embryo turning in TWis/TWis mutant and wild type embryos at E9.5 A-J. Left and frontal views of head and heart of E9.5 embryos showing a wild type dextral looped heart (A, B) and TWis/TWis mutant embryos with a dextral looped heart (C, D), dextral/ventral looped heart (E, F), sinestral/ventral looped heart (G, H), and sinestral looped heart (I, J). Yellow “C” in panel B indicates dextral heart looping and orange “J” in panel J indicates sinestral heart looping. K, L. Frontal view of embryos within the yolk sac with the placenta attached. The wild type embryo (K) has turned toward its right side; vitelline vessels exit on the embryo’s left side and the placenta is on the right side. In the TWis/TWis mutant embryo the vitelline vessels exit the embryo on the right side and placenta is on the left (L). PL, placenta; VV, vitelline vessels; YS, yolk sac.

Figure 3: Expression of left/right specific genes in TWis/TWis mutant and wild type embryos at E8.0 A-L. Left lateral and ventral views of wild type (A-F, I,J) and TWis /TWis (C-H, K,L) embryos showing the expression of Nodal in the perinodal region and left LPM in wild types (A,B), and no expression in TWis /TWis (C,D); Gdf1 bilateral expression in the perinodal region and LPM of wild types (E,F), and only bilaterally in the LPM of TWis /TWis mutants, and and Cer2 bilateral perinodal expression in wild types (I,J) and no expression in TWis /TWis mutants (K,L). Black arrowheads indicate LPM and black arrows indicate the perinodal region. M-P. Frontal views of Pitx2 expression in the head folds and left inflow tract in wild type embryos (M,N) and in the head folds in TWis /TWis mutants (O,P). Pitx2 expression on the right side of TWis /TWis mutants is specific to the yolk sac remnants still attached to the embryo and absent from the left inflow tract. Red arrows indicate left inflow tract and red arrowheads indicate Pitx2 expression in the head folds. Al, allantois; Hf, headfolds; H, heart. 32

Figure 4: Confocal and scanning electron microscopy of TWis/TWis mutant and wild type embryos at E8.0 A-D. Scanning electron microscopy of the embryonic node in wild type (A,B) at early headfold (A) and LHF (B) stage and TWis/TWis mutants at early and late head fold stages (C,D). The left inset of each panel corresponds to a ventral view of the embryo at 300X magnification. The right inset of each panel is an image of cilia found in the corresponding node taken at 3300X. Yellow box indicates magnified area in the right inset. E. Optical slice of a wild type and TWis/TWis mutant node stained for acetylated tubulin (red) and zona occludens 1 (green). Dotted line indicates the xy length of the bilaminar node taken to estimate the surface area of the node. White arrowheads indicate cilia. Scatter plot shows the distribution of node surface areas. Circles indicate early head fold stage embryos and triangles are late head fold. Double asterisks represent a statistically significant difference between the two populations calculated by a Mann-Whitney U test. 34

Figure 5: Markers of the node and midline in TWis/TWis mutant and wild type embryos at E8.0 A-D. Left lateral and ventral views of wild type (A,B) and TWis/TWis mutant (C,D) embryos showing expression of Foxa2 by RNA in situ hybridization. Wild type embryos express Foxa2 in the midline and node and TWis/TWis mutant embryos show no midline expression. E-H. Left lateral and frontal views of wild type (E, F) and TWis/TWis mutant embryos (G, H) demonstrating expression of Shh in the node and midline of wild type embryos which is lacking in mutant embryos. I-L. Left lateral and frontal views of wild type embryos (I, J) and TWis/TWis mutant embryos (K, L) showing Gsc expression in the anterior foregut endoderm and prechordal plate in wild type with lower levels in mutant embryos. Arrows point to the midline and arrowheads point to the node. AL, allantois; HF, headfolds.

Figure 6: Expression of Wnt3a and Dll1 in TWis/TWis mutant and wild type embryos at E8.0 A-F. Left lateral, posterior, and ventral views of the distal tip of wild type (A-C) and TWis /TWis embryos (D-F) showing similar Wnt3a expression throughout the entire primitive streak (double arrows); arrowheads point to the node. G-L Left lateral, posterior, and ventral views of Dll1 expression in the presomitic mesoderm in wild type embryos (G-I) and in the perinodal region of TWis /TWis mutants but reduced expression in the PSM (J-L). Arrows indicate Dll1 expression arrowheads indicate the node. Abbreviations: AL is allantois and Hf is headfolds.

Chapter 3: Search for Tbx6 targets

Introduction Tbx6 establishes the neural vs. mesoderm identity of presomitic mesoderm

(PSM) and has a role in patterning the somites. Tbx6 homozygous null mutants die

around E9.5. They have two ectopic neural tubes in place of posterior somites,

patterning defects in anterior somites and an enlarged tail bud (Chapman et al., 1996;

Chapman and Papaioannou, 1998). Homozygous mutants for a hypomoprhic allele of

Tbx6 rib-vertebrae, Tbx6rv, show a disruption of anterior-posterior polarization of somites, as seen by altered expression of Pax1 and Mox1, which affects the morphogenesis of axial skeleton (Nacke et al., 2000). Study of homozygous Tbx6rv

mutants demonstrated that Tbx6 affects somite patterning and segmentation by

regulating the Notch signaling pathway component, Dll1. Tbx6 also directly regulates

Msgn1 and Mesp2, two genes essential to somite patterning (Hofmann et al., 2004a;

Oginuma et al., 2008; Yasuhiko et al., 2008). How Tbx6 is regulating the neural vs

mesoderm identity of the PSM and somite patterning is still an unanswered question.

Recently it was discovered that the ectopic neural tube phenotype observed in

Tbx6 homozygous mutants is due to the ectopic expression of Sox2, a gene essential

for neural differentiation, in presomitic mesoderm. The work shows that Tbx6 is a

negative regulator for Sox2 in the presomitic mesoderm via an enhancer named N1.

Tbx6 homozygous mutants that were also homozygous mutant for the N1 enhancer,

ΔN1, of Sox2 failed to develop ectopic neural tubes (Takemoto et al., 2011).

A microarray was conducted in order to investigate the functions of Tbx6. Pure

populations of tail bud mesoderm were isolated from E9.5 embryos of three genotypes,

wild type, Tbx6tm1Pa/tm2Pa homozygous null and compound heterozygous 37

Tbx6rv/Tbx6tm2Pa, in order to find gene targets of Tbx6 relevant to the different

phenotypes. The tail buds were cut off with a micro scalpel approximately one half somite’s length distal to the most recently formed somite, in the case of wild type and

Tbx6rv/Tbx6 tm2Pa compound heterozygous embryos, or at the start of the enlarged tail

bud in null mutants. The tail buds were incubated in 2.5% pancreatin, 0.25% trypsin,

and 0.05% polyvinylpyrrolidone for 5 minutes at 4o C. The ectoderm and neural plate as well as any ventral tissue including gut were removed by dissection with solid glass needles. RNA was extracted from the remaining presomitic mesoderm. Three independent pools of tail buds of each genotype were used for the microarray analysis.

RNA was extracted and followed by cDNA synthesis and hybridization to Affymetric

GeneChips (Hadjantonakis, A. –K., Begum, S., and Papaioannou, V.E., unpublished).

Previously identified direct targets of Tbx6, such as Dll1, Msgn and Mesp2, were down

regulated in the homozygous null expression profile compared with wild type, while

Wnt3a and Sox2, which are ectopically expressed in the tail bud of Tbx6 homozygous

mutants were up regulated in Tbx6 homozygous null expression profile compared to

wild type (White and Chapman, 2005; Yasuhiko et al., 2006; Wittler et al., 2007;

Takemoto et al., 2011).

Expression profiles for each of the three genotypes were analyzed in order to

understand the endogenous role of Tbx6 in both presomitic mesoderm identity and somite patterning. Genes that are differentially expressed between the wild type and

Tbx6 homozygous mutant should enrich for genes that Tbx6 regulates to establish both

the neural vs. mesoderm identity of the PSM and to pattern the somites (Figure 6).

Genes that are differentially expressed between the wild type and hypomorph should 38

enrich for genes that Tbx6 regulates specifically to pattern the somites as the identity of

the presomitic mesoderm of the hypomorph is correctly established (Figure 6). Finally,

comparing the expression profiles of the hypomorph with the null should enrich for

genes that Tbx6 regulates to establish neural vs. mesoderm identity (Figure 6). In order

to find gene targets of Tbx6 responsible for establishing neural versus mesoderm

identity we focused on a unique set of genes whose expression was differentially

regulated in the null vs. both the wild type and hypomorph but was not affected in the

hypomorph vs. wild type, which will be referred to as the subtracted list (star on Figure

6).

In this study we narrowed the subtracted list to transcriptional regulators that are

potentially directly regulated by Tbx6 in order to find genes that govern the

establishment of presomitic mesoderm identity.

Results

Identification of potentially direct transcription factor targets of Tbx6

With the goal of finding transcriptional regulators involved in presomitic mesoderm identity, the 155 genes differentially regulated in Tbx6 null vs. wild type and

Tbx6 null vs. hypomorph but not the hypomorph vs. wild type comparisons were further refined using the Database for Annotation, Visualization and Integrated Discovery

(DAVID) that narrowed the list to genes involved in transcription using gene ontology terms. In parallel, the mouse gene promoter database, as provided by ENSMBL, was scanned for putative Tbx6 binding sites with the use of a Tbx6 position weight matrix

(White and Chapman, 2005) and the program Conservation-aided Transcription-factor 39

Binding Site Finder, COTRASIF (Tokovenko et al., 2009). Thirty genes were present

on both the DAVID analysis list and the COTRASIF analysis list and were classified as

transcriptional regulators that are potential direct targets of Tbx6 (Table 2). Additionally,

the expression of Cxcl12, one of the top highly deregulated genes of the subtracted list,

was characterized in Tbx6 homozygous mutants.

Genes whose expression is lost in the PSM of Tbx6 homozygous mutants at E9.5

Genes from the list of potential targets involved in transcription (Table 2) were

selected for further analysis based on the highest fold change in expression and the

availability of RNA in situ hybridization probes. We characterized the spatial distribution

of expression in wild type and Tbx6 homozygous null mutants to investigate how

changes in expression pattern may contribute to the Tbx6 homozygous null phenotype.

Mesenchyme homeobox 1, Mox1, is down regulated by 10.9 fold in Tbx6 homozygous null embryos compared to wild type and by 9.1 fold in null compared to hypomorph; it contains nine putative Tbx6 binding sites within 2kb of its transcriptional start site (Table

2). Mox1 is a transcription factor that is expressed in presomitic mesoderm at the

rostral end of the tail bud and throughout all the somites in wild type E9.5 embryos

(Figure 7A, A1) (Candia et al., 1992). Transverse slices at the level of the presomitic

mesoderm and posterior somites show Mox1 expression in the dorsal aspect of these structures (Figure 7A2, A3). In Tbx6 homozygous null mutants, Mox1 expression is present only in the abnormally patterned anterior somites (arrows in Figure 7B) but is 40

completely lacking from the tail bud. It is not present in the ectopic neural tubes (Figure

7B-B3).

Paraxis is down regulated by 3.49 fold in Tbx6 homozygous null embryos

compared to wild type and by 3.24 fold in null compared to the hypomorph; it has three

putative Tbx6 binding sites within 2kb for its transcriptional start site (Table 2). Paraxis

is expressed in the presomitc mesoderm at the anterior end of the tail bud as well as in

all somites in wild type embryos at E9.5 (Figure 7C,C1) (Burgess et al., 1995). Paraxis is expressed throughout the somite as seen in a transverse slice at the level of the somites (Figure 7C2). In Tbx6 homozygous null mutants, expression is observed only in

anterior somites and is not present in the presomitic mesoderm or the ectopic neural

tubes (Figure 7D-D3).

Eyes absent 1 homolog, Eya1, is down regulated by 4.4 fold in Tbx6

homozygous null mutants compared to wild type and by 3.73 fold in null compared to

the hypomorph; it has seven putative Tbx6 binding sites within 2kb for its transcriptional

start site (Table 2). Eya1 is expressed in the forebrain, eye, brachial aches, and otic

vesicles, as well as all of the somites (Figure 7E). Eya1 expression extends further

caudally into the tail bud mesoderm than Mox1 and Paraxis (Figure 7E1). Eya1 is also expressed in the intermediate mesoderm (Figure 7E2) and in the dermomyotome of the somites (Figure 7E3) (Xu et al., 1997). In Tbx6 homozygous mutants, Eya1 is expressed in the forebrain, eye, brachial arches, otic vesicles and the abnormal anterior somites and shows weak expression in the ectopic neural tubes (Figure 7F,F3), but is not expressed in the presomitic mesoderm (Figure 7F1,F2). 41

Naked cuticle 2, Nkd2, is part of the Naked cuticle family of proteins that regulates both the canonical and non-canonical Wnt signaling pathway (Wharton et al.,

2001). Nkd2 is down regulated by 4.6 fold in the Tbx6 homozygous null compared to wild type embryos and by 3.62 fold in null compared to hypomorph; it contains two putative Tbx6 binding sites within 2kb for its transcriptional start site (Table 2). Nkd2 is expressed in the brachial arches, forebrain, somites and mainly in the caudal end of presomitic mesoderm in E9.5 wild type embryos (Figure 7G-G3) (William et al., 2007).

Tbx6 homozygous mutants express Nkd2 in the brachial arches, forebrain, and abnormal anterior somites but there is no expression in the presomitic mesoderm or in the ectopic neural tubes (Figure 7H-H3).

Genes with reduced but detectable expression in the PSM of Tbx6 homozygous mutants at E9.5

Sine oculis-related homeobox 1, Six1, is down regulated by 3.3 fold in Tbx6 homozygous nulls compared to wild type and by 2.62 fold in nulls compared to hypomorph; it has five putative Tbx6 binding sites within 2kb for its transcriptional start site (Table 2). Six1 is expressed in the head, brachial arches, otic vesicles, somites and presomitic mesoderm but is excluded from the caudal tip of the tail bud at E9.5 (Figure

8A,A1) (Oliver et al., 1995). Six1 is expressed throughout the somite (Figure 8A3). In

Tbx6 homozygyous mutants, Six1 is expressed in the anterior structures of the embryo including the abnormal anterior somites (Figure 8B) and reduced but similar pattern to wild types in the tail bud; it is not expressed in the ectopic neural tubes (Figure 8B2,B3). 42

Chemokine (C-X-C motif) ligand 12, Cxcl12, is a chemokine family member that is strongly chemotactic specifically for lymphocytes (Bleul et al., 1996) and is the only non transcription factor examined in Tbx6 homozygous mutants. Cxcl12 was one of the mostly highly down regulated genes in Tbx6 homozygous mutants. Cxcl12 is expressed in the forebrain, anterior boarder of the brachial arch, somites and presomitic mesoderm at E9.5 (Figure 8C,C1,C3) (McGrath et al., 1999; Gray et al., 2004). It is expressed in a banded pattern in the tail bud in which the caudal and rostral ends of the tail bud show expression at the lateral edge of the tissue and the middle of the tail bud shows expression in a band across the tail bud along with expression in the dorsal gut

(Figure 8C1). A transverse slice through the tail bud reveals that Cxcl12 expression is limited to presomitic mesoderm nearest the ectodermal layer (Figure 8C2). Tbx6 homozygous mutants express Cxcl12 in the forebrain, brachial arches and abnormal anterior somites. Tbx6 homozygous mutants lose the banded expression of Cxcl12 in the tail bud and transverse slices show reduced expression in the tail bud (Figure 8D-

D3).

Genes with ectopic expression in Tbx6 homozygous mutants at E9.5

Forkhead box N3, Foxn3, is a transcription factor that was up regulated by 0.46 fold in Tbx6 homozygous mutants compared to wild type embryos and by 0.33 fold in nulls compared to hypomorphs; it has four putative Tbx6 binding sites within 2kb for its transcriptional start site (Table 2) and expression has not been previously characterized in mouse embryos at E9.5. The only known expression is in the brain at E10.5 (Gray et al., 2004). Our expression analysis shows that Foxn3 is expressed in the forebrain, 43

44 brachial arches, forelimb bud and presomitic mesoderm of the tail bud (Figure 9A-A2).

Transverse slices at the level of the somites show that Foxn3 is expressed in the neural tube and throughout the somites (Figure 9A3). In Tbx6 homozygous null mutants,

Foxn3 has higher expression in the tail bud than that seen in wild type embryos (Figure

9B-B2) and is also expressed in the ectopic neural tubes and axial neural tubes (Figure

9B3).

Homeobox A7, Hoxa7, is a homeobox transcription factor that is up regulated 2.9 fold in Tbx6 homozygous mutants compared to wild type embryos and by 2.1 fold in the null compared to the hypomorph; it has four putative Tbx6 binding sites within 2kb for its transcriptional start site (Table 2). Hoxa7 is expressed in the posterior end of the embryo in all of the presomitic mesoderm and ectoderm in the tail bud (Figure 9C-C2)

(Satoh et al., 2006). Transverse slices at the level of the somites shows expression of

Hoxa7 in the dorsal neural tube and dermomyotome of somites (Figure 9C3). In Tbx6 homozygous mutants, Hoxa7 expression is more intense in the tail bud and is also found in the ectopic neural tubes in Tbx6 homozygous mutants (Figure 9D1-D3. Hoxa7 is expression extends anteriorly to the same level in both wild type and Tbx6 homozygous mutants (Figure 9D).

Discussion

Tbx6 regulates a number of genes involved in somite patterning and development. Among the differentially regulated genes selected for analysis, we demonstrate for genes that regulate somite patterning and development of the skeletal system, Mox1, Paraxis, Eya1 and Six1, expression is either lost or down regulated in 44

45 the tail bud of Tbx6 homozygous mutants. Homozygous null mutants for Mox1 display abnormal rib development, rib fusions, abnormal vertebrae development, hemi vertebra as well as vertebral fusions (Mankoo et al., 2003). Paraxis homozygous null embryos show truncation of the anterior-posterior axis, disrupted somite formation, and severe muscle and skeletal defects (Burgess et al., 1996). Eya1 homozygous have skeletal defects that include abnormal cranium morphology, rib fusion and cervical vertebral fusion. Eya1 homozygous mutants also have a range of renal system defects that include kidney and ureter agenesis (Xu et al., 1999). Six1 homozygous null mutants have muscle and skeletal system defects, which includes abnormal myogenesis, muscle hypoplasia, and bifurcation and fusions of ribs (Laclef et al., 2003). The altered expression of Mox1, Paraxis, Eya1 and Six1 expression in Tbx6 homozygous mutants provides evidence as to the role Tbx6 plays in somite differentiation. Tbx6 may also be necessary for specifying the identity of both the presomitic and intermediate mesoderm as seen by the absence of Eya1.

A previous study demonstrated that Tbx6 homozygous mutants develop ectopic neural tubes due to ectopic expression of Sox2 in the PSM. Tbx6 negatively regulates

Sox2 expression in the PSM by the N1 enhancer. Tbx6-/-; ΔN/ΔN1 double homozygous mutant embryos do not completely rescue the Tbx6 homozygous mutant phenotype, as embryos do not develop posterior somites. The regulation of Mox1, Paraxis and Eya1 provides evidence that Tbx6 plays a dual role in the presomitic mesoderm, not only to maintain mesoderm identity but also to promote the survival and proliferation of mesoderm tissue. 45

Cxcl12 is down regulated but not absent in the tail bud of Tbx6 homozygous

mutants. Cxcl12 homozygous mutants show abnormal angiogenesis and hematopoietic

system developmental defects (Nagasawa et al., 1996; Ara et al., 2005). The role of

Cxcl12 in the tail bud remains unknown.

Both Foxn3 and Hoxa7 are up regulated in Tbx6 homozygous mutants.

Currently, there are no Foxn3 mutant mice. Foxn3 is a potential new regulator of posterior tissue development. As it is up regulated in Tbx6 homozygous mutants compared to wild type its function may be to specify or promote neural identity.

Investigation of mutant alleles of Foxn3 will elucidate its normal role during embryogenesis and would provide insight into how it contributes to the Tbx6 homozygous mutant phenotype. Hoxa7 homozygous mutants are viable and fertile.

Hoxa7/Hoxb7 double homozygous mutants show rib fusions in 71% of embryos and have a small thymus (Chen et al., 1998). Tbx6 homozygous mutants had stronger expression of Hoxa7 in the tail bud than in wild type embryos, however, the anterior extent of expression was not different. Hox genes are involved in patterning the anterior/posterior axis of the embryo (Le Mouellic et al., 1992). This result provides evidence that the anterior/posterior axis is patterned normally in Tbx6 homozygous mutants and the phenotype is not due to homeotic transformations. The increased expression of Hoxa7 observed in the tail bud and ectopic neural tubes of Tbx6 homozygous mutants may be due to the increase of mutant tail bud tissue compared to wild type.

In this study we expanded on the expression data from the Tbx6 microarray by looking at expression patterns of potential targets in Tbx6 homozygous mutant embryos 46

with RNA in situ hybridization to identify the affected tissues. The analysis also

identified putative Tbx6 binding sites within 2kb of the transcriptional start site of these

genes, indicating their potential as direct targets. This analysis enriched for new

potential direct targets for Tbx6 and characterization of expression these targets helped

further the understanding of the endogenous role of Tbx6 in establishing presomitic mesoderm identity, somite development and patterning. The analysis is not complete, as further study is needed to elucidate whether the genes found are direct targets of

Tbx6. To further investigate this question, gel electrophoretic mobility shift assays, using Tbx6 protein and DNA probes for each putative binding sites, could be used.

Sites that are found to bind in vitro could then be validated in vivo by ChIP on presomitic mesoderm tissue of E9.5 embryos using an antibody for Tbx6.

Materials and Methods

Mice and embryo collection

In this study we used a null, expression reporter allele, Tbx6tm2pa, which deletes

exon two and part of exon 3 to delete Tbx6 function and inserts a H2B-EYFP fusion gene, which expresses a fusion protein of histone 2B and yellow fluorescent protein under the regulation of the Tbx6 promoter (Hadjantonakis et al., 2008). The allele was maintained on a mixed genetic background of 129 and ICR (Taconic). Tbx6tm2pa

heterozygous mice, which are viable and fertile, were mated to produce +/+, Tbx6tm2pa/+

and Tbx6tm2pa/ Tbx6tm2pa embryos at E9.5 (E0.5 denotes noon of the day a vaginal plug

was observed). Embryos were genotyped by fluorescence, as fluorescence intensity is

proportional to the number of Tbx6tm2pa alleles present. Tbx6tm2pa will be referred to as 47

Tbx6- for this study. Wild types, identified by lack of fluorescence were used as controls.

Tbx6+/- embryos, which were distinguished by fluorescence intensity, were used to test

RNA In situ hybridization probes (Hadjantonakis et al., 2008).

RNA In situ hybridization

Embryos were dissected in phosphate buffered saline (PBS) containing 0.2% albumin bovine serum (Sigma), fixed overnight in 4% paraformaldehyde (PFA) in PBS at 4°C, dehydrated in 100% methanol and stored at -20°C. Whole mount in situ hybridization using antisense RNA probes was performed as described in previously

(Wilkinson, 1998).

Embryo analysis

Transverse slices using a scalpel were made at the level of the tail bud caudalto the last formed somite, through the tail bud, and at the level of the recently formed somites in wild type E9.5 embryos. Transverse slices were made in Tbx6-/- E9.5 embryos at the level of the tail bud, through the caudal tail bud and at the level of the ectopic neural tubes.

Table 2: Validation of gene lists using genes known or predicted to be altered in PSM in Tbx6 -/- mutants

Gene Fold Change in expression nullvswt

Mox1(Meox1) -10.92 (p=4.48E-05) Ripply2(RIKEN C030003E08) -9.26 (p=2E-04) Mesp2 -5.96 (p=4E-04) Tcf15 -3.49 (p=3E-04) -3.27 (p=6.79E-05) Dll1

-2.84 (p=6E-04) Tbx6

1.61 (p=2E-04) Wnt3a

6.17 (p= 7E-04) Sox2

tcf15 -3.49 (p=3E-04)

Table 3: Subtracted gene list of putative direct Tbx6 targets that play a role in transcriptional regulation with the expression fold change from the microarray analysis and the number of putative Tbx6 binding sites in their promoters.

# of Tbx6 putative binding sites Directio within 2kb of n of fold transcription Mutant Gene change Fold change in expression1 al start site phenotype nullvswt nullvshypo Axial -10.9 (p=4.48E-05) -9.16 (p=3E-04) skeletal Meox1* - 9 defects Viable and -4.65 (p=5.70E-05) -3.62 (p=0.001) Nkd2 - 2 Fertile Rib fusions, -4.46 (p=.001) -3.73 (p=0.015) kidney Eya1 - 7 defects Somite patterning -3.49 (p=3E-04) -3.24 (p=0.002) defects, skeletal Paraxis - 3 defects -3.47 (p= 0.006) -2.29 (p=0.006) Smarcd3 - 4 NA 49

Axial skeletal -3.39(p= 6.82E-05) -2.62 (p=9E-04) defects,

kidney Six1 - 5 agenesis Hematopoie -3.28 (p=1E-03) -2.44 (p=.002) Meis1 - 1 tic defects -2.84 (p=..005) Limb -2.86 (p=1E-03) Ebf2 - 6 defects Axial -1.18 (p=.003) -1.71 (p=2E-03) skeletal

Eif4e3 - 4 defects -1.17 (p=.02) -1.55 (p=1E-03) Cbx4 - 3 NA Viable and -1.42 (p=6.90E-05) -1.77 (p=1E-04) Hey1 - 5 fertile Brain -1.30 (p=0.01) -1.23 (p=0.01) Gbx2 - 3 defects Hematopoie -0.78 (p=0.05) -0.63 (p=.05) Ifnar2 - 3 tic defects Neural tube -0.41 (p=0.01) -0.43 (p=0.01) Dnmt3b - 5 defects Axial -0.40 (p=0.02) -0.29 (p=0.02) Skeletal Cbx2 - 3 defects Trim27 - -0.28 (p=0.03) -0.18 (p=.03) 4 NA Ncl - -0.14 (p=0.04) -0.11 (p=0.04) 4 NA Hoxa7 + 2.92 (p=0.007) 2.1 (p=.007) 4 Rib fusions Neural tube 1.68 (p=0.02) 1.05 (p=0.02) and cardiac

Jarid2 + 3 defects Mesoderm 1.46 (p=.015) 1.55 (p=0.01) formation

Tcfap2c + 4 defects Craniofacial 1.39 (p=1.77E-05) 1.34 (p=1.77E- skeletal 05) malformatio Msx1 + 2 ns Somite 1.27 (p=0.002) 0.97 (p=0.03) patterning Mkx + 7 defects

0.83 (p=0.005) 0.67 (p=0.05) Bcor + 3 NA

0.68 (p=3E-04) 0.44 (p=.009) Cardiac Hdac5 + 2 defects Hematopoie 0.67 (p=1E-04) 0.68 (p=7E-04) Malt1 + 3 tic defects Viable and 0.59 (p=3E-04) 0.72 (p=6E-04) Rps6ka5 + 3 fertile 50

Embryonic 0.49 (p=3E-04) 0.27 (p=0.02) lethal, liver Srebf1 + 2 defects 0.46 (p=.001) 0.33 (p=0.03) Foxn3 + 4 NA2 0.28 (p=.008) 0.28 (p=0.04) Hematopoie Tcf12 + 1 tic defects 0.21 (p=.003) 0.36 (p=..001) Hematopoie Satb1 + 2 tic defects 1Two columns represent the log fold difference in gene expression between Tbx6 null vs. wild type and null vs. hypomorph. 2NA means no mutants available *Genes in bold represent ones whose expression was characterized in wild type and Tbx6 homozygous mutant embryos at E9.5. 51

Figure 7: Venn diagram of differentially expressed genes in three genotypes from Tbx6- expressing E9.5 tailbud tissues. Venn diagram represents groups of differentially expressed genes in wildtype vs. null (pink), wild type vs. hypomorph (yellow) and hypomorph vs. null (blue). The purple area represents genes that are differentially expressed in the wild type vs. null and hypomorph vs. null, but not wild type vs. hypomorph. This subtracted group of 155 genes was used to narrow down Tbx6 targets that contribute to the ectopic neural tube phenotype. The null refers to Tbx6tm1Pa/tm2Pa and the hypomorph refers to Tbx6rv/Tbx6tm2Pa. 52

53 53

Figure 8: Expression of Mox1, Paraxis, Eya1 and Nkd2 in wild type and Tbx6 homozygous mutant embryos at E9.5. A-H3. Expression of Mox1 (A-B3), Paraxis (C-D3), Eya1 (E-F3) and Nkd2 (G-H3) in wild type (A-A3, C-C3, E-E3, G-G3) and Tbx6 homozygous mutants (B-B3, D-D3, F-F3, H-H3). For all sets of panels line 1 is the level at which the tail bud was cut. Dorsal views of the cut tail bud are shown in adjacent panels (A1,B1,C1,D1,E1,F1,G1,H1); line 2 is a transverse cut made at the level of the presomitic mesoderm (A2,B2,C2,D2,E2,F2,G2,H2) and line 3 is a transverse cut made at the somite (A3,C3, E3,G3) in wild type embryos or ectopic neural tube (B3,D3,F3,H3) in Tbx6 homozygous mutants. Left view of embryos (A,B,C,D,E,F,G,H); lines indicate where scalpel slices were made. Arrows point to abnormal somites, PSM, IM, N, and EN. S, somites; N, neural tube; EN ectopic neural tube; PSM, presomitic mesoderm; IM, intermediate mesoderm.

Figure 9: Expression of Six1 and Cxcl12 in Tbx6 homozygous mutants as E9.5 A-D3. Expression of Six1 (A-B3) and Cxcl12 (C-D3) in wild type (A-A3, C-C3) and Tbx6 homozygous mutants (B-B3, D-D3). For all sets of panels line 1 is the level at which the tail bud was cut. Dorsal views of the cut tail bud are shown in adjacent panels (A1,B1,C1,D1); line 2 is a transverse cut made at the level of the presomitic mesoderm (A2,B2,C2,D2) and line 3 is transverse a cut made at the somite (A3,C3,) in wild type embryos or ectopic neural tube (B3,D3) in Tbx6 homozygous mutants. Left view of embryos (A,B,C,D,); lines indicate where scalpel slices were made. Arrows point to abnormal anterior somites, N or EN. S, somites; N, neural tube; EN ectopic neural tube.

Figure 10: Expression of Foxn3 and Hoxa7 in Tbx6 homozygous mutants at E9.5 A-D3. Expression of Foxn3 (A-B3) and Hoxa7 (C-D3) in wild type (A-A3, C-C3) and Tbx6 homozygous mutants (B-B3, D-D3). For all sets of panels line 1 is the level at which the tail bud was cut. Dorsal views of the cut tail bud are shown in adjacent panels (A1,B1,C1,D1); line 2 is a cut made at the level of the presomitic mesoderm (A2,B2,C2,D2) and line 3 is a cut made at the somite (A3,C3,) in wild type embryos or ectopic neural tube (B3,D3) in Tbx6 homozygous mutants. Left view of embryos (A,B,C,D,); lines indicate where scalpel slices were made. Arrows point to N or EN. S, somites; N, neural tube; EN ectopic neural tube.

Chapter 4. The role of Tbx6 in determination of L/R asymmetry

Introduction

The mouse embryo at E8.0 is initially bilaterally symmetrical. This symmetry is broken during early gastrulation when genes are asymmetrically expressed around the embryonic node (mouse organizer) and in the LPM. The earliest known morphological left/right asymmetry in the mouse embryo is the leftward displacement of the future atrioventricular canal, followed by the dextral looping of the linear heart tube. As the embryo progresses, it undergoes a process of axial rotation towards its right side that leads to an asymmetric placement of the placenta umbilical cord and vitelline vessels.

Further asymmetric morphological events occur as the embryo develops, leading to asymmetric positions of organ systems in the adult mouse (Levin et al., 1995; Miller and

White, 1998; Beddington and Robertson, 1999; Brown and Anderson, 1999).

The node and its cilia are important for establishment of left-right asymmetry.

Noto, Foxj1 and Rfx3 affect node and node cilia development. When mutated these transcription factors show left-right asymmetry defects. Noto is a homoeobox gene and homozygous null mutants have randomized expression of left-right specific genes, a disrupted node structure and immotile nodal cilia (Beckers et al., 2007). FoxJ1 is a forkhead box transcription factor that when mutated has a similar morphological laterality phenotype to Tbx6 mutants and which is necessary for ciliogenesis in the mouse (Brody et al., 2000). Rfx3 is a transcription factor expressed in all ciliated cells of the node at the time laterality is established; its mutants have defects in ciliogenesis.

Studies have shown that Rfx3 regulates the transcription of genes involved in interflagellar transport (IFT) (Bonnafe et al., 2004; Beckers et al., 2007). RNA in situ 57

hybridization analysis revealed that Noto is upstream of both Rfx3 and Foxj1 (Brody et

al., 2000; Bonnafe et al., 2004; Beckers et al., 2007).

Genes involved in the non-canonical Wnt pathway have been shown to regulate

ciliogenesis and therefore determination of left-right asymmetry in the vertebrate

embryo (Oishi et al., 2006). The non-canonical Wnt pathway includes both the planar cell polarity (PCP) pathway and the Wnt/Ca2+ signaling pathway. Non-canonical Wnt

ligands bind to frizzled (Fzd) receptors. In the PCP pathway, this binding activates a specific group of cytoplasmic phosphoproteins known as Disheveled (Dvl). Dvl2 and

Dvl3 proteins in turn regulate the expression of genes involved in cell movements. Dvl2

mutants have transposition of the great arteries and decreased expression of Pitx2 in

the outflow tract. Dvl2; Dvl3 double homozygous mutants have abnormal looping of the

heart as well as defects in somite segmentation and neural tube closure (Hamblet et al.,

2002; Etheridge et al., 2008). In the Wnt/Ca2+ signaling pathway, proteins that regulate the release of intracellular calcium are activated Fzd receptors and IP3 proteins (Fanto and McNeill, 2004). Morpholino-mediated loss of function of Vangl2, a modifier of non- canonical Wnt signaling, in the chick results in disrupted expression of left-right asymetrically expressed genes (Zhang and Levin, 2009). Knock down morpholino studies of the Fzd2, a receptor of the non-canonical Wnt signaling pathway show that

Fzd2 is necessary for correct establishment of left-right asymmetry in the zebrafish embryo as Fzd2 morphants have reversed looping of the heart and gut tube. Fzd2 morphants also show a defect in the cilia of the Kuppfer vesicle, the zebrafish equivalent of the mammalian embryonic node (Oishi et al., 2006). In Xenopus downstream effectors of the non-canonical Wnt signaling pathway, Inturned and fuzzy, 58

also have ciliogenesis defects (Park et al., 2006). These studies demonstrate how non- canonical Wnt signalling is essential for the establishment of left-right asymmetry and

ciliogenesis in vertebrates.

The molecular events that orchestrate the determination of left-right asymmetry are tightly regulated. An asymmetric signal generated in the embryonic node leads to the asymmetric expression of Nodal and its antagonist, Cer2 in the perinodal region

(Hamada et al., 2002; Krebs et al., 2003a). Gdf1 perinodal expression is necessary for the asymmetric expression of Nodal in the left LPM (Tanaka et al., 2007). It is still unknown what upstream factors regulate the expression of Gdf1. Homozygous null mutants of both Nodal and Gdf1 show a loss of expression of left-right specific genes in the LPM (Rankin et al., 2000; Saijoh et al., 2003b).

T-box genes have been shown to interact with components of non-canonical Wnt signaling pathway. In zebrafish, the ortholog of Brachyury, ntl, and wnt5 work synergistically to form posterior structures (Marlow et al., 2004). It has also been shown in Xenopus that Wnt11 is a target of Brachyury (Makita et al., 1998; Tada and Smith,

2000). In mice, Tbx1 regulates Wnt5a in cardiac progenitors of the secondary heart

field and Tbx20 positively regulates the non-canonical Wnt signaling pathway in the

facial neurons in the mouse (Song et al., 2006; Chen et al., 2012).

This study focuses on the T-box gene; Tbx6, which is expressed between

embryonic day (E) 6.5 and E13.5 first in the primitive streak and later in the presomitic mesoderm and tailbud. Tbx6 null mutants die around E9.5. They have defects in

anterior somite morphology and patterning, two ectopic neural tubes in place of

posterior somites and an enlarged tail bud (Chapman et al., 1996; Chapman and 59

Papaioannou, 1998). They have a defect in node cilia motility and morphology and

show a decrease in Dll1 and Nodal expression in the perinodal region and, in almost all mutant embryos, show an absence of asymmetric expression of Nodal, Pitx2 and Lefty2

in the LPM. The decrease in perinodal Nodal expression could be due to the decrease

in perinodal Dll1 expression (Hadjantonakis et al., 2008). The mechanism by which

Tbx6 affects the development of the node and node cilia is not understood. However, the node cilia motility and morphology defects of Tbx6 homozygous mutants does not

account for the lack of expression of left-right specific genes in the LPM. Tbx6,

therefore, along with playing a role in ciliogenesis, must be regulating genes that are

necessary for LPM expression of left-right genes.

In this study we make use of Tbx6 mutant embryos to investigate how Tbx6

affects multiple processes in the establishment of left-right asymmetry, which include

node and node cilia development and the expression of genes necessary for nodal

signal transduction from the perinodal region to the left LPM. We investigated the

expression of transcription factors and genes involved in the non-canonical Wnt

signaling pathway. We also examined whether the left-right asymmetry defects in Tbx6 homozygous mutants are due to direct regulation of Gdf1.

Results

Expression of transcription factors that affect laterality, node and nodal cilia

development in wild type and Tbx6 homozygous mutants

Expression of transcription factors necessary for node and node cilia development was investigated in Tbx6 homozygous mutants ranging from the primitve 60

61 streak stage to the late head fold stage, E7.5-E8.0, and compared to wild type controls.

In wild type embryos at the primitive streak stage, Noto is expressed in precursors of the embryonic node at the anterior end of the primitive streak (Figure 10A, D). At the bud and head fold stages, Noto is expressed in the embryonic node and developing notochord (Figure 10B,C, B’,C’) (Beckers et al., 2007).Tbx6 homozygous mutants have no detectable Noto expression at the midstreak stage (n=2, Figure 10E) and at the late streak stage one of three mutants evaluated had weak, punctate Noto expression

(Figure 10H) while the other two showed normal expression when compared to wild types. At the late bud stage one of two mutants evaluated showed a lower level of Noto expression than wild type embryos (Figure 10F,F’) and the other showed normal expression. At the head fold stage three of six mutants evaluated had an irregular pattern of Noto expression (Figure 10G,G') while the other three mutants showed normal Noto expression.

Foxj1 is expressed in precursors of the node at the anterior end of the primitive streak in streak stage embryos and in the node during bud, headfold, and early somite stages in wild type embryos (Figure 11A,B,B’, E-H) (Brody et al., 2000). Mutant embryos evaluated at the late streak stage (n=3) showed similar FoxJ1 expression to wild type (Figure 11C). One early bud stage mutant had a pale, irregular pattern of expression when compared to a stage-matched wild type embryo (Figure 11D,D’).

Mutants at the late bud (n=4), EHF (n=1), and LHF to somite stages (n=8) showed no difference in expression when compared to wild type (Figure 11I-L).

In wild type embryos between bud and head fold stages, Rfx3 is expressed in the embryonic node (Figure 12A-D) (Bonnafe et al., 2004). Like wild type embryos, Tbx6 61

62 homozygous mutants between bud and head fold stages showed expression of Rfx3 in the node (n=15, Figure 12E-H).

Expression of components of the non-canonical Wnt signaling pathway in wild type and Tbx6 mutants between E7.5-E8.0

The expression pattern of non-canonical Wnt signaling components was investigated in Tbx6 mutants during node development. Wnt5a and Wnt5b are non- canonical Wnt signaling ligands that are expressed at the posterior end of the embryo at the early bud stage (Figure 13A,I). As the embryo develops Wnt5a expression is localized to the base of the allantois and extends towards the distal end of the embryo

(Figure 13B-D,J-L) (Gavin et al., 1990). There is no difference in expression pattern of

Wnt5a and Wnt5b between wild type embryos and Tbx6 homozygous mutants between the early bud to late head fold stages (Figure 13E-H,M-P).

Fzd proteins act as receptors for Wnt signaling. Fzd2 and Fzd3, between the streak and head fold stages, are expressed in the epiblast but excluded from the primitive endoderm and extra embryonic regions of the embryo (Figure 14A-C,G-I)

(Wang et al., 1996). No difference in Fzd2 or Fzd3 expression is observed between wild type and Tbx6 homozygous mutants between the streak and head fold stage (Figure

14D-F, J-L). Fzd10, similar to Wnt5a and Wnt5b, is expressed in the posterior end of the embryo. Expression is first seen at the bud stage and extends to the distal tip of the embryo (Figure 14N). At later somite stages Fzd10 expression is observed in the headfolds, developing somites and presomitic mesoderm (Figure 14O) (Kim et al., 62

2001). No difference in expression of Fzd10 was seen between Tbx6 homozygous mutants and wild type embryos (Figure 14P-R).

Expression of Gdf1 in wild type and Tbx6 homozygous mutants between E8.0-

E8.5

In addition to the effect Tbx6 has on cilia motility and morphology, homozygous

mutants also show an absence of left-right gene expression in the LPM. We therefore investigated the expression of Gdf1, a gene necessary to transfer the asymmetric signal

generated at the node to the left LPM. At the LHF stage, wild type embryos express

Gdf1 throughout the embryo with stronger, discrete bilateral expression in the perinodal region (Figure 15A,E). Between zero and seven somite stages, Gdf1 is expressed bilaterally in both the perinodal region and LPM in wild type embryos (Figure 15B-D,F-

H) (Rankin et al., 2000; Wall et al., 2000). In Tbx6 homozygous mutant embryos, Gdf1 is expressed uniformly throughout the embryo at the LHF stage; however, no signal is observed in the perinodal region (n=2, Figure 15I,M) nor is it observed between the LHF and seven somite stages (n=10, Figure 15I-L,M-P). However, between the zero and seven somite stages, Tbx6 homozygous mutants express Gdf1 bilaterally in the LPM similar to wild type embryos (Figure 15J-L,N-P).

Regulation of Gdf1 expression by Tbx6

Since we observed a loss of Gdf1 expression in Tbx6 homozygous mutants in an area that overlaps with Tbx6 expression, we hypothesized that Tbx6 directly regulates

Gdf1 in the perinodal region. The program Conserved Transcription Binding Site Finder, 63

COTRASIF, was used with a position weight matrix for Tbx6 to scan 2kb upstream and downstream of the transcriptional start site of Gdf1. Five putative Tbx6 binding sites, including one in exon 6, were found (Table 3; Figure 16A). Electrophoretic mobility shift

assays (EMSA) were used to test whether Tbx6 protein binds to fluorescently labeled

DNA probes for each of the five sites in vitro. Probes with mutated sites were used to test binding specificity (Table 3). Results show that Tbx6 protein can bind in vitro specifically to sites #1,4, and 5. Site #3 showed no binding and site #2 showed non- specific binding in which both the wild type and mutated probe bound to Tbx6 protein

(Figure 16B). Chromatin IP was not used to test these sites in vivo, as tissue sample size was a limiting factor and a Tbx6 antibody was not available.

Luciferase assays were used to test whether Tbx6 can regulate the expression of a luciferase reporter through the putative binding sites in the Gdf1 promoter. We generated a luciferase reporter that contains 2.3kb of the Gdf1 promoter region. Due to its location in the sixth exon of Gdf1 site #5 was not included in the reporter construct

(Figure 16C). PCR based mutagenesis was used to create a luciferase reporter that contained the 2.3 kb Gdf1 promoter region with mutated putative Tbx6 binding sites.

NIH 3T3 cells were transfected with increasing amount of Tbx6 expression construct which lead to a two-fold increase in luciferase reporter activity (Figure 16D). Western blot demonstrates that transfected cells express Tbx6 protein (Figure 16E). However, no difference in luciferase activity between wild type and mutant luciferase reporters was observed. Though we do see a small increase in luciferase activity, Tbx6 does not regulate luciferase activity through these binding sites (Figure 16D). 64

Investigating a possible genetic interaction between Tbx6 and Gdf1 in determination of left-right asymmetry

Embryos that are homozygous mutant alleles for Tbx6 or Gdf1 have randomization of heart looping and embryo turning, while heterozygous embryos have normal situs (Rankin et al., 2000; Hadjantonakis et al., 2008). To determine whether

Tbx6 and Gdf1 genetically interact we crossed Tbx6 and Gd1 heterozygous mice to produce Tbx6+/-, Gdf1l+/- double heterozygotes and examined their morphological left-

right asymmetry phenotype. Embryos at E9.5 have distinct morphological asymmetries

including direction of heart looping, as well as tail, placenta and vitelline vessel

placement. Tbx6+/-, Gdf1+/- double heterozygous embryos have normal situs (n=21). If

heart looping and embryo turning were randomized then half of Tbx6+/-, Gdf1+/- double

heterozygous embryos would be expected to have reversed looping and turning.

However, normal situs was observed in all double heterozygous embryos indicating

there is no genetic interaction. As a more sensitized screen for detecting a genetic interaction the dose of Tbx6 was further reduced using a hypomorphic allele, Tbx6rv in

combination with the null allele. Tbx6rv/-,Gdf1+/- mutant embryos also have normal situs

at E9.5 (n=11).

Rescue of Gdf1 perinodal expression in Tbx6-/- mutants results in asymmetric express Pitx2 in the left LPM

Previous studies have shown that it is specifically the perinodal expression of

Gdf1 that is essential for asymmetric expression of Nodal in the left LPM (Tanaka et al.,

2007). We made use of a transgene that expresses the cDNA of Gdf1 bilaterally in the 65

perinodal region, node-Tg, to rescue Gdf1 expression in Tbx6 homozygous mutants. A

Tbx6 heterozygous mouse that contained node-Tg was crossed with Tbx6

heterozygotes to produce Tbx6-/-; node-Tg embryos. At E8.5, wild type embryos show expression of Pitx2 in the left inflow tract (n=13/13, Figure 17A) whereas the majority of

Tbx6 homozygous mutants have no detectable Pitx2 expression in the left inflow tract

(n=26/27 Figure 17B). Eight Tbx6-/ -; node-Tg mutant embryos showed expression of

Pitx2 in the left inflow tract (n=8/22 Figure 17C), while the remaining fourteen showed

Pitx2 expression only in the head region.

Discussion

With the exception of Noto, Tbx6 homozygous mutants show little to no change in expression of transcription factors for node and cilia development. Noto is a homeobox gene that is necessary for the development of the embryonic node, node cilia and notochord (Beckers et al., 2007). Noto expression was, however, not observed at the midstreak stage in Tbx6 homozygous mutants. At this developmental stage, the node precursor cells are specified and migrate towards the distal end of the embryo

(Tam and Beddington, 1987). The irregular expression pattern of Noto in Tbx6 homozygous mutants between bud and LHF stages may be due to the absence of Noto at the midstreak stage or could mark an irregularly shaped node as Tbx6 homozygous mutants do have some node morphological defects (Hadjantonakis et al., 2008).

Between the bud and LHF stages, Noto expression is present in the node and developing notochord, therefore Tbx6 homozygous mutants have a late onset of expression, which may account for its node and node cilia defects. Previous reports 66

have observed that Noto is upstream of both Foxj1 and Rfx3, two transcription factors

that regulate ciliogenesis (Brody et al., 2000; Bonnafe et al., 2004; Beckers et al., 2007).

The absence of Noto at the midstreak stage of Tbx6 homozygous mutants, however, does not affect the expression of Rfx3 and Foxj1. At the head fold stage, some Tbx6

homozygous mutants had an irregular expression pattern of Noto when compared to

wild type embryos. Since Noto is a marker for the node, the irregular expression pattern

observed in half of the mutants may be a reflection of node morphological irregularities

previously observed in Tbx6 homozygous mutants (Hadjantonakis et al., 2008). Future

work will focus on identifying and characterization potential Tbx6 targets via a

microarray expression study at stages when the node and node cilia are developing.

We investigated the expression of components of the non-canonical Wnt

signaling pathway in Tbx6 homozygous mutants because previous work in Xenopus,

zebrafish and mice implicates the pathway in node and cilia development as well as

determination of left-right asymmetry (Hamblet et al., 2002; Oishi et al., 2006; Etheridge

et al., 2008; Zhang and Levin, 2009). The non-canonical Wnt signaling pathway also

plays a role in development of node cilia (Hashimoto et al., 2010). Although no

differences in expression of Wnt5a, Wnt5b, Fzd2, Fzd3 and Fzd10 were seen between

Tbx6 homozygous mutants and wild type embryos, expression of other non-canonical

Wnt signaling components could still be perturbed. Currently, there is no molecular

readout for the non-canonical Wnt signaling pathway but individual components could

be investigated in Tbx6 homozygous mutants.

An alternate explanation for the observed node cilia morphological defects in

Tbx6 homozygous mutants is the disruption of Dll1 expression (Hadjantonakis et al., 67

2008). Dll1 is a co-receptor of the Notch signaling pathway and homozygous null

mutants have node and midline morphological defects (Przemeck et al., 2003). Dll1 expression, however, is not completely lost in Tbx6 homozygous mutants so further investigation could assess whether a reduction of Notch signaling can lead to disruption of node and cilia development.

Tbx6 homozygous mutants have morphological left-right asymmetry defects with an absence of asymmetric expression of Nodal, Lefty2 and Pitx2 in the left LPM and

Lefty1 in the floor plate. Perinodal expression of Nodal is also decreased in Tbx6 homozygous mutants (Hadjantonakis et al., 2008). However, previous work suggests that a low level of Nodal expression is sufficient to initiate expression of left-right specific genes in the LPM (Brennan et al., 2002a). Gdf1 perinodal expression, is critical to the asymmetric expression of Nodal in the left LPM (Tanaka et al., 2007). In this study it was shown that Tbx6 homozygous mutants do not express Gdf1 in the perinodal region, which would account for the lack of left-right specific genes expression in the LPM of

Tbx6 homozygous mutants. Furthermore the combination of the node-Tg transgene, which expresses Gdf1 bilaterally in the perinodal region with Tbx6 homozygous mutation showed rescue of Pitx2 expression in the left inflow tract in some embryos.

This indicates that the absence of expression of left-right genes in the LPM of Tbx6 homozygous mutants is due to the lack of Gdf1 perinodal expression. Some Tbx6-/ -,

node-Tg mutant embryos showed no Pitx2 expression in the inflow tract. It is possible

that the node-Tg transgene may have variable expression, which may not always

rescue LPM expression of Pitx2. 68

Unlike other mutants with cilia defects, Tbx6 homozygous mutants have a

complete absence of asymmetric gene expression in the LPM due to the lack of Gdf1

perinodal expression. One could hypothesize that the addition of the node-Tg to Tbx6

homozygous mutants would lead to randomized expression of left-right specific genes in

the LPM as seen in other mutants with cilia defects. However, whenever Pitx2

expression was observed in Tbx6-/ -, node-Tg mutant embryos, it was only present in the

left inflow tract indicating that left-right asymmetry was established correctly. There are

a several possible explanations as to why Tbx6-/ -, node-Tg mutant embryos express

Pitx2 only in the left inflow tract rather than randomly in either the left or right. The

asymmetric expression of Cer2, Nodal’s antagonist, may not be affected in Tbx6

homozygous mutants. However, since asymmetric perinodal expression of Cer2 is

dependent on canonical Wnt signaling and on the flow generated at the node

(Nakamura et al., 2012), and Tbx6 homozygous mutants do not generate a flow at the node, as seen by loss of asymmetric Ca2+, we would predict that Cer2 would not be

asymmetrically expressed in Tbx6 homozygous mutants. Characterization of Cer2

expression in Tbx6 homozygous mutants between E8.0-E8.5 would address this

question. It is also possible that with analysis of a larger sample, some right-sided

expression would be detected. However, with the current sample size, chi square

analysis gives a p value of <.01, indicating asymmetric Pitx2 expression is not random.

Finally, the addition of the Gdf1 node-Tg in Tbx6 homozygous mutants may be rescuing

asymmetric expression of Pitx2 independent of the flow generated at the node through

an unknown mechanism. 69

Our analysis shows that Tbx6 does not regulate luciferase reporter activity

through the putative Tbx6 binding sites found within 2kb of Gdf1’s promoter region. It is

possible that Tbx6 regulates Gdf1 expression directly in vivo through other sites not

detected in this analysis. However, our result suggests that Tbx6 may indirectly

regulate the perinodal expression of Gdf1. Gdf1 is a member of the TGF beta family of

proteins. Perinodal expression of other members of the TGF-beta family, such as Nodal,

is regulated by Notch signaling. It is possible that the decrease in Notch signaling seen

in Tbx6 homozygous mutants leads to a loss of perinodal Gdf1 expression. To address

this question, characterization of Gdf1 expression could be investigated in embryos that

have decreased Notch activity between E8.0 and E8.5.

No genetic interaction was detected between Tbx6 and Gdf1. Both Tbx6+/-,

Gd1+/- double heterozygous embryos and Tbx6rv/-,Gdf1+/- compound heterozygous embryos had normal situs. The most likely explanation is that there is enough Tbx6

protein present to drive Gdf1 expression. To further investigate genetic interaction, we

could further decrease the gene dosage of Gdf1 with the use of hypomorphic alleles of

Gdf1, thus further sensitizing our screen for left-right asymmetry defects.

Materials and Methods

Mice and Embryo collection

In this study we used the null, expression reporter allele, Tbx6tm2Pa, referred in this study as Tbx6-, which deletes exon two and part of exon 3 to delete Tbx6 function

and inserts a H2B-EYFP fusion gene which expressed a fusion protein of histone 2B

and yellow fluorescent protein under the regulation of the Tbx6 promoter (Hadjantonakis 70

et al., 2008). The allele fails to fully recapitulate endogenous Tbx6 expression. The

allele was maintained on a mixed genetic background of 129 and ICR (Taconic). Tbx6-

heterozygous mice, which are viable and fertile, were mated to produce +/+, Tbx6+/- and

Tbx6-/- embryos between E7.5-E8.5 (E0.5 denotes noon of the day a vaginal plug was observed). Embryos carrying the Tbx6- allele were genotyped by fluorescence, as

fluorescence intensity is proportional to the number of Tbx6- alleles (Hadjantonakis et al.,

2008).

The null allele Gdf1tm1Sjl, (Jackson Labs) which in this study will be referred to as

Gdf1- is a targeted deletion of the entire protein coding region of Gdf1 (Rankin et al.,

2000). A transgene, node-Tg expresses Gdf1 cDNA and LacZ in the perinodal region

under the regulation of the node specific enhancer (NDE) of nodal and an hsp8

promoter (A gift from Dr. Hiroshi Hamada) (Tanaka et al., 2007). Both alleles were

maintained on a mixed genetic background of C57 and ICR (Taconic).

A hypomorphic allele of Tbx6, Tbx6 rib vertebrae or Tbx6rv contains a rearrangement in the promoter region. An insertion upstream of the translation initiation site includes part of exon 1, intron 1, and a portion of exon 2 in inverted orientation

(Jackson Labs) (Watabe-Rudolph et al., 2002). Mice were maintained on a mixed

genetic background of C57 and ICR (Taconic).

Tbx6+/- heterozygous mice were mated with Gdf1+/- heterozygous mice to

produce embryos that are Tbx6 +/-;Gdf1 +/- at E9.5. Additionally Tbx6rv heterozygous

mice were mated to Tbx6+/-;Gdf1+/- mice to produce Tbx6rv/-,Gdf1+/- embryos at E9.5

days. Embryos were removed from the uterus and dissected out of the decidua leaving

the yolk sac and placenta intact. Placement of the tail, placenta and vitelline vessels 71

was recorded. The yolk sac was then removed and heart morphology and the direction

of heart looping was recorded. Yolk sacs were used for genotyping by PCR using

primers for Tbx6, Tbx6rv, Gdf1 and node-Tg (Table 4) (Rankin et al., 2000; Watabe-

Rudolph et al., 2002; Hadjantonakis et al., 2008).

Tbx6+/- heterozygous mice were mated to node-Tg transgenic mice to produce

Tbx6 +/-;node-Tg mice. Tbx6 +/-,node-Tg mice were mated to Tbx6 +/- to produce Tbx6 -/-

,node-Tg embryos at E8.5. Embryos were genotyped using PCR for primers for Tbx6

and node-Tg (Supplementary Table 1) (Tanaka et al., 2007).

RNA ISH hybridization

(Wilkinson, 1998).

Electrophoretic mobility shift assays

Tbx6 protein was made using full-length Tbx6 cDNA cloned into a pET21a expression vector (Novagen). A coupled TNT in vitro transcription/translation system with rabbit reticulocyte lysate (Promega) was used to create full-length Tbx6 protein used for electrophoretic mobility shift assay (EMSA) DNA binding studies (White and

Chapman, 2005). 1μg of Tbx6 cDNA in pET21a expression vector was incubated in 72

50μl of rabbit reticulocyte lysate for 1 hour at 30°C. 3μl of the reaction was used for

DNA binding studies.

Fluorescent probe was generated by attaching a linker sequence 5’-

GTAGAGACTCGT-3’ to the 3’ end of the reverse compliment of five putative Tbx6

binding sites. The core sequence of the T-box binding element was mutated to create

mutant versions of each probe. To create a double stranded fluorescently labeled DNA

probe for EMSA a fluorescently labeled oligonucleotide, Tbx6 linker: 5’-Cy5-

GTAGAGACTCGT-3’, was annealed to the linker sequence on each of the reverse

compliment oligonucleotides, and second used KLENOW polymerase to fill in the

remaining sequence. This protocol was used to create the 10 fluorescently labeled

DNA probes used in DNA binding assays.

Three micro liters of lysate containing either the Tbx6 expression construct or

empty vector was incubated with 0.3 ng of each fluorescently labeled probe in binding

buffer (20 mM HEPES, pH 7.5, 50 mM KCl, 5 mM MgCl2, 10 µM ZnCl2, 6% glycerol,

200 µg of bovine albumin per ml, and 50 µg of poly(dI-dC)·poly(dI-dC) per ml (Gebelein

and Urrutia, 2001) for 20 minutes at room temperature. Each binding reaction was then loaded onto a 4% polyacrylamide gel and ran at 120 volts at 4°C. Fluorescent probe alone was loaded as a negative control. The gel was then vacuum dried and imaged using a Typhoon TRIO variable mode imager (Amersham Biosciences).

Cell culture and luciferase assays

NIH-3T3 cells (ATCC) were cultured in DMEM (Gibco) with 10% FBS (Hyclone),

1% Penicillin/Streptomycin (Gibco), 1% non-essential amino acids (Gibco), 1% sodium 73

pyruvate (Gibco). Cells were split at 80% confluency and plated at a concentration of

200,000 cells per mL for transfection. NIH-3T3 cells were transfected with a luciferase reporter containing the promoter region of Gdf1, a luciferase reporter containing mutated putative Tbx6 binding sites, and Tbx6 cDNA (White and Chapman, 2005))

cloned in frame into the expression vector pCMV-Tag2a that inserts a FLAG tag at the 5’

end of Tbx6 protein. Transfection was achieved by PEI-based transfection as

previously described (Christina et al., 2006).

Cells collected 48hrs after transfection were lysed in cold NP40 Vanadate lysis

buffer containing protease inhibitor cocktail (Sigma) and phenylmethylsulfonyl fluoride

(PMSF) at 1mM final concentration for 20 minutes. Cells were spun down and protein

in the supernatant was quantified by Bradford reagent (Biorad) and used for western

blotting. 10ug of protein per sample per lane was run on a 4% polyacrylamide gel and

transferred onto polyvinylidene difluoride (PVDF) membrane. Western Blots were

blocked in 4% milk for 30 minutes at room temperature and incubated with mouse anti-

FLAG antibody at 1:200 (Sigma) overnight at 4°C. Blots were washed with PBS

containing 0.1% Tween-20 and anti-mouse horseradish peroxidase (Jackson Labs) was added at a concentration of 1;10,000 for one hour. Blots were visualized with ECL

Substrate (Thermo Scientific).

Table 4. Sequences of Tbx6 putative bindings sites with 2kb of the Gdf1 transcriptional start site and EMSA DNA probes

Tbx6 binding site location relative to Tbx6 DNA Gdf1 transcriptional binding site start site sequence Wild type EMSA DNA probe Mutant EMSA DNA probe1 GGAACTGCGAGCTGTCACA GGAACTGCGAGCTGTCTT AGGTGTGA CCTCTCCAGACCCACGAGT TTAGCTCCAGACCCACGA -1522 CAGC CTCTAC GTCTCTAC TAGCTCTCTAGCCCTCTCA TAGCTCTCTAGCCCTCTTT AGGTGAG CCTACACCATTTAACGAGT TAGACACCATTTAACGAG -1356 AGGGC CTCTAC TCTCTAC TCCTCCATCAGTATTTAAAA TCCTCCATCAGTATTTATT AGGTTTTA CCTTGGATGGCTCAACGAG TTAGTGGATGGCTCAACG -836 AATA TCTCTAC AGTCTCTAC TAGCCTGATCCTTACTAAC TAGCCTGATCCTTACTATT AGGAGTTA TCCTCCAGCCATATAACGA TTAGCCAGCCATATAACG -544 GTAA GTCTCTAC AGTCTCTAC CGCATCTGACCAGTCAGCA CGCATCTGACCAGTCATT AGGTGCT CCTTGGCTGCGAAACGAGT TTAGTGGCTGCGAAACGA 989 GACTG CTCTAC GTCTCTAC 1Mutation indicated by Italicized sequence

Figure 11: Expression of Noto in wild type and Tbx6 homozygous mutants from midstreak through head fold stages between E7.5-E8.0 Noto expression in wild type embryos (A-D,B'C') is found in the anterior primitive streak at the MS stage and later in the node and nascent notochord at the bud and head fold stages. Tbx6 homozygous mutants (E-H,F',G') do not express Noto at the MS stage (E), 1 of 3 showed reduced expression at the LS stage (H), 1 of 2 showed reduced expression at the Bud stage (F,F’), while 3 of 6 showed irregular pattern of Noto expression at the HF stage (G,G’) Expression was similar to wild type in all other mutant embryos. Images in B’,C’,F’ and G’ show ventral views of the distal tip of embryos in the corresponding panelswith anterior to the bottom of the figure. Arrows indicate anterior end of the streak and arrowheads indicate the node. A, allantois;HF, head fold; MS, midstreak; LS, late streak.

Figure 12: Expression of Foxj1 in wild type andTbx6 homozygous mutants from streak to somite stages between E7.5-E8.5 A-D’. Left view of Foxj1 expression shows no difference in wild type and Tbx6 homozygous mutants at the streak stage at the anterior end of the streak (A,C). Left and ventral views of Foxj1 expression in wild type (B,B’) and Tbx6 homozygous mutants (D,D’) at EB stage show irregular pattern of expression at the node between the two genotypes. E-L. Ventral views of FoxJ1 expression in the node from latebud to 6 somite stage in wild type (E-H) and Tbx6 homozygous mutants (I-L). No difference in Foxj1 expression was observed between wild type embryos andTbx6 homozygous mutants. Arrows indicate anterior end of the primitive streak and arrowheads indicate the node. EB, early bud; LB, late bud; EHF, early headfold, LHF, late headfold; Som, somite.

Figure 13. Expression of Rfx3 in wild type and Tbx6 homozygous mutants from bud and head fold stages between E7.5-E8.0 Rfx3 expression in ventral view of distal tip of wild type (A,B) and in Tbx6 homozygous mutants (E,F) at bud stage. Left side and ventral view of Rfx3 expression in wild type (C,D) and Tbx6 homozygous mutants (G,H) at the head fold stage (C,D). No difference in Rfx3 expression was observed between wild type and Tbx6 homozygous mutants. Arrowheads indicate the node. A, allantois; HF, headfolds.

Figure 14. Expression of non-canonical Wnt signaling ligands in wild type and Tbx6 homozygous mutants from early bud and late head fold stages between E7.5-E8.0 Left views of Wnt5a expression (A-H) and Wnt5b (I-P) in wild type (A-D, I-L) and Tbx6 homozygous mutants (E-H,M-P) show no difference in expression pattern at the caudual end of the presomitic mesoderm and the posterior embryonic/extraembryonic junction. A, allantois; HF, headfolds.

Figure 15. Left view of expression of non-canonical Wnt signaling receptors from streak to somite stages in wild type and Tbx6 homozygous mutants between E7.5 and E.8.5 A-L. Fzd2 (A-F) and Fzd3 (G-L) expression in wild type (A-C, G-I) and in Tbx6 homozygous mutants (D-F,J-L) is in the embryo proper but excluded from primitive endoderm and extra embryonic tissues. M-R. Fzd10 expression in wild type (M-O) and Tbx6 homozygous mutants (P-R) is in the presomitic mesoderm and base of the allantois. No difference was observed in Fzd2, Fzd3 and Fzd10 expression between the wild types and Tbx6 homozygous mutant embryos. B, allantoic bud; H, heart; A, allantois; HF, headfolds.

Figure 16. Expression of Gdf1 in wild type and Tbx6 homozygous mutant embryos between LHF and 7 somite stages A-H. Left lateral (A-D) and ventral (E-H) views of Gdf1 expression in the perinodal region of wild type embryos. Gdf1 is expressed bilaterally in both the perinodal region and LPM between three and seven somites. I-P. Left lateral (I-L) and ventral (M-P) views of Gdf1 expression in Tbx6 homozygous mutant embryos at show a loss of perinodal expression at LHF and bilateral expression of Gdf1 in the LPM between three and seven somites. AL, allantois; HF, headfold; H, heart.

Figure 17: Characterization of Tbx6 putative binding sites in the Gdf1 promoter region by electrophoretic mobility shift (EMSA) and luciferase assays in 3T3 cells

A. Schematic of Gdf1 genomic region and locations of putative Tbx6 binding sites relative to the transcriptional start site of Gdf1. Blue boxes represent exons. B. EMSA with wild type and mutant (m) DNA probes for each of five Tbx6 putative binding sites run with or without (+ or -) Tbx6 protein. A known Tbx6 binding site of Dll1 (D1) was used as a positive binding control. C. Diagram of wild type and mutant Gdf1 luciferase reporters with relative locations of putative Tbx6 binding sites. “X”s represents a mutated putative Tbx6 binding site. D. The bar graph represents the relative fold change of luciferase reporter activity with increasing amount of Tbx6 protein for the wild type and mutant reporter. Asterisks indicate a significant difference between groups indicated (ANOVA). E. Western blot for FLAG tagged Tbx6 with an anti-FLAG antibody.

Figure 18. Expression of Pitx2 in wild type, Tbx6-/- and Tbx6-/-; node-Tg embryos. Pitx2 expression is in the head folds of all embryos and in the left inflow tract of wild type (A) and in 8 out 22 Tbx6-/-; node-Tg embryos (C). The rest of the Tbx6-/-; node-Tg embryos showed no expression of Pitx2 in the inflow tracts. Tbx6-/- embryos showed no Pitx2 expression in the left inflow tract (B). HF, headfolds; H, heart.

Table 5: Primer sequences used for genotyping mice and embryos

Genotype Primer Name Primer Sequence Tbx6 T6koGS1 ATTGCACGCAGGTTCTCCGG T6koGS2 GTCACGACGAGATCCTCGCC T6met GGGAGAATGGGATCCAGG T6ln TACCATCCACGAGAGTTGTAC Tbx6rv Rv1b GTGTCTGGCGTATCAGCTCA Rv2a CTCGCAGCTTCACTAGTCC- Gdf1 oIMR183 GTTGCGGCTGGAGGCTGAGAG oIMR184 CCCACTGGACCAACTTCTACC oIMR185 CCACTGCAGCCTGTGGGCGC oIMR186 GGAAGACAATAGCAGGCATGCTGG Node-Tg ZS-6 GCACGGTTACGATGCGCCCATCTACACCAACGT ZA-6 ACGGCAAACGACTGTCCTGGCCGTAACCGACC

Discussion

T and Tbx6 during gastrulation

The T-box genes, T and Tbx6, share many similarities. First, both genes are

capable of binding the same DNA binding element known as the T-half site. Additionally,

both genes are expressed in the primitive streak when the node precursor cells in the

mid gastrula organizer are being specified and later in the tail bud during somitogenesis

(Chapman et al., 1996). Since T and Tbx6 can bind to the same DNA sequence and have overlapping expression patterns, they may share the same DNA targets and have overlapping functions during development. However, mutational analysis reveals that T and Tbx6 play different roles during gastrulation.

T is first expressed in the primitive streak at the onset of gastrulation. T has been hypothesized to play a role in gastrulation by affecting specification and migration of cells that ingress through the primitive streak (Figure 18A), as cells that lack T protein fail to ingress (Beddington et al., 1992). Cells of the primitive streak give rise to the

presomitic mesoderm (PSM) and embryonic node (Figure 18A). In both TWis and Tbx6

homozygous mutants, node development is adversely affected. Our analysis shows that TWis homozygous mutants have node morphological defects and have a reduced

number of cilia in the ventral node. Tbx6 is first expressed in the primitive streak at

E7.5 after the onset of T expression and homozygous null mutants have node cilia

motility and morphology defects (Chapman et al., 1996; Hadjantonakis et al., 2008).

Since T plays a role in cell migration, morphology defects in the nodes of TWis

homozygous mutants may be due to a loss of the precursor cell population that gives

rise to the node. In zebrafish, the ortholog of T, ntl, affects the development of Kupfer’s 87

vesicle, a structure analogous to the mouse embryonic node, by regulating cellular

organization (Amack and Yost, 2004). Alternatively, T may affect the expression of

genes necessary for node formation, such as Foxa2 and Chd, at the mid streak stage.

In Tbx6 homozygous mutants, early gastrulation seems unaffected as cells in the

anterior/posterior axis give rise to morphologically normal midline structures including

the allantois (Chapman and Papaioannou, 1998). The role of Tbx6 may be to regulate

expression of genes that are necessary for development of node cilia. We observed that

Tbx6 homozygous mutants have late onset of Noto expression, which could account for

the observed cilia defect. Tbx6 could also regulate the expression of as yet unidentified

genes necessary for node cilia morphology. T and Tbx6, therefore, have very different roles in node morphogenesis; T functions upstream of Tbx6 to specify or provide the population of node precursors while Tbx6 may act to regulate genes necessary for ciliogenesis.

Though both T and Tbx6 have overlapping expression in the tailbud, each plays a unique role in the development of the PSM and somites. The primitive streak is the source of mesoderm for anterior somites while cells that give rise to posterior somites originate from the PSM of the tailbud. Currently, the model for the development of posterior somites proposes that Wnt3a expressing cells of the presomitic mesoderm migrate through the streak and initiate expression of T, which then allows the cells to move away from the streak. T initiates Tbx6 expression, which gives cells their identity as mesoderm and helps to pattern somites (Yamaguchi et al., 1999; Hofmann et al.,

2004b). T plays a role in the development of both anterior and posterior somites as embryos that are homozygous mutant for different alleles of T develop a variable 88

number of anterior somites ranging from 0-10. TWis being more severe than the T

homozygous null mutant has no somites (Shedlovsky et al., 1988; Beddington et al.,

1992). Therefore, T may directly regulate Tbx6 expression in the PSM or may just be necessary for cell migration while other factors initiate Tbx6 expression. Tbx6 works to maintain mesoderm identity as Tbx6 homozgyous mutants develop ectopic neural tubes in place of somites due to ectopic expression of Sox2 in the tailbud (Figure 18A)

(Takemoto et al., 2011). Tbx6 also plays a role in somite patterning through its regulation of the Notch signaling pathway as well as its regulation of transcription factors necessary for somitogenesis, Mesp2, Msgn1 and Ripply2 (White and Chapman,

2005; Yasuhiko et al., 2006; Wittler et al., 2007; Dunty et al., 2008). Our work shows that the observed Tbx6 homozygous null phenotype is partially due to the down regulation of genes necessary for somite development and also points to the fact that

Tbx6 may be necessary for proper identity of all mesoderm found in the tail bud. Overall the roles of T and Tbx6 during somitogenesis supports the idea that T functions upstream of Tbx6 (Figure 18A).

T and Tbx6 play different roles in the determination of left/right asymmetry

T and Tbx6 homozygous mutants have left/right asymmetry defects. T and Tbx6

each play a role in node morphological development and perinodal signaling. T

regulates the morphology of the node and number of cilia of the node while Tbx6 affects

the development of node cilia morphology (Figure 18B). Both T and Tbx6 affect the

expression of perinodally-expressed genes. Gdf1, Cer2 and Nodal are all expressed in

the perinodal crown cells of the node so their absence in TWis homozygous mutants may 89

indicate either that T is acting as a master regulator of these genes or that there is a

defect in the formation or specification of the tissue in which they are expressed. Tbx6

homozygous mutants show decreased expression of Nodal and lack Gdf1 expression in

the perinodal region. The node crown morphology is not affected in Tbx6 homozygous

mutants, which suggests that Tbx6 functions to promote gene transcription of

perinodally-expressed genes. Both TWis and Tbx6 homozygous mutants have an effect

on Dll1 expression at E8.0, which may account for the alteration in Nodal expression as

Notch signaling regulates the perinodal expression of Nodal. T and Tbx6 homozygous

mutants show a loss of left-right specific gene expression in the LPM, which indicates

that both are necessary for asymmetric signal transduction from the perinodal region to

the left LPM. Also since Tbx6 expression is unaffected in T homozygous null embryos

at E8.0 the two genes function independently of one another to regulate the expression

of left/right genes in the perinodal region (Chapman et al., 1996).

Cells that make up the node arise from the primitive streak during gastrulation.

In this study we conducted a detailed analysis of the node morphological defects in TWis

homozygous mutants and in doing so demonstrated that T functions to develop the

morphology of the node and its cilia. Our work contributes to the hypothesis that T

plays a role in gastrulation, similar to Foxa2 and Dll1, by developing structures of the midline.

As previously mentioned, correct determination of left/right asymmetry is dependent on an asymmetric signal generated at the node, which leads to asymmetric perinodal expression of Nodal on the left. Its antagonist, Cer2 and its agonist, Gdf1, regulate perinodal nodal activity. Nodal is then transferred to the left LPM where it 90

governs the expression of other asymmetrically expressed genes such as Pitx2, which

leads to asymmetric organogenesis. In this study we found that Tbx6 and T affect multiple steps of the left/right asymmetry determination pathway. Both genes affect the node and regulate perinodal gene expression. Our investigation provides new insight into how T-box genes fit in the transcriptional network that regulates the determination

of left/right asymmetry.

Future Perspectives

The dominant negative allele of T, TWis and a homozygous null allele of Tbx6 affect node development in very different ways. Further study would focus on understanding how these two T-box genes affect the genetic network that regulates patterning of the streak stage embryo. The role Notch signaling plays in early embryonic patterning is still unknown. In zebrafish, Notch signaling regulates the formation of endoderm while in Xenopus, it regulates the segregation of the three germ layers (Kikuchi et al., 2004; Latimer and Appel, 2006; Revinski et al., 2010). Regulation of Notch signaling by T-box genes occurs during somitogenesis so it is possible that T- box genes play a role in the development of the early embryo by regulating components of the Notch signaling pathway.

Tbx6 homozygous mutants have several different defects that can each lead to a left/right asymmetry phenotype. Node cilia morphological defects and loss of Gdf1 perinodal expression each can perturb expression of left/right specific genes in the LPM.

Whether Tbx6 is directly or indirectly regulating both node cilia morphogenesis and perinodal expression of Gdf1 are areas of interest that require further investigation. 91

It still remains unknown whether T directly regulates expression of Tbx6 during somitogenesis. Investigation of the presomitic mesoderm defects of T and Tbx6 homozygous mutants will contribute to the understanding of the interplay between T and

Tbx6 and provide insight into how T-box genes regulate organ development.

Figure 19: Multiple roles of T and Tbx6 during gastrulation and determination of left/right asymmetry A. Roles of T and Tbx6 during gastrulation. T affects cell specification and migration of cells of the primitive streak while Tbx6 affects cell fate and patterning of somites. B. Roles of T and Tbx6 during left/right asymmetry determination. T regulates node morphology and cilia number while Tbx6 regulates node cilia morphology. Both T and Tbx6 affect perinodal signaling. Gene names represent known effector genes.

References

Agathon A, Thisse C, Thisse B. 2003. The molecular nature of the zebrafish tail organizer. Nature 424:448-452. Agulnik SI, Garvey N, Hancock S, Ruvinsky I, Chapman DL, Agulnik I, Bollag R, Papaioannou V, Silver LM. 1996. Evolution of mouse T-box genes by tandem duplication and cluster dispersion. Genetics 144:249-254. Amack J, Yost H. 2004. The T box transcription factor no tail in ciliated cells controls zebrafish left-right asymmetry. Current biology : CB 14:685-690. Ang S, Rossant J. 1994. HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78:561-574. Ara T, Tokoyoda K, Okamoto R, Koni P, Nagasawa T. 2005. The role of CXCL12 in the organ- specific process of artery formation. Blood 105:3155-3161. Arnold S, Robertson E. 2009. Making a commitment: cell lineage allocation and axis patterning in the early mouse embryo. Nature reviews. Molecular cell biology 10:91- 103. Bachiller D, Klingensmith J, Kemp C, Belo J, Anderson R, May S, McMahon J, McMahon A, Harland R, Rossant J, De Robertis E. 2000. The organizer factors Chordin and Noggin are required for mouse forebrain development. Nature 403:658-661. Beckers A, Alten L, Viebahn C, Andre P, Gossler A. 2007. The mouse homeobox gene Noto regulates node morphogenesis, notochordal ciliogenesis, and left right patterning. Proc Natl Acad Sci U S A 104:15765-15770. Beddington R. 1994. Induction of a second neural axis by the mouse node. Development (Cambridge, England) 120:613-620. Beddington R, Rashbass P, Wilson V. 1992. Brachyury--a gene affecting mouse gastrulation and early organogenesis. Development (Cambridge, England). Supplement:157-165. Beddington RSP, Robertson EJ. 1999. Axis development and early asymmetry in mammals. Cell 96:195-209. Bleul C, Fuhlbrigge R, Casasnovas J, Aiuti A, Springer T. 1996. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). The Journal of experimental medicine 184:1101-1109. Bonnafe E, Touka M, AitLounis A, Baas D, Barras E, Ucla C, Moreau A, Flamant F, Dubruille R, Couble P, Collignon J, Durand B, Reith W. 2004. The transcription factor RFX3 directs nodal cilium development and left-right asymmetry specification. Mol Cell Biol 24:4417-4427. Borycki A, Mendham L, Emerson C. 1998. Control of somite patterning by Sonic hedgehog and its downstream signal response genes. Development (Cambridge, England) 125:777-790. Brand-Saberi B, Christ B. 2000. Evolution and development of distinct cell lineages derived from somites. Curr Top Dev Biol 48:1-42. Brennan J, Norris D, Robertson E. 2002a. Nodal activity in the node governs left-right asymmetry. Genes & development 16:2339-2344. Brennan J, Norris DP, Robertson EJ. 2002b. Nodal activity in the node governs left-right asymmetry. Genes & Development 16:2339-2344. 94

Brody SL, Yan XH, Wuerffel MK, Song SK, Shapiro SD. 2000. Ciliogenesis and left-right axis defects in forkhead factor HFH-4-null mice. Am J Respir Cell Mol Biol 23:45-51. Brown NA, Anderson RH. 1999. Symmetry and laterality in the human heart: developmental implications. In: Harvey RP, Rosenthal N, editors. Heart Development. San Diego London Boston New York Sydney Tokyo Toronto: Academic Press. pp 447-461. Burgess R, Cserjesi P, Ligon KL, Olson EN. 1995. Paraxis: a basic helix-loop-helix protein expressed in paraxial mesoderm and developing somites. Dev Biol 168:296-306. Burgess R, Rawls A, Brown D, Bradley A, Olson E. 1996. Requirement of the paraxis gene for somite formation and musculoskeletal patterning. Nature 384:570-573. Bush J, Lan Y, Maltby K, Jiang R. 2002. Isolation and developmental expression analysis of Tbx22, the mouse homolog of the human X-linked cleft palate gene. Developmental dynamics : an official publication of the American Association of Anatomists 225:322-326. Bussen M, Petry M, Schuster-Gossler K, Leitges M, Gossler A, Kispert A. 2004. The T-box transcription factor Tbx18 maintains the separation of anterior and posterior somite compartments. Genes & development 18:1209-1221. Camus A, Tam P. 1999. The organizer of the gastrulating mouse embryo. Current topics in developmental biology 45:117-153. Candia AF, Hu J, Crosby J, Lalley PA, Noden D, Nadeau JH, Wright CV. 1992. Mox-1 and Mox- 2 define a novel homeobox gene subfamily and are differentially expressed during early mesodermal patterning in mouse embryos. Development 116:1123-1136. Chapman DL, Agulnik I, Hancock S, Silver LM, Papaioannou VE. 1996. Tbx6, a mouse T-box gene implicated in paraxial mesoderm formation at gastrulation. Developmental Biology 180:534-542. Chapman DL, Papaioannou VE. 1998. Three neural tubes in mouse embryos with mutations in the T-box gene, Tbx6. Nature 391:695-697. Chen F, Greer J, Capecchi M. 1998. Analysis of Hoxa7/Hoxb7 mutants suggests periodicity in the generation of the different sets of vertebrae. Mechanisms of development 77:49-57. Chen L, Fulcoli F, Ferrentino R, Martucciello S, Illingworth E, Baldini A. 2012. Transcriptional control in cardiac progenitors: Tbx1 interacts with the BAF chromatin remodeling complex and regulates Wnt5a. PLoS genetics 8. Christ B, Brand-Saberi B, Grim M, Wilting J. 1992. Local signalling in dermomyotomal cell type specification. Anat Embryol (Berl) 186:505-510. Christina E, Mirco S, Andreas M, Alexander K, Carola W, Viktor W, Stephan L. 2006. Polyethylenimine, a cost-effective transfection reagent. Signal Transduction 6. Chu J, Ding J, Jeays-Ward K, Price S, Placzek M, Shen M. 2005. Non-cell-autonomous role for Cripto in axial midline formation during vertebrate embryogenesis. Development (Cambridge, England) 132:5539-5551. Collignon KJ, Varlet I, Robertson EJ. 1996. Relationship between asymmetric nodal expression and the direction of embryo turning. Nature 381:155-158. Conlon F, Wright C, Robertson E. 1995. Effects of the TWis mutation on notochord formation and mesodermal patterning. Mechanisms of development 49:201-209. 95

Conlon FL, Lyons KM, Takaesu N, Barth KS, Kispert A, Herrmann B, Robertson EJ. 1994. A primary requirement for nodal in the formation and maintenance of the primitive streak in the mouse. Development 120:1919-1928. Davidson B, Kinder S, Steiner K, Schoenwolf G, Tam P. 1999. Impact of node ablation on the morphogenesis of the body axis and the lateral asymmetry of the mouse embryo during early organogenesis. Developmental biology 211:11-26. Davidson BP, Tam PP. 2000. The node of the mouse embryo. Curr Biol 10:R617-619. Dobrovolskaia-Zavadskaia N. 1927. Sur la mortification spontanée de la queue che la souris nouveau-née et sur l'existence d'un caractère (facteur) héréditaire "non viable". C. R. Seanc. Soc. Biol. 97:114-116. Dunty WC, Jr., Biris KK, Chalamalasetty RB, Taketo MM, Lewandoski M, Yamaguchi TP. 2008. Wnt3a/beta-catenin signaling controls posterior body development by coordinating mesoderm formation and segmentation. Development 135:85-94. Etheridge SL, Ray S, Li S, Hamblet NS, Lijam N, Tsang M, Greer J, Kardos N, Wang J, Sussman DJ, Chen P, Wynshaw-Boris A. 2008. Murine dishevelled 3 functions in redundant pathways with dishevelled 1 and 2 in normal cardiac outflow tract, cochlea, and neural tube development. PLoS Genet 4:e1000259. Fanto M, McNeill H. 2004. Planar polarity from flies to vertebrates. J Cell Sci 117:527-533. Farin H, Bussen M, Schmidt M, Singh M, Schuster-Gossler K, Kispert A. 2007. Transcriptional repression by the T-box proteins Tbx18 and Tbx15 depends on Groucho corepressors. J Biol Chem 282:25748-25759. Gardner RL. 1982. Investigation of cell lineage and differentiation in the extraembryonic endoderm of the mouse embryo. J Embryol Exp Morphol 68:175-198. Gardner RL, Rossant J. 1979. Investigation of the fate of 4-5 day post-coitum mouse inner cell mass cells by blastocyst injection. J Embryol Exp Morphol 52:141-152. Gavin BJ, McMahon JA, McMahon AP. 1990. Expression of multiple novel Wnt-1/int-1- related genes during fetal and adult mouse development. Genes Dev 4:2319-2332. Gebelein B, Urrutia R. 2001. Sequence-specific transcriptional repression by KS1, a multiple-zinc-finger-Krüppel-associated box protein. Molecular and cellular biology 21:928-939. Goldin SN, Papaioannou VE. 2003. Unusual misregulatin of RNA splicing caused by insertion of a transposable element into the T (Brachyury) locus. BMC Genomics 4:14. Goldman D, Martin G, Tam P. 2000. Fate and function of the ventral ectodermal ridge during mouse tail development. Development (Cambridge, England) 127:2113-2123. Gray P, Fu H, Luo P, Zhao Q, Yu J, Ferrari A, Tenzen T, Yuk D-I, Tsung E, Cai Z, Alberta J, Cheng L-P, Liu Y, Stenman J, Valerius M, Billings N, Kim H, Greenberg M, McMahon A, Rowitch D, Stiles C, Ma Q. 2004. Mouse brain organization revealed through direct genome-scale TF expression analysis. Science (New York, N.Y.) 306:2255-2257. Gruneberg H. 1958. Genetical studies on the skeleton of the mouse. XXIII. The development of brachyury and anury. J Embryol Exp Morphol 6:424-443. Hadjantonakis AK, Pisano E, Papaioannou VE. 2008. Tbx6 regulates left/right patterning in mouse embryos through effects on nodal cilia and perinodal signaling. PLoS ONE 3:e2511. Hamada H, Meno C, Watanabe D, Saijoh Y. 2002. Establishment of vertebrate left-right asymmetry. Nature Reviews Genetics 3:103-113. 96

Hamblet NS, Lijam N, Ruiz-Lozano P, Wang J, Yang Y, Luo Z, Mei L, Chien KR, Sussman DJ, Wynshaw-Boris A. 2002. Dishevelled 2 is essential for cardiac outflow tract development, somite segmentation and neural tube closure. Development 129:5827-5838. Hashimoto M, Shinohara K, Wang J, Ikeuchi S, Yoshiba S, Meno C, Nonaka S, Takada S, Hatta K, Wynshaw-Boris A, Hamada H. 2010. Planar polarization of node cells determines the rotational axis of node cilia. Nature cell biology 12:170-176. Hofmann M, Schuster-Gossler K, Watabe-Rudolph M, Aulehla A, Herrmann B, Gossler A. 2004a. WNT signaling, in synergy with T/TBX6, controls Notch signaling by regulating Dll1 expression in the presomitic mesoderm of mouse embryos. Genes & development 18:2712-2717. Hofmann M, Schuster-Gossler K, Watabe-Rudolph M, Aulehla A, Herrmann BG, Gossler A. 2004b. WNT signaling, in synergy with T/TBX6, controls Notch signaling by regulating Dll1 expresion in the presomitic mesoderm of mouse embryos. Genes & Development 18:2712-2717. Jeong Y, Epstein D. 2003. Distinct regulators of Shh transcription in the floor plate and notochord indicate separate origins for these tissues in the mouse node. Development (Cambridge, England) 130:3891-3902. Kikuchi Y, Verkade H, Reiter J, Kim C-H, Chitnis A, Kuroiwa A, Stainier D. 2004. Notch signaling can regulate endoderm formation in zebrafish. Developmental dynamics : an official publication of the American Association of Anatomists 229:756-762. Kim AS, Lowenstein DH, Pleasure SJ. 2001. Wnt receptors and Wnt inhibitors are expressed in gradients in the developing telencephalon. Mech Dev 103:167-172. Kinder S, Tsang T, Quinlan G, Hadjantonakis A, Nagy A, Tam P. 1999. The orderly allocation of mesodermal cells to the extraembryonic structures and the anteroposterior axis during gastrulation of the mouse embryo. Development (Cambridge, England) 126:4691-4701. Kinder S, Tsang T, Wakamiya M, Sasaki H, Behringer R, Nagy A, Tam P. 2001. The organizer of the mouse gastrula is composed of a dynamic population of progenitor cells for the axial mesoderm. Development (Cambridge, England) 128:3623-3634. King T, Beddington RSP, Brown NA. 1998. The role of the brachyury gene in heart development and left-right specification in the mouse. Mechanisms of Development 79:29-37. Krebs L, Iwai N, Nonaka S, Welsh I, Lan Y, Jiang R, Saijoh Y, O'Brien T, Hamada H, Gridley T. 2003a. Notch signaling regulates left-right asymmetry determination by inducing Nodal expression. Genes & development 17:1207-1212. Krebs LT, Iwai N, Nanaka SW, I. C., Lan Y, Jiang R, Saijoh Y, O'Brien TP, Hamada H, Gridley T. 2003b. Notch signaling regulates left-right asymmetry determination by inducing Nodal expression. Laclef C, Hamard G, Demignon J, Souil E, Houbron C, Maire P. 2003. Altered myogenesis in Six1-deficient mice. Development (Cambridge, England) 130:2239-2252. Latimer A, Appel B. 2006. Notch signaling regulates midline cell specification and proliferation in zebrafish. Developmental biology 298:392-402. Le Mouellic H, Lallemand Y, Brulet P. 1992. Homeosis in the mouse induced by a null mutation in the Hox-3.1 gene. Cell 69:251-264. 97

Levin M, Johnson RL, Stern CD, Kuehn MR, Tabin C. 1995. A molecular pathway determining left-right asymmetry in chick embryogenesis. Cell 82:803-814. Lin C, Kioussi C, O'Connell S, Briata P, Szeto D, Liu F, Izpisúa-Belmonte J, Rosenfeld M. 1999. Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis. Nature 401:279-282. Liu P, Wakamiya M, Shea MJ, Albrecht U, Behringer RR, Bradley A. 1999. Requirement for Wnt3 in vertebrate axis formation. Nat Genet 22:361-365. Lowe L, Supp D, Sampath K, Yokoyamma T, Wright C, Potter S, Overbeek P, Kuehn M. 1996. Conserved left-right asymmetry of nodal expression and alterations in murine situs inversus. Nature 381:158-161. Lowe LA, Yamada S, Kuehn MR. 2001. Genetic dissection of nodal function in patterning the mouse embryo. Development 128:1831-1843. Makita R, Mizuno T, Koshida S, Kuroiwa A, Takeda H. 1998. Zebrafish wnt11: pattern and regulation of the expression by the yolk cell and No tail activity. Mech Dev 71:165- 176. Mankoo B, Skuntz S, Harrigan I, Grigorieva E, Candia A, Wright C, Arnheiter H, Pachnis V. 2003. The concerted action of Meox homeobox genes is required upstream of genetic pathways essential for the formation, patterning and differentiation of somites. Development (Cambridge, England) 130:4655-4664. Marlow F, Gonzalez E, Yin C, Rojo C, Solnica-Krezel L. 2004. No tail co-operates with non- canonical Wnt signaling to regulate posterior body morphogenesis in zebrafish. Development (Cambridge, England) 131:203-216. McGrath J, Somlo S, Makova S, Tian X, Brueckner M. 2003. Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell 144:61-73. McGrath KE, Koniski AD, Maltby KM, McGann JK, Palis J. 1999. Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev Biol 213:442-456. Meyers E, Lewandoski M, Martin G. 1998. An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nature genetics 18:136-141. Meyers E, Martin G. 1999. Differences in left-right axis pathways in mouse and chick: functions of FGF8 and SHH. Science (New York, N.Y.) 285:403-406. Miller SA, White RD. 1998. Right-left asymmetry o fcell proliferation predominates in mouse embryos undergoing clockwise axial rotation. Anatomical Record 250:103- 108. Murcia NS, Richards WG, Yoder BK, Mucenski ML, Dunlap JR, Woychik RP. 2000. The oak ridge polycystic kidney (orpk) disease gene is required for left-right axis determination. Development 127:2347-2355. Nacke S, Schafer R, Habre de Angelis M, Mundlos S. 2000. Mouse mutant "rib-vertebrae" (rv): a defect in somite polarity. Dev Dyn 219:192-200. Nagasawa T, Hirota S, Tachibana K, Takakura N, Nishikawa S, Kitamura Y, Yoshida N, Kikutani H, Kishimoto T. 1996. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382:635-638. Naiche LA, Harrelson Z, Kelly RG, Papaioannou VE. 2005. T-box genes in vertebrate development. Annual Review of Genetics 39:219-239. Nakamura T, Saito D, Kawasumi A, Shinohara K, Asai Y, Takaoka K, Dong F, Takamatsu A, Belo J, Mochizuki A, Hamada H. 2012. Fluid flow and interlinked feedback loops 98

establish left-right asymmetric decay of Cerl2 mRNA. Nature communications 3:1322. Nakaya M, Biris K, Tsukiyama T, Jaime S, Rawls AA, Yamaguchi TP. 2005a. Wnt3a links left- right determination with segmentation and anteroposterior axis elongation. Development:5435-5436. Nakaya M-a, Biris K, Tsukiyama T, Jaime S, Rawls J, Yamaguchi T. 2005b. Wnt3a links left- right determination with segmentation and anteroposterior axis elongation. Development (Cambridge, England) 132:5425-5436. Nauli SM, Alenghat FJ, Luo Y, Williams E, Vassilev P, Li X, Elia AE, Lu W, Brown EM, Quinn SJea. 2003. Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nature Genetics 33:129-137. Nonaka S, Tanaka Y, Okada Y, Takeda S, Harada A, Kanai Y, Kido M, Hirokawa N. 1998. Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell 95:829-837. Nonaka S, Yoshiba S, Watanabe D, Ikeuchi S, Goto T, Marshall WF, Hamada H. 2005. De novo formation o fleft-right asymmetry by posterior tilt of nodal cilia. PLoS Biology 3:1-6. Nowotschin S, Hadjantonakis A-K. 2010. Cellular dynamics in the early mouse embryo: from axis formation to gastrulation. Current opinion in genetics & development 20:420-427. Oginuma M, Niwa Y, Chapman D, Saga Y. 2008. Mesp2 and Tbx6 cooperatively create periodic patterns coupled with the clock machinery during mouse somitogenesis. Development (Cambridge, England) 135:2555-2562. Oishi I, Kawakami Y, Raya A, Callol-Massot C, Izpisua Belmonte JC. 2006. Regulation of primary cilia formation and left-right patterning in zebrafish by a noncanonical Wnt signaling mediator, duboraya. Nat Genet 38:1316-1322. Okada Y, Nonaka S, Tanaka Y, Saijoh Y, Hamada H, Hirokawa N. 1999. Abnormal nodal flow precedes situs inversus in iv and inv mice. Molecular Cell 4:459-468. Okada Y, Takeda S, Tanaka Y, Izpisua Belmonte J-C, Hirokawa N. 2005. Mechanism of nodal flow: a conserved symmetry breaking event in left-right axis determination. Cell 121:633-644. Oliver G, Wehr R, Jenkins NA, Copeland NG, Cheyette BN, Hartenstein V, Zipursky SL, Gruss P. 1995. Homeobox genes and connective tissue patterning. Development 121:693- 705. Papaioannou VE. 2001. T-box genes in development: From hydra to humans. International Reviews of Cytology 207:1-70. Park TJ, Haigo SL, Wallingford JB. 2006. Ciliogenesis defects in embryos lacking inturned or fuzzy function are associated with failure of planar cell polarity and Hedgehog signaling. Nat Genet 38:303-311. Peeters H, Devriendt K. 2006. Human laterality disorders. European Journal of Medical Genetics 49:349-362. Perea-Gomez A, Rhinn M, Ang S. 2001. Role of the anterior visceral endoderm in restricting posterior signals in the mouse embryo. The International journal of developmental biology 45:311-320. Pourquié O, Tam P. 2001. A nomenclature for prospective somites and phases of cyclic gene expression in the presomitic mesoderm. Developmental cell 1:619-620. 99

100

Przemeck G, Heinzmann U, Beckers J, Hrabé de Angelis M. 2003. Node and midline defects are associated with left-right development in Delta1 mutant embryos. Development (Cambridge, England) 130:3-13. Rankin CT, Bunton T, Lawler AM, Lee SJ. 2000. Regulation of left-right patterning in mice by growth/differentiation factor-1. Nat Genet 24:262-265. Raya A, Izpisua Belmonte JC. 2004. Sequential transfer of left-right information during vertebrate embryo development. Current Opinions in Genetics and Development 14:575-581. Revinski D, Paganelli A, Carrasco A, López S. 2010. Delta-Notch signaling is involved in the segregation of the three germ layers in Xenopus laevis. Developmental biology 339:477-492. Rivera-Pérez J, Mallo M, Gendron-Maguire M, Gridley T, Behringer R. 1995. Goosecoid is not an essential component of the mouse gastrula organizer but is required for craniofacial and rib development. Development (Cambridge, England) 121:3005- 3012. Robb L, Tam P. 2004. Gastrula organiser and embryonic patterning in the mouse. Seminars in cell & developmental biology 15:543-554. Rong PM, Teillet MA, Ziller C, Le Douarin NM. 1992. The neural tube/notochord complex is necessary for vertebral but not limb and body wall striated muscle differentiation. Development 115:657-672. Rossant J, Pedersen RA. 1988. Experimental Approaches to Mammalian Embryonic Development. Cambridge University Press. Russ A, Wattler S, Colledge W, Aparicio S, Carlton M, Pearce J, Barton S, Surani M, Ryan K, Nehls M, Wilson V, Evans M. 2000. Eomesodermin is required for mouse trophoblast development and mesoderm formation. Nature 404:95-99. Saijoh Y, Oki S, Ohishi S, Hamada H. 2003a. Left-right patterning of the mouse lateral plate requires Nodal produced in the node. Developmental Biology 256:160-172. Saijoh Y, Oki S, Ohishi S, Hamada H. 2003b. Left-right patterning of the mouse lateral plate requires nodal produced in the node. Developmental biology 256:160-172. Satoh W, Gotoh T, Tsunematsu Y, Aizawa S, Shimono A. 2006. Sfrp1 and Sfrp2 regulate anteroposterior axis elongation and somite segmentation during mouse embryogenesis. Development 133:989-999. Schlueter J, Brand T. 2007. Left-right axis development: examples of similar and divergent strategies to generate asymmetric morphogenesis in chick and mouse embryos. Cytogenet Genome Res 117:256-267. Shedlovsky A, King T, Dove W. 1988. Saturation germ line mutagenesis of the murine t region including a lethal allele at the quaking locus. Proceedings of the National Academy of Sciences of the United States of America 85:180-184. Shiratori H, Hamada H. 2006. The left-right axis in the mouse:from origin to morphology. Development 133:2095-2104. Song MR, Shirasaki R, Cai CL, Ruiz EC, Evans SM, Lee SK, Pfaff SL. 2006. T-Box transcription factor Tbx20 regulates a genetic program for cranial motor neuron cell body migration. Development 133:4945-4955. Sun X, Meyers E, Lewandoski M, Martin G. 1999. Targeted disruption of Fgf8 causes failure of cell migration in the gastrulating mouse embryo. Genes & development 13:1834- 1846. 100

101

Supp D, Witte D, Potter S, Brueckner M. 1997. Mutation of an axonemal dynein affects left- right asymmetry in inversus viscerum mice. Nature 389:963-966. Tada M, Smith JC. 2000. Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation movements via Dishevelled, but not through the canonical Wnt pathway. Development 127:2227-2238. Takaoka K, Yamamoto M, Hamada H. 2007. Origin of body axes in the mouse embryo. Curr Opin Genet Dev 17:344-350. Takeda S, Yonekawa Y, Tanaka Y, Okada Y, Nonaka S, Hirokawa N. 1999. Left-right asymmetry and kinesin superfamily protein KIF3A: New insights indetermination of laterality and mesoderm induction by kif3A-/- mice analysis. Journal of Cell Biology 145:824-836. Takemoto T, Uchikawa M, Yoshida M, Bell D, Lovell-Badge R, Papaioannou V, Kondoh H. 2011. Tbx6-dependent Sox2 regulation determines neural or mesodermal fate in axial stem cells. Nature 470:394-398. Tam P, Beddington R. 1987. The formation of mesodermal tissues in the mouse embryo during gastrulation and early organogenesis. Development (Cambridge, England) 99:109-126. Tam P, Beddington R. 1992. Establishment and organization of germ layers in the gastrulating mouse embryo. Ciba Foundation symposium 165:27. Tam P, Steiner K. 1999. Anterior patterning by synergistic activity of the early gastrula organizer and the anterior germ layer tissues of the mouse embryo. Development (Cambridge, England) 126:5171-5179. Tam P, Steiner K, Zhou S, Quinlan G. 1997. Lineage and functional analyses of the mouse organizer. Cold Spring Harbor symposia on quantitative biology 62:135-144. Tam PP. 1984. The histogenetic capacity of tissues in the caudal end of the embryonic axis of the mouse. J Embryol Exp Morphol 82:253-266. Tanaka C, Sakuma R, Nakamura T, Hamada H, Saijoh Y. 2007. Long-range action of Nodal requires interaction with GDF1. Genes Dev 21:3272-3282. Tanaka Y, Okada Y, Hirokawa N. 2005. FGF-induced vesicular release of Sonic hedgehog and retinoic acid in leftward nodal flow is critical for left-right determination. Nature 435:172-177. Thomas P, Beddington R. 1996. Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Current biology : CB 6:1487-1496. Thomas P, Brown A, Beddington R. 1998. Hex: a homeobox gene revealing peri- implantation asymmetry in the mouse embryo and an early transient marker of endothelial cell precursors. Development (Cambridge, England) 125:85-94. Tokovenko B, Golda R, Protas O, Obolenskaya M, El'skaya A. 2009. COTRASIF: conservation- aided transcription-factor-binding site finder. Nucleic acids research 37. Viotti M, Niu L, Shi S-H, Hadjantonakis A-K. 2012. Role of the gut endoderm in relaying left- right patterning in mice. PLoS biology 10. Waldrip W, Bikoff E, Hoodless P, Wrana J, Robertson E. 1998. Smad2 signaling in extraembryonic tissues determines anterior-posterior polarity of the early mouse embryo. Cell 92:797-808. 101

102

Wall N, Craig E, Labosky P, Kessler D. 2000. Mesendoderm induction and reversal of left- right pattern by mouse Gdf1, a Vg1-related gene. Developmental biology 227:495- 509. Wang Y, Macke JP, Abella BS, Andreasson K, Worley P, Gilbert DJ, Copeland NG, Jenkins NA, Nathans J. 1996. A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J Biol Chem 271:4468- 4476. Watabe-Rudolph M, Schlautmann N, Papaioannou VE, Gossler A. 2002. The mouse rib- vertebrae mutation is a hypomorphic Tbx6 allele. Mechanisms of Development 119:251-256. Watanabe D, Saijoh Y, Nonaka S, Sasake G, Ikawa Y. 2003. The left-right determinant Inversin is a component of node monocilia and other 9+0 cilia. Development 130:1725-1734. Wharton K, Zimmermann G, Rousset R, Scott M. 2001. Vertebrate proteins related to Drosophila Naked Cuticle bind Dishevelled and antagonize Wnt signaling. Developmental biology 234:93-106. White PH, Chapman DL. 2005. Dll1 is a downstream target of Tbx6 in the paraxial mesoderm. genesis 42:193-202. Wilkinson DG. 1998. In situ hybridization: a practical approach. Oxford University Press. William DA, Saitta B, Gibson JD, Traas J, Markov V, Gonzalez DM, Sewell W, Anderson DM, Pratt SC, Rappaport EF, Kusumi K. 2007. Identification of oscillatory genes in somitogenesis from functional genomic analysis of a human mesenchymal stem cell model. Dev Biol 305:172-186. Wilson V, Rashbass P, Beddington R. 1993. Chimeric analysis of T (Brachyury) gene function. Development (Cambridge, England) 117:1321-1331. Wittler L, Shin E-h, Grote P, Kispert A, Beckers A, Gossler A, Werber M, Herrmann B. 2007. Expression of Msgn1 in the presomitic mesoderm is controlled by synergism of WNT signalling and Tbx6. EMBO reports 8:784-789. Xu P, Adams J, Peters H, Brown M, Heaney S, Maas R. 1999. Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of organ primordia. Nature genetics 23:113-117. Xu PX, Woo I, Her H, Beier DR, Maas RL. 1997. Mouse Eya homologues of the Drosophila eyes absent gene require Pax6 for expression in lens and nasal placode. Development 124:219-231. Yamaguchi T, Takada S, Yoshikawa Y, Wu N, McMahon A. 1999. T (Brachyury) is a direct target of Wnt3a during paraxial mesoderm specification. Genes & development 13:3185-3190. Yasuhiko Y, Haraguchi S, Kitajima S, Takahashi Y, Kanno J, Saga Y. 2006. Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression. Proceedings of the National Academy of Sciences of the United States of America 103:3651-3656. Yasuhiko Y, Kitajima S, Takahashi Y, Oginuma M, Kagiwada H, Kanno J, Saga Y. 2008. Functional importance of evolutionally conserved Tbx6 binding sites in the presomitic mesoderm-specific enhancer of Mesp2. Development 135:3511-3519. Yoshiba S, Shiratori H, Kuo I, Kawasumi A, Shinohara K, Nonaka S, Asai Y, Sasaki G, Belo J, Sasaki H, Nakai J, Dworniczak B, Ehrlich B, Pennekamp P, Hamada H. 2012. Cilia at 102

103

the node of mouse embryos sense fluid flow for left-right determination via Pkd2. Science (New York, N.Y.) 338:226-231. Zhang XM, Ramalho-Santos M, McMahon AP. 2001. Smoothened mutants reveal redundant roles for Shh and Ihh signaling including regulation of L-R asymmetry by the mouse node. Cell 105:781-792. Zhang Y, Levin M. 2009. Left-right asymmetry in the chick embryo requires core planar cell polarity protein Vangl2. Genesis.

103

104

Appendix: Additional publication produced under the course of this research

Nowotschin S, Ferrer-Vaquer A, Concepcion D, Papaioannou V, Hadjantonakis A-K. 2012. Interaction of Wnt3a, Msgn1 and Tbx6 in neural versus paraxial mesoderm lineage commitment and paraxial mesoderm differentiation in the mouse embryo. Developmental biology 367:1-14. 104

105 105

106 106

107 107

108 108

109 109

110 110

111 111

112 112

113 113

114 114

115 115

116 116

117 117

118