Role of Cyclooxygenase-2 and Fatty Acid Synthase in Breast Cancer Development

ROLE OF CYCLOOXYGENASE-2 AND FATTY ACID SYNTHASE IN BREAST CANCER DEVELOPMENT

Suying Lu

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Nutritional sciences University of Toronto

395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada

Your file Votre reference ISBN: 978-0-494-39890-6 Our file Notre reference ISBN: 978-0-494-39890-6

NOTICE: AVIS: The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation. reproduced without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne Privacy Act some supporting sur la protection de la vie privee, forms may have been removed quelques formulaires secondaires from this thesis. ont ete enleves de cette these.

While these forms may be included Bien que ces formulaires in the document page count, aient inclus dans la pagination, their removal does not represent il n'y aura aucun contenu manquant. any loss of content from the thesis. Canada ROLE OF CYCLOOXYGENASE-2 AND FATTY ACID SYNTHASE IN BREAST CANCER DEVELOPMENT

Doctor of Philosophy, 2008 Suying Lu Graduate Department of Nutritional Sciences University of Toronto

Abstract

Cyclooxygenase-2 (COX-2) and fatty acid synthase (FAS) are over-expressed in breast cancer. Inhibitors of COX-2 and FAS decrease proliferation and induce apoptosis in breast cancer cells. A previous study showed that the COX-2 inhibitor celecoxib not only inhibited rat mammary carcinogenesis, but also decreased fat deposition in rats fed a high fat diet, suggesting that celecoxib may affect lipid metabolism. We demonstrated that celecoxib suppresses FAS expression, and decreases fat accumulation by down-regulating c-Jun N- terminal kinase 1 (JNK1) in rats fed a high fat diet rich in n-6 polyunsaturated fatty acids

(PUFAs). This finding suggests that not only inhibition of COX-2 but also down-regulation of

FAS contribute to the chemopreventive effect of celecoxib. This observation led us to investigate the roles of both COX-2 and FAS in breast cancer development. We showed that

COX-2 over-expression in breast epithelial cells inhibits proliferation, detachment-induced apoptosis and differentiation, and causes epithelial to mesenchymal transition (EMT). This finding suggests that COX-2 over-expression disturbs the homeostatic status of mammary epithelial cells, leading to partial transformation of these cells, and predisposing the mammary gland to tumorigenesis. Malignant transformation of breast epithelial cells is associated with elevated expression of FAS. We showed that inhibition of FAS by triclosan suppresses rat mammary tumorigenesis induced by N-methyl-N-nitrosourea (MNU). This finding suggests that FAS is a promising molecular target for breast cancer prevention. In cancers, de novo fatty

ii acid synthesis is functionally linked to cell proliferation by providing fatty acids for the biosynthesis of cellular membranes, but the molecular link between these two processes was not known. We demonstrated that Spl coordinately regulates the expression of FAS, a key enzyme of fatty acid synthesis, and CDC25A, a key cell cycle protein, in estrogen-sensitive breast cancer cells. Thus, Spl is a molecular link between de novo lipogenesis and proliferation in these cells. Overall, findings of this thesis contribute to our knowledge relating to how COX-

2 and FAS act to facilitate breast cancer development, and provide evidence that these enzymes could be potential targets for breast cancer prevention.

in Acknowledgements

Writing this part of the thesis is a humbling experience, which reminds me that many people have helped me to achieve this work. Without their help, this thesis would be impossible.

First of all, I would like to thank my supervisor, Dr. Michael Archer, for accepting me into his lab, for his guidance and support over the years and for providing an excellent environment to explore my love of science.

I would also like to thank the other members of my advisory committee, Dr. Young-In

Kim and Dr. Dittakavi Sarma, for their time, guidance and support. My special thanks go out to

Dr. Wendy Ward and Dr. Kelley Meckling, who served as my external examiners and provided many helpful comments.

I learned a great deal from many other colleagues, past and present, either through practical help with lab work, advice on data interpretation, or suggestions for seminar presentations. This alphabetical list is undoubtedly incomplete, and I apologize for those I have forgotten: Jian Min Chen, Robin Duncan, Kafi Ealey, Ahmed El-Sohemy, James Korkola,

Dominic Lau, George Saati, Runlan Song, Geoffrey Wood, Wanli Xuan, Guo Yu and

Yonghong Zhu.

I am very grateful to my husband, Xiaodong and my son, Alex for their understanding, patience, support and love.

Permissions to include published papers in this thesis were kindly granted by

Funding for this work was provided by the Natural Sciences and Engineering Research

Council (NSERC) and Canadian Breast Cancer Research Alliance (CBCRA).

iv Table of Contents

Page

Chapter One - Introduction and Literature review 1

1.1 Introduction 2

1.2Cyclooxygenase-2(COX-2) 5

1.2.1 The COX pathway 5

1.2.2 Functions of prostanoids 5

1.2.3 Nonsteroidal Anti-inflammatory Drugs (NSAIDs) 6

1.2.4 COX-2 and breast cancer 7

1.2.5 COX-2-independent mechanisms for NSAIDs 15

1.3 Fatty acid synthase (FAS) 17

1.3.1 The fatty acid synthesis pathway 17

1.3.2 Inhibitors of the fatty acid synthesis pathway 17

1.3.3 FAS in normal tissues 19

1.3.4 FAS and breast cancer 20

1.4 Hypothesis and organization of thesis 28

v Chapter Two - Celecoxib decreases FAS Expression via Down-regulation of JNK1 30

2.1 Abstract 31

2.2 Introduction 31

2.3 Materials and methods 33

2.4 Results 37

2.5 Discussion 46

Chapter Three - COX-2 Over-expression Causes Partial Transformation in

MCF-10F Human Breast Epithelial Cells 53

3.1 Abstract 54

3.2 Introduction 54

3.3 Materials and methods 56

3.4 Results 59

3.5 Discussion 64

Chapter Four - FAS is a Potential Target for the Chemoprevention of Breast cancer 71

4.1 Abstract 72

4.2 Introduction 72

4.3 Materials and methods 73

4.4 Results 75

4.5 Discussion 79

vi Chapter Five - Coordinate Regulation of FAS and CDC25A Phosphatase

in Human Breast Cancer Cells by Spl: a Molecular Link

Between de novo Lipogenesis and Cell Proliferation 83

5.1 Abstract 84

5.2 Introduction 85

5.3 Materials and methods 86

5.4 Results 90

5.5 Discussion 96

Chapter Six - General Discussion 103

6.1 Overview 104

6.2 Future directions 110

References 113

vii List of Abbreviations

AA arachidonic acid

ACC acetyl-coenzyme A carboxylase

ACL ATP citrate lyase

ACO acyl-CoA oxidase

ChREBP carbohydrate response element-binding protein

COX cyclooxygenase

COXIBs a family of COX-2 inhibitors

CPTI carnitine palmitoyl transferase-I

CREB cyclic AMP response element binding protein

DCIS ductal carcinoma in situ

DMBA 7,12-dimethylbenz[a]anthracene

E2 17p-estradiol

EMT epithelial to mesenchymal transition

ER estrogen receptor

Erkl/2 extracellular signal-regulated kinase 1/2

FAS fatty acid synthase

FFA free fatty acids

GAPDH glyceraldehyde phosphate dehydrogenase y-GT y-glutamyl transferase

HSL hormone sensitive lipase

IDPs intraductal proliferations

JNK c-Jun N-terminal kinase

viii LA linoleic acid

LPL lipoprotein lipase

LXR liver X receptor

MAPK mitogen-activated protein kinase

MI myocardial infarction

MMTV mouse mammary tumor virus

MNU N-methyl-N-nitrosourea

NF-KB nuclear factor-kappaB

NSAIDs nonsteroidal anti-inflammatory drugs

PCNA proliferating cell nuclear antigen

PDK1 3-phosphoinositide-dependent protein kinase-1

PGs prostaglandins

PhIP 2-amino-1 -methyl-6-phenylimidazopyridine

PI3K phosphoinositide 3-kinase

PKA protein kinase A

PKB protein kinase B

PPAR peroxisome proliferator-activated receptor

PR progesterone receptorreceptor

PUFAs polyunsaturated fatty acids

RXR retinoid X receptor

SREBP sterol response element binding protein

TXA2 thromboxane A2

USF upstream stimulatory factor VEGF vascular endothelial growth factor

x List of Tables

Page

Table 2.1 Body, liver and intra-abdominal adipose tissue weights and liver triglyceride levels in rats fed a high fat diet with or without

1500 ppm celecoxib for 15 weeks 39

Table 2.2 Serum levels of y-glutamyl transferase (y-GT), insulin, triglycerides and free fatty acids (FFA) in rats fed a high fat diet with or without 1500 ppm celecoxib for 15 weeks 40

XI List of Figures

Page

Figure 1.1. COX signaling pathway and associated biologic activities 8

Figure 1.2. Fatty acid synthesis pathway 18

Figure 1.3. The as-acting elements and trans-acting factors involved in the regulation of transcription of the FAS gene 21

Figure 2.1. Celecoxib decreases hepatic FAS mRNA, protein and enzyme activity levels in rats fed a high fat diet 41

Figure 2.2. Celecoxib decreases FAS expression in retroperitoneal adipose tissue in rats fed a high fat diet 42

Figure 2.3. Effect of celecoxib on prostaglandin 2 (PGE2) levels in liver and intra-abdominal adipose tissue in rats fed a high fat diet 43

Figure 2.4. Celecoxib decreases levels of JNKl/pJNKl, but increases levels of pAkt/PKB (pSer473) in the livers of rats fed a high fat diet 45

xn Figure 2.5. Celecoxib treatment decreases levels of FAS and pJNKl but increases levels of pAkt/PKB (pSer473) in rat hepatocytes 47

Figure 2.6. JNK inhibitor SP600125 (SP) decreases FAS expression in rat hepatocytes 48

Figure 3.1. COX-2 expression and PGE2 levels 60

Figure 3.2. Effect of COX-2 expression on cell growth, cell cycle progression and expression of cyclins A, D1 and E 62

Figure 3.3. Effect of COX-2 expression on apoptosis in mammary epithelial cells and expression levels of Bcl-2, BC1-XL and Bax 63

Figure 3.4. Effect of COX-2 expression on differentiation of mammary epithelial cells in Matrigel 65

Figure 3.5. Effect of COX-2 expression on cell transformation 66

Figure 4.1. Cumulative mammary tumor incidence (A) and weekly body weights (B) in rats treated with 50 mg/kg MNU 77

Figure 4.2. FAS in rat mammary tumors induced by MNU 78

xiii Figure 4.3. Inhibition by triclosan of FAS activity in mammary tumor homogenates from rats treated with MNU 80

Figure 5.1. Effects of Spl siRNA transfection on Spl protein levels, proliferation and expression of FAS and CDC25A in MCF-7 cells 92

Figure 5.2. Effects of Sp3 siRNA transfection on Sp3 protein levels, proliferation, cell cycle progression and expression of FAS and CDC25A in MCF-7 cells 93

Figure 5.3. Effects of Sp4 siRNA transfection on Sp4 protein levels, proliferation and expression of FAS and CDC25A in MCF-7 cells 94

Figure 5.4. Effects of mithramycin on proliferation, expression of FAS and

CDC25A and binding of Spl to FAS and CDC25A promoters in MCF-7 cells 95

Figure 5.5. Effects of estrogen on proliferation, expression of FAS and

CDC25A and binding of Spl to FAS and CDC25 A promoters in MCF-7 cells 97

Figure 5.6. Effects of Spl, Sp3 and Sp4 siRNAs, mithramycin, and

E2 on mRNA levels of SREBP-lc in MCF-7 cells 98

xiv CHAPTER ONE

Introduction and Literature Review 2

1.1 Introduction

In women, breast cancer is the most common cancer and is the leading cause of cancer

death worldwide (1). Reproductive, genetic, environmental and lifestyle factors affect breast

cancer development (2). Early menarche, late menopause, and late or no pregnancy increase the

risk (3). A family history of the disease also increases breast cancer risk (4), and this genetic

predisposition is caused by germline mutations in breast cancer susceptibility genes such as

BRCA1 and BRCA2 that confer high-risk (5) and single nucleotide polymorphisms in certain

genes such as FGFR2 and MAPK1 that confer moderate-risk (2, 6). Some environmental

factors that are known to promote breast cancer development include exogenous hormones,

alcohol, smoking and ionizing radiation (2). Globally, breast cancer incidence rates vary about

five-fold, with rates in North America being much higher than those in Asia and Africa,

suggesting that the Western lifestyle is a risk factor (2). This notion is further supported by the

following: the incidence of breast cancer increases among migrants from Asia to the USA (2);

and breast cancer incidence is increasing in some Asian countries along with Westernization of

their lifestyle (7, 8). One of the major characteristics of the Western lifestyle is a diet high in

saturated fat, simple sugars, and low in vegetables and fiber and low physical activity. These

factors are considered to be major causes of the high prevalence of obesity and insulin

resistance that occur in Western countries (9). Furthermore, obesity and insulin resistance have

been shown to be risk factors for breast cancer, particularly for postmenopausal women (10). It

is estimated that environmental and lifestyle factors contribute to about 60% of breast cancer

(11,12).

At cellular and molecular levels, the development of breast cancer is a multistep process characterized by the accumulation of activated oncogenes and inactivated tumor suppressor 3

genes that influence key pathways involved in cell survival and growth (13). Recent evidence

has suggested that breast cancers may derive from cancer stem cells (14, 15). Despite years of

research to target oncogenes and their associated pathways, clinical successes have been

limited because of the redundancy of many cancer-related pathways as well as the high degree

of variability in genotype and phenotype among individual tumors (13). In addition,

chemopreventive strategies have not been widely used for breast cancer, tamoxifen being the

only preventive agent with U.S. Food and Drug Administration approval (16). For most

women, however, the risks of uterine cancer, blood clots or stroke associated with tamoxifen

outweigh the potential benefits of preventing breast cancer (16). Clearly, more efficient

therapeutic and chemopreventive approaches need to be developed, and this will require the

identification of more specific molecular targets.

A distinctive feature of cancer cells is their altered cellular metabolism. About 80 years

ago, the renowned German biochemist Otto Warburg discovered that cancer cells have

increased glycolysis (17). Along with increased glycolysis, de novo fatty acid synthesis in

tumor tissues also occurs at high levels, as first demonstrated more than half a century ago (18).

In addition, many human cancers also have increased activity to convert polyunsaturated fatty

acids (PUFAs) such as linoleic acid (LA) and arachidonic acid (AA) to bioactive fatty acids

such as prostaglandins (PGs) and thromboxanes that modulate cellular signal transduction pathways (19, 20). Although there has been renewed interest in cancer cell metabolism in recent years, much remains to be elucidated. We anticipate that sound understanding of the role of metabolism in breast cancer will open new avenues for the treatment and prevention of this disease. The objective of this work was to investigate the role of cyclooxygenase-2 (COX-2), a key enzyme involved in converting PUFAs to bioactive fatty acids, and fatty acid synthase 4

(FAS), a key enzyme of de novo fatty acid synthesis in breast cancer development, and to provide information on the potential of these pathways as molecular targets for breast cancer prevention and therapy. 5

1.2 Cyclooxygenase-2 (COX-2)

1.2.1 The COX Pathway

Many tissues metabolize arachidonic acid (AA) to bioactive eicosanoids (PGs,

leukotrienes, thromboxanes and lipoxins) that modulate diverse physiological and

pathophysiological responses (21). COX catalyzes the rate-limiting step in the formation of

prostanoids (PGs and thromboxanes) from AA, and it has two isoforms, COX-1 and COX-2

(20). Expression of COX-1 is constitutive in most tissues, but it is expressed at high levels in

endothelium, monocytes, platelets, renal collecting tubules, and seminal vesicles (22). In most

tissues, COX-2 expression is low, but it is induced by growth factors, cytokines and mitogens

(23, 24). Both isoforms of COX catalyze a bis-oxygenase reaction in which arachidonate plus

two molecules of O2 are converted to prostaglandin G2 (PGG2), and a peroxidase reaction in

which PGG2 is reduced to prostaglandin H2 (PGH2) by two electrons (22). Prostaglandin

synthases convert PGH2 to various signaling prostanoids.

1.2.2 Functions of Prostanoids

Prostanoids include PGE2, PGF2a, PGD2, PGI2, and thromboxane A2 (TXA2) (20).

Different prostanoids exert their biological actions primarily via their respective G protein-

coupled receptors on the cell surface membrane. PGE2 action is mediated via four EP receptors

(EP1, EP2, EP3, and EP4), PGI2 via IP, TXA2 via TP, PGF2a via FP, and PGD2 via DP

receptors (20, 25). The predominance of a particular EP receptor type may determine the

mechanism of PGE2 action in a particular cell type. Thus, PGE2 is involved in a variety of

biological functions, including vasodilatation, muscle constriction, inflammation and cancer

development (21, 26-29). PGF2a is critical for parturition (30). PGD2 is the major prostanoid released from mast cells after challenge with immunoglobulin E (31), and it has also been 6

shown to mediate vasodilation and vasoconstriction, as well as inhibition of platelet

aggregation (32). PGI2 has been demonstrated to play an important role in vasodilation in the

kidney (33-35) as well as to regulate rennin release (36, 37). TXA2 plays a role in modulating

platelet shape and aggregation as well as smooth muscle contraction and proliferation (20).

Increased TXA2 synthesis has been linked to cardiovascular diseases including acute

myocardial ischemia (38), heart failure (39), and renal diseases (40, 41).

1.2.3 Nonsteroidal Anti-inflammatory Drugs (NSAIDs)

PGs elicit a variety of both beneficial and adverse biological responses. Among the

undesirable properties of PGs are their abilities to induce pain, fever, and symptoms associated

with the inflammatory response. NSAIDs block the formation of PGs, and have analgesic,

antipyretic, and anti-inflammatory activity. In 1971, Vane was the first to propose that aspirin

and other NSAIDs inhibit PG biosynthesis and release (42, 43). Later, it was shown that

NSAIDs inhibit COX activity (44). There are two classes of NSAIDs: (a) classical (pre-1995)

NSAIDs (such as aspirin, piroxicam, ibuprofen, naproxen sodium, sulindac and indomethacin)

and (b) COX-2 inhibitors (such as rofecoxib, celecoxib, and valdecoxib). All classical NSAIDs

inhibit both COX-1 and 2, but generally bind more tightly to COX-1 (45). COX-2 inhibitors

exhibit selectivity towards COX-2 (46, 47). All NSAIDs compete with AA for binding to the

COX active site (48). In contrast to other NSAIDs, aspirin covalently modifies the COX protein

(49, 50).

About 1% of chronic users of classical NSAIDs develop ulcers or other serious

gastrointestinal complications (22). These ulcers result from inhibition of COX-1, the predominant COX isoform in the stomach lining. COX-2 selective NSAIDs have the same anti- 7

inflammatory, anti-pyretic, and analgesic activities as nonselective NSAIDs, but with fewer

gastrointestinal side effects (22).

Recently, clinical trials have revealed that COX-2 selective inhibitors cause an

increased risk of myocardial infarction (MI) and stroke while aspirin reduces risk of MI (51).

Among the metabolites of COX, PGI2 plays an important role in vasodilation (33, 36) while

TXA2 induces platelet aggregation as well as smooth muscle contraction (20). COX-2 is a

major source of systemic PGI2 biosynthesis in healthy humans (52), and COX-1 is the major

source of TXA2. Suppression of PGI2 synthesis by COX-2 selective inhibitors without a

concomitant inhibition of COX-1-derived TXA2 has been proposed as the mechanism by which

COX-2 selective inhibitors increase the risk of cardiovascular diseases (51).

1.2.4 COX-2 and breast cancer

COX-2 expression in primary human breast cancers. The first evidence of a potential

relationship between COX-2 and human cancer was reported in 1994, when COX-2 mRNA

levels were found to be markedly elevated in colorectal carcinomas compared to normal colon

tissues (53). Subsequent studies have demonstrated that COX-2 is also over-expressed in other

neoplasms of epithelial origin including breast cancer (54). Ristimaki et al. reported that about

40% of breast cancers have elevated expression of COX-2, and elevated COX-2 expression was

associated with poor prognostic characteristics (55). This association is also observed in ductal

carcinoma in situ (DCIS) as well as node-negative, and invasive breast cancers (56-59). COX-2

expression is also associated with the presence of the HER-2/neu oncogene. For example,

COX-2 is over-expressed in HER-2/neu positive human breast cancers and HER-2/neu- transformed human mammary epithelial cells, and HER-2/neu has been shown to stimulate

COX-2 transcription via the Ras/Raf/MAPK (mitogen-activated protein kinase) pathway 8

Arachidonic Acid NSAIDs COX-1 COXIBs COX-2 PQG'? , PGH, PG synthases r 1 1 TXA PGD2 PGF2a PGE PGI2 2 EP1.EP2 EP3, EP4 DP] ,P| H Anti-inflammation Loss of parturition (1) Inflammation (1) Protection of Thrombotic (2) Cancer gastric mucosa tendency (2) Resistance to thromboembolism

Figure 1.1. COX signaling pathway and associated biologic activities. DP, FP, EP, IP and TP are the receptors of the prostanoids. 9

mediated, in part, by transcription factors AP-1 and PEA3 (60). In some studies, no significant

correlation between COX-2 expression, clinical outcomes, and HER-2 status is observed (61-

63). COX-2 expression is consistently associated with the expression of genes involved in

angiogenesis (61, 64).

COX-2 expression in human breast cancer cell lines. COX-2 is over-expressed in

breast cancer cell lines, and expression levels are associated with invasive phenotypes. For

example, Gauthier et al. (65) showed that COX-2 expression is elevated in a variant human

mammary epithelial cell line with premalignant properties compared to the parental cell line.

The estrogen-independent, more invasive, metastatic MDA-MB-231 cell line expresses higher

levels of COX-2 than estrogen-dependent, less invasive MCF-7 and SKBr3 cells (60, 66). As in

primary human breast cancers, COX-2 expression is also associated with the presence of

oncogenes. For example, COX-2 expression is significantly elevated in MCF-7 cells stably

transfected with HER2 compared to the parental cells (62). Furthermore, HER2 has been

shown to be expressed in the nucleus, and associates with the COX-2 gene promoter to induce

COX-2 expression (67). In addition to HER2, COX-2 expression is also associated with the

presence of ras oncogenes. The more invasive MDA-MB-231 and Hs578T cancer cell lines that possess mutated Ki-ras and H-ras, respectively, express higher levels of COX-2, and produce

more PGE2 in comparison with the less invasive MDA-MB-435 and SKBR3 lines that lack

mutated ras genes, express lower levels of COX-2, and secret less PGE2. Likewise, the ras- transfected MCF10A cells express a higher level of COX-2 than parental MCF10A cells (68).

Epidemiological studies. Case-control studies consistently suggest that regular intake of

NSAIDs may protect against breast cancer development. For example, Harris et al.

demonstrated an inverse association between the relative risk of breast cancer and NSAID use, 10

particularly in women who reported daily intake of aspirin, ibuprofen, or other NS AIDs for at

least 5 years (69-71). A similar outcome was also observed in a study in Canadian women (72).

Estrogen receptor (ER) status may affect the outcomes of NSAID use. For example, a reduction

in breast cancer risk with aspirin use has been reported among women with ER-positive tumors

but not for those with ER-negative tumors (73).

Evidence from prospective studies is inconsistent, although most of the studies support

a protective role of NSAIDs. Schreinemachers et al. (74) examined the association between

aspirin use and cancer risk using data from the National Health and Nutrition Examination

Survey I (NHANES I) and the NHANES I Epidemiologic Follow-up Studies (NHEFS), and

showed that incidence of lung, colorectal and breast cancer was lower among aspirin users. An

association between lower cancer incidence and mortality and aspirin use was also observed in

other studies (75, 76). In the prospective Nurses' Health Study, however, regular aspirin use did

not affect breast cancer risk (77). A recent meta-analysis evaluated the relationship between

NSAID use and cancers other than colorectal, and reported reduced risks of breast, esophageal

and gastric cancers in both NSAID and aspirin users (78).

Genetic polymorphisms of the COX-2 gene have been shown to play a role in cancer

development. This gene carries a polymorphism in the 3'-untranslated region (8473C/T) that is

associated with the stability of the mRNA, and two promoter polymorphisms (1195G/A and

765G/C) that are associated with mRNA expression levels, which have all been associated with

susceptibility to malignant disease (79, 80). Langsenlehner et al. (81) reported that 8473-CC

genotype was more frequent among breast cancer patients than among controls. The odds ratio for this genotype was 2.1. In studies conducted in Danish and Chinese women, however, no association was observed between this polymorphism and breast cancer risk (82, 83). The 11

8473-CC genotype might interact with NSAID intake to reduce risk for ER-positive breast cancer (84). A significantly increased risk of breast cancer was reported among women with the combined genotypes containing A-l 195G-765T8473 and A-l 195C-765T8473 (83).

Animal studies. Animal studies have consistently suggested an involvement of COX-2 in breast cancer development. A few years ago, studies from our laboratory demonstrated that nutritional and hormonal factors such as n-6 PUFAs, estrogen and progesterone that are known to promote the development of mammary tumors in rats, also induce COX-2 expression in the mammary gland (85, 86). In contrast, HER2/neu-induced mammary tumorigenesis is inhibited in COX-2 knockout mice (87).

More convincing evidence for a role for COX-2 in promoting breast cancer development comes from the mouse mammary tumor virus (MMTV)/COX-2 transgenic mice.

In these mice in an outbred CD1 genetic background, the human COX-2 cDNA is over- expressed in luminal mammary epithelial cells by the MMTV promoter. Spontaneous mammary tumors occur in multiparous mice possibly due to high expression levels of the

COX-2 transgene during pregnancy and lactation, but only precocious lobuloalveolar differentiation occurs in virgin females (88). Similar phenotypes have also been reported in transgenic mice over-expressing the same transgene but in an FVB/N genetic background (89).

In the transgenic mice where the COX-2 transgene was targeted to myoepithelial cells of the mammary gland, fibrocystic changes, a frequent benign disorder of the human breast, occurred in the mammary gland (90). These different phenotypes suggest that specific cell types may become tumorigenic when they over-express COX-2.

Suppression of mammary carcinogenesis by NSAIDs further suggests the involvement of COX in breast cancer development. Various studies have shown that classical NSAIDs such 12 as flurbiprofen, indomethacin and ibuprofen inhibit rat mammary carcinogenesis induced by chemical carcinogens such as 7,12-dimethylbenz[a]anthracene (DMBA), 2-amino-l-methyl-6- phenylimidazopyridine (PhIP) and JV-methyl-JV-nitrosourea (MNU) (91-97). Classical NSAIDs also inhibit mammary tumor development in other model systems. For example, indomethacin has been shown to suppress spontaneous murine mammary tumorigenesis (98). In some studies, however, indomethacin and piroxicam did not exert chemopreventive effects against DMBA- induced rat mammary tumors (99, 100), likely because of the differences in the time course of administration of the NSAIDs compared to the other studies mentioned above.

Inhibition of mammary tumorigenesis by COX-2 selective inhibitors further supports the specific involvement of COX-2 in breast cancer development. Celecoxib protects against

HER-2/neu-induced mammary tumorigenesis in MMTV/neu transgenic mice. Furthermore,

COX-2 protein is detectable in breast carcinomas from these mice, and levels of celecoxib in the sera of drug-treated mice ranged from 0.7 to 8.8 uM (mean, 2.4 uM), which is within the range reported to inhibit inflammation and PG biosynthesis in humans (101). Other COX-2 selective inbititors have also been shown to suppress rat mammary carcinogenesis induced by chemical carcinogens (102-107). Interestingly, nimesulide inhibits rat mammary carcinogenesis induced by MNU but not by DMBA (108). This is likely because mammary tumors induced by

MNU and DMBA are dominated by different signaling mechanisms. For example, MNU- induced mammary carcinomas appear to be more estrogen dependent while those induced by

DMBA appear to be more prolactin dependent (109). Since dietary n-6 PUFAs induce COX-2 expression in rat mammary glands (85), our laboratory investigated the effect of celecoxib on rat mammary carcinogenesis induced by MNU in the context of a high fat diet rich in n-6

PUFAs. Celecoxib added to the diet at a concentration of 1500 ppm, significantly suppressed 13 mammary tumorigenesis. Surprisingly, there was a significant decrease in body weight gain in the rats treated with celecoxib (110), although the same concentration of celecoxib added to a low fat diet did not affect body weight gain in rats (107). These observations promoted us to hypothesize that celecoxib may play a role in fatty acid metabolism. This hypothesis will be addressed in Chapter 2 of this thesis.

Mechanisms of the stimulatory role ofCOX-2 in breast cancer development. Several studies have suggested that COX-2 promotes breast cancer development by affecting a number of factors including mutagen production, genomic instability, tumor suppressor gene function, estrogen biosynthesis, immune function, cell proliferation, apoptosis, angiogenesis and invasiveness (as reviewed in (111)).

(a) Mutagen production, genomic instability, and inactivation of tumor suppressor genes. COX can function as a peroxidase to bioactivate carcinogens such as aromatic amines, heterocyclic amines and polycyclic aromatic hydrocarbons thereby contributing to carcinogenesis (112). In addition, the mutagen malondialdehyde (MDA) is produced by enzymatic and nonenzymatic breakdown of PGH2 (113). The aspirin metabolite salicylate has been shown to inhibit DMBA-DNA adduct formation in breast cancer cells (114). In MCF10A human breast epithelial cells, COX-2 over-expression induces genomic instability such as chromosomal fusions, breaks and tetraploidy (115). Reactive lipid species (4-hydroxy-2- nonenal, 4-oxo-2-nonenal, and cyclopentenone prostaglandin A and J) produced by COX-2 inactivate the tumor suppressor LKB1 in MCF-7 cells (116).

(b) Aromatase-mediated estrogen biosynthesis. Modulation of estrogen biosynthesis in breast tissue by PGE2 affects breast cancer development (117). The final step in estrogen biosynthesis is catalyzed by aromatase. PGE2 increases aromatase gene expression and estrogen 14 production through EP1 and EP2 receptor signaling (118, 119). In breast tumors, tumor cells, tumor fibroblasts, adipose stromal cells and macrophages all contribute to the production of

PGE2 via elevated COX-2 activity (120-122). Thus, breast tumors provide a potentially rich source of PGE2 to stimulate aromatase expression both in the tumor itself and in surrounding adipose tissue. The resulting increased estrogen biosynthesis in local sites in turn may result in increased growth and development of the tumor. NSAIDs have been shown to down-regulate aromatase activity and gene expression (123-126).

(c) Immune function. COX-2-derived PGs can suppress proliferation of T and B cells, and diminish the cytotoxic activity of natural killer cells (113). Thus, PG-mediated immune suppression may allow tumors to avoid immune surveillance and contribute to tumorigenesis.

PGE2 has been shown to inhibit the production of TNFa, but induce the production of interleukin-10 (IL-10), an immunosuppressive cytokine. Pretreatment of the tumors with indomethacin partially blocks the IL-10 production (127). Indomethacin or celecoxib has been shown to inhibit metastatsis of mammary tumor cells through modulating activities of natural killer cells (128).

(d) Cell proliferation, apoptosis, invasion and angiogenesis. COX-2-derived PGE2 stimulates cell proliferation, inhibits apoptosis, enhances invasion, and increases angiogenesis by activating EP receptor signaling. All EP receptors are expressed in mammary glands of

MMTV/neu transgenic mice (101). HER2/neu-induced mammary tumorigenesis together with angiogenesis is significantly decreased in COX-2 knockout mice (129). In mammary tumors of

MMTV/COX-2 transgenic mice, expression of EP1, EP2, and EP4 is increased while EP3 expression is decreased compared to normal mammary tissue (130). EP2 signaling has been shown to mediate COX-2-induced mammary hyperplasia, vascularization and pro-angiogenic 15 gene expression (130, 131). In the PhlP-induced rat mammary tumorigenesis model, COX-2 has been suggested to inhibit apoptosis of mammary tumor cells via EP1 receptor signaling

(132). In various breast cancer cell lines, COX-2 has been shown to stimulate cell proliferation through EP4 or EP1/EP2 signaling, increase metastasis through EP4 signaling, and induce angiogenesis through EP1/EP4 signaling (133-136). Overall, evidence suggests that COX-2 promotes breast cancer development through EP1, EP2 and EP4 but not EP3.

1.2.5 COX-2-independent mechanisms for NSAIDs

Various observations suggest that COX is not the only target of NSAIDs. For example,

NSAID derivatives such as sulindac sulfone that lack the ability to inhibit COX, can inhibit cancer development (137). NSAIDs inhibit proliferation, and induce cell death in cells that do not express COX (138, 139). A series of molecular targets for NSAIDs have been identified, including the peroxisome proliferator-activated receptors (PPAR) a and y, 15-lipoxygenase-1, extracellular signal-regulated kinasel/2 (ERK1/2), p38, 3-phosphoinositide-dependent protein kinase-1 (PDK1), nuclear factor-kappaB (NF-KB), p70S6 kinase, and p21™ (140-146). The sulfone metabolite of sulindac has been shown to inhibit MNU-induced rat mammary carcinogenesis through modulation of the Ha-ras signal transduction cascade (147). In SKBr3 breast cancer cells, sulfonanilide analogues derived from the COX-2 selective inhibitor NS-398 have been shown to suppress aromatase expression and activity independent of COX-2 inhibition (148). The COX-2 inhibitor meloxicam has been shown to inhibit cell survival of

MCF-7 breast cancer cells through an ERKl/2-dependent signaling pathway (149). Celecoxib has been shown to enhance doxorubicin-induced cytotoxicity in MDA-MB231 cells via modulation of NF-KB activity (150). 16

In summary, evidence from the literature suggests that COX-2 plays an important role in breast cancer development by affecting multiple processes. In addition to the mechanisms that have been addressed, it is known that a disturbance in mammary tissue homeostasis by changes in proliferation, differentiation and/or apoptosis can promote mammary tumorigenesis

(151). Over-expression of COX-2 has been shown to deregulate the cellular balance of rat intestinal epithelial cells by decreasing differentiation and inhibiting apoptosis (152). The influence of COX-2 over-expression on mammary epithelial cell homeostasis, however, was not known, and this is discussed in Chapter 3 of this thesis. 17

1.3 Fatty acid synthase (FAS)

1.3.1 The fatty acid synthesis pathway

Fatty acid synthesis refers to the biochemical process that converts glucose to palmitate.

Glucose in the cell is first converted to pyruvate via glycolysis. Pyruvate is converted to acetyl-

coenzyme A (CoA) inside mitochondria by the citric acid cycle. Citrate is then transported out of the mitochondria into the cytoplasm, where ATP citrate lyase (ACL) converts citrate back to

acetyl-CoA. Acetyl-coenzyme A carboxylase (ACC) catalyzes the carboxylation of acetyl-CoA to malonyl-CoA in an ATP-dependent manner. Fatty acid synthase (FAS), a homodimer of

250-kDa subunits, is a multifunctional enzyme that uses acetyl-CoA and malonyl-CoA as the

substrates, and NADPH as the reducing agent to synthesize palmitate (153). From the N- terminus of FAS to its C-terminus, amino acids encoding P-ketoacyl synthase, acetyl-CoA transacylase, malonyl-CoA transacylase, dehydratase, enoyl reductase, ketoacyl reductase, acyl carrier protein, and thioesterase are organized into discrete domains in the order indicated

(154).

1.3.2 Inhibitors of the fatty acid synthesis pathway

Small molecules have been synthesized to inhibit the enzymes of the fatty acid synthesis pathway. In addition to the inhibitors of ACL and ACC (155, 156), there are also several inhibitors of FAS. Cerulenin irreversibly inhibits FAS by binding covalently to the active site cysteine of the P-ketoacyl synthase moiety, which performs the condensation reaction between the elongating fatty acid chain and each successive acetyl or malonyl residue

(157). C75, tetrahydro-4-methylene-2-octyl-5-oxo-3-furancarboxylic acid, is also a potent inhibitor of FAS (158). Unlike cerulenin, C75 also activates carnitine palmitoyltransferase-1

(CPT-1) and thereby increases fatty acid oxidation (159). C93, (±)-4-hydroxy-5-methyl-5- Citrate ACL » Acetyl CoA ASC • Malonyl CoA

Mitochondriot n 6 malonyl CoA —\— 14NADPH Pyruvate t t Glucose 7CO, I' 14 NADP Palmitate

ACL: ATP citrate lyase ACC: Acetyl CoA carboxylase FAS: Fatty acid synthase

gure 1.2. Fatty acid synthesis pathway 19 octyl-5H-thiophen-2-one, inhibits FAS activity, but without affecting CPT-1 activity (83).

Recently, Orlistat, (S)-2-formylamino-4-niethyl-pentanoic acid (S)-1-[[(2S, 3S)-3-hexyl-4-oxo-

2-oxetanyl]methyl]-dodecyl ester, a potent inhibitor of pancreatic lipase, has also been shown to be a potent and selective inhibitor of FAS. It inhibits the thioesterase domain of FAS that responsible for releasing plamitate from the acyl carrier protein of the enzyme (160). Orlistat has been approved for treating obesity (161). Another FAS inhibitor triclosan, 2,4,4'-trichloro-

2'-hydroxydiphenyl ester, inhibits enoyl-reductase domain of FAS (162). Various dietary compounds such as epigallocatechin gallate (EGCG), flavonoids and resveratrol have also been shown to be able to inhibit FAS activity (163).

1.3.3 FAS in normal tissues

In most normal tissues, fatty acid synthesis occurs at a very low rate that is independent of diet and hormones. In liver and adipose tissues, the synthesis of fatty acids occurs at rates that are 10-1000 times those in other tissues and is regulated by diet and hormones. This process converts excess dietary carbohydrate to triacylglycerol for energy storage (164). A high-carbohydrate diet, fasting and refeeding, insulin, thryroid hormone and glucocorticoids up-regulate FAS expression while dietary PUFAs, fasting and glucagon down-regulate FAS expression (165-167). Nutritional and hormonal stimuli regulate FAS transcription through interaction of c/s-acting DNA elements in the promoter of the FAS gene and trans-acting transcription factors (153). In the promoter of the FAS gene, there are binding sites for various transcription factors including sterol response element binding protein (SREBP), Spl, upstream stimulatory factor (USF), NF-Y, carbohydrate response element-binding protein (ChREBP), liver X receptor (LXR), retinoid X receptor (RXR) and cAMP response element binding protein (CREB) (153, 168). Various studies have shown that phosphoinositide 3-kinase 20

(PI3K)/Akt/protein kinase B (PKB) and/or MAPK/SREBP-1 are the major signaling pathways involved in the induction of FAS expression by insulin or glucose (169-179). NF-Y and CREB have also been shown to play a role in this process (180, 181). USF1, USF2, and ChREBP are essential to sustain the hepatic induction of the FAS gene by fasting then refeeding a carbohydrate-rich diet (182-186).

Fasting and glucagon suppress FAS expression by increasing the intracellular cAMP level possibly by up-regulating p38 MAPK and decreasing SREBP-1 mRNA levels (153, 173,

187). PUFAs have been shown to suppress FAS expression by down-regulating the activities of various transcription factors such as SREBP-lc, NF-Y, and ChREBP (179, 188-196).

Inhibition of FAS has metabolic and cellular consequences both centrally and peripherally. In the ventromedial nucleus of the hypothalamus (VMN), FAS is expressed and physiologically regulated by fasting and refeeding (197). In diet-induced obese mice or ob/ob mice, chronic C75 treatment increases fat oxidation and reduces food intake to decrease adipose mass (198-200). C75 treatment also inhibits the expression of genes responsible for fatty acid synthesis and fat accumulation in peripheral tissues (201). Similar metabolic effects are observed with tea extracts (202, 203). Furthermore, inhibition of FAS with cerulenin, triclosan or C75 reduces differentiation of 3T3-L1 preadipocytes (204).

1.3.4 FAS and breast cancer

In 1989, Kuhajda et al. first reported the immunologic identification of a prognostic molecule in tumor cells of breast cancer patients (205). Later, this molecule was identified as

FAS, and its activity has been shown to parallel the overall activity of endogenous fatty acid synthesis in a group of established human breast carcinoma cell lines and normal human fibroblasts (HS-27) (158). The tumor FAS produces 80% palmitate, 10% myristate, and 10% 21

1 SRE-1 CRE IRE TATA w -730 -700 I -150 -141 -99 -92 -68 -52 — USF — SREBP — SP1 — *EBP ™" SREBP — NF-Y

CRE: cAMP response element; IRE: insulin response element SRE: sterol response element; TATA: TATA box.

Figure 1.3. The as-acting elements and trans-acting factors involved in the regulation of transcription of the FAS gene. Numbers indicate the positions of each element relative to the transcription start site. 22 stearate, and FAS is a surrogate marker of the fatty acid synthesis pathway in cancer cells

(158). As first demonstrated more than half a century ago (18), highly active fatty acid synthesis is a common event in cancer cells. Indeed, FAS is over-expressed in a variety of human epithelial cancers including breast, colon, prostate, liver, esophagus, and bladder (206-

214). This review will focus on FAS in breast cancer biology.

FAS expression. In human breast cancers, FAS is over-expressed in early stage in situ ductal or lobular carcinomas as well as in late stage invasive lesions (215, 216). This enzyme is also over-expressed in rodent mammary tumors induced by viruses, oncogenes, or chemical carcinogens (217-219). In human breast cancer patients, over-expression of FAS is associated with poor prognosis (206, 220-223). Breast cancer patients also have significantly higher serum

FAS levels compared with healthy subjects (222). FAS expression is higher in ER and progesterone receptor (PR) positive breast cancers (223). In a panel of human breast cancer cell lines, however, FAS expression did not correlate with ER or PR status, but was positively correlated with the amplification and/or overexpression of the HER-2/neu oncogene (224), possibly because the strong effect of this oncogene on FAS expression overwhelmed any effect of ER or PR. ACC, another enzyme of the fatty acid synthesis pathway, is also highly expressed in human breast carcinomas (215), and ACC polymorphisms are associated with breast cancer risk (225).

FAS and cell proliferation. In cancer cells, de novo fatty acid synthesis provides fatty acids for the biosynthesis of membrane phospholipids to sustain cell proliferation (226, 227). In human primary breast cancers, FAS expression is correlated with the Ki-67 proliferation index

(216). In both ER and PR positive breast cancer cells, synthetic progestins enhance FAS expression, cell proliferation and survival through activation of ER signaling (228, 229). In 23 contrast, inhibition of FAS with various small molecule inhibitors or siRNA, decreases cell proliferation. For example, in MCF-7 and SKBr3 cells, triclosan decreases both cell viability and growth (162). In MCF-7 cells, inhibition of FAS by C75 produces a profound inhibition of

DNA replication and S phase progression, suggesting a link between fatty acid synthesis and

DNA synthesis in proliferating tumor cells (230). In the MDA-MB-435 breast cancer cell line, ablation of FAS activity with the FAS inhibitor orlistat or siRNA causes a dramatic down- regulation of Skp2, leading to an up-regulation of p27Klpl and a cell-cycle arrest at the Gl/S boundary (231). In SKBr3 breast cancer cells, orlistat leads to S-phase cell cycle arrest, induces apoptotic cell death, and down-regulates HER2/neu oncogene expression (232). The down- regulation of HER2/neu indicates that FAS not only provides building blocks for the biosynthesis of cellular membranes, but also plays a role in maintaing cellular signaling pathways.

FAS and apoptosis. Sustained inhibition of FAS leads to apoptosis. For example, Pizer et al. reported that inhibition of FAS by cerulenin decreases fatty acid synthesis, inhibits clonogenic capacity, and causes DNA fragmentation and morphological changes characteristic of apoptosis in breast cancer cells (233). Similar outcomes have also been observed following triclosan treatment (162). Apoptosis induced by FAS inhibition may be cell cycle-specific since

FAS inhibition has been shown to trigger apoptosis only during S phase in MCF-7 cells (156).

FAS inhibition also sensitizes breast cancer cells to other apoptotic agents. Menendez et al. showed that pharmacological and siRNA-mediated inhibition of FAS synergistically enhances Taxo (Paclitaxel)-induced apoptosis in MDA-MB-231 and MCF-7 cells (234, 235).

In MDA-MB-231 cells, FAS inhibition suppresses HRE2/neu oncogene over-expression, and synergistically enhances apoptosis induced by anti-HER2 antibody trastuzumab (236). 24

Furthermore, inhibition of FAS preferentially induces apoptosis in HER2-transfected breast epithelial cells compared to matched vector-transfected control cells (237). Intervention in other signaling pathways can enhance apoptosis induced by FAS inhibition. In MCF-7 cells,

RNA interference-mediated silencing of the p53 tumor-suppressor protein drastically increases apoptosis after endogenous fatty acid synthesis is inhibited by C75 (235). In MBA-MB468 cells, inhibition of PI3K enhances cerulenin-induced apoptosis via activation of caspases, down-regulation of antiapoptotic proteins (XIAP, cIAP-1 and Akt), and activation of Bak in mitochondria (238).

Although the exact mechanism underlying apoptosis induced by FAS inhibition has not been elucidated, inhibition of FAS has been shown to cause malonyl-CoA accumulation that leads to inhibition of CPT-1, up-regulation of ceramide, induction of the proapoptotic genes

(BNTP3, TRAIL, and DAPK2), and finally apoptosis (19, 239, 240). Mitochondria play a significant role in initiating apoptosis (241). In various cancer cell lines including breast, mitochondria have been shown to be key players in cerulenin-mediated apoptosis with cytochrome c release being an early event (242). In MCF-7, MDA-MB-231, and transformed breast epithelial HBL100 cells, specific silencing of FAS or ACCa with siRNAs results in a major decrease in palmitic acid synthesis and induction of apoptosis, together with formation of reactive oxygen species (ROS) and mitochondrial impairment (243).

FAS regulation. As addressed previously, FAS levels in liver and adipose tissue are nutritionally regulated, and PI3K/MAPK/SREBP-1 is the major signaling pathway that modulates FAS expression (244-246). In contrast, FAS expression in cancers is unresponsive to nutritional regulation. Indeed, Cognault et al. showed that FAS is highly expressed in carcinogen-induced rat mammary tumors, and the level of FAS mRNA in these tumors is not 25 regulated by dietary fat (219). In SKBr3 breast cancer cells, FAS expression is not suppressed by LA or AA that are known to down-regulate FAS expression in lipogenic tissues, but it is selectively inhibited by tumoricidal alpha-linolenic and gamma-linolenic acids (247). The underlying mechanism is not known.

Oncogenes have been shown to play a role in regulating FAS expression in breast cancers. H-ras up-regulates FAS expression via the PI3K/MAPK/SREBP-1 pathway in MCF-

10A cells (248, 249). In SKBr3 human breast cancer cells and H16N2 human mammary epithelial cells, HER-2/neu stimulates FAS through activation of the MAPK ERK1/2 and

PI3K/Akt signal transduction cascades (237, 247, 250, 251). A recent proteomic study showed that over-expression of FAS in HER-2/neu-positive breast cancer and HER-2/neu-dependent differential expression of FAS in four breast cancer cell lines and 12 breast tumors (251), further supporting the role of HER2/neu in up-regulating FAS expression.

In breast cancer cells, steroid hormones also control FAS expression, and both ER and progestrogen receptor (PR) signaling pathways are involved in this process. Progestin R5020 up-regulates FAS expression in PR positive cell lines T47D and MCF-7, but not in PR negative cell lines BT20, MDA-MB231, and HBL100 (252). In MCF-7 cells, synthetic progestins induce FAS expression through both ER and PR signaling (228), and SREBP-lc plays a role in this process (253). In a panel of primary human breast cancer samples, the mRNA levels of

FAS correlate with those of SREBP-lc (249), further suggesting a role for SREBP-lc in regulating FAS expression. In T47D human breast cancer cells, progestins and androgens increase triglyceride accumulation by interacting with their own receptors, and this effect follows FAS induction and precedes cell growth inhibition (254). 26

Recently, the tumor suppressor gene BRCA1 has been shown to decrease fatty acid

synthesis. In MCF-7 cells, BRCA1 suppresses fatty acid synthesis through its interaction with

ACC-a by preventing dephosphorylation of phosphorylated ACC-a (255). RNAi-mediated

knockdown of BRCA1 induces a marked increase in fatty acid synthesis (256).

FAS as a target for breast cancer therapy and prevention. The high level of FAS

expression in cancers and its association with poor prognosis have led to the exploration of

FAS as a target for therapy. As discussed previously, in vitro studies have shown that FAS

inhibition causes apoptosis, and synergistically enhances the apoptotic effects of other agents in

various breast cancer cell lines (162, 233-236, 238). Inhibition of FAS has been shown to

suppress the growth of xenografts of breast cancer cells in nude mice along with increased

levels of apoptosis (240). Clinically, this approach has not been implemented possibly because

of undesirable side effects of currently available FAS inhibitors such as weight loss and

decreased appetite (159).

FAS expression is elevated at early stages of multistep mammary tumorigenesis (215,

216). In vitro studies suggest that over-expression of FAS is associated with malignant transformation. For example, in breast epithelial cells, HER2 over-expression and v-H-ras-

mediated transformation up-regulate FAS, and sensitize the cells to apoptosis induced by FAS

inhibition (237, 248). Similar observations are reported in HER2-transformed NIH-3T3 cells

(257). In the neu-N transgenic mouse model of mammary tumorigenesis, C75 significantly

decreases tumor progression (218). All these lines of evidence indicate that FAS can be targeted for breast cancer prevention. Because of the role of BRCA1 in inhibiting acetyl-

coenzyme A carboxylase (ACC), another enzyme in the fatty acid synthesis pathway, in breast 27

cancer cells (255, 256), exploration of FAS as a target for breast cancer prevention may be particularly promising for women with BRCA1 mutations.

In summary, FAS is significantly elevated in breast cancer. This enzyme is functionally

significant since it synthesizes fatty acids that breast cancer cells use for the biosynthesis of membrane phospholipids to sustain cell proliferation. In these cells, inhibition of FAS decreases proliferation and induces apoptosis. Thus, FAS has been suggested to have the potential as a target for breast cancer therapy (at the time the research of this thesis was planned). The potential of FAS as a target for breast cancer prevention, however, had not been investigated. Furthermore, the molecular link between de novo fatty acid synthesis and cell proliferation, a fundamental process in breast cancer biology, was not known. These issues are discussed in Chapter 5 of this thesis. 28

1.4 Hypothesis and organization of thesis

When this thesis research was planned, the evidence at that time suggested that COX-2

and FAS were each involved in breast cancer development, but there were major gaps in our

knowledge of how these genes act at the whole organism, cellular and molecular levels during

mammary tumorigenesis. The overall hypothesis of this thesis was that COX-2 and FAS each

play an important role in promoting the development of breast cancer.

In a previous study, as outlined in section 1.2.4, we demonstrated that the COX-2

inhibitor celecoxib not only inhibits mammary carcinogenesis, but also decreases fat

accumulation in rats fed a high fat diet rich in n-6 PUFAs. This unexpected outcome promoted

us to hypothesize that celecoxib plays a role in fatty acid metabolism. In Chapter 2, we

demonstrated that, indeed, celecoxib decreased fat accumulation by down-regulating FAS in

hepatic and adipose tissues in rats fed a high fat diet rich in n-6 PUFAs. This finding suggests that both inhibition of COX-2 and down-regulation of FAS may contribute to the suppression

of rat mammary carcinogenesis by celecoxib.

Based on the results from Chapter 2, our subsequent research developed into two branches. One of the branches was to investigate the role of COX-2 in mammary tumorigenesis. Tissue homeostasis plays an important role in mammary tumorigenesis (151).

Studies reviewed in section 1.2.4 suggested that COX-2 expression promotes breast cancer

development, but whether this effect is mediated through a disruption in mammary tissue homeostasis was not investigated. We hypothesized, therefore, that COX-2 over-expression would increase the susceptibility of the mammary tissue to tumorigenesis by affecting cellular homeostasis in the gland. In Chapter 3, this hypothesis was tested by over-expressing COX-2 in

MCF-10F human breast epithelial cells. 29

Based on the results from Chapter 2, the other branch of the research in this thesis was to investigate the role of FAS in mammary tumorigenesis. As documented in section 1.3.4, various studies suggested that FAS plays a crucial role in breast cancer biology, and this enzyme has been suggested to be a target for breast cancer therapy. The potential of FAS as a molecular target for breast cancer prevention, however, remained unclear, particularly since the stage at which the enzyme becomes over-expressed during carcinogenesis was not known. In

Chapter 4, therefore, we investigated whether inhibiting FAS inhibits MNU-induced rat mammary carcinogenesis.

Development of strategies for cancer prevention/therapy by targeting FAS is likely to be facilitated by a sound understanding of the underlying mechanism that controls the elevated expression of this gene in cancers. This mechanism is the subject of Chapter 5. As reviewed in section 1.3.4, in cancer cells, de novo fatty acid synthesis is functionally linked to cell proliferation by providing fatty acids for membrane biosynthesis (226), but the molecular link between these two biological processes was not known. Sp proteins Spl, Sp3 and Sp4, members of the Sp/KLF family of transcription factors, are expressed in a variety of cancers

(258). They regulate gene expression by binding to GC-rich DNA sequences (258). The promoters of genes encoding the enzymes of fatty acid synthesis (259-261) and cell cycle regulatory proteins (258) contain GC-rich DNA sequences. We hypothesized that Spl, Sp3 or

Sp4 is a molecular link between fatty acid synthesis and cell proliferation. This hypothesis was tested in Chapter 5 using the ER positive MCF-7 breast cancer cell line. CHAPTER TWO

Celecoxib Decreases FAS Expression via Down-regulation of JNK1

Suying Lu and Michael C. Archer

(A version of: Exp Biol Med 232:643-653, 2007)

30 31

2.1 Abstract

Previous observations from our laboratory that the COX-2 inhibitor celecoxib not only inhibits rat mammary carcinogenesis, but also decreases fat deposition in rats fed a high fat diet, prompted us to determine whether celecoxib affects lipid metabolism. At 57 days of age, 2 groups of 10 female Sprague Dawley rats were pair fed a high fat diet with or without 1500 ppm celecoxib for 15 weeks. Compared to controls, celecoxib-treated rats had 44.4% less hepatic triglycerides and 22.6% less intra-abdominal adipose tissue mass. In liver and adipose tissue, of several genes involved in fat metabolism and mobilization that we measured, only

FAS was significantly down-regulated by celecoxib treatment. There were no differences in the level of PGE2 in these tissues, indicating that celecoxib decreases fat accumulation by down- regulating FAS possibly through a COX-2-independent mechanism. Among the potential molecular targets by which celecoxib may regulate FAS expression, only c-Jun N-terminal kinase 1 (JNK1) was significantly down-regulated. Furthermore, a known inhibitor of JNK suppressed FAS expression in rat hepatocytes. Our observations suggest that celecoxib suppresses FAS expression, and decreases fat accumulation by down-regulating JNK1.

2.2 Introduction

NSAIDs inhibit COX activity and are widely used for the treatment of rheumatoid arthritis and osteoarthritis (262). In addition to COX, NSAIDs have also been shown to affect a series of new molecular targets such as 15-lipoxygenase-l (141), ERK1/2 signaling (263), NF-

KB (144), p70S6 kinase (145), p2\ras signaling (146) and PDK1 (143). These new molecular targets suggest new biological roles for NSAIDs. Particularly, some NSAIDs such as indomethacin, fenoprofen and ibuprofen have been shown to activate PPAR a and y (140). 32

Since the PPARa activator fenofibrate reduces adiposity in C57BL/6 mice fed a high fat diet

(264), while the PPARy activator rosiglitazone lowers serum triglyceride levels in dbldb mice

(265), NSAIDs may play a role in regulating lipid metabolism. Indeed, a recent study has shown that high doses of salicylates reverse hyperglycemia, hyperinsulinemia and dyslipidemia in obese rodents by sensitizing insulin signaling (266).

Among NSAIDs, celecoxib has been shown to possess strong chemopreventive activity against mammary, colon and skin carcinogenesis in rodents (107, 110, 267, 268). In a study from our laboratory, celecoxib-treated rats not only had lower mammary tumor incidence and tumor multiplicity, but also reduced body weight gain, less abdominal adipose tissue accumulation and lower serum triglyceride levels compared to untreated controls (110). The celecoxib, however, was administered in a high fat diet rich in n-6 polyunsaturated fatty acids, while other studies not showing any effect of celecoxib on body weight gain used low fat diets

(107,267).

Generally, high fat diets induce an increase in fatty acid oxidation (269), and a decrease in de novo fatty acid synthesis (270, 271). After prolonged exposure to a high-fat diet, however, de novo fatty acid synthesis can be induced by hyperinsulinemia in insulin-resistant obese animals (272). Several molecular targets have been shown to affect obesity and insulin resistance induced by high-fat diets. For example, in C57BL/6 mice, PPARa activators improve insulin sensitivity and reduce adiposity (264). In a recent study of the role of JNK1 in obesity and insulin resistance, Hirosumi et al. (273) observed that the body weight gain of

JNK1 knockout mice was similar to that of wild type mice when they were fed a low fat diet, but lower when they were fed a high fat diet. Osei-Hyiaman et al. (271) have demonstrated that anandamide acting at hepatic CBi receptors contributes to diet-induced obesity by increasing 33 basal rates of fatty acid synthesis. These various results prompted us to investigate whether celecoxib plays a role in lipid metabolism, thereby decreasing fat accumulation induced by a high fat diet.

2.3 Materials and methods

Animals and diets. At 57 days of age, twenty female Sprague Dawley rats were divided into two groups (10/group). The control group was fed a modified AIN-93G diet containing

18% safflower oil and 3% soybean oil at the expense of carbohydrate. The experimental group was fed the same diet supplemented with 1500 ppm celecoxib (kindly supplied by Pharmacia,

Skokie, IL). A modified pair feeding regime was used in which the control group was pair fed to the mean daily food intake of the experimental group. Body weights were recorded weekly.

After 15 weeks, all rats were fasted overnight and killed the next morning. Immediately after blood collection by cardiac puncture, livers, intra-abdominal adipose tissue (including retroperitoneal, parametrial and mesenteric adipose) and gastrocnemius muscle were removed, weighed, immediately frozen in liquid nitrogen and stored at -80°C.

Cell culture and treatment of rat hepatocytes. Rat hepatocytes (Cat. No. CRL-1439,

ATCC, Rockville, MD) were cultured in Ham's F12K medium with 10% fetal bovine serum, and kept in at 37°C humidified incubator with a mixture of 95% air and 5% CO2. Since regenerating liver over-expresses FAS and JNK1 (274, 275), to simulate the non-dividing hepatocytes in resting liver, we treated confluent cells with 20, 40 uM celecoxib, or 10, 20 uM

JNK inhibitor SP600125 (Biomol Research Laboratories, Inc., Plymouth Meeting, PA) for various time periods. DMSO was used as vehicle with a final concentration of 0.1% in all cases. After treatments, hepatocytes were washed with ice-cold phosphate-buffered saline 34

followed by incubation in cold lysis buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, ImM

EGTA, 0.5 mM Na3V04, 10 mM glycerophosphate, 5 mM NaF, 1 mM phenylmethylsulfonyl

fluoride, and 40 ng/ml each of pepstatin A, aprotinin, and leupeptin). Whole cell lysates were

stored at -80°C for Western analysis.

Biochemical analysis. The following were analyzed in serum: triglycerides, measured enzymatically using Sigma Diagnostics Triglyceride (GPO-Trinder) reagent (Sigma, St Louis,

MO); insulin, measured by an insulin 125I RIA kit (ICN Pharmaceuticals, Inc., Costa Mesa,

CA); free fatty acids (FFA), measured by an acyl-CoA synthetase (ACS)-acyl-CoA oxidase

(ACOD) method (Wako Chemicasls USA, Inc., Richmond, VA); y-glutamyl transferase (y-

GT), measured by a y-glutamyltransferase kit (Sigma). Liver and muscle triglyceride levels were measured as previously described (276). Briefly, tissue samples (200~250 mg) were extracted in 2 ml isopropanol. After centrifugation at 12,000 x g for 10 min, 10 ul of

supernatant were used to measure the triglyceride concentration. PGE2 levels in liver and adipose tissue were measured by an ELISA kit (Cedarlane Laboratories Limited, Hornby,

Canada), using positive and negative controls that we previously described (277).

Gene expression analysis. Total RNA from livers, retroperitoneal adipose and muscle tissues was isolated using TRI REAGENT™ (Sigma), and poly(A)+ mRNA was purified using

GenElute™ mRNA miniprep kits (Sigma). About 10 p,g poly(A) mRNA were elecrophoresed in 1% formaldehyde-agarose gels, transfered onto nylon membranes and probed with P- labeled cDNA probes for FAS, acyl-CoA oxidase (ACO), CPT-I (liver and muscle isoforms), hormone sensitive lipase (HSL) and lipoprotein lipase (LPL). cDNA probes were prepared by

PCR using cDNAs from rat liver, retroperitoneal adipose tissue or muscle as templates with the following primer pairs: FAS, 5'-AGAGGCTGTTCTCAAGGAAGG-3', 5'- 35

AGGGTACATCCCAGAGGAAGT-3'; ACO, 5'-CACTGCCTATGCCTTCCACT-3', 5'-

GGCCAAGAAGTGAGCCAAGT-3'; CPT-I liver isoform, 5'-

CTGGATGATCCCTCAGAGCC-3', 5'-CTCCATGGCTCAGACAATAC-3'; CPT-I muscle

isoform, 5'-GATTCTCTGGAACTGCATCT-3\ 5'-CTGAGACACATCTACCTGTC-3'; HSL,

5'-CTGCGCATAGACTCCGTAAG-3', 5'-GCCATAGACCCAGAGTTGCGT-3'; LPL, 5'-

TCGTGCGAGCACTTCACCAG-3', 5'-TCTGTGTCTAACTGCCACTT-3'. cDNA probes of

P-actin and glyceraldehyde phosphate dehydrogenase (GAPDH) (Oncogene™ Research

Products, La Jolla, CA) were used to adjust for mRNA loading. Bands were quantified by

electronic autoradiography (Instanflmager, Packard Instrument Company, Meriden, CT).

Western blot analysis. Liver and retroperitoneal adipose tissue were homogenized on ice in a glass-glass tissue grinder with PBS containing 10 ug/ml leupeptin, 10 ug/ml pepstatin

A and 10 ug/ml aprotinin. The homogenates were centrifuged at 16,000 x g for 15 min, and the

superaatants were stored at -80°C for Western analysis. The proteins from livers, retroperitoneal adipose tissue and cultured hepatocytes were separated by 10% SDS-PAGE.

Proteins were transferred onto PVDF membranes (Bio-Rad Laboratories, Inc., Hercules, CA) using a semi-dry blotter (C.B.S. Scientific Co., Del mar, CA). Membranes were blocked with

5% nonfat dried milk in TTBS (10 mM Tris-HCL, pH 8.0, 100 mM NaCl, and 0.05% Tween

20) overnight at 4°C, then incubated for 2 h at room temperature with one of the following antibodies: mouse monoclonal anti-human FAS at 1:500 dilution (BD Transduction

Laboratories, Mississauga, Canada); rabbit polyclonal anti-human JNK1 at 1:500 dilution; mouse monoclonal anti-human pJNK at 1:2000 dilution; rabbit polyclonal anti-human phospho-p38 MAP kinase at 1:1000 dilution; rabbit polyclonal anti-human phospho-Erkl/2 at

1:1000 dilution; mouse monoclonal anti-mouse pAkt/PKB (pSer473), rabbit polyclonal anti- 36 mouse pAkt/PKB (pThr308) at 1:1000 (New England Biolabs, Ltd., Pickering, Ontario,

Canada); rabbit polyclonal anti-human pCREB at 1:1000 dilution (Upstate Biotechnology,

Lake Placid, NY). The membranes were then incubated with horseradish peroxidase- conjugated goat anti-mouse or anti-rabbit secondary antibodies (Santa Cruz Biotechnology) at

1:2000 dilution for 45 min at room temperature. Membranes were stripped in 62.5 mM Tris pH

6.7, 100 mM p-mercaptoethanol and 2% SDS, for 30 min at 50°C. p-Actin was used as a loading control. Bands were quantified using a FluorChem digital imager (Alpha Innotech

Corp, San Leandro, CA).

Liver enzyme activity analysis. FAS activity of livers (adipose tissue was not analyzed because of limited sample size) was measured using a previously described method (278).

Briefly, livers were homogenized on ice in 20 mM Tris-HCl, pH 7.5 containing 1 mM DTT and

1 mM EDTA using a glass-glass tissue grinder. Homogenates were centrifuged at 12000 x g for

10 min and the supernatants were used for measuring FAS activity. One hundred |_ig protein in a volume of 20 ul were added to 125 ul of 100 mM potassium phosphate, pH 7.0, containing

100 mM KC1 and 0.5 mM NADPH. The reaction mixtures were pre-warmed for 15 min at

37°C, and reactions were started by the addition of 4.5 ul of a substrate mixture containing 25 nmol of acetyl-CoA and 25 nmol of malonyl-CoA together with 0.05 uCi (5 ul) of [2-14C] malonyl-CoA (47.0 mCi/mmol, NEN Life Sciences Products, Inc., Boston, MA). Reactions were carried out at 37°C for 10 min and were stopped by the addition of 1 ml of ice-cold 1 N

HCl/methanol (6:4, v/v). Fatty acids were extracted with 1 ml of petroleum ether (Sigma) and incorporation of radioactivity into the fatty acids was assessed by scintillation counting. 37

Statistical analysis. All data were expressed as means ± SEM. The differences between the two groups were analyzed by unpaired t test. Data from the hepatic PGE2 experiment were analyzed by nonparametric test. PO.05 was considered statistically significant.

2.4 Results

Celecoxib-treated rats accumulate less intra-abdominal adipose tissue and hepatic triglycerides. In a previous carcinogenesis study from our laboratory (110), from 57 days of age, female Sprague Dawley rats had ad libitum access to a high fat diet (modified AIN-93G diet containing 18% safflower oil and 3% soybean oil) containing 1500 ppm celecoxib, a dose that had been used by others with no adverse effects (107, 267). After 14 weeks, our rats had decreased body weight gain and lower serum triglyceride levels than controls not given celecoxib (110). There was no evidence of toxicity caused by the drug. In that study, however, we did not control food intake in the two groups. To be sure there would be no differences in intake levels, in the present experiment we pair fed the treated and control rats. In the first 3-4 days of the experiemt, celecoxib-treated rats had a lower food intake than controls, presumably due to reduced palatability, but the food intakes were not different between the two groups thereafter. There were no differences in the body weights of the two groups at 15 weeks (Table

2.1) and throughout the experimental period. The weight of intra-abdominal adipose tissue, however, was significantly lower in the celecoxib-treated rats compared to controls (Table 2.1).

Liver weights were slightly higher in the treated group (Table 2.1), but there were no differences in serum levels of y-GT (Table 2.2), indicating that celecoxib did not induce hepatotoxicity. Serum levels of triglycerides, insulin and FFA were not different between the two groups after the 15 week period of this experiment (Table 2.2), but the celecoxib-treated 38

animals had significantly lower levels of hepatic triglycerides than the controls (Table 2.1).

Muscle triglyceride levels were similar in the two groups (data not shown).

FAS in liver and retroperitoneal adipose tissue is down-regulated in celecoxib-treated rats. To determine the metabolic pathway(s) by which celecoxib affects lipid metabolism in these animals, we measured the expression in liver, retroperitoneal adipose and muscle tissues of several genes involved in fatty acid metabolism. In the celecoxib-treated rats, hepatic FAS mRNA was significantly reduced to about 70% of controls (Figure 2.1 A), while in the retroperitoneal fat pad, expression of FAS was reduced to about 50% of controls (Figure 2.2A).

FAS protein levels were also reduced in liver and retroperitoneal adipose tissue as shown by

Western blot analysis (Figs. 2.1C and 2.2C respectively). Furthermore, hepatic FAS enzyme activity was lower in celecoxib-treated rats compared to controls (Figure 2.ID). The hepatic expression of ACO and CPT-I (Figure 2.1 A) and the expression of ACO, CPT-I, HSL and LPL in the retroperitoneal fat pad (Figgure 2.2A) were not different between the two groups. In muscle, there were no differences in expression of any of these genes between the two groups

(data not shown). To determine whether the changes in lipid metabolism in celecoxib-treated rats were mediated by inhibition of COX-2, we measured levels of PGE2, the major product of

COX-2, in liver and retroperitoneal adipose tissue. There were no differences, however, in

PGE2 levels between the two groups (Figure 2.3).

JNK1 is down-regulated in the livers of celecoxib-treated rats. Celecoxib has been shown to inhibit PDK1 activity (143). This kinase phosphorylates Akt/PKB at Thr308 (279).

To determine whether celecoxib down-regulates FAS by this mechanism in rat liver, we measured the levels of pAkt/PKB (pThr308). pThr308 levels, however, were not different in the livers of celecoxib-treated rats compared to untreated controls (data not shown). Akt/PKB is 39

Table 2.1 Body, liver and intra-abdominal adipose tissue weights and liver triglyceride levels in rats fed a high fat diet with or without 1500 ppm celecoxib for 15 weeks

Group Body weight Liver Visceral adipose tissue Liver triglycerides (g) (% body weight) (% body weight) (mg/g)

Celecoxib 371.4 ±12.1 2.8 ±0.1** 10.6 ±0.4** 5.9 ±0.4*

Control 386.9 ±15.7 2.2 ±0.1 13.3 ±0.5 8.3 ±0.9

Values are means ± SEM; n = 10 per group. P < 0.05 and **P <0.01 compared with controls. 40

Table 2.2 Serum levels of y-glutamyl transferase (y-GT), insulin, triglycerides and free fatty acids (FFA) in rats fed a high fat diet with or without 1500 ppm celecoxib for 15 weeks

Group y-GT Triglycerides Insulin FFA (units/ml) (mg/dL) (ulU/ml) (mEq/L)

Celecoxib 0.5 ±0.1* 72.3 ± 8.9 " 60.6 ±5.7 0.8 ±0.1

Control 0.7 ±0.1 120.0 ±35.3 57.7 ±2.9 0.7 ±0.1

Values are means ± SEM; n = 10 per group. P = 0.48 and P = 0.23 compared with controls. 41

2 3 4 FAS ACO

CPT-I p-Actin Control Celecoxib

C "55 +•» o

FAS * E p-Actin | 1 "o E c Control Celecoxib

Figure 2.1. Celecoxib decreases hepatic FAS mRNA, protein and enzyme activity levels in rats fed a high fat diet. (A) mRNA levels of FAS, ACO and CPT-I. (B) Quantification of FAS expression by densitometry. (C) Protein levels of FAS. (D) Hepatic FAS activity. Activity was assessed by 14C-malonyl CoA incorporation into fatty acids, p-actin was used as a loading control. Lanes 1 and 3 are representative samples from celecoxib- treated rats; lanes 2 and 4 are from control rats. Values are means ± SEM (n = 9; * PO.05). 42

FAS ACO CPT-I HSL LPL GAPDH

1" FAS IO 1 P-Actin

Control Celecoxib

Figure 2.2. Celecoxib decreases FAS expression in retroperitoneal adipose tissue in rats fed a high fat diet. (A) mRNA levels of FAS, ACO, CPT-I, HSL and LPL. GAPDH was used as a loading control. (B) Quantification of FAS expression by densitometry. Values are means ± SEM (n = 4; * P<0.05). (C) Protein levels of FAS. P-Actin was used as a loading control. Lanes 1 and 3 are representative samples from celecoxib-treated rats; lanes 2 and 4 are from control rats. 43

150

120

LU CD Q.

Control Celecoxib Control Celecoxib Liver Adipose

Figure 2.3. Effect of celecoxib on prostaglandin 2 (PGE2) levels in liver and intra-abdominal adipose tissue in rats fed a high fat diet. About 200 ~ 250 mg of liver and adipose tissue were used to measure PGE2 levels using an ELISA kit. Values are means ± SEM (n = 8; P = 0.21 for liver; n = 6 for adipose). 44 also a substrate of PDK2 that phosphorylates Ser473, and Ser473 phosphorylation plays an important role in the activation of Akt. Therefore, we examined the activity of Akt by Western blotting with phosphoserine 473-specific antibody (280). Figures 2.4A and 2.4B show that levels of pSer473 were higher in celecoxib-treated rats than controls. The levels of total

Akt/PKB did not differ between the two groups (data not shown). Celecoxib has also been demonstrated to decrease the phosphorylation of p38 and Erkl/2 (p44/42) in osteoarthritic chondrocytes (142), and both Erkl/2 and p38 participate in the activation of CREB (281, 282).

The activation of this transcription factor has been shown to play an essential role in the insulin stimulation of FAS in HepG2 cells (181). However, we did not observe any difference between controls and celecoxib-treated rats in the hepatic levels of pERKl/2, pp38 or pCREB (Figure

2.4A).

It has been shown that feeding rats a high fat diet leads to the activation of hepatic

JNK1, a stress-activated protein kinase (283), and that JNK1 knockout mice are resistant to obesity induced by a high fat diet (273). Furthermore, downregulation of JNK signaling has been shown to mediate the suppression of FAS expression in the livers of rats treated with pu- erh tea (284). Therefore, we explored whether the effect of celecoxib in our study is mediated by this molecular target. As shown in Figs. 2.4A and 2.4B, the levels of JNK1 and pJNKl were significantly lower in the livers of celecoxib-treated rats than those of controls.

In rat hepatocytes celecoxib decreases levels of FAS and JNK1, and JNK inhibitor down-regulates FAS expression. To further explore the relationship between celecoxib, FAS and JNK1, we treated rat hepatocytes with celecoxib at concentrations of 20 and 40 uM in vitro for 24, 48 or 72 h. These concentrations of celecoxib are within the range of serum concentrations we measured previously when rats were administrated 1500 ppm of the drug in 45

1 2 3 4

Mrt/PKB •• • •» *s*A,!'i;-. "'.•V -*#m

pp38 'fu*ttmtMtfti»

pErk1/2 „ ..^ff*-" ""^ftV^r-y • •»v.JS*rfljA;JP* •*^a»>

pCREB '- -t-fj^" -- - ,. » « JNK1 '+•#>-

"''SwWBIllJ'*' pJNK1 W-WisWfflJ* -•- • :**

P-Actin • - 'SsajiMfcti**- * v«*sr*~-- • »..*• «w

B 150

control celecoxib control celecoxib control celecoxib JNK1 pJNK1 pAkt/PKB

Figure 2.4. Celecoxib decreases levels of JNKl/pJNKl, but increases levels of pAkt/PKB (pSer473) in the livers of rats fed a high fat diet. (A) Sixty u.g protein was subjected to Western blot analysis. P-Actin was used as a loading control. Lanes 1 and 3 are representative samples from control rats; lanes 2 and 4 are from celecoxib- treated rats. (B) Quantification by densitometry of JNK1, pJNKl and pAkt/PKB. Values are means ± SEM (n = 3; * P<0.05). 46

the diet (110), the same level as used in the present experiment. As expected, celecoxib

decreased the expression of both FAS and pJNKl. pJNKl levels were significantly down-

regulated by 24 h (Figs. 2.5, A and C). Inhibition of FAS expression, however, was not

apparent until 72 h after celecoxib treatment (Figs. 2.5, A and B). As in the in vivo study,

celecoxib increased the levels of pAkt/PKB (pSer473) (Figs. 2.5, D and E), but did not alter the

levels of pERKl/2, pp38 and pCREB (Figure 2.5D). To investigate further whether the down-

regulation of JNK1 is causally related to the suppression of FAS expression, we treated rat

hepatocytes with the known JNK inhibitor SP600125 (285). Figures 2.6A and 2.6B show that

the JNK inhibitor significantly suppressed the expression of FAS.

2.5 Discussion

The purpose of this study was to determine whether the COX-2 inhibitor celecoxib

affects lipid metabolism in rats fed a high fat diet. After pair feeding controls and celecoxib- treated rats for 15 weeks, the celecoxib-treated rats accumulated significantly less intra

abdominal fat and lower levels of hepatic triglycerides. To determine whether these effects

were related to alterations of enzymes involved in fatty acid metabolism, we analyzed the

expression in liver, retroperitoneal adipose and muscle tissues of several important genes

involved in fatty acid synthesis, fatty acid oxidation, and fat mobilization and distribution.

FAS, a central enzyme in the pathway of de novo lipogenesis, catalyzes all of the steps in the conversion of malonyl-CoA, the product of ACC, to palmitate. FAS is abundant in liver and adipose tissue and is known to be regulated primarily at the level of transcription (153). ACO catalyzes the first step of peroxisomal long chain fatty acid P-oxidation while CPT-I is the rate- limiting enzyme of mitochondrial p-oxidation. Northern and Western analysis showed a clear B Celecoxib [|iM] 0 20 40 24 h FAS 48 h 72 h 0 20 40 p-Actin 72 h celecoxib friM] 24 h pJNK1 48 h 72 h P-Actin 72 h 0 20 40 celecoxib [JIM] Celecoxib [\M] 0 20 40

pAkt J2 — 400 Q) _W pp38 & 2 300 pErk1/2 pCREB 0 20 40 p-Actin celecoxib [jxM]

Figure 2.5. Celecoxib treatment decreases levels of FAS and pJNKl but increases levels of pAkt/PKB (pSer473) in rat hepatocytes. (A) Rat hepatocytes were treated with celecoxib for 24, 48 or 72 h. (D) Rat hepatocytes were treated with celecoxib for 72 h. Ten }j.g (for FAS analysis) or 60 (ag (for pJNKl analysis) of protein were subjected to Western blot analysis as described in materials and methods. P-Actin was used as a loading control. (B), (C) and (E) Quantification by densitometry of FAS, pJNKl and pAkt/PKB in celecoxib-treated and control rat hepatocytes at 72 h. Values are means ± SEM (n = 3; * PO.05, versus controls). 48

SP [\M]

0 10 20

FAS

p-Actin

B 150n

o J2 100H a-3 50H < 55

10 SP[nM]

Figure 2.6. JNK inhibitor SP600125 (SP) decreases FAS expression in rat hepatocytes. Cells were treated with SP for 72 h. (A) Western blot analysis. P-Actin was used as a loading control. (B) Quantification by densitometry of FAS in SP-treated and control rat hepatocytes. Values are means ± SEM (n = 3; * P<0.01, versus controls). 49 down-regulation of FAS in both the liver and the retroperitoneal fat pad in celecoxib-treated rats compared to untreated controls. As expected, hepatic FAS activity was also lower in celecoxib-treated rats. Celecoxib had no effect on the expression of ACO and CPT-1 in liver, retroperitoneal fat pad or muscle. Since ACO and CPT-1 are transcriptionally induced by

PPARs (286, 287), our results suggest that the effects of celecoxib on lipid metabolism are unlikely to be mediated by PPAR activation. However, the down-regulation of FAS by celecoxib may lead to elevated levels of malonyl-CoA, a known inhibitor of CPT-1 (288), thereby leading to reduced activity of this enzyme.

LPL-mediated fatty acid uptake and HSL-mediated lipolysis also affect adipose accumulation. A recent clinical study showed that adipose tissue loss induced by a low calorie diet in obese patients was associated with a significant decrease in LPL expression and a significant increase in HSL expression in adipose tissue, and a decrease in HSL expression but no change in LPL expression in muscle tissue (289). Adipose tissue loss was also associated with a large increase in serum FFA levels (289). In our study, however, there were no differences in the expression of HSL and LPL in retroperitoneal adipose tissue or muscle tissue or in serum FFA levels between the celecoxib-treated and control rats. These results indicate that the effect of celecoxib on lipid metabolism in our animals is unlikely to be caused by changes in the mobilization and redistribution of triglycerides in muscle and adipose tissue.

Taken together, our results suggest that celecoxib inhibits triglyceride accumulation in liver and intra-abdominal adipose tissue of rats fed a high fat diet by down-regulating FAS in these tissues.

Next we investigated whether the effect of celecoxib on lipid metabolism is mediated by inhibition of COX-2 activity. COX-1 and COX-2 are mainly expressed in non-parenchymal 50 cells such as Kupffer cells in liver and endothelial cells in adipose tissue and COX products act on parenchymal cells through a paracrine process (290, 291). By acting via the EP3 receptor to increase cellular cAMP levels, PGE2, the main product of COX, has been shown to decrease lipogenic gene expression, including FAS, in hepatocytes and adipocytes (290, 292). To determine whether decreased fat accumulation in celecoxib-treated rats was mediated by inhibition of COX-2, we measured PGE2 levels in liver and retroperitoneal adipose tissue.

There were no differences between the two groups suggesting that COX-1 in these tissues is the major source of PGE2. Indeed, studies have shown that COX-1 is expressed at much higher levels than COX-2 in rat liver (290) and mouse adipose tissue (293). Yuan et al. have shown that homozygous or heterozygous deletion of either COX-1 or COX-2 has no effect on lipid metabolism in insulin-resistant mice (266). Therefore, it is likely that celecoxib down-regulates

FAS in livers and abdominal adipose tissue in rats fed a high fat diet by a mechanism that is independent of COX-2. This COX-2 independent mechanism coild be further tested in a COX-

2 knockout model.

Under physiological conditions, insulin is a major factor that regulates FAS expression

(153). Conceivably, modification of the insulin signaling pathway may lead to an alteration in

FAS expression. The serine/threonine kinase Akt/PKB, one of the major elements in the insulin signaling pathway, is known to mediate stimulation of FAS expression by insulin (176), and is a downstream target of PDK1 (143). PDK1 phosphorylates Akt/PKB on Thr308 (279). Arico et al. (143) have reported that celecoxib is an inhibitor of PDK1. In the livers of our celecoxib- treated rats, however, levels of pAkt/PKB (pThr308) were not different from those in the control animals. Although Thr308 phosphorylation is necessary and sufficient for Akt/PKB activation (294), maximal activation requires additional phosphorylation at Ser473 by PDK2 51

(280). In both our in vivo and in vitro experiments, celecoxib treatment caused the up- regulation of hepatic pAkt/PKB (pSer473), further suggesting that the down-regulation of FAS by celecoxib is not mediated through the Akt/PKB pathway.

Although celecoxib is a COX-2-specific inhibitor, recent studies have shown that this

drug affects multiple molecular targets (143, 144). In human osteoarthritic chondrocytes,

celecoxib has been shown to decrease the phosphorylation of p38 and Erkl/2, members of the

MAPK pathway (142). Both p38 and Erkl/2 have been shown to participate in the phosphorylation of CREB (281, 282). Insulin stimulates the phosphorylation of CREB at serine

133, and the activation of CREB plays an essential role in the insulin activation of FAS (181).

Herzig et al. (295), on the other hand, have shown that mice deficient in CREB activity have a

fatty liver and display elevated hepatic expression of lipogenic genes including FAS. We measured the levels of pp38, pErkl/2 and pCREB to test the potential involvement of these pathways in the regulation of hepatic FAS by celecoxib. The drug, however, did not

significantly alter the levels of the phosphorylated proteins either in vivo or in vitro. Our observations indicate that down-regulation of FAS by celecoxib in the liver is not mediated through alteration of p38, Erkl/2 or CREB and, in view of the results in human osteoarthritic chondrocytes (142), suggest that the effects of celecoxib on signaling pathways may be species or cell-type specific.

Activation of JNK1, a stress-activated protein kinase, is associated with hepatic triglyceride accumulation and insulin resistance in rats fed a high fat diet (283). Furthermore,

JNK1 knockout mice are resistant to the obesity induced by a high fat diet and have improved insulin sensitivity (273). Therefore, we measured the levels of both JNK1 and pJNKl to explore the possibility that the effects of celecoxib in lipid metabolism are mediated by this 52

kinase. In both our in vivo and in vitro studies, celecoxib significantly decreased the levels of

JNK1 and pJNKl. Furthermore, down-regulation of JNK1 occurred prior to inhibition of FAS

expression in celecoxib-treated rat hepatocytes. To determine whether the down-regulation of

JNK1 is causally related to the suppression of FAS expression, we treated rat hepatocytes with

a known JNK inhibitor. This inhibitor significantly decreased the expression of FAS. These

observations demonstrate that JNK1 is directly involved in the regulation of FAS by celecoxib.

In a similar manner, celecoxib has been reported to decrease endothelial tissue factor

expression in human aortic endothelial cells by down-regulating the activation of JNK 1 without

affecting levels of pp38 or pErkl/2 (296). The molecular mechanism by which celecoxib regulates FAS expression via JNK1 signaling needs further investigation.

In summary, we have demonstrated that celecoxib reduces fat accumulation in rats fed a high fat diet by decreasing FAS expression via down-regulation of JNK1. Since JNK1 is

involved in the development of inflammation (297), obesity, insulin resistance (273, 298) and

cancer (299), as well as in maintaining normal cardiovascular (300) and neural function (301),

our observations may contribute to understanding why celecoxib has a variety of biological

effects, including the recent finding of an increased cardiovascular risk caused by this drug

(302, 303). CHAPTER THREE

COX-2 Over-expression Causes Partial Transformation in MCF-10F Human

Breast Epithelial Cells

Suying Lu, Guo Yu, Yonghong Zhu and Michael C. Archer

(A version of: Int J Cancer 116:847-852, 2005)

53 54

3.1 Abstract

COX-2 plays an important role in breast cancer development. Deregulation of tissue homeostasis promotes mammary tumorigenesis. To investigate whether COX-2 exerts its effect by affecting homeostasis of breast epithelial cells, we stably transfected MCF-10F human breast epithelial cells with an expression vector containing human COX-2 cDNA oriented in the sense (10F-S) or antisense (10F-AS) direction. As expected, 10F-S cells expressed elevated levels of COX-2 protein, whereas this protein was undetectable in the 10F-AS cells.

Prostaglandin E2 production in these cells reflected COX-2 levels. The 10F-S cells had a significantly decreased rate of proliferation compared to 10F-AS or parental cells, and a delay in progression through the Gl phase of the cell cycle. COX-2 over-expression also caused resistance to detachment-induced apoptosis (anoikis) as well as an inhibition of differentiation in cells cultured in Matrigel. Furthermore, after ~ 20 passages in culture, 10F-S cells developed fibroblast-like features, expressed vimentin, and formed foci of dense growth when cultured at confluence, suggesting that the cells were undergoing epithelial to mesenchymal transition

(EMT). The 10F-S cells, however, were unable to grow in soft agar or form tumors in nude mice, suggesting that they were only partially transformed. Our observations suggest that COX-

2 over-expression in human breast epithelial cells will predispose the mammary gland to carcinogenesis.

3.2 Introduction

Over-expression of COX-2 is a general feature of neoplasms of epithelial origin including breast cancer (111). Interestingly, a recent study has shown that in human breast tissue, COX-2 is concordantly expressed in DCIS, invasive cancer and paired normal breast 55 epithelium (304), suggesting the possibility that COX-2 expression in normal breast tissue could be an early event during carcinogenesis and precede the changes in DCIS and invasive breast tumors. Indeed, a transgenic mouse study showing that over-expression of COX-2 in mammary epithelial cells induces spontaneous mammary tumors (88), suggests that COX-2 acts as an oncogene. In that study, however, mammary tumors only developed in mice that had been pregnant several times. Precocious development of the mammary glands, not mammary tumors, occurred in virgin animals (88). As suggested by the authors, the relatively low level of

COX-2 expression in the virgin mice compared to the much higher level of expression in the multiparous mice during pregnancy and lactation, may explain these differences. It is not clear, however, whether COX-2 over-expression causes any phenotypic changes in normal mammary epithelial cells or whether COX-2 over-expression itself is sufficient to induce malignant transformation. Indeed, Liu et al. speculate that a second mutation may be necessary for complete transformation of the mammary epithelium (88).

In the present study, we have stably over-expressed COX-2 in MCF-10F cells. These cells were established from normal human breast tissue and do not grow in soft agar and are not tumorigenic in nude mice. They provide a valuable tool with which to investigate differentiation, immortalization and carcinogenesis in a non-neoplastic breast epithelial system

(305). The susceptibility of the mammary gland to tumorigenesis is influenced by its tissue homeostasis that is maintained by a sound balance in cell proliferation, apoptosis and differentiation (151). Our objective was to determine whether COX-2 over-expression causes any changes in these parameters in MCF-10F cells that may predispose them to malignant transformation. Furthermore, we sought to determine whether over-expression of COX-2 is itself sufficient to cause malignant transformation. 56

3.3 Materials and methods

Cell line. MCF-10F cells from the American Type Culture Collection (ATCC,

Rockville) were grown in a 1:1 mixture of Dulbecco's modified Eagle's medium (DMEM) and

Ham's F12 medium with 20 ng/ml epidermal growth factor, 100 ng/ml cholera toxin, 0.01

mg/ml insulin, 500 ng/ml hydrocortisone and 5% chelexed horse serum (306). MCF-7 human breast cancer cells were obtained from ATTC (cultured in DMEM/F12 1:1 with 10% FBS) and

HCA-7 human colon cancer cells (cultured in DMEM with 5% FBS) were generously provided by Dr Susan Kirkland (Imperial College School of Medicine, London, UK).

Transfection. Human COX-2 cDNA, generously provided by Dr Stephen M. Prescott

(University of Utah, Salt Lake City, UT) (307), was cloned into the eukaryotic expression vector pIRES2-EGFP (CloneTech, Palo Alto, CA) in both sense and antisense orientations that were confirmed by digestion with restriction enzymes and the vectors were transfected into

MCF-10F cells with selection in medium containing 1.5 mg/ml of G418. Cells transfected with the sense vector were designated 10F-S, those transfected with the antisense vector 10F-AS,

and the parental cells 10F-P.

COX-2 protein expression and PGE2 measurements. 10F-P, 10F-S and 10F-AS cells were cultured to 70-80% confluence. The cells were harvested and lysed in RIPA buffer (PBS containing l%NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 100 ng/ml PMSF, 66 ng/ml aprotinin). Samples containing 50 ug protein were separated on 12% SDS-polyacrylamide gels.

COX-2 was detected by using a rabbit polyclonal antibody (Cedarlane Laboratories Limited,

Hoenby, ON, Canada). Culture medium was analysed for PGE2 by an ELISA kit (Cedarlane

Laboratories Limited) and levels normalized to cell protein. 57

Cell proliferation. 10F-P, 10F-S and 10F-AS cells were seeded at an initial density of 5

x 104 cells per well in 24-well plates and cultured for 4 days. After removal of the medium,

cells were washed once in PBS, fixed in 100% methanol for 10 min, stained with 0.5% crystal

violet in 20% methanol for 10 min, and washed with tap water (162). After air-drying, the

stained cells were solubilized in 1% SDS. Absorbance of the retained crystal violet was

determined at 595nm. The cell density is reported as the ratio of cells at different time points to

cells at day zero expressed as a percentage (162).

Cell cycle and cyclin A, Dl and E measurements. 10F-P, 10F-S and 10F-AS cells were

grown to 70% confluence on 10 cm plates. Some plates were used for protein isolation, while

others were used for FACS analysis. Cells were washed with PBS, trypsinized, fixed with 70%)

ethanol, and stored at -20 °C prior to staining for 30 min at room temperature with propidium

iodide (20 ug/ml) in PBS containing 0.1% Triton X-100 and 0.2 mg/ml DNase-free RNase A

and analyzed on a FACSCalibur flow cytometer (Becton and Dickenson, Franklin Lakes, NJ).

For cyclin analysis, proteins from whole cell lysates were separated on 10% SDS- polyacrylamide gels. Cyclin A, Dl and E levels were determined using rabbit anti-human

cyclin A, Dl and E (catalog # 06-138, 06-137 and 06-459, Upstate Biotechnology, Lake Placid,

NY).

Apoptosis and Bcl-2, Bcl-Xi, Box and Bak measurements. To assess detachment-

induced apoptosis (anoikis), cells were seeded at a density of 105 cells/ml in 6-well poly(2- hydroxyethyl methacrylate) (HEMA)-coated dishes (308), then harvested after 24 and 48 h.

Apoptosis was quantified using a TUNEL-based Apoptosis Detection kit (catalog # TA5354,

R&D Systems, Inc., Minneapolis, MN) according to the manufacturer's protocol. For Bcl-2,

BC1-XL, Bax and Bak measurements, proteins from whole cell lysates were separated on 13% 58

SDS-polyacrylamide gels and probed with rabbit polyclonal anti-Bcl-2 or rabbit polyclonal anti-Bcl-Xs/L (catalog # sc-492 and sc-1041, Santa Cruz Biotechnology, Santa Cruz, CA), rabbit polyclonal anti-Bax, or rabbit polyclonal anti-Bak (catalog # 06-499 and 06-536, Upstate

Biotechnology).

Cell differentiation in Matrigel. Six-well culture plates were coated with 1 ml/well BD

Matrigel Matrix (catalog # BD 354234, BD Biosciences, Mississauga, ON, Canada) as supplied by the manufacturer, and incubated overnight at 37 °C. Cells were suspended in complete medium and seeded at a density of 1 x 10 per well and incubated at 37 °C for 24-72 h, after which time morphology was assessed by light microscopy (309, 310).

Cell transformation assays. Cells were passaged until there were obvious morphological changes. At this time, proteins from whole cell lysates were separated on 10%

SDS-polyacrylamide gels and probed with mouse monoclonal anti-E-cadherin (catalog #13-

5700, Zymed Laboratories Inc., San Francisco, CA), mouse monoclonal anti-keratin (catalog #

MS-343-P, Lab Vision Corporation, Fremont, CA) or mouse monoclonal anti-vimentin (catalog

# MS-129-P, Lab Vision Corporation). At this stage, some cells were maintained at confluence to observe focus formation. Anchorage-independent growth was assessed by measuring growth in soft agar. Briefly, ~ 5x10 cells were suspended in 2 ml of 0.3% (w/v) agarose dissolved in culture medium and poured onto a bed of 0.5% agarose in 6-well plates. Colony formation was followed for 4 weeks (311). MCF-7 cells were used as a positive control. Tumorigenicity was assessed in nude mice. Under anesthesia, a 1.7-mg, 60-day release 17p-estradiol pellet (catalog

# SE-121, Innovative Research of America, Sarasota, FL) was implanted into the interscapular region of 8 week-old nude mice (CDl-Nu/Nu, Charles River Laboratories, St Constant,

Quebec, Canada) (5 mice/group). At the same time, ~ 106 (100 ul) cells were injected into the 59 mammary fat pad (312). After 8 weeks, mice were sacrificed and the tumor growth was assessed. MCF-7 human breast cancer cells were used as a positive control.

Statistical analyses. All data were expressed as means ± SEM. Differences between groups were analyzed by one-way ANOVA.

3.4 Results

Preparation of human breast epithelial cells (MCF-10F) that constitutively over- express COX-2. COX-2 is expressed at a low level in MCF-10F human breast epithelial cells

(313). To examine the effect of COX-2 expression in these cells, they were transfected with the eukaryotic expression vector pIRES2-EGFP containing human COX-2 cDNA in the sense

(10F-S) or antisense (10F-AS) orientations. This vector leads to stable gene expression. Five clones of 10F-S and 10F-AS cells were prepared that had similar properties and the results from one representative clone are presented here. To evaluate relative COX-2 expression levels in the clones, we performed Western blot analysis as well as COX assays. HCA-7 colon cancer cells that are known to over-express COX-2 (314) were used as a positive control. As shown in

Figure 3.1 A, the 69 kDa COX-2 protein was expressed at a high level in both the HCA-7 and

10F-S cells, to a small extent in the parental cells (10F-P), but was absent in the 10F-AS cells.

Similar results were obtained in early- as well as late- (~ 20) passage cells. PGE2 production in

10F-S, 10F-P and 10F-AS cells reflected the COX-2 levels (Figure 3.IB).

COX-2 over-expression causes decreased cell proliferation and cell cycle arrest. Since

COX-2 is induced by growth factors and tumor promoters, we initially hypothesized that the stable expression of COX-2 might promote cell growth. It is clear from Figure 3.2A, however, 60

HCA-7 10F-P 10F-AS 10F-S

B 20

3 P 15

O |> 10- 3)

CM LU 5H O Q.

HCA-7 10F-P 10F-AS 10F-S

Figure 3.1. COX-2 expression and PGE2 levels. (A) Western blot analysis for COX-2 expression. Cells at 70-80% confluence were harvested and lysed in RIPA buffer. Equal loading was confirmed by staining the membrane with coomassie brilliant blue R250. (B) PGE2 measurement. PGE2 levels were measured in culture media by ELISA. HCA-7 colon cancer cells were used as positive control. Values are mean ± SEM (n = 3; * PO.01 vs. 10F-AS or 10F-P). The higher level of PGE2 in 10F-S compared to HCA-7 cells was possibly due to COX-1 activity. 61 that COX-2 over-expression decreased the proliferative rate of 10F-S cells compared to 10F-P or 10F-AS cells that had similar growth rates. As shown in Figure 3.2B, 10F-S cells had a significantly higher percentage of cells in Gl phase and a significantly lower percentage of cells in S phase compared to parental line or 10F-AS cells. Furthermore, 10F-S cells expressed a lower level of cyclin E than 10F-P and 10F-AS cells, but there were no differences in cyclins

AorDl(Figure3.2C).

COX-2 over-expression alters susceptibility to apoptosis. To determine whether expression of COX-2 in MCF-10F cells promotes resistance to detachment-induced apoptosis

(anoikis), we cultured the clones in polyHEMA-coated plates, a procedure that is known to induce anoikis in normal epithelial cells (315). 10F-S cells were less susceptible to anoikis than

10F-AS or 10F-P cells, although this difference was not significant until 48 h (Figure 3.3A).

We showed, furthermore, that 10F-S cells expressed somewhat higher levels of Bcl-2 and Bcl-

XL at both 24 and 48 h. At 24 h, 10F-AS and 10F-S cells expressed higher levels of Bax than

10F-P cells, whereas, at 48 h, 10F-S cells clearly expressed higher levels than the other two cell lines. Levels of Bak were similar among the three cell lines at both time points (Figure 3.3B).

COX-2 over-expression inhibits differentiation. It is well established that the extracellular matrix is required for normal differentiation of mammary epithelial cells (316).

Therefore, to investigate the effect of COX-2 expression on differentiation, we cultured the cells on Matrigel-coated plates, a method that has been used by other investigators to study epithelial differentiation (309, 310). Under these conditions, 10F-P and 10F-AS cells aggregated to form smooth spheroids (Figure 3.4A), structures previously observed to form from well differentiated mammary epithelial cells (309, 310). 10F-S cells, however, formed 62

I3UU- 10F-P 1600- T

**•* —-10F-AS / —— 10F-S / aws 1300- / ,A wt h 2 iooo- OJ jt' •*• /f 0) */*/ O 700- /'/ '-'V 400- ,,*^>^ ^ * ''^y^~~ ~~ *~ 100- ^ 1 1 1 1 1

Days

sP 120 10F-AS 10F-P 10F-S

.. - *wv,- • - «*••••*£* "g*- •' f Cycl i n A

Cyclin D1

Cyclin E

10F-P 10F-S 10F-AS

Figure 3.2. Effect of COX-2 expression on cell growth, cell cycle progression and expression of cyclins A, Dl and E. (A) Cell growth. 5 X 104 cells/well were seeded in 24-well plates, and cultured for 4 days. The number of cells was assessed daily using crystal violet (n = 4). (B) Cell cycle progression. Cells at 70% confluence were grown in serum- and growth factor-free medium for 24 hours, then provided with complete media. At different time points, cells were stained with propidium iodide, and analyzed on a FACSCalibur flow cytometer (n = 3). (C) Expression levels of cyclins A, Dl and E. The total cell lysates from (B) were separated on 12% SDS- polyacrylamide gels. Equal loading was confirmed by staining the membrane with coomassie brilliant blue R250. 63

24h 48h

B 24h 48h

AS AS S

Bcl-2

Bcl-XT

^ MSK*»»*«»* Bak

^"^g^***** %^hsaiak Bax

Figure 3.3. Effect of COX-2 expression on apoptosis in mammary epithelial cells and expression levels of Bcl-2, BC1-XL and Bax. (A) Apoptosis. 1.7 x 105 cells were cultured in poly(2-hydroxyethyl methacrylate) (HEMA)- coated plates for indicated times. Apoptosis was assessed by a TUNEL-based apoptosis detection kit ELISA. (B) Expression levels of Bcl-2, BC1-XL and Bax. The total cell lysate samples from (A) were separated on 13% SDS-polyacrylamide gels. Equal loading was confirmed by staining the membrane with coomassie brilliant blue R250. Values are mean ± SEM (n = 3; * PO.01 vs. 10F-AS or 10F-P), and are representative of 3 independent experiments. 64 irregular 3-dimensional structures with many fibroblast-like cells showing invasion into the

Matrigel (Figure 3.4B), suggesting differentiation of these cells was inhibited.

COX-2 over-expression causes partial transformation. To determine whether over- expression of COX-2 would eventually lead to neoplastic transformation, we passaged cells many times. After about 20 passages, some of the 10F-S cells developed long projections and they began to show the loss of contact inhibition (Figure 3.5A). In contrast, throughout the culture period, 10F-P (Figure 3.5A) and 10F-AS cells (not shown) consisted of uniformly well flattened, polyhedral cells that grew in monolayers, though individual cells varied somewhat in size and shape. Furthermore, unlike 10F-P and 10F-AS cells that only expressed the epithelial markers E-cadherin and keratin, after 20 passages 10F-S cells also expressed the fibroblastoid marker vimentin (Figure 3.5B). When cells that had been passaged 20 times were maintained at confluence for 5 weeks, 10F-S cells formed 12-17 foci of dense growth per plate (Figs. 3.5 C and D), whereas 10F-P cells formed only 0-3 foci per plate and 10F-AS cells formed no foci

(Figure 3.5D). Cells from the foci, however, neither grew in soft agar, nor formed tumors in nude mice. MCF-7 human breast cancer cells were used as a positive control for these experiments.

3.5 Discussion

Like most other tissues, mammary gland homeostasis is maintained by a dynamic balance of cell proliferation, apoptosis and differentiation, but particularly large changes in these parameters occur during gland development at puberty and during pregnancy, lactation and involution (151). Factors that disturb this balance may influence the susceptibility of the mammary gland to tumorigenesis. In the present study, we have shown that a number of 65

Figure 3.4. Effect of COX-2 expression on differentiation of mammary epithelial cells in Matrigel. 106 cells were cultured in Matrigel-coated 6-well plates for 24-72 hours. (A) 10F-P cells. Cells aggregated to form smooth spheroids. (B) 10F-S cells. Cells formed irregular 3-dimensional structures with fibroblast-like cells showing invasion into the Matrigel. 66

10F-S 10F-P

B 10F-AS 10F-P 10F-S E-Cadherin

•?5%#i^-' Keratin

Vimentin

10F-AS 10F-P 10F-S

Figure 3.5. Effect of COX-2 expression on cell transformation. (A) Cell morphology. After 20 passages, 10F-S cells developed long projections overlapping with other cells whereas 10F-P cells consisted of uniformly well flattened, polyhedral cells that grew in monolayers. (B) Expression levels of E-cadherin, keratin and vimentin. Equal loading was confirmed by staining the membrane with coomassie brilliant blue R250. (C) Focus formed from 10F-S cells maintained at confluence for 5 weeks. (D) Quantification of foci. Cells were cultured as described in (C) in 10 cm plates (n=5). 67 phenotypic changes occur in human breast epithelial cells over-expressing COX-2 that may be

associated with an increased susceptibility of these cells to transformation.

We have demonstrated that over-expression of COX-2 in MCF-10F human breast

epithelial cells leads to decreased cell proliferation and a delay in progression through the Gl phase of the cell cycle. In breast cancer cell lines, COX-2 stimulates cell proliferation through

EP4 or EP1/EP2 signaling (133, 134). Indeed, in mammary tumors from MMTV/COX-2 transgenic mice, expression of EP1, EP2 and EP4 is increased while expression of EP3, which

negatively regulates cell proliferation (317), is decreased compared to normal mammary tissue

(130). In our study, it is possible that MCF-10F cells express high levels of EP3, but low levels

of EP1, EP2 and EP4, leading to a decrease in cell proliferation by COX-2 over-expression.

Similar phenotypes induced by COX-2 over-expression have also been reported in rat intestinal

epithelial cells (318), immortalized endothelial cells, NIH3T3, COS-7, bovine microvascular

endothelial cells, and human embryonic kidney cells (239 cells) (319). The COX-2-induced Gl

arrest in MCF-10F cells was associated with a down-regulation of cyclin E, but no changes in the expression levels of cyclins A or Dl. In rat intestinal epithelial cells, however, Gl delay was associated with down-regulation of cyclin Dl (318). Since cyclins Dl, E and A are

involved in the passage of cells through the restriction point and entry into S phase (320), our results confirm other reports that regulation of cyclins is cell-type specific (321, 322). Gl delay in rat intestinal epithelial cells was shown to be associated with an increased resistance to butyrate-induced apoptosis and thus, to a survival advantage that may play a role in carcinogenesis (152, 318). Therefore, we next examined the effect of COX-2 over-expression on the susceptibility of MCF-10F cells to apoptosis. 68

Apoptosis that is induced by inadequate or inappropriate cell-matrix interactions

(anoikis), is involved in a wide diversity of tissue-homeostatic, developmental and oncogenic processes (323). Recent reports have shown that resistance to anoikis contributes significantly to the malignancy of mammary cancers (324). We found that MCF-10F cells over-expressing

COX-2 were more resistant to anoikis than 10F-P or 10F-AS cells. This resistance was associated with higher levels of expression of the anti-apoptotic proteins Bcl-2 and BC1-XL. Up- regulation of Bcl-2 has been found to be associated with resistance to apoptosis in mammary epithelial cells during lactation and involution and in mammary tumors in MMTV-COX-2 transgenic mice (88), as well as in rat intestinal cells that over-express COX-2 (152). We found no differences, however, in the expression of the pro-apoptotic protein Bak among the 10F-S,

10F-AS and 10F-P cells and, surprisingly, higher levels of pro-apoptotic Bax were present in

10F-S cells compared to the 10F-AS and 10F-P cells. These results suggest that neither Bak nor

Bax play a direct role in conferring resistance to anoikis in the breast epithelial cells over- expressing COX-2. Our observations suggest that resistance to apoptosis in human breast epithelial cells over-expressing COX-2 may be conferred by anti-apoptotic Bcl-2 and BC1-XL.

Interestingly, in MCFIOA human breast epithelial cells, over-expression of Bcl-2 known to be involved in regulating anoikis (325) increases the expression of matrix metalloproteinase inhibitor-1 (TIMP-1), which leads to constitutive activation of focal adhesion kinase, a signaling molecule known to be critical for the cell survival pathway (326).

Differentiation, together with proliferation and apoptosis, tightly regulates mammary gland development and remodeling (327). In the present study, we have demonstrated that over-expression of COX-2 in MCF-10F cells leads to the inhibition of differentiation when cells are cultured in matrigel. Similar inhibition of differentiation was seen in rat intestinal 69 epithelial cells that over-expressed COX-2 (152). It is well known in rodent models that pregnancy and age-related mammary gland differentiation are associated with resistance to mammary carcinogenesis (328). Indeed, susceptibility to mammary carcinogenesis has recently been related to the extent of morphological differentiation of the gland and the expression of genes involved in differentiation (329). Our observations, therefore, suggest that COX-2- induced inhibition of the differentiation of human breast epithelial cells will increase the susceptibility of the breast to carcinogenesis. Our observations also help to explain, from another point of view, why mammary tumors only occur in MMTV-COX-2 transgenic mice after multiple pregnancies (88). Liu et al (88) suggested that mammary tumorigenesis in these mice is mainly related to the resistance of their mammary epithelial cells to apoptosis. Our results suggest that an inhibition of differentiation during pregnancy and lactation in these cells may also contribute to mammary tumorigenesis.

We reasoned that the alterations in proliferation, apoptosis and differentiation induced by COX-2 may predispose the breast epithelial cells to malignant transformation. After ~ 20 passages in culture, the 10F-AS and 10F-P cells showed no morphological changes. After the same number of passages, however, the MCF-10F-S cells showed fibroblast-like features and formed foci of dense growth when cultured at confluence. Furthermore, at this time, all 3 cell lines expressed the epithelial markers E-cadherin and keratin, but only 10F-S cells also expressed vimentin, a fibroblastoid marker. These findings suggest that 10F-S cells were undergoing EMT, a process that characterizes progression towards a malignant phenotype (330,

331). The 10F-S cells, however, were unable to grow in soft agar and did not form tumors in nude mice showing that they are not fully transformed. We have now cultured the 10F-S cells for an additional 10 passages and observed no further changes. Our results suggest that COX-2 70

over-expression in breast epithelial cells induces partial transformation. Phenotypic changes in

mammary epithelial cells expressing the int-\ oncogene similar to those we observed, were also

interpreted as evidence of partial transformation (332). It is possible that suppression of both

growth and apoptosis by COX-2 confers a survival advantage such that repeated passaging of

the cells selects additional genetic/epigenetic changes that lead to EMT.

In sum, we have shown that over-expression of COX-2 in human breast epithelial cells

inhibits proliferation, apoptosis and differentiation. Since these parameters are normally tightly

regulated, COX-2 expression may disrupt homeostasis, thereby predisposing the gland to

carcinogenesis. Furthermore, after many passages in culture, the cells over-expressing COX-2

displayed evidence of partial transformation. During pregnancy, lactation and involution, when

mammary epithelial cells undergo cycles of proliferation, apoptosis and differentiation,

expression of COX-2 may have more profound effects than at other times. This may explain why mammary tumors occur only after multiple pregnancies in MMTV-COX-2 transgenic mice (88). Although a full term pregnancy is normally protective for breast cancer

development (333), our observations suggest that, as in mice, over-expression of COX-2 in the breast epithelium in women during pregnancy may be a risk factor. It is clear that control of

COX-2 levels in the mammary gland at all stages may be important for breast cancer prevention. CHAPTER FOUR

FAS is a Potential Molecular Target for the Chemoprevention of Breast Cancer

Suying Lu and Michael C. Archer

(A version of: Carcinogenesis 26:153-157, 2005)

71 72

4.1 Abstract

The purpose of this investigation was to determine whether FAS is a potential

molecular target for the chemoprevention of breast cancer by evaluating the effect of the FAS

inhibitor triclosan on rat mammary carcinogenesis. At 50 days of age, 60 female Sprague

Dawley rats received 50 mg/kg MNU ip to initiate mammary carcinogenesis. One week later, half of the rats were fed triclosan at a level of 1000 ppm in an AIN-93G diet for the remainder

of the experiment. The other 30 control rats were fed an AIN-93G diet without triclosan.

Twelve weeks after MNU treatment, 70.0% of control rats had mammary adenocarcinomas

compared to only 43.3% of the triclosan group (PO.05). The control rats had an average of 2.7

± 0.3 tumors/rat compared to 1.8 ± 0.3 in the triclosan group (P<0.05). Western analysis

showed that the tumors in the control rats expressed high levels of FAS. Immunohistochemistry

showed that sections of tumors that stained strongly for FAS also showed strong staining for proliferating cell nuclear antigen (PCNA). Furthermore, at pharmacological dose levels, triclosan inhibited the activity of FAS in mammary tumor homogenates. These results indicate that triclosan suppresses rat mammary carcinogenesis by inhibiting FAS and suggest that FAS

is a promising molecular target for breast cancer chemoprevention.

4.2 Introduction

Like many other cancers, breast cancer expresses high levels of FAS, and expression levels often correlate with poor prognosis (226). Inhibition of FAS decreases cell proliferation and induces apoptosis in breast cancer cell lines such that FAS may be a useful target for breast cancer therapy (233). There is a paucity of data regarding the potential of FAS as target for breast cancer prevention. Previous studies from our laboratory showed that the COX-2 inhibitor 73

celecoxib not only inhibits rat mammary carcinogenesis (110), but also down-regulats FAS

expression in liver and visceral adipose tissues (334). Furthermore, immunohistochemistry

staining (our unpublished observations) showed that FAS is highly expressed in intraductal proliferations (IDPs) (putative preneoplastic lesions) of rat mammary glands induced by MNU

in a previous study of our laboratory (335). These results prompted us to investigate the potential of FAS as a molecular target for breast cancer prevention.

Triclosan is a broad spectrum antimicrobial agent because of its ability to inhibit

bacterial FAS (336). It has been safely used in a variety of personal care products for more than

20 years (337). This antibiotic has also been shown to inhibit mammalian and avian FAS

activity by inhibiting enoyl-reductase of the FAS multienzyme complex (162). The objective of the present study was to provide evidence that FAS is a molecular target for the prevention of breast cancer by examining the effects of triclosan on mammary carcinogenesis in rats.

4.3 Materials and methods

Tumor induction protocol Female Sprague Dawley rats (43 days old), purchased from

Charles River Laboratories (St Constant, Quebec, Canada), were housed at 22 ± 2°C, 50% humidity with a 12 h light-dark cycle. Tap water was provided ad libitum throughout the

experiment. The rats were acclimatized for 1 week on an AIN-93G diet. At 50 days of age, they were given a single i.p. injection of 50 mg/kg MNU (Sigma Chemical Co, St Louis, MO)

dissolved in 0.05% acetic acid in normal saline and used within 30 min of preparation. A week

later, the animals were randomized into control and experimental groups (30/group). The control group was maintained on the AIN-93G diet, and the experimental group was fed the

AIN-93G diet supplemented with 1000 ppm triclosan (Protameen Chemicals, Totowa, NJ). 74

Both diets were in the form of pellets. Animals were weighed and palpated for mammary lesions weekly. Moribund animals, those with tumors >20mm in diameter, or those remaining

12 weeks after MNU administration were killed and the lesions dissected. All internal organs were examined at autopsy. Tumors were fixed in 10% formalin, embedded in paraffin, sectioned and processed for histopathological evaluation by hematoxylin and eosin staining.

Western blot analysis. Mammary tumors were homogenized on ice in a glass-glass tissue grinder with PBS containing 10 ug/ml leupeptin, 10 |J.g/ml pepstatin A and 10 |~ig/ml aprotinin. The homogenates were centrifuged at 16,000 x g for 15 min and the supernatants were used for Western analysis. Twenty ug protein were fractioned by 10% SDS-PAGE.

Proteins were transferred onto PVDF membranes (Bio-Rad Laboratories, Inc., Hercules, CA) using a semi-dry blotter (C.B.S. Scientific Co., Del mar, CA). Membranes were blocked with

5% dried nonfat milk in TTBS (10 mM Tris-HCL, pH 8.0, 100 mM NaCl, and 0.05% Tween

20) overnight at 4 °C, then incubated with a mouse monoclonal anti-FAS antibody (BD

Transduction Laboratories, Mississauga, Canada) at 1:250 dilution or a mouse monoclonal anti-

P-actin antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at 1:500 dilution for 2 h at room temperature, followed by incubation with horseradish peroxidase-conjugated goat anti- mouse secondary antibody (Santa Cruz Biotechnology, Inc.) at 1:2000 dilution for 45 min at room temperature.

Immunohistochemical staining for FAS and PCNA. Serial sections (5 um) from paraffin embedded mammary tumors were subjected to heat-induced epitope retrieval followed by exposure to primary antibodies. Detection was with the LSAB2 system (DakoCytomation

Inc., Mississauga, Canada). The anti-FAS antibody was used at 1:100 dilution and the mouse monoclonal antibody against PCNA (DakoCytomation Inc.) was diluted 1:5. The specificity of 75 the staining was ensured by replacing the primary antibody with a negative serum (from the

LSAB2 system). In all cases, no staining was observed.

FAS activity analysis. FAS activity of mammary tumors was measured using a previously described method (278). Briefly, tumors were homogenized on ice in 20 mM Tris-

HC1, pH 7.5 containing 1 mM DTT and 1 mM EDTA using a glass-glass tissue grinder.

Homogenates were centrifuged at 12000 x g for 10 min and the supernatants were used for measuring FAS activity. Thirty ug protein in a volume of 20 ul were added to 125 ju.1 of 100 mM potassium phosphate, pH 7.0, containing 100 mM KC1, 0.5 mM NADPH and 0 - 250 uM triclosan. The reaction mixtures were pre-warmed for 15 min at 37 °C, and reactions were started by the addition of 4.5 ul of a substrate mixture containing 25 nmol of acetyl-CoA, 25 nmol of malonyl-CoA, and 0.05 uCi (5 ul) of [2-14C] malonyl-CoA (NEN Life Sciences

Products, Inc., Boston, MA). Reactions were carried out at 37 °C for 10 min and were stopped by the addition of 1 ml of ice-cold 1 N HCl/methanol (6:4, v/v). Fatty acids were extracted with

1 ml of petroleum ether (Sigma) and incorporation of radioactivity into the fatty acids was assessed by scintillation counting.

Statistical analysis. Tumor incidences were compared using Kaplan-Meier survival analysis. Differences in average numbers of tumors/rat were determined using Mann Whitney test and differences in final body weights and FAS activities were determined using Student's t- tests.

4.4 Results

Tumor incidence and body weights. The effects of 1000 ppm dietary triclosan on the cumulative mammary tumor incidence in Sprague Dawley rats over a period of 12 weeks 76

following administration of 50 mg/kg MNU are shown in Figure 4.1 A. This dose of triclosan

has been demonstrated to be nontoxic after long-term oral administration in Sprague Dawley

rats (337). The drug produced a significant reduction in the final mammary tumor incidence

(43.3% in the triclosan group vs 70.0% in the control group, PO.05) as well as the average

numbers of tumors/rat (1.8 + 0.3 in the triclosan group vs 2.7 ± 0.3 in the control group,

P<0.05). As expected from our own work (338) and that of others (339), histopathological

examination of the tumors by an experienced pathologist (Dr. Alan Medline, Humber River

regional Hospital in Toronto) blinded to the study, showed that they were adenocarcinomas.

Body weights of the two groups began to diverge somewhat 7-8 weeks after MNU

administration (Figure 4.IB). The food intake at that time, however, was not significantly

different in the control (15.2 ± 0.5 gram/rat/day) and triclosan (14.0 + 0.6 gram/rat/day) groups.

However, in order to minimize body weight differences, we began to feed the control rats 10%

less than the amount consumed by the triclosan-treated rats. Thereafter, the difference in body weights between the two groups was always <10% (Figure 4.IB). At autopsy, no gross changes

in any tissues other than the mammary glands were observed.

FAS and PCNA expression in tumors. FAS was abundantly expressed in mammary tumors as shown by Western blot analysis (Figure 4.2A), although the expression levels varied

among the tumors. Immunohistochemical analysis of tumor sections showed that FAS was

localized in the cytoplasm, and its expression showed cellular heterogeneity (Figure 4.2B).

Regions of tumors showing strong staining of FAS also had high levels of PCNA expression

(Figure 4.2B). 77

ou- —•— Control o • «if • Triclosan A^ o 60- e a>

o 40- c o 20- r E 3 0^ • <• t *^KA i . . . 4 6 8 10 12 14 Weeks after MNU B 450 -•— Control B400- • A • • Triclosan £ 350- | 300- •&250- o m 200- 150 4 6 8 10 12 14 Weeks after MNU

Figure 4.1. Cumulative mammary tumor incidence (A) and weekly body weights (B) in rats treated with 50 mg/kg MNU. The triclosan group received 1000 ppm triclosan in the diet beginning 1 week after MNU administration. Kaplan-Meier survival analysis showed that the tumor incidences between the two groups were significantly different (P<0.01). Body weights are expressed as means + SEM. 78

A FAS ^MWiPR^^^^HlP

Figure 4.2. FAS in rat mammary tumors induced by MNU. (A) Expression of FAS in representative mammary tumors from rats treated with MNU and fed the control diet. Equal loading was confirmed using p-actin. (B) Immunohistochemical staining for FAS (1 and 2) and PCNA (3 and 4) in serial sections from a representative mammary tumor from a rat treated with MNU and fed the control diet. Positively staining cells appear red, counter- stained negative cells appear blue. 1, 2, 3 and 4 are 250x magnification. 79

In vitro inhibition of FAS activity. FAS enzyme activity in mammary tumor homogenates from rats fed the control diet showed a dose-dependent inhibition by triclosan

(Figure 4.3).

4.5 Discussion

The purpose of this investigation was to determine whether the FAS inhibitor triclosan inhibits rat mammary carcinogenesis, and thus, whether FAS is a potential molecular target for the chemoprevention of breast cancer. We used a well-established model in which mammary

adenocarcinomas are induced in rats by a single i.p. injection of the direct-acting carcinogen

MNU (340). One thousand ppm triclosan in the diet significantly inhibited tumorigenesis,

leading to a 33% decrease in tumor multiplicity as well as a 38% reduction in tumor incidence.

An unexpected small difference in body weights between the triclosan-treated and control

groups occurred 7-8 weeks after MNU treatment. The food intake at that time, however, was not significantly different in the two groups, suggesting that the difference in body weights may be the metabolic outcome of FAS inhibition as previously reported for another FAS inhibitor,

C75 (341, 342). Throughout the course of the experiment, the difference in body weights of the two groups was kept to <10% by feeding the control rats 10% less than the amount consumed by the triclosan-treated rats. At the termination of the experiment, the body weights of the two groups were not significantly different. A 12% reduction in body weight gain induced by chronic food restriction has been shown to have no effect on mammary tumor occurrence in

Sprague Dawley rats (343). The inhibitory action of triclosan on mammary tumorigenesis, therefore, was unlikely to have been caused by the small differences in body weight that occurred during the course of the experiment. 80

100 150 200 300 Triclosan [JIM]

Figure 4.3. Inhibition by triclosan of FAS activity in mammary tumor homogenates from rats treated with MNU. Rats were fed the control diet. Thirty jag protein from tumor homogenates were incubated with triclosan at indicated concentrations for 15 minutes. FAS activity was assessed by 14C-malonyl CoA incorporation into fatty acids. Values for each dose were repeated 4 times for each of 3 tumors. Data (means + S.E.M.) are shown for one of the tumors. 81

As expected from previous studies (219), Western blot analysis showed that FAS was abundantly expressed in the mammary tumors induced by MNU in rats fed the control diet, although the expression levels varied among the tumors. Previous studies have also demonstrated a link between FAS and cell proliferation. For example, studies of human endometrial carcinomas have shown that regions of tumors displaying the highest FAS expression are those regions with highest cell proliferation as measured by Ki-67 expression

(344). Similar observations have also been reported in colorectal neoplasia (345). In the present study, examination of the expression of both FAS and PCNA in mammary tumors by immunohistochemistry showed that FAS is highly expressed in the regions showing high levels of PCNA expression, suggesting that FAS is also associated with cell proliferation in our model system.

Long-term oral administration of 1000 ppm triclosan in Sprague Dawley rats has previously been shown to lead to blood levels of the drug ranging from 26.3 to 88.6 ppm (90 to

300 uM) (337). When we incubated mammary tumor homogenates from rats fed the control diet with triclosan within this dose range, we observed significant inhibition of FAS activity, suggesting that the enzyme would have been inhibited in vivo in the present tumorigenesis experiment. We also measured FAS activity of mammary tumor homogenates from both control and triclosan-treated animals. Surprisingly, tumors of triclosan-treated rats had higher levels of FAS activity than those of controls (data not shown). This is likely because mammary tumorigenesis in triclosan-treated rats occurred under the selection pressure of FAS inhibition.

Studies have shown that inhibition of FAS in human breast cancer cells leads to decreased cell growth and increased apoptosis. For example, 20 ppm triclosan in the culture medium inhibited the growth and decreased the viability of MCF-7 and SKBr-3 cells (162). Furthermore, 82

subcutaneous xenografts of MCF-7 cells in nude mice treated with the FAS inhibitor C75,

displayed inhibition of fatty acid synthesis, increased levels of apoptosis, and inhibition of tumor growth (346). In distinction to these previous studies using breast cancer cells, however, we have shown here that inhibition of FAS inhibits the development of mammary tumors.

Commensurate with our findings, we have recently shown that, like preneoplastic lesions of the colon and oesophagus (207, 213), putative preneoplastic IDPs induced by MNU in the mammary glands of Wistar-Furth rats also over-express FAS (unpublished observations). Thus, triclosan likely inhibits mammary carcinogenesis by inhibiting FAS expressed in IDPs, thereby

suppressing the progression of these lesions to neoplasia. Our observations also suggest that the down-regulation of FAS we observed following treatment of rats with celecoxib (334) may have contributed to the inhibitory effects of this drug on mammary carcinogenesis we demonstrated previously (110).

In summary, we have shown that administration of the FAS inhibitor triclosan to rats suppresses mammary tumorigenesis. Our observations suggest that FAS is a molecular target for breast cancer chemoprevention. Furthermore, since FAS is over-expressed in many neoplasms, it may also be a useful target for chemoprevention of other common cancers such as colon and prostate. CHAPTER FIVE

Coordinate Regulation of FAS and CDC25A Phosphatase in Human Breast Cancer Cells

by Spl: a Molecular Link Between de novo Lipogenesis and Cell Proliferation

To be submitted

83 84

5.1 Abstract

Cancers express high levels of fatty acid synthase (FAS) from which they derive fatty acids for membrane biosynthesis to sustain cell proliferation. The molecular link between de novo lipogenesis and cell growth, however, has not been elucidated. Transcription factors Spl,

Sp3 and Sp4 are over-expressed in a variety of cancers and regulate gene expression by interacting with GC-rich Spl binding sites. Genes encoding FAS and cell cycle proteins contain

Spl binding sites in their promoters, but whether Sp proteins coordinately regulate fatty acid synthesis and cell growth is not known. CDC25A, a tyrosine and threonine phosphatase, plays a critical role in promoting cell cycle progression by catalyzing the dephosphorylation of cyclin-dependent kinases. Using the estrogen-responsive MCF-7 human breast cancer cell line, we demonstrate by RNA interference that Spl, Sp3 and Sp4 all play a role in regulating

CDC25A expression and proliferation. Among these three Sp proteins, however, only Spl also regulates FAS. Furthermore, mifhramycin, which blocks Spl binding sites, decreased proliferation, inhibited CDC25A and FAS expression, and reduced the binding of Spl to the promoters of these genes as assessed by ChIP assays. Conversely, 17P-estradiol increased proliferation and expression of CDC25A and FAS along with increased binding of Spl to the promoters of the two genes. In addition, we showed that the expression of sterol regulatory element-binding protein- lc (SREBP-lc), the only transcription factor that has been shown to regulate genes of lipogenic enzymes in cancer cells, is also regulated by Spl. Overall, our results demonstrate that Spl coordinately regulates FAS and CDC25A, indicating that this transcription factor is a molecular link between de novo lipogenesis and proliferation in breast cancer cells. 85

5.2 Introduction

Fatty acid synthase (FAS) catalyzes the condensation of acetyl-CoA and malonyl-CoA to yield long chain fatty acids, predominantly palmitate (226). FAS activity or expression levels have been shown to be surrogate markers for the overall activity of cellular de novo fatty acid synthesis (158). Cancers express high levels of FAS from which they derive their fatty acids for the biosynthesis of membrane phospholipids to sustain cell growth (226). Indeed, elevated expression of FAS is often associated with poor prognosis (213, 220, 226, 347-349) and in several human cancers, expression of FAS correlates with expression of the proliferation antigen Ki-67 (344, 350, 351). FAS activity is associated with the growth rate of the human breast cancer cell line SKBR3 (158), and proliferation induced by progestins is accompanied by up-regulation of FAS in MCF-7 human breast cancer cells (228). In xenograft models of breast and ovarian cancers and plural mesothelioma, inhibition of FAS activity suppresses cell proliferation and tumor growth (157, 240, 352). Furthermore, in various cancer cell lines, inhibition of FAS causes cell cycle arrest, indicating that fatty acid synthesis is essential for growth. The molecular link between these two processes, however, has not been elucidated.

Spl, Sp3 and Sp4, members of the Sp/KLF family of transcription factors, are over- expressed in a variety of cancers including breast cancer (353-358), and play an important role in cell growth regulation by modulating the expression of several cell cycle regulatory proteins

(359). Elevated expression of Spl in cancers has been associated with poor prognosis (360,

361). Sp proteins regulate gene expression by binding to 'Spl sites' that include GC-boxes,

CACCC-boxes and basic transcription elements (359). The promoters of genes encoding the enzymes of fatty acid synthesis, ATP-citrate lyase (ACL), acetyl-CoA carboxylase (ACC) and

FAS, are known to contain Spl sites (259-261). Promoter functionality analyses have shown 86 that both Spl and Sp3 are involved in the activation of ACL by glucose in human hepatoma

cells (259), and together with sterol regulatory element-binding protein-1 (SREBP-1), they

activate ACC and FAS promoters in Drosophila SL2 cells (362). Whether Sp transcription

factors play a role in regulating fatty acid synthesis in cancer cells, however, is not known.

CDC25A, a tyrosine and threonine phosphatase and potential human oncogene (363), plays a critical role in promoting cell cycle progression by catalyzing the dephosphorylation of

CDK2-cyclin E, CDK2-cyclin A, and CDKl-cyclin B complexes (364). Down-regulation of

CDC25A leads to the phosphorylation of CDK4 and CDK6 and Gl arrest (365). CDC25A has been shown to play an important role in breast cancer development. About 50% of breast cancers over-express CDC25A and this is associated with poor prognosis (366). MMTV-

CDC25A transgenic mice are susceptible to mammary tumorigenesis (367). Inhibition of

CDC25A with antisense oligonucleotides inhibits S-phase entry in human breast cancer cells

(366). Hemizygous disruption of CDC25A inhibits cellular transformation and mammary tumorigenesis in mice (368). The proximal region of the CDC25A promoter contains several

GC-rich Spl sites (43) and through binding to these sites, Spl has been shown to mediate estrogen-induced CDC25A expression in breast cancer cells (369). Whether Sp3 or Sp4 also regulates the expression of CDC25A, however, has not been investigated.

Using the human breast adenocarcinoma cell line MCF-7 that is estrogen-sensitive and expresses high levels of CDC25A (366) and FAS (230) as an experimental model, here we show that Spl is a molecular link between de novo fatty acid synthesis and cell growth.

5.3 Materials and methods

Cell Culture. MCF-7 cells were obtained from ATCC and maintained in DMEM/F12 medium (Invitrogen Canada Inc., Burlington, Ontario) supplemented with 10% fetal bovine 87 serum (FBS) and 100 units/ml penicillin/streptomycin in a humidified incubator in an atmosphere of 5% C02 at 37°C. At 70% confluence, the cells were treated with 0.025 or 0.05 nM mithramycin (Biomol International L.P., Plymouth Meeting, PA) for 48 or 72 h. Cells were also treated with 0.05 nM mithramycin in the presence of 100 nM 17P-estrodiol (E2) (Sigma-

Aldrich Canada Ltd., Oakville, Ontario) for 48 or 72 h.

siRNA Transfection. MCF-7 cells in DMEM/F12 medium supplemented with 10%

FBS were plated and transfected with 50 nM siRNA duplexes using Lipofectamine™

RNAiMAX (Invitrogen Canada Inc.) according to the manufacturer's protocol for reverse transfection. The siRNA duplexes were: GL2, 5'-CGUACGCGGAAUACUUCGATT and

TTGCAUGCGCCUUAUGAAGCU-5' (370); Spl, 5'-AUCACUCCAUGGAUGAAAUGATT and TTUAGUGAGGUACCUACUUUACU-5' (370); Sp3, 5'-

GCGGCAGGUGGAGCCUUCACUTT and TTCGCCGUCCACCUCGGAAGUGA-5' (371); and Sp4, 5'-GCAGUGACACAUUAGUGAGCTT and TTCGUCACUGUGUAAUCACUCG-

5' (371).

Cell Proliferation and Cell Cycle Analysis. Cell proliferation was measured using crystal violet staining (158). Briefly, cells were washed once with PBS, fixed in 100% methanol for 10 min, stained with 0.5% crystal violet in 20%) methanol for 10 min and washed with water. After air-drying, the stained cells were solubilized in 1% SDS. Absorbance of the retained crystal violet was determined at 595 nm. Proliferation was reported as the ratio of treated cells to control cells expressed as a percentage. For flow cytometry, cells were washed once with PBS, trypsinized, fixed with 70% ethanol, and stored at -20°C prior to staining for

30 min at room temperature with propidium iodide (20 ug/ml) in PBS containing 0.1 % Triton 88

X-100 and 0.2 mg/ml DNase-free RNase A. Cells were analyzed on a FACSCalibur flow

cytometer (Becton-Dickenson, Franklin Lakes, NJ).

Preparation of Whole Cell Extracts and Western Blot Analysis. Cells were washed

with ice-cold phosphate-buffered saline then incubated with cold lysis buffer (50 mM Tris-HCl,

pH 7.5, 1 mM EDTA, ImM EGTA, 0.5 mM Na3V04, 10 mM glycerophosphate, 5 mM NaF, 1

mM phenylmethylsulfonyl fluoride, and 40 ug/ml each of pepstatin A, aprotinin, and leupeptin)

for 30 min, and centrifuged at 16,000 x g for 15 min. Supernatants were stored at -80°C for

Western blot analysis. The proteins from whole cell extracts were separated by 10% SDS-

PAGE, and were transferred onto PVDF membranes (Bio-Rad Laboratories, Inc., Hercules,

CA) using a semi-dry blotter (C.B.S. Scientific Co., Del Mar, CA). Membranes were blocked

with 5% nonfat dried milk in TTBS (10 mM Tris-HCL, pH 8.0, 100 mM NaCl, and 0.05%

Tween 20) for 1 h at room temperature, then incubated overnight at 4°C with one of the

following antibodies: mouse monoclonal anti-human FAS at 1:1000 dilution (BD Transduction

Laboratories, Mississauga, Ontario, Canada); mouse monoclonal anti-human Spl, HSC70 or

CDK4 at 1:500 dilution (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); rabbit polyclonal

anti-human CDC25A, Sp3 or Sp4 at 1:500 dilution (Santa Cruz Biotechnology, Inc.). The

membranes were then incubated with horseradish peroxidase-conjugated goat anti-mouse or

anti-rabbit secondary antibodies (Santa Cruz Biotechnology, Inc.) at 1:5000 dilution for 45 min

at room temperature. Membranes were stripped in 62.5 mM Tris pH 6.7, 100 mM [3-

mercaptoethanol and 2% SDS, for 30 min at 50°C. HSC70 or CDK4 was used as a loading

control. Bands were quantified using a FluorChem digital imager (Alpha Innotech Corp, San

Leandro, CA). 89

Preparation of Total RNA and Semiquantitative RT-PCR Analysis. Total RNA was isolated using TRI REAGNET™ (Sigma-Aldrich Canada Ltd.) according to the manufacturer's protocol. Two ug of total RNA were used to synthesize cDNA with the Superscript First-

Strand Synthesis System for RT-PCR (Invitrogen Canada Inc.) using random hexamers. One ul of cDNA products was used for PCR reactions with the following primer pairs: FAS, 5'-

CAGTGGCTGATACAGCGTGG -3', 5'-GAGCTGTCCAGGTTGACAGC-3'; SREBP-lc, 5'-

GCCATGGATTGCACTTT-3', 5'-CAAGAGAGGAGCTCAATG-3' (249); CDC25A, 5'-

CCTCAAAAGCTGTTGGGATG-3', 5'-TGGCCTCCCTCGTATTCATA-3'. QuantumRNA™

18S Internal Standards were used to adjust for mRNA loading and cDNA synthesis efficiency.

PCR products were resolved on 1% agarose gels.

Chromatin Immunoprecipitation Assay (ChIP). Cells were grown in 15 cm tissue culture plates to about 70% confluence, then treated with 0.05 nM mithrarnycin, 100 nM E2 or a combination of mithrarnycin and E2 for 48 h. Chromatin was isolated according to the manufacture's protocol using a ChlP-IT™ kit (Active Motif, Carlsbad, CA), immunoprecipitated with Spl antibody (Active Motif), and protein-DNA crosslinks were reversed by incubation at 65 °C for 4 h. PCR was performed with the purified DNA using the following primer pairs: FAS, 5'-ACGCTATTTAAACCGCGGCCA-3', 5'-

GCACGAGCATCACCCCACCGG-3'(372); CDC25A, 5'-CTTCTGAGAGCCGATGACCT-

3', 5'-CAGCTCTTACCCAGGCTGTC-3' (369). PCR products were resolved on 2% agarose gels.

Statistical Analysis. All data are expressed as means ± SEM. Differences between groups were analyzed by Student's Mest. 90

5.4 Results

Transfection ofSpl siRNA decreased cell proliferation and suppressed CDC25A and

FAS expression. Previous studies have shown that Spl plays a role in controlling proliferation of breast and pancreatic cancer cells (370, 371). Spl also plays a role in regulating FAS expression in Drosophila SL2 cells (362). To investigate whether Spl is involved in regulating of CDC25A and FAS expression in MCF-7 cells, we inhibited Spl expression by transfecting the cells with Spl siRNA. Seventy two h after transfection, Spl protein expression was

significantly lower than in cells transfected with control (GL2) siRNA (Figure 5.1 A). Cells transfected with Spl siRNA displayed the same morphology as control cells, but grew slower

(Figure 5.IB), and expressed significantly lower levels of both CDC25A and FAS (Figs. 5.1C and D).

Transfection of Sp3 siRNA caused contact inhibition of growth, transfection of Sp4

siRNA decreased proliferation, and both Sp3 and Sp4 siRNAs suppressed CDC25A expression but did not affect FAS expression. Sp3 and Sp4 have been shown to play an important role in regulating proliferation of pancreatic and prostate cancer cells (371, 373). Sp3 together with

SREBP-1 activates FAS expression in Drosophila SL2 cells (362). To investigate whether these transcription factors play a role in regulating CDC25A and FAS expression in MCF-7 cells, we transfected the cells with Sp3 or Sp4 siRNAs. Seventy two hours after transfection, expression of the Sp3 and Sp4 proteins was significantly lower than in cells transfected with control siRNA (Figs. 5.2A and 5.3A). At this time point, cells transfected with Sp3 siRNA grew as a monolayer, whereas, as expected, control cells grew in multiple layers. At 120 h, transfected cells displayed contact inhibition of growth and there were about 30% fewer cells compared to the controls (Figure 5.2B). Furthermore, the majority of transfected cells were in Gl phase, 91 while control cells progressed normally through the cell cycle (Figure 5.2C). The cells transfected with Sp4 siRNA grew in multiple layers like the control cells, although their growth rate was somewhat slower than controls (Figure 5.3B). Compared to cells transfected with

control siRNA, cells transfected with Sp3 or Sp4 siRNA expressed significantly lower levels of

CDC25A, but similar levels of FAS (Figs. 5.2D and E, 5.3C and D).

Mithramycin inhibited cell proliferation, suppressed CDC25A and FAS expression and decreased Spl binding to CDC25A and FAS promoters. The results described above

showed that Spl siRNA, but not Sp3 or Sp4 siRNAs, led to a down-regulation of both

CDC25A and FAS expression. Next we used ChIP to investigate whether this effect was

associated with a decrease in Spl binding to the promoters of these two genes. Since the 50% knockdown efficiency of Spl protein expression by Spl siRNA may have limited the

sensitivity of the ChIP assays, we treated cells with mithramycin, an antibiotic that is known to block GC-rich motifs (258) and has been shown to suppress Spl functions in MCF-7 cells

(374). Compared to untreated controls, cells treated with mithramycin grew slower (Figure

5.4A) and expressed significantly lower levels of CDC25A and FAS (Figs. 5.4B and C).

Promoter functionality analyses have shown that Spl stimulates the expression of CDC25A and

FAS by binding to the GC-rich DNA sequences in their promoters (362, 369). To investigate whether the down-regulation of CDC25A and FAS expression by mithramycin was mediated through a decrease in Spl binding to the promoters of these two genes, we performed ChIP assays. Figure 5.4D shows that Spl binding to both promoters was, indeed, lower in mythramycin-treated cells compared to controls.

Induction of FAS expression by estrogen is mediated by Spl. Since 17P-estradiol (E2)

is known to induce expression of both CDC25A and FAS (228, 369), and Spl mediates the 92

A _ B P 120- p 120- oc 8 90H u 90- n . o 60H d) 60- re D> re c 30- *-» c 30- o a> o Q. • 0. Control Sp1 siRNA Control Sp1 siRNA Sp1 3 HSC70!

C o 120- P 120 c o o o 90- u 90 * * o 60- V 60 O) O) re +•» c 30- re 30 a> +J u c i_ a> a> o a. ^ Control Sp1 siRNA a> :flControl Sp1l siRNA Q. FAS ! CDC25A HSC70 HSC70!

D op 120 P 120- c o ! 90- o 90H * 4- o 60- 0) 60 U) re re c c 0) 30- 0) 30 u o 0) a> a. 0 a. Control Sp1 siRNA Control Sp1 siRNA FAS CDC25A 18S *' v'!,s 5 18S

Figure 5.1. Effects of Spl siRNA transfection on Spl protein levels, proliferation and expression of FAS and CDC25A in MCF-7 cells. Cells at 70% confluence were transfected with 50 nM Spl or control siRNAs for 72 h. (A) Spl protein levels. (B) Cell proliferation. Cell growth was assessed using crystal violet staining. (C) Protein levels of FAS and CDC25A. (D) mRNA levels of FAS and CDC25A. Bands were quantified using a FluorChem digital imager. Results are expressed as means ± SEM (n=3; * PO.Ol versus controls). 93

" e 120 D e. 120- I 120- 90' 90 8 90- 60' 60H S 60- * O) 30 30 (0 1 30- I 0 0 a Control Sp3siRNA I aControl Sp3siRN A S. 0- Controul Sp3 siRNA Sp3 | FAS I CDC25A HSC70] HSC70! HSC70 B 12 I 150 120 o °" 120 X, ^, I 1 90 90H B 90H O I 60 1 CD S 60-^ 30H D) 60H (S | 30-| 4-* 0 c 30H £ 0 Control Sp3 siRNA ControUl Sp3 siRNA 0) 0) Q. FAS 72 h 120 h 72h 120h Control Sp3 siRNA 18S

G1 G1

S G2/M S G2/M 20% 14% 7% 8% 1 1

Control Sp3 siRNA

Figure 5.2. Effects of Sp3 siRNA transfection on Sp3 protein levels, proliferation, cell cycle progression and expression of FAS and CDC25A in MCF-7 cells. Cells at 70% confluence were transfected with 50 nM Sp3 or control siRNAs for 72 h (A and B) or 120 h (B, C, D and E). (A) Sp3 protein levels. (B) Cell proliferation. Cell growth was assessed using crystal violet staining. (C) Cell cycle progression. Cells at confluence were stained with propidium iodide and analyzed by flow cytometry. (D) Protein levels of FAS and CDC25A. (E) mRNA levels of FAS and CDC25A. Bands were quantified using a FluorChem digital imager. Results are expressed as means ± SEM (n=3; * P<0.01 versus control). B ,20 120- 1 1 c o 90- * u "5 oS 60- I • i

0 1SU" 120- 1 120- 90- o "5 90- 6 | 60- & °- 30- g 30- Q) °- n- I 0- Contro Sp14 siRNA Contro1l WSp4 siRNA FAS CDC25A HSC70 HSC70

0 1SU" o 120- 1 120- o 8 90- "5 90- * 0) G) 60- ID J 60- d> 30- | 30-

S 0- Contro Sp14 siRNA Control Sp4 siRNA FAS CDC25A 9* .-**« 18S 18S

Figure 5.3. Effects of Sp4 siRNA transfection on Sp4 protein levels, proliferation and expression of FAS and CDC25A in MCF-7 cells. Cells at 70% confluence were transfected with 50 nM Sp4 or control siRNAs for 72 h. (A) Sp4 protein levels. (B) Cell proliferation. Cell growth was assessed using crystal violet staining. (C) Protein levels of FAS and CDC25A. (D) mRNA levels of FAS and CDC25A. Bands were quantified using a FluorChem digital imager. Results are expressed as means ± SEM (n=3; * P<0.01 versus controls). 95

A _ 120 •5 120

8 R 3U90-' o O 60- Bta a c c V 30- • * a 0) fl> 0- Q. nil 111 0 0.025 0.05 0 0.025 0.05 0 0.025 0.05 [Mithramycin], nM [Mithramycin], nM [Mithramycin], nM

FAS CDC25A) cdk4 cdk4

g 120- o 12° I 90- 90-

60 0) 60- & " TO B | 30H i 30 0) i* V o. Q. 0 ControUl Mithramycin Control Mithramycin CDC25A 18S 18S

10% input lp: IgG lp: Sp1

Figure 5.4. Effects of mithramycin on proliferation, expression of FAS and CDC25A and binding of Spl to FAS and CDC25A promoters in MCF-7 cells. Cells at 70% confluence were treated with 0.025 or 0.05 nM mithramycin for 48 h (D) or 72 h (A, B and C). (A) Cell proliferation. Cell growth was assessed using crystal violet staining. (B) Protein levels of FAS and CDC25A. (C) mRNA levels of FAS and CDC25A. Cells were treated with 0.05 nM mithramycin for 72 h. (D) ChIP assay. Cells were treated with either PBS (C) or mithramycin (M). Chromatin fragments from these cells were subjected to immunoprecipitation (lp) with Spl antibody or control IgG. The binding of Spl to FAS and CDC25A promoters was assessed using a ChlP-IT™ kit. Bands were quantified using a FluorChem digital imager. Results are expressed as means ± SEM (n=3; ** P<0.05, * PO.01 versus controls). 96 induction of CDC25A (228, 369), we next investigated whether the induction of FAS by estrogen is also mediated by Spl. Compared to untreated controls, cells treated with E2 grew faster (Figure 5.5A), expressed higher levels of CDC25A and FAS (Figs. 5.5B and C), and had significantly higher levels of Spl binding to the promoters of CDC25A and FAS (Figure 5.5D).

Transfection of Spl siRNA or treatment with mithramycin decreased SREBP-lc expression. Since SREBP-lc is known to mediate oncogene-induced expression of FAS in breast cancer cells (249) and since the promoter of SREBP-lc contains Spl binding sites (375), we investigated whether Sp transcription factors regulate SREBP-lc expression. Compared to cells transfected with control siRNA, cells transfected with Spl siRNA, but not Sp3 or Sp4 siRNAs, expressed significantly lower levels of SREBP-lc mRNA (Figure 5.6A). The cells treated with mithramycin also expressed lower levels of SREBP-lc than the control cells

(Figure 5.6B). Since androgens induce SREBP-lc and FAS expression in prostate cancer cells

(278), and activation of ERa stimulates FAS expression in breast cancer cells (228, 369), we investigated whether E2 also increases SREBP-lc expression in MCF-7 cells. The levels of

SREBP-lc mRNA, however, were not affected by E2 treatment (Figure 5.6C). We could not perform Western analyses for SREBP-lc in these experiments because an antibody specific for the SREBP-lc isoform was not available.

5.5 Discussion

In the present study, using both RNA interference and pharmacological approaches to knockdown the functions of Sp transcription factors, we investigated whether Spl, Sp3 or Sp4, are involved in the regulation of both FAS and CDC25A in the estrogen-sensitive MCF-7 97

A _ 200' B _ 200- •K 300' £ 160- c 240 o 160' o o o o "5 120' •S 120- "8 180' o> 0) ? 80- £ 80. |120- 40- 40- | 60' i 0' Q. 0- o- n. Control Control Control

FAS CDC25A

HSC70 HSC70

o SOD o 200- 'S 250- 160- £ 200- 120- 15 S, °" 0) ff 80- | 100- 40- y 50- i 0- Control Control FAS CDC25A 18S 18S

10% input lp: IgG Ip: Sp1

Figure 5.5. Effects of estrogen on proliferation, expression of FAS and CDC25A and binding of Spl to FAS and CDC25A promoters in MCF-7 cells. Cells at 70% confluence were treated with 100 nM E2 for 48 h (D) or 72 h (A, B and C). (A) Cell proliferation. Cell growth was assessed using crystal violet staining. (B) Protein levels of FAS and CDC25A. (C) mRNA levels of FAS and CDC25A. (D) ChIP assay. Cells were treated with the vehicle DMSO (C), or E2. Chromatin fragments from these cells were subjected to immunoprecipitation (Ip) with Spl antibody or control IgG. The binding of Spl to FAS and CDC25A promoters was assessed using a ChlP-IT™ kit. Bands were quantified using a FluorChem digital imager. Results are expressed as means + SEM (n=3; * P<0.01 versus controls). 98

o 120- o 12°" o 120- c c c o o o o 90 u 90H u 90' "8 "8 60' v 0) » o> 60- OJ 60' 3 c 3

SREBP-lc C^w™^*™ 'MB

B g 120 o 120-

I 90- 90-

& 60" c | 30 * o 30- 0) 0- ft. 2. Control Mithramycin Control

SREBP-lc

18S

Figure 5.6. Effects of Spl, Sp3 and Sp4 siRNAs, mithramycin, and E2 on mRNA levels of SREBP-lc in MCF-7 cells. Cells at 70% confluence were transfected with Spl, Sp3 or Sp4 siRNAs (A), or treated with 0.05 nM mithramycin (B) or 100 nM E2 (C) for 72 h. Two |ag total RNA were used for RT-PCR. Bands were quantified using a FluorChem digital imager. Results are expressed as means ± SEM (n=3; * PO.01 versus controls). 99 breast cancer cell line. We hypothesized that one or more of these transcription factors could be a molecular link between fatty acid synthesis and proliferation in these cells.

In various cancer cell lines, Spl has been shown to play an important role in sustaining cell cycle progression. For example, inhibition of Spl suppressed cell growth and caused Gl phase arrest in human glioblastoma, lung and pancreatic cancer cells (371, 376). A dominant- negative Spl mutation in Hela cells decreased cell growth, led to Gl phase arrest, reduced expression of cyclin Dl, and increased expression of p27 (377). Another study in Hela cells showed that ectopic expression of dominant negative Spl reduced growth rate by prolonging the S phase (378). In serum-starved MCF-7 cells, Abdelrahim et al. (370) showed that Spl siRNA transfection blocked E2-stimulated cell cycle progression by causing Gl phase arrest. In the present study in which Spl levels were significantly decreased in MCF-7 cells following transfection with Spl siRNA, CDC25A expression was suppressed with a concomitant decrease in growth rate. Whether Spl regulates FAS expression in cancers has not been investigated although promoter function studies in Drosophila SL2 cells have shown that Spl can activate FAS transcription (362). Here we showed that Spl siRNA significantly suppressed

FAS expression in breast cancer cells, suggesting that Spl plays a role in sustaining elevated expression of this enzyme.

A role for Sp3 and Sp4 in proliferation and cell cycle progression has been demonstrated in pancreatic cancer cells. Thus, in Panc-1 cells, transfection of Sp3 siRNA decreased cell proliferation and caused a significant Gl phase arrest through increased p27 expression, but transfection of Sp4 siRNA did not affect cell cycle progression (371). In Panc-

28 cells, however, Sp4 was shown to participate in PPARy-dependent induction of p21 and inhibition of G0/G1-S phase progression (379). The function of Sp3 and Sp4 in breast cancer 100

cells has not been reported. Here we showed that a decrease in Sp3 expression following Sp3

siRNA transfection in MCF-7 cells decreased CDC25A expression. Moreover, these cells no

longer grew in multiple layers, most cells accumulating in Gl. Since loss of contact inhibited

growth is an important component of neoplastic transformation, our observations suggest that

Sp3 may be involved in the transformation of breast epithelial cells. We also showed that

transfection of Sp4 siRNA into MCF-7 cells inhibited proliferation and decreased CDC25A

expression. The expression of FAS was not affected by decreased expression of either Sp3 or

Sp4. Promoter function analyses, however, have shown that like Spl, Sp3 can also activate

FAS transcription (362). This inconsistency with our result is probably because promoter

function analysis does not take into account the influence of chromatin structure on transcription (380). In sum, our results show that of the three Sp transcription factors we

investigated, only Spl plays a role in regulating CDC25A expression and cell growth as well as

FAS expression.

To investigate whether the decrease in expression of CDC25A and FAS was associated with a decrease in Spl binding to the regulatory sequences of these genes, we utilized ChIP

assays. In the experiments described above, the knockdown efficiency of Spl protein expression by siRNA was about 50% that would be insufficient to see a clear effect on promoter binding by ChIP assay. Instead, we used mithramycin that has been shown to mitigate

ER-mediated insulin-like growth factor-1 receptor (IGF-IR) expression by blocking Spl binding to the promoter of this gene in MCF-7 cells (374). We showed that mithramycin

significantly decreased proliferation of MCF-7 cells and inhibited CDC25A and FAS expression in a dose-dependent manner. Moreover, Spl binding to the promoters of both the 101

CDC25A and FAS genes was significantly inhibited in the presence of mithramycin, providing additional evidence for the direct involvement of Spl in the regulation of these genes.

Estrogen stimulates the proliferation of ERa-positive cells by accelerating the Gl to S transition (370) and Spl has been shown to mediate estrogen-induced CDC25A expression

(369). Activation of ERa signaling also stimulates FAS expression in breast cancer cells (228), but it is not known whether Spl is involved in this process. In the present study, treatment of

MCF-7 cells with E2 significantly increased proliferation and expression of both CDC25 A and

FAS accompanied by increased binding of Spl to the promoters of these genes without alterations in Spl protein levels (data not shown). Other studies have also reported that E2 increases Spl activity without affecting Spl protein expression (369, 374). Thus, our results suggest that up-regulation of FAS by E2 is mediated by increased activity of Spl.

To our knowledge, SREBP-lc is the only transcription factor that has been shown to regulate FAS expression in cancer cells. Yang et al. (248, 249) showed that SREBP-lc and

FAS mRNAs are concomitantly elevated in Ha-ras transformed breast epithelial cells, EGF- treated MCF-7 cells, and in a subset of primary breast cancers. In prostate cancer cells, SREBP-

lc mediates growth factor- or androgen-induced FAS expression (381, 382). This transcription factor has also been shown to regulate FAS expression in colon cancer cells (345). The promoter of SREBP-lc, however, contains Spl binding sites (375), and a recent study has shown that Spl mediates insulin-stimulated SREBP-lc expression in rat hepatocytes (383).

Whether Sp proteins control SREBP-lc expression in cancer cells has not been investigated.

Here we showed that either Spl siRNA transfection or mithramycin treatment significantly suppressed SREBP-lc expression in MCF-7 cells, while Sp3 or Sp4 siRNAs had no effect on this gene. E2 did not affect SREBP-lc expression, suggesting that unlike FAS, SREBP-lc 102

expression is not regulated through ERa signaling. Our finding that Spl siRNA decreased

SREBP-lc expression suggests that both Spl and SREBP-lc are involved in the regulation of

FAS. Indeed, in a promoter analysis in Drosophila SL2 cells, either Spl or SREBP-1 alone slightly stimulated FAS promoter activity, but when both transcription factors were expressed, they acted synergistically to stimulate the activity of the promoter (362). Another study has shown that FAS is expressed in lipogenic tissues of SREBP-1 knockout mice, clearly showing that FAS can be expressed independently of this transcription factor. Further studies are needed to determine how Spl and SREBP-1 interact to regulate FAS in cancer cells.

In summary, we have shown that Spl, Sp3 and Sp4 all play a role in regulating

CDC25A expression and proliferation in MCF-7 breast cancer cells. Of these three transcription factors, however, only Spl also regulates FAS. The notion that metabolic pathways may be coordinately regulated derives from studies showing that a common transcription factor concomitantly controls the expression of genes involved in related metabolic pathways by binding to their regulatory sequences (382, 384). Thus, our findings demonstrate that Spl coordinately controls the expression of CDC25A and FAS, indicating that this transcription factor is a molecular link between fatty acid synthesis and proliferation in breast cancer cells. Furthermore, our finding that Spl also regulates the expression of SREBP-

lc, a key transcription factor for genes of lipogenic enzymes, suggests that these two transcription factors interact to regulate FAS. Our observations, together with those showing that Spl plays an important role in glucose metabolism (385), angiogenesis (386), apoptosis

(359), invasion and metastasis (387), indicate that Spl regulates multiple biological processes that are essential for the survival, growth and progression of cancer cells. CHAPTER SIX

General Discussion

103 104

6.1 Overview

Based on previous evidence suggesting that COX-2 and FAS each promote the

development of breast cancer, the overall objective of the thesis was to address major gaps in

our knowledge relating to how these genes act at the whole organism, cellular and molecular

levels during breast cancer development. The research in this thesis was the continuation and

further development of previous research performed in our laboratory.

In the first study (Chapter 2), continuing a previous study from our laboratory showing that the COX-2 selective inhibitor celecoxib not only inhibits MNU-induced rat mammary

carcinogenesis but also decreases fat accumulation in the context of a high fat diet rich in n-6

PUFAs (110), we investigated the underlying mechanism by which celecoxib decreased fat

accumulation. We demonstrated that, independent of food intake, celecoxib prevented high fat

diet-induced obesity possibly via down-regulation of JNK1/FAS rather than other known molecular targets of celecoxib such as PDK1 (143), p38 and Erkl/2 (142). Our observations for the first time show that celecoxib plays a role in lipid metabolism. This conclusion is supported by observations of decreased fat accumulation and improved insulin sensitivity in JNK1 knockout mice in the context of a high fat diet (273). In addition to fat metabolism and insulin

sensitivity, JNK1 has been shown to play a role in other biological processes. For example,

JNK1 is required for metalloproteinase expression that leads to joint destruction in

inflammatory arthritis (297). JNK1 is activated in non-small-cell lung cancer and promotes neoplastic transformation in human bronchial epithelial cells (388). Activation of JNK1/2 protects the myocardium from ischemia-reperfusion-induced cell death (389) and protects

cardiac function from deteriorating in response to pressure overload (390). JNK1 is associated with the formation of Hirano bodies, an important neuropathologic feature of Alzheimer's 105 disease (391). Our observations, therefore, may contribute to understanding why celecoxib has similar effects to those of JNK1, including anti-inflammatory effects (22), anti-cancer effects

(54), increased cardiovascular risk (302, 303) and beneficial effects in Alzheimer's disease

(392). Furthermore, our findings suggest that both inhibition of COX-2 and down-regulation of

FAS may contribute to the cancer chemopreventive effect of celecoxib.

Based on the findings from Chapter 2, the subsequent research in the thesis developed into two branches. One of the branches (Chapter 3) was to further investigate the exact role of

COX-2 over-expression in the transformation of mammary epithelial cells. We demonstrated that over-expression of COX-2 in MCF-10F human breast epithelial cells decreased proliferation, detachment-induced apoptosis (anoikis), and differentiation, suggesting that over- expression of COX-2 in the mammary epithelium deregulates mammary tissue homeostasis.

Indeed, after multiple passages, these cells developed EMT, a biological state that characterizes transition towards neoplasia (330, 331), and partial transformation. Clearly, our observations indicate that COX-2 over-expression in mammary epithelial cells increases the susceptibility of the mammary gland to tumorigenesis by affecting the homeostatic balance in the epithelial cells. This notion is further supported by an MMTV/COX-2 transgenic mouse study. In these mice, spontaneous mammary carcinomas occured only in multiparous transgenic mice, but precocious lobuloalveolar differentiation occured in virgin females (88, 89). During pregnancy, lactation and involution, when mammary epithelial cells undergo cycles of proliferation, differentiation and apoptosis (151), over-expression of COX-2 may have more profound effects on the homeostatic status of mammary epithelial cells than at other times. Consistent with our observations, over-expression of COX-2 in basal keratinocytes in transgenic mice has been shown to cause abnormal differentiation of epidermis and basal cell hyperplasia (a 106 preneoplastic phenotype). These mice do not develop skin tumors spontaneously, but are

sensitized to skin carcinogenesis (393, 394). Since the work in Chapter 3 was completed, another study with similar findings to ours has been reported. COX-2 over-expression was

shown to induce a preneoplastic phenotype in MCF-10A human breast epithelial cells. As in our study, however, these cells were not fully transformed (115).

The findings from Chapter 3 suggest that, consistent with other studies, COX-2 should be explored as a molecular target for breast cancer prevention. Our findings also suggest that mitigating the disturbance in mammary tissue homeostasis induced by COX-2 may contribute to the chemopreventive effect of COX-2 inhibitors (107, 110). Recently, reactive lipid products produced by COX-2 have been shown to inactivate the tumor suppressor gene LKB1 in MCF-7 cells (116). Germline mutations in the LKB1 cause Peutz-Jeghers syndrome that is associated with an increased risk of developing intestinal and extraintestinal cancers including breast carcinomas (395). In hamartomatous polyps and carcinomas from patients with Peutz-Jeghers syndrome, expression of COX-2 correlates with that of LKB1 (396). Thus, targeting COX-2 as a chemopreventive strategy will be even more significant in the population with Peutz-Jeghers syndrome than in the general population.

Based on the findings from Chapter 2, the other branch of research in this thesis was to explore the potential of FAS as a molecular target for breast cancer prevention. Using a standard MNU-induced rat mammary carcinogenesis model, we demonstrated that FAS is not only expressed in mammary carcinomas but also in intraductal proliferations (IDPs) that are putative preneoplastic lesions, and inhibition of FAS significantly inhibited rat mammary carcinogenesis. These results suggest that FAS plays an important role in facilitating the progression of multi-step mammary carcinogenesis. Findings from this experiment provide 107 direct evidence that FAS is a potential molecular target for the chemoprevention of breast cancer. This notion is further supported by other studies. In breast epithelial cells, oncogene- mediated transformation led to up-regulation of FAS and sensitized the cells to apoptosis induced by FAS inhibitors (237, 249). In the neu-N transgenic mouse model of mammary cancer, the FAS inhibitor C75 significantly delayed tumor progression (218). Recent studies have shown that the breast cancer tumor suppressor gene BRCA1 inhibits fatty acid synthesis, and down-regulation of BRCA1 increases fatty acid synthesis in breast cancer cells (255, 256).

We predict, therefore, that FAS will be a promising molecular target for the chemoprevention of breast cancer particularly among the women with BRCA1 mutations. Targeting FAS as a strategy for breast cancer therapy was proposed a decade ago, but the implementation of this strategy is still not a reality possibly because of undesirable side effects of currently available

FAS inhibitors (159). Recently, a new FAS inhibitor, C93, has been developed that appears to be more specific than the ones now available and hence may have fewer side effects (397).

Hopefully, the potential of FAS inhibition in breast cancer prevention will be put to test in the near future.

Previous studies suggest that in cancers, de novo fatty acid synthesis is functionally linked to cell proliferation (228, 344, 350, 351). Chapter 5 of this thesis investigated the molecular link between fatty acid synthesis and cell proliferation by using MCF-7 human breast cancer cell line as an experimental model. We demonstrated that Spl, a member of the

Sp/KLF family of transcription factors, coordinately regulates FAS and CDC25A expression, and that Spl is a molecular link between de novo fatty acid synthesis and cell growth. In addition, we also found that Spl is involved in regulating SREBP-lc expression. Others have shown that SREBP-lc plays a role in regulating FAS expression in breast cancer cells (249). 108

Further studies are needed to determine how Spl and SREBP-lc interact to regulate FAS in cancer cells. The significance of this work is that for the first time, we provide direct evidence showing that, in cancer cells, FAS is regulated, at least in part, by the same transcription factor that controls the cell cycle machinery.

The research in Chapter 5 will shed light on our understanding of the differential effects of some dietary fatty acids on FAS regulation in breast cancer cells and normal lipogenic tissues. For example, in breast cancer cells, FAS is not suppressed by LA or AA that are known to inhibit FAS expression in lipogenic tissues, but this enzyme is selectively down-regulated by alpha-linolenic and gamma-linolenic acids (257). In various breast cancer cell lines, LA and

AA have been shown to induce cell growth while alpha-linolenic and gamma-linolenic acids inhibit cell growth (398, 399). Unpublished research in our laboratory has shown that conjugated linoleic acid (CLA), that is known to decrease proliferation in breast cancer cells

(400), also suppresses FAS expression. These various studies support the association of cell proliferation and FAS expression documented in Chapter 5. Based on other findings in Chapter

5, it is clear that Spl may play a role in mediating this regulation although the mechanism of interaction of fatty acids with Spl is not known. Further research is clearly needed to understand how FAS and cell proliferation are regulated by certain dietary fatty acids not others in cancer cells.

The findings from Chapter 5 may have implications for breast cancer therapy and prevention. Although mortality from breast cancer has declined in the past decade owing to advances in diagnosis and treatment (401), clinical challenges still exist because of the development of drug resistance and serious side effects (13). Better approaches need to be developed. Spl is over-expressed in 80% of breast carcinomas, and its expression is associated 109 with poor prognosis (361). As addressed in Chapter 5, in breast cancer cells, Spl has been shown to play an important role in proliferation (402, 403), glucose metabolism (385), angiogenesis (386), apoptosis (359), invasion and metastasis (387). Our research has demonstrated that Spl is a molecular link between fatty acid synthesis and cell proliferation.

Taken together, these observations indicate that Spl is crucial for maintaining multiple biological processes that are essential for the survival and growth of cancer cells. Therefore,

Spl is a particularly promising target for breast cancer therapy, and the implementation of this notion depends on the development of Spl-specific inhibitors. The experiments in Chapter 5 were performed using breast cancer cells, so extrapolation of the findings in this experiment to cancer prevention in general is not legitimate. The potential of Spl as a molecular target for chemoprevention of other cancers, however, has been suggested by other observations. For example, in carcinogen- or oncogene-transformed human fibroblast cells that express Spl at 8- fold to 18-fold higher levels than their parental cells, down-regulation of Spl reverses the transformation, and inhibits tumor formation (404).

Various approaches have been taken to down-regulate Spl and the genes that it regulates, including drugs (e.g. mithramycin) that inactivate GC-rich DNA motifs, oligonucleotides and peptide nucleic acid (PNA)-DNA chimeras that specifically interact with

Spl binding motifs (Spl decoys) (258). All these approaches have been shown to decrease

Spl-DNA binding and Spl-dependent gene expression in cancer cells (376, 405, 406). A problem with these approaches, however, is that unspecific effects will occur because of the decreased binding of other Sp transcription factors. Indeed, mithramycin has been shown to decrease the binding of Sp3 to the promoter of the adenomatous polyposis coli (APC) gene in human breast epithelial cells (407). Clinically, mithramycin has been used to treat 110 hypercalcemia of malignancy that is caused by bone metastasis of cancers, and it has side effects such as hepatotoxicity, nephrotoxicity, nausea and vomiting (408). We anticipate that targeting Spl more specifically such as using Spl siRNA, will lead to fewer side effects.

In summary, research in this thesis addressed some of the major gaps in our understanding of the role of COX-2 and FAS in breast cancer biology. From perspectives that were different from the existing literature, our findings have demonstrated the significance of

COX-2, FAS and Spl in the development of breast cancer and the potential of these proteins as the molecular targets for breast cancer prevention or therapy. We anticipate that developing more specific and less harmful inhibitors of these proteins will significantly help to decrease side effects and increase efficacy for breast cancer therapy. Because COX-2, FAS and Spl are also over-expressed in other cancers (258, 409, 410), the findings in the thesis may have wide implications for the prevention and treatment of cancer. Furthermore, a number of dietary factors such as epigallocatechin gallate (EGCG), flavonoids, resveratrol and indole-3-carbinol that occur in tea, soy, grape seed and cruciferous vegetables respectively have been shown to down-regulate or inhibit COX-2, FAS and Spl (163, 411, 412). Such food materials have already received considerable attention for their ability to inhibit cancer development, but the research described in this thesis provides a mechanistic basis for the further exploration of cancer prevention by these and perhaps other dietary compounds.

6.2 Future directions

Results from Chapter 2 show that over-expression of COX-2 in mammary epithelial cells affects homeostasis and causes partial transformation of these cells. These observations indicate that COX-2 expression itself is not sufficient to cause malignant transformation, but increases the susceptibility to mammary tumorigenesis. Consistent with the literature, our Ill

observations suggest COX-2 is a potential target for the prevention of breast cancer, but

increased risk of cardiovascular diseases associated with the use of selective COX-2 inhibitors

indicates the needs to develop more specific and less harmful means for cancer prevention (51).

Recently, studies have shown that COX-2 affects cancer development mainly through EP

receptor signaling (413-415), and different EP receptors may have opposing effects (317). For

example, in NIH-3T3 cells, both positive and negative regulation of cell proliferation through

EP receptors has been reported (317). Thus, it is important to continue the work of Chapter 2 by characterizing EP receptor expression in mammary epithelial cells, and determining the

specific effect of each EP receptor. This will provide valuable information for understanding the role of COX-2 in breast cancer development and targeting more specific pathways with EP receptor antagonists for cancer prevention.

Results from Chapter 5 show that Spl coordinately regulates FAS expression and cell proliferation in a hormone-responsive MCF-7 breast cancer cell line. In addition, we also

showed that Spl is involved in the regulation of SREBP-lc expression in these cells. It is known that the promoter of FAS gene contains both Spl and SREBP-1 binding sites (153).

Previous promoter function analyses have shown that both transcription factors are involved in regulating FAS expression by binding to the promoter (362). How Spl and SREBP-lc interact to regulate FAS expression was not investigated in this thesis. Further investigation of this issue will provide valuable information regarding regulation of fatty acid synthesis in cancers.

In addition to breast cancer, the results in this thesis may find application in the prevention colon cancer. COX-2 has been shown to play an important role in colorectal carcinogenesis during the transition from adenoma to carcinoma and subsequently during invasion and metastasis (416-418). Selective COX-2 inhibitors have recently been introduced 112 into clinical trials to test the efficacy of this family of drugs in colon cancer prevention and therapy (419, 420). Adverse cardiovascular events associated with these drugs (51), however, suggest the need to develop other approaches.

Colon cancer cells have been shown to express high levels of Spl (129). COX-2 is over-expressed in 50% of benign polyps and 80-85% of adenocarcinomas (421). Elevated FAS expression occurs in all adenomas and adenocarcinomas (207). Like COX-2 inhibition, inhibition of FAS suppresses cell growth, and causes cytotoxicity in colon cancer cells (422).

The promoter of the COX-2 gene also contains Spl binding sites (423), and Spl has been shown to induce COX-2 expression in human gliomas (424). It will be useful to know whether

Spl coordinately regulates COX-2 and FAS expression in colon carcinogenesis, and to test the significance of Spl inhibition in colon cancer prevention and therapy. References

113 114

1. Althuis, M. D., Dozier, J. M, Anderson, W. F., Devesa, S. S., and Brinton, L. A. Global

trends in breast cancer incidence and mortality 1973-1997. Int J Epidemiol, 34: 405-

412, 2005.

2. Key, T. J., Verkasalo, P. K., and Banks, E. Epidemiology of breast cancer. Lancet

Oncol, 2: 133-140,2001.

3. Kelsey, J. L., Gammon, M. D., and John, E. M. Reproductive factors and breast cancer.

Epidemiol Rev, 15: 36-47, 1993.

4. Pharoah, P. D., Day, N. E., Duffy, S., Easton, D. F., and Ponder, B. A. Family history

and the risk of breast cancer: a systematic review and meta-analysis. Int J Cancer, 71:

800-809, 1997.

5. Antoniou, A. C. and Easton, D. F. Models of genetic susceptibility to breast cancer.

Oncogene, 25: 5898-5905, 2006.

6. Easton, D. F., Pooley, K. A., Dunning, A. M, Pharoah, P. D., Thompson, D., Ballinger,

D. G., Struewing, J. P., Morrison, J., Field, H., Luben, R., Wareham, N., Ahmed, S.,

Healey, C. S., Bowman, R., Meyer, K. B., Haiman, C. A., Kolonel, L. K., Henderson,

B. E., Le Marchand, L., Brennan, P., Sangrajrang, S., Gaborieau, V., Odefrey, F., Shen,

C. Y., Wu, P. E., Wang, H. C., Eccles, D., Evans, D. G., Peto, J., Fletcher, O., Johnson,

N., Seal, S., Stratton, M. R., Rahman, N., Chenevix-Trench, G., Bojesen, S. E.,

Nordestgaard, B. G., Axelsson, C. K., Garcia-Closas, M., Brinton, L., Chanock, S.,

Lissowska, J., Peplonska, B., Nevanlinna, H., Fagerholm, R., Eerola, H., Kang, D.,

Yoo, K. Y., Noh, D. Y., Ahn, S. H., Hunter, D. J., Hankinson, S. E., Cox, D. G., Hall,

P., Wedren, S., Liu, J., Low, Y. L., Bogdanova, N., Schurmann, P., Dork, T., Tollenaar,

R. A., Jacobi, C. E., Devilee, P., Klijn, J. G., Sigurdson, A. J., Doody, M. M., 115

Alexander, B. H., Zhang, J., Cox, A., Brock, I. W., MacPherson, G., Reed, M. W.,

Couch, F. J., Goode, E. L., Olson, J. E., Meijers-Heijboer, H., van den Ouweland, A.,

Uitterlinden, A., Rivadeneira, F., Milne, R. L., Ribas, G., Gonzalez-Neira, A., Benitez,

J., Hopper, J. L., McCredie, M., Southey, M., Giles, G. G., Schroen, C, Justenhoven,

C, Brauch, H., Hamann, U., Ko, Y. D., Spurdle, A. B., Beesley, J., Chen, X.,

Mannermaa, A., Kosma, V. M., Kataja, V., Hartikainen, J., Day, N. E., Cox, D. R. and

Ponder, B. A. Genome-wide association study identifies novel breast cancer susceptibility loci. Nature, 447: 1087-1093, 2007.

Yoo, K. Y., Kim, Y., Park, S. K., and Kang, D. Lifestyle, genetic susceptibility and future trends of breast cancer in Korea. Asian Pac J Cancer Prev, 7: 679-682, 2006.

Kato, I., Tominaga, S., and Kuroishi, T. Relationship between westernization of dietary habits and mortality from breast and ovarian cancers in Japan. Jpn J Cancer Res, 78:

349-357, 1987.

Schrauwen, P. High-fat diet, muscular lipotoxicity and insulin resistance. Proc Nutr

Soc, ^.-33-41,2007.

Stoll, B. A. Upper abdominal obesity, insulin resistance and breast cancer risk. Int J

Obes Relat Metab Disord, 26: 747-753, 2002.

Verkasalo, P. K., Kaprio, J., Koskenvuo, M., and Pukkala, E. Genetic predisposition, environment and cancer incidence: a nationwide twin study in Finland, 1976-1995. Int J

Cancer, 83: 743-749,1999.

Lichtenstein, P., Holm, N. V., Verkasalo, P. K., Iliadou, A., Kaprio, J., Koskenvuo, M.,

Pukkala, E., Skytthe, A., and Hemminki, K. Environmental and heritable factors in the 116

causation of cancer—analyses of cohorts of twins from Sweden, Denmark, and Finland.

N Engl J Med, 343: 78-85, 2000.

13. Osborne, C, Wilson, P., and Tripathy, D. Oncogenes and tumor suppressor genes in

breast cancer: potential diagnostic and therapeutic applications. Oncologist, 9: 361-377,

2004.

14. Stingl, J. and Caldas, C. Molecular heterogeneity of breast carcinomas and the cancer

stem cell hypothesis. Nat Rev Cancer, 7: 791-799, 2007.

15. Campbell, L. L. and Polyak, K. Breast tumor heterogeneity: cancer stem cells or clonal

evolution? Cell Cycle, 6: 2332-2338, 2007.

16. Savage, L. Researchers wonder why high-risk women are not taking chemoprevention

drugs. J Natl Cancer Inst, 99: 913-914, 2007.

17. Warburg, O. On the origin of cancer cells. Science, 123: 309-314, 1956.

18. Medes, G., Thomas, A., and Weinhouse, S. Metabolism of neoplastic tissue. IV. A

study of lipid synthesis in neoplastic tissue slices in vitro. Cancer Res, 13: 27-29, 1953.

19. Bandyopadhyay, S., Zhan, R., Wang, Y., Pai, S. K., Hirota, S., Hosobe, S., Takano, Y.,

Saito, K., Furuta, E., Iiizumi, M., Mohinta, S., Watabe, M., Chalfant, C, and Watabe,

K. Mechanism of apoptosis induced by the inhibition of fatty acid synthase in breast

cancer cells. Cancer Res, 66: 5934-5940, 2006.

20. Breyer, R. M., Bagdassarian, C. K., Myers, S. A., and Breyer, M. D. Prostanoid

receptors: subtypes and signaling. Annu Rev Pharmacol Toxicol, 41: 661-690, 2001.

21. Dubois, R. N., Abramson, S. B., Crofford, L., Gupta, R. A., Simon, L. S., Van De Putte,

L. B., and Lipsky, P. E. Cyclooxygenase in biology and disease. FASEB J, 12: 1063-

1073,1998. 117

22. Smith, W. L., DeWitt, D. L., and Garavito, R. M. Cyclooxygenases: structural, cellular,

and molecular biology. Annu Rev Biochem, 69: 145-182, 2000.

23. FitzGerald, G. A. and Patrono, C. The coxibs, selective inhibitors of cyclooxygenase-2.

N Engl J Med, 345: 433-442, 2001.

24. Smith, W. L. and Song, I. The enzymology of prostaglandin endoperoxide H synthases-

1 and -2. Prostaglandins Other Lipid Mediat, 68-69: 115-128,2002.

25. Coleman, R. A., Smith, W. L., and Narumiya, S. International Union of Pharmacology

classification of prostanoid receptors: properties, distribution, and structure of the

receptors and their subtypes. Pharmacol Rev, 46: 205-229, 1994.

26. Lydford, S. J., McKechnie, K. C, and Dougall, I. G. Pharmacological studies on

prostanoid receptors in the rabbit isolated saphenous vein: a comparison with the rabbit

isolated ear artery. Br J Pharmacol, 117: 13-20, 1996.

27. Coleman, R. A., Grix, S. P., Head, S. A., Louttit, J. B., Mallett, A., and Sheldrick, R. L.

A novel inhibitory prostanoid receptor in piglet saphenous vein. Prostaglandins, 47:

151-168, 1994.

28. Lawrence, R. A. and Jones, R. L. Investigation of the prostaglandin E (EP-) receptor

subtype mediating relaxation of the rabbit jugular vein. Br J Pharmacol, 105: 817-824,

1992.

29. Daniels, E. G., Hinman, J. W., Leach, B. E., and Muirhead, E. E. Identification of

prostaglandin E2 as the principal vasodepressor lipid of rabbit renal medulla. Nature,

215: 1298-1299, 1967.

30. Sugimoto, Y., Yamasaki, A., Segi, E., Tsuboi, K., Aze, Y., Nishimura, T., Oida, H.,

Yoshida, N., Tanaka, T., Katsuyama, M., Hasumoto, K., Murata, T., Hirata, M., 118

Ushikubi, F., Negishi, M., Ichikawa, A., and Narumiya, S. Failure of parturition in mice

lacking the prostaglandin F receptor. Science, 277: 681-683, 1997.

31. Lewis, R. A., Soter, N. A., Diamond, P. T., Austen, K. F., Oates, J. A., and Roberts, L.

J., 2nd Prostaglandin D2 generation after activation of rat and human mast cells with

anti-IgE. J Immunol, 129: 1627-1631,1982.

32. Giles, H., Leff, P., Bolofo, M. L., Kelly, M. G., and Robertson, A. D. The classification

of prostaglandin DP-receptors in platelets and vasculature using BW A868C, a novel,

selective and potent competitive antagonist. Br J Pharmacol, 96: 291-300,1989.

33. Bolger, P. M., Eisner, G. M., Ramwell, P. W., and Slotkoff, L. M. Renal actions of

prostacyclin. Nature, 271: 467-469, 1978.

34. Edwards, R. M. Effects of prostaglandins on vasoconstrictor action in isolated renal

arterioles. Am J Physiol, 248: F779-784,1985.

35. Jackson, E. K. Relation between renin release and blood pressure response to

nonsteroidal anti-inflammatory drugs in hypertension. Hypertension, 14: 469-471,

1989.

36. Bugge, J. F., Stokke, E. S., Vikse, A., and Kiil, F. Stimulation of renin release by PGE2

and PGI2 infusion in the dog: enhancing effect of ureteral occlusion or administration

of ethacrynic acid. Acta Physiol Scand, 138: 193-201, 1990.

37. Ito, S., Carretero, O. A., Abe, K., Beierwaltes, W. H., and Yoshinaga, K. Effect of

prostanoids on renin release from rabbit afferent arterioles with and without macula

densa. Kidney Int, 35: 1138-1144, 1989. 119

38. Oates, J. A., FitzGerald, G. A., Branch, R. A., Jackson, E. K., Knapp, H. R., and

Roberts, L. J., 2nd Clinical implications of prostaglandin and thromboxane A2

formation (1). N Engl J Med, 319: 689-698,1988.

39. Castellani, S., Paladini, B., Paniccia, R., Di Serio, C, Vallotti, B., Ungar, A., Fumagalli,

S., Cantini, C, Poggesi, L., and Neri Serneri, G. G. Increased renal formation of

thromboxane A2 and prostaglandin F2 alpha in heart failure. Am Heart J, 133: 94-100,

1997.

40. Spurney, R. F., Fan, P. Y., Ruiz, P., Sanfilippo, F., Pisetsky, D. S., and Coffman, T. M.

Thromboxane receptor blockade reduces renal injury in murine lupus nephritis. Kidney

Int, 41: 973-982,1992.

41. Morinelli, T. A., Tempel, G. E., Jaffa, A. A., Silva, R. FL, Naka, M., Folger, W., and

Halushka, P. V. Thromboxane A2/prostaglandin F£2 receptors in streptozotocin-induced

diabetes: effects of insulin therapy in the rat. Prostaglandins, 45: 427-438, 1993.

42. Piper, P. J. and Vane, J. R. Release of additional factors in anaphylaxis and its

antagonism by anti-inflammatory drugs. Nature, 223: 29-35, 1969.

43. Vane, J. R. Inhibition of prostaglandin synthesis as a mechanism of action for aspirin

like drugs. Nat New Biol, 231: 232-235, 1971.

44. Vane, J. R. and Botting, R. M. Mechanism of action of aspirin-like drugs. Semin

Arthritis Rheum, 26: 2-10, 1997.

45. Laneuville, O., Breuer, D. K., Dewitt, D. L., Hla, T., Funk, C. D., and Smith, W. L.

Differential inhibition of human prostaglandin endoperoxide H synthases-1 and -2 by

nonsteroidal anti-inflammatory drugs. J Pharmacol Exp Ther, 271: 927-934, 1994. 120

46. Marnett, L. J., Rowlinson, S. W., Goodwin, D. C, Kalgutkar, A. S., and Lanzo, C. A.

Arachidonic acid oxygenation by COX-1 and COX-2. Mechanisms of catalysis and

inhibition. J Biol Chem, 274: 22903-22906, 1999.

47. DeWitt, D. L. Cox-2-selective inhibitors: the new super aspirins. Mol Pharmacol, 55:

625-631, 1999.

48. Smith, W. L. and Dewitt, D. L. Prostaglandin endoperoxide H synthases-1 and -2. Adv

Immunol, 62: 167-215, 1996.

49. DeWitt, D. L., el-Harith, E. A., Kraemer, S. A., Andrews, M. J., Yao, E. F., Armstrong,

R. L., and Smith, W. L. The aspirin and heme-binding sites of ovine and murine

prostaglandin endoperoxide synthases. J Biol Chem, 265: 5192-5198, 1990.

50. Kulmacz, R. J. and Lands, W. E. Stoichiometry and kinetics of the interaction of

prostaglandin H synthase with anti-inflammatory agents. J Biol Chem, 260: 12572-

12578, 1985.

51. Wang, D., Wang, M., Cheng, Y., and Fitzgerald, G. A. Cardiovascular hazard and non

steroidal anti-inflammatory drugs. Curr Opin Pharmacol, 5: 204-210, 2005.

52. McAdam, B. F., Catella-Lawson, F., Mardini, I. A., Kapoor, S., Lawson, J. A., and

FitzGerald, G. A. Systemic biosynthesis of prostacyclin by cyclooxygenase (COX)-2:

the human pharmacology of a selective inhibitor of COX-2. Proc Natl Acad Sci USA,

96: 272-277, 1999.

53. Eberhart, C. E., Coffey, R. J., Radhika, A., Giardiello, F. M, Ferrenbach, S., and

DuBois, R. N. Up-regulation of cyclooxygenase 2 gene expression in human colorectal

adenomas and adenocarcinomas. Gastroenterology, 107: 1183-1188, 1994. 121

54. Sinicrope, F. A. and Gill, S. Role of cyclooxygenase-2 in colorectal cancer. Cancer

Metastasis Rev, 23: 63-75,2004.

55. Ristimaki, A., Sivula, A., Lundin, J., Lundin, M., Salminen, T., Haglund, C, Joensuu,

H., and Isola, J. Prognostic significance of elevated cyclooxygenase-2 expression in

breast cancer. Cancer Res, 62: 632-635, 2002.

56. Boland, G. P., Butt, I. S., Prasad, R., Knox, W. F., and Bundred, N. J. COX-2

expression is associated with an aggressive phenotype in ductal carcinoma in situ. Br J

Cancer, 90: 423-429, 2004.

57. Schmitz, K. J., Callies, R., Wohlschlaeger, J., Kimmig, R., Otterbach, F., Bohr, J., Lee,

H. S., Takeda, A., Schmid, K. W., and Baba, H. A. Overexpression of cyclo-oxygenase-

2 is an independent predictor of unfavourable outcome in node-negative breast cancer,

but is not associated with protein kinase B (Akt) and mitogen-activated protein kinase

(ERK1/2, p38) activation or with Her-2/neu signalling pathways. J Clin Pathol, 59: 685-

691,2006.

58. Sivula, A., Talvensaari-Mattila, A., Lundin, J., Joensuu, H., Haglund, C, Ristimaki, A.,

and Turpeenniemi-Hujanen, T. Association of cyclooxygenase-2 and matrix

metalloproteinase-2 expression in human breast cancer. Breast Cancer Res Treat, 89:

215-220,2005.

59. Zerkowski, M. P., Camp, R. L., Burtness, B. A., Rimm, D. L., and Chung, G. G.

Quantitative analysis of breast cancer tissue microarrays shows high cox-2 expression is

associated with poor outcome. Cancer Invest, 25: 19-26, 2007. 122

60. Subbaramaiah, K., Norton, L., Gerald, W., and Dannenberg, A. J. Cyclooxygenase-2 is

overexpressed in HER-2/neu-positive breast cancer: evidence for involvement of AP-1

and PEA3. J Biol Chem, 277: 18649-18657, 2002.

61. Davies, G., Salter, J., Hills, M., Martin, L. A., Sacks, N., and Dowsett, M. Correlation

between cyclooxygenase-2 expression and angiogenesis in human breast cancer. Clin

Cancer Res, 9: 2651-2656, 2003.

62. Half, E., Tang, X. M., Gwyn, K., Sahin, A., Wathen, K., and Sinicrope, F. A.

Cyclooxygenase-2 expression in human breast cancers and adjacent ductal carcinoma in

situ. Cancer Res, 62: 1676-1681, 2002.

63. Watanabe, O., Shimizu, T., Imamura, H., Kinoshita, J., Utada, Y., Okabe, T., Kimura,

K., Hirano, A., Yoshimatsu, K., Aiba, M., and Ogawa, K. Expression of

cyclooxygenase-2 in malignant and benign breast tumors. Anticancer Res, 23: 3215-

3221,2003.

64. Kirkpatrick, K., Ogunkolade, W., Elkak, A., Bustin, S., Jenkins, P., Ghilchik, M., and

Mokbel, K. The mRNA expression of cyclo-oxygenase-2 (COX-2) and vascular

endothelial growth factor (VEGF) in human breast cancer. Curr Med Res Opin, 18:

237-241,2002.

65. Gauthier, M. L., Pickering, C. R., Miller, C. J., Fordyce, C. A., Chew, K. L., Berman,

H. K., and Tlsty, T. D. p38 regulates cyclooxygenase-2 in human mammary epithelial

cells and is activated in premalignant tissue. Cancer Res, 65: 1792-1799, 2005.

66. Liu, X. H. and Rose, D. P. Differential expression and regulation of cyclooxygenase-1

and -2 in two human breast cancer cell lines. Cancer Res, 56: 5125-5127, 1996. 123

67. Wang, S. C, Lien, H. C, Xia, W., Chen, I. F., Lo, H. W., Wang, Z., Ali-Seyed, M.,

Lee, D. F., Bartholomeusz, G., Ou-Yang, F., Giri, D. K., and Hung, M. C. Binding at

and transactivation of the COX-2 promoter by nuclear tyrosine kinase receptor ErbB-2.

Cancer Cell, 6: 251-261, 2004.

68. Gilhooly, E. M. and Rose, D. P. The association between a mutated ras gene and

cyclooxygenase-2 expression in human breast cancer cell lines. Int J Oncol, 15: 267-

270, 1999.

69. Harris, R. E., Namboodiri, K., Stellman, S. D., and Wynder, E. L. Breast cancer and

NSAID use: heterogeneity of effect in a case-control study. Prev Med, 24: 119-120,

1995.

70. Harris, R. E., Beebe-Donk, J., and Alshafie, G. A. Cancer chemoprevention by

cyclooxygenase 2 (COX-2) blockade: results of case control studies. Subcell Biochem,

42: 193-212, 2007.

71. Harris, R. E., Namboodiri, K. K., and Farrar, W. B. Nonsteroidal antiinflammatory

drugs and breast cancer. Epidemiology, 7: 203-205,1996.

72. Sharpe, C. R., Collet, J. P., McNutt, M., Belzile, E., Boivin, J. F., and Hanley, J. A.

Nested case-control study of the effects of non-steroidal anti-inflammatory drugs on

breast cancer risk and stage. Br J Cancer, 83: 112-120, 2000.

73. Terry, M. B., Gammon, M. D., Zhang, F. F., Tawfik, H., Teitelbaum, S. L., Britton, J.

A., Subbaramaiah, K., Dannenberg, A. J., and Neugut, A. I. Association of frequency

and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA,

291: 2433-2440, 2004. 124

74. Schreinemachers, D. M. and Everson, R. B. Aspirin use and lung, colon, and breast

cancer incidence in a prospective study. Epidemiology, 5: 138-146, 1994.

75. Johnson, T. W., Anderson, K. E., Lazovich, D., and Folsom, A. R. Association of

aspirin and nonsteroidal anti-inflammatory drug use with breast cancer. Cancer

Epidemiol Biomarkers Prev, 11: 1586-1591, 2002.

76. Bardia, A., Ebbert, J. O., Vierkant, R. A., Limburg, P. J., Anderson, K., Wang, A. H.,

Olson, J. E., Vachon, C. M., and Cerhan, J. R. Association of aspirin and nonaspirin

nonsteroidal anti-inflammatory drugs with cancer incidence and mortality. J Natl

Cancer Inst, 99: 881-889, 2007.

77. Egan, K. M., Stampfer, M. J., Giovannucci, E., Rosner, B. A., and Colditz, G. A.

Prospective study of regular aspirin use and the risk of breast cancer. J Natl Cancer Inst,

88: 988-993, 1996.

78. Gonzalez-Perez, A., Garcia Rodriguez, L. A., and Lopez-Ridaura, R. Effects of non

steroidal anti-inflammatory drugs on cancer sites other than the colon and rectum: a

meta-analysis. BMC Cancer, 3: 28, 2003.

79. Campa, D., Zienolddiny, S., Maggini, V., Skaug, V., Haugen, A., and Canzian, F.

Association of a common polymorphism in the cyclooxygenase 2 gene with risk of non-

small cell lung cancer. Carcinogenesis, 25: 229-235, 2004.

80. Zhang, X., Miao, X., Tan, W., Ning, B., Liu, Z., Hong, Y., Song, W., Guo, Y., Shen, Y.,

Qiang, B., Kadlubar, F. F., and Lin, D. Identification of functional genetic variants in

cyclooxygenase-2 and their association with risk of esophageal cancer.

Gastroenterology, 129: 565-576, 2005. 125

81. Langsenlehner, U., Yazdani-Biuki, B., Eder, T., Renner, W., Wascher, T. C,

Paulweber, B., Weitzer, W., Samonigg, H., and Krippl, P. The cyclooxygenase-2

(PTGS2) 8473T>C polymorphism is associated with breast cancer risk. Clin Cancer

Res, 12: 1392-1394, 2006.

82. Vogel, U., Christensen, J., Nexo, B. A., Wallin, H., Friis, S., and Tjonneland, A.

Peroxisome profilerator-activated receptorgamma2 Pro 12Ala, interaction with alcohol

intake and NSAID use, in relation to risk of breast cancer in a prospective study of

Danes. Carcinogenesis, 28: 427-434, 2007.

83. Gao, J., Ke, Q., Ma, H. X., Wang, Y., Zhou, Y., Hu, Z. B., Zhai, X. J., Wang, X. C,

Qing, J. W., Chen, W. S., Jin, G. F., Liu, J. Y., Tan, Y. F., Wang, X. R., and Shen, H. B.

Functional polymorphisms in the cyclooxygenase 2 (COX-2) gene and risk of breast

cancer in a Chinese population. J Toxicol Environ Health A, 70: 908-915, 2007.

84. Shen, J., Gammon, M. D., Terry, M. B., Teitelbaum, S. L., Neugut, A. I., and Santella,

R. M. Genetic polymorphisms in the cyclooxygenase-2 gene, use of nonsteroidal anti

inflammatory drugs, and breast cancer risk. Breast Cancer Res, 8: R71, 2006.

85. Badawi, A. F., El-Sohemy, A., Stephen, L. L., Ghoshal, A. K., and Archer, M. C. The

effect of dietary n-3 and n-6 polyunsaturated fatty acids on the expression of

cyclooxygenase 1 and 2 and levels of p21ras in rat mammary glands. Carcinogenesis,

19: 905-910,1998.

86. Badawi, A. F. and Archer, M. C. Effect of hormonal status on the expression of the

cyclooxygenase 1 and 2 genes and prostaglandin synthesis in rat mammary glands.

Prostaglandins Other Lipid Mediat, 56: 167-181, 1998. 126

87. Howe, L. R., Chang, S. H., Tolle, K. C, Dillon, R., Young, L. J., Cardiff, R. D.,

Newman, R. A., Yang, P., Thaler, H. T., Muller, W. J., Hudis, C, Brown, A. M., Hla,

T., Subbaramaiah, K., and Dannenberg, A. J. HER2/neu-induced mammary

tumorigenesis and angiogenesis are reduced in cyclooxygenase-2 knockout mice.

Cancer Res, 65: 10113-10119, 2005.

88. Liu, C. H., Chang, S. H., Narko, K., Trifan, O. C, Wu, M. T., Smith, E., Haudenschild,

C, Lane, T. F., and Hla, T. Overexpression of cyclooxygenase-2 is sufficient to induce

tumorigenesis in transgenic mice. J Biol Chem, 276: 18563-18569, 2001.

89. Narko, K., Zweifel, B., Trifan, O., Ristimaki, A., Lane, T. F., and Hla, T. COX-2

inhibitors and genetic background reduce mammary tumorigenesis in cyclooxygenase-2

transgenic mice. Prostaglandins Other Lipid Mediat, 76: 86-94, 2005.

90. Muller-Decker, K., Berger, I., Ackermann, K., Ehemann, V., Zoubova, S., Aulmann, S.,

Pyerin, W., and Furstenberger, G. Cystic duct dilatations and proliferative epithelial

lesions in mouse mammary glands upon keratin 5 promoter-driven overexpression of

cyclooxygenase-2. Am J Pathol, 166: 575-584, 2005.

91. McCormick, D. L. and Moon, R. C. Inhibition of mammary carcinogenesis by

flurbiprofen, a non-steroidal antiinflammatory agent. Br J Cancer, 48: 859-861,1983.

92. McCormick, D. L., Madigan, M. J., and Moon, R. C. Modulation of rat mammary

carcinogenesis by indomethacin. Cancer Res, 45: 1803-1808, 1985.

93. Noguchi, M., Taniya, T., Koyasaki, N., Kumaki, T., Miyazaki, I., and Mizukami, Y.

Effects of the prostaglandin synthetase inhibitor indomethacin on tumorigenesis, tumor

proliferation, cell kinetics, and receptor contents of 7,12-dimethylbenz(a)anthracene- 127

induced mammary carcinoma in Sprague-Dawley rats fed a high- or low-fat diet.

Cancer Res, 57: 2683-2689, 1991.

94. Carter, C. A., Ip, M. M., and Ip, C. A comparison of the effects of the prostaglandin

synthesis inhibitors indomethacin and carprofen on 7,12-dimethylbenz[a]anthracene-

induced mammary tumorigenesis in rats fed different amounts of essential fatty acid.

Carcinogenesis, 10: 1369-1374,1989.

95. Alshafie, G. A., Harris, R. E., Robertson, F. M., Parrett, M. L., Ross, M., and Abou-

Issa, H. Comparative chemopreventive activity of ibuprofen and N-(4-hydroxyphenyl)

retinamide against the development and growth of rat mammary adenocarcinomas.

Anticancer Res, 19: 3031-3036, 1999.

96. Robertson, F. M., Parrett, M. L., Joarder, F. S., Ross, M., Abou-Issa, H. M, Alshafie,

G., and Harris, R. E. Ibuprofen-induced inhibition of cyclooxygenase isoform gene

expression and regression of rat mammary carcinomas. Cancer Lett, 122: 165-175,

1998.

97. Mori, H., Sugie, S., Rahman, W., and Suzui, N. Chemoprevention of 2-amino-l-methyl-

6-phenylimidazo [4,5-b]pyridine-induced mammary carcinogenesis in rats. Cancer Lett,

143: 195-198, 1999.

98. Nagasawa, H. and Naito, T. Inhibition by indomethacin of spontaneous mammary

tumorigenesis in SHN mice. Breast Cancer Res Treat, 8: 249-255, 1986.

99. Abou-el-Ela, S. H., Prasse, K. W., Farrell, R. L., Carroll, R. W., Wade, A. E., and

Bunce, 0. R. Effects of D,L-2-difluoromethylornithine and indomethacin on mammary

tumor promotion in rats fed high n-3 and/or n-6 fat diets. Cancer Res, 49: 1434-1440,

1989. 128

100. Kitagawa, H. and Noguchi, M. Comparative effects of piroxicam and esculetin on

incidence, proliferation, and cell kinetics of mammary carcinomas induced by 7,12-

dimethylbenz[a]anthracene in rats on high- and low-fat diets. Oncology, 51: 401-410,

1994.

101. Howe, L. R., Subbaramaiah, K., Patel, J., Masferrer, J. L., Deora, A., Hudis, C, Thaler,

H. T., Muller, W. J., Du, B., Brown, A. M, and Dannenberg, A. J. Celecoxib, a

selective cyclooxygenase 2 inhibitor, protects against human epidermal growth factor

receptor 2 (HER-2)/neu-induced breast cancer. Cancer Res, 62: 5405-5407, 2002.

102. Matsunaga, K., Yoshimi, N., Yamada, Y., Shimizu, M., Kawabata, K., Ozawa, Y.,

Hara, A., and Mori, H. Inhibitory effects of nabumetone, a cyclooxygenase-2 inhibitor,

and esculetin, a lipoxygenase inhibitor, on N-methyl-N-nitrosourea-induced mammary

carcinogenesis in rats. Jpn J Cancer Res, 89: 496-501, 1998.

103. Kubatka, P., Ahlers, I., Ahlersova, E., Adamekova, E., Luk, P., Bojkova, B., and

Markova, M. Chemoprevention of mammary carcinogenesis in female rats by

rofecoxib. Cancer Lett, 202: 131-136, 2003.

104. Jang, T. J., Jung, H. G., Jung, K. H., and O, M. K. Chemopreventive effect of celecoxib

and expression of cyclooxygenase-1 and cyclooxygenase-2 on chemically-induced rat

mammary tumours. Int J Exp Pathol, 83: 173-182, 2002.

105. Abou-Issa, H. M., Alshafie, G. A., Seibert, K., Koki, A. T., Masferrer, J. L., and Harris,

R. E. Dose-response effects of the COX-2 inhibitor, celecoxib, on the chemoprevention

of mammary carcinogenesis. Anticancer Res, 21: 3425-3432, 2001.

106. Nakatsugi, S., Ohta, T., Kawamori, T., Mutoh, M., Tanigawa, T., Watanabe, K., Sugie,

S., Sugimura, T., and Wakabayashi, K. Chemoprevention by nimesulide, a selective 129

cyclooxygenase-2 inhibitor, of 2-amino-l-methyl-6-phenylimidazo[4,5-b]pyridine

(PhlP)-induced mammary gland carcinogenesis in rats. Jpn J Cancer Res, 91: 886-892,

2000.

107. Harris, R. E., Alshafie, G. A., Abou-Issa, H., and Seibert, K. Chemoprevention of breast

cancer in rats by celecoxib, a cyclooxygenase 2 inhibitor. Cancer Res., 60: 2101-2103,

2000.

108. Kubatka, P., Kalicka, K., Chamilova, M., Ahlersova, E., Ahlers, I., Bojkova, B., and

Adamekova, E. Nimesulide and melatonin in mammary carcinogenesis prevention in

female Sprague-Dawley rats. Neoplasma, 49: 255-259, 2002.

109. Thompson, H. J. and Singh, M. Rat models of premalignant breast disease. J Mammary

Gland Biol Neoplasia, 5: 409-420, 2000.

110. Lu, S., Zhang, X., Badawi, A., El-Sohemy, A., and Archer, M. C. Cyclooxygenase-2

inhibitor celecoxib inhibits promotion of mammary tumorigenesis in rats fed a high fat

diet rich in n-6 polyunsaturated fatty acids. Cancer Lett., 184: 7-12, 2002.

111. Singh, B. and Lucci, A. Role of cyclooxygenase-2 in breast cancer. J Surg Res, 108:

173-179,2002.

112. Wiese, F. W., Thompson, P. A., and Kadlubar, F. F. Carcinogen substrate specificity of

human COX-1 and COX-2. Carcinogenesis, 22: 5-10, 2001.

113. Marnett, L. J. Aspirin and the potential role of prostaglandins in colon cancer. Cancer

Res, 52: 5575-5589, 1992.

114. Abbadessa, G., Spaccamiglio, A., Sartori, M. L., Nebbia, C, Dacasto, M., Di Carlo, F.,

and Racca, S. The aspirin metabolite, salicylate, inhibits 7,12- 130

dimethylbenz[a]anthracene-DNA adduct formation in breast cancer cells. Int J Oncol,

28: 1131-1140,2006.

115. Singh, B., Vincent, L., Berry, J. A., Multani, A. S., and Lucci, A. Cyclooxygenase-2

expression induces genomic instability in MCF10A breast epithelial cells. J Surg Res,

140: 220-226, 2007.

116. Wagner, T. M., Mullally, J. E., and Fitzpatrick, F. A. Reactive lipid species from

cyclooxygenase-2 inactivate tumor suppressor LKB1/STK11: cyclopentenone

prostaglandins and 4-hydroxy-2-nonenal covalently modify and inhibit the AMP-kinase

kinase that modulates cellular energy homeostasis and protein translation. J Biol Chem,

281: 2598-2604, 2006.

117. Howe, L. R., Subbaramaiah, K., Brown, A. M., and Dannenberg, A. J. Cyclooxygenase-

2: a target for the prevention and treatment of breast cancer. Endocr Relat Cancer, 8:

97-114,2001.

118. Zhao, Y., Agarwal, V. R., Mendelson, C. R., and Simpson, E. R. Estrogen biosynthesis

proximal to a breast tumor is stimulated by PGE2 via cyclic AMP, leading to activation

of promoter II of the CYP19 (aromatase) gene. Endocrinology, 137: 5739-5742, 1996.

119. Richards, J. A. and Brueggemeier, R. W. Prostaglandin E2 regulates aromatase activity

and expression in human adipose stromal cells via two distinct receptor subtypes. J Clin

Endocrinol Metab, 88: 2810-2816, 2003.

120. Schrey, M. P. and Patel, K. V. Prostaglandin E2 production and metabolism in human

breast cancer cells and breast fibroblasts. Regulation by inflammatory mediators. Br J

Cancer, 72: 1412-1419,1995. 131

121. Mitchell, M. D., Cleland, W. H., Smith, M. E., Simpson, E. R., and Mendelson, C. R.

Inhibition of prostaglandin biosynthesis in human adipose tissue by

glucocorticosteroids. J Clin Endocrinol Metab, 57: 771-776, 1983.

122. Purohit, A., Ghilchik, M. W., Duncan, L., Wang, D. Y., Singh, A., Walker, M. M., and

Reed, M. J. Aromatase activity and interleukin-6 production by normal and malignant

breast tissues. J Clin Endocrinol Metab, 80: 3052-3058,1995.

123. Brueggemeier, R. W., Diaz-Cruz, E. S., Li, P. K., Sugimoto, Y., Lin, Y. C, and

Shapiro, C. L. Translational studies on aromatase, cyclooxygenases, and enzyme

inhibitors in breast cancer. J Steroid Biochem Mol Biol, 95: 129-136,2005.

124. Su, B., Landini, S., Davis, D. D., and Brueggemeier, R. W. Synthesis and biological

evaluation of selective aromatase expression regulators in breast cancer cells. J Med

Chem,50: 1635-1644,2007.

125. Prosperi, J. R. and Robertson, F. M. Cyclooxygenase-2 directly regulates gene

expression of P450 Cypl9 aromatase promoter regions pll, pi.3 and pi.7 and estradiol

production in human breast tumor cells. Prostaglandins Other Lipid Mediat, 81: 55-70,

2006.

126. Subbaramaiah, K., Howe, L. R., Port, E. R., Brogi, E., Fishman, J., Liu, C. H., Hla, T.,

Hudis, C, and Dannenberg, A. J. HER-2/neu status is a determinant of mammary

aromatase activity in vivo: evidence for a cyclooxygenase-2-dependent mechanism.

Cancer Res, 66: 5504-5511, 2006.

127. Huang, M., Sharma, S., Mao, J. T., and Dubinett, S. M. Non-small cell lung cancer-

derived soluble mediators and prostaglandin E2 enhance peripheral blood lymphocyte

IL-10 transcription and protein production. J Immunol, 157: 5512-5520, 1996. 132

128. Kundu, N., Walser, T. C, Ma, X., and Fulton, A. M. Cyclooxygenase inhibitors

modulate NK activities that control metastatic disease. Cancer Immunol Immunother,

54: 981-987, 2005.

129. Abdelrahim, M. and Safe, S. Cyclooxygenase-2 inhibitors decrease vascular endothelial

growth factor expression in colon cancer cells by enhanced degradation of Spl and Sp4

proteins. Mol Pharmacol, 68: 317-329, 2005.

130. Chang, S. H., Liu, C. H., Conway, R., Han, D. K., Nithipatikom, K., Trifan, O. C,

Lane, T. F., and Hla, T. Role of prostaglandin E2-dependent angiogenic switch in

cyclooxygenase 2-induced breast cancer progression. Proc Natl Acad Sci U S A, 101:

591-596, 2004.

131. Chang, S. H., Ai, Y., Breyer, R. M., Lane, T. F., and Hla, T. The prostaglandin E2

receptor EP2 is required for cyclooxygenase 2-mediated mammary hyperplasia. Cancer

Res, 65: 4496-4499,2005.

132. Kawamori, T., Uchiya, N., Nakatsugi, S., Watanabe, K., Ohuchida, S., Yamamoto, H.,

Maruyama, T., Kondo, K., Sugimura, T., and Wakabayashi, K. Chemopreventive

effects of ONO-8711, a selective prostaglandin E receptor EP(1) antagonist, on breast

cancer development. Carcinogenesis, 22: 2001-2004, 2001.

133. Ma, X., Kundu, N., Rifat, S., Walser, T., and Fulton, A. M. Prostaglandin E receptor

EP4 antagonism inhibits breast cancer metastasis. Cancer Res, 66: 2923-2927, 2006.

134. Timoshenko, A. V., Xu, G., Chakrabarti, S., Lala, P. K., and Chakraborty, C. Role of

prostaglandin E2 receptors in migration of murine and human breast cancer cells. Exp

Cell Res, 289: 265-274, 2003. 133

135. Timoshenko, A. V., Lala, P. K., and Chakraborty, C. PGE2-mediated upregulation of

iNOS in murine breast cancer cells through the activation of EP4 receptors. Int J

Cancer, 108: 384-389, 2004.

136. Timoshenko, A. V., Chakraborty, C, Wagner, G. F., and Lala, P. K. COX-2-mediated

stimulation of the lymphangiogenic factor VEGF-C in human breast cancer. Br J

Cancer, 94: 1154-1163, 2006.

137. Piazza, G. A., Alberts, D. S., Hixson, L. J., Paranka, N. S., Li, H., Finn, T., Bogert, C,

Guillen, J. M., Brendel, K., Gross, P. FL, Sperl, G., Ritchie, J., Burt, R. W., Ellsworth,

L., Ahnen, D. J., and Pamukcu, R. Sulindac sulfone inhibits azoxymethane-induced

colon carcinogenesis in rats without reducing prostaglandin levels. Cancer Res, 57:

2909-2915, 1997.

138. Hanif, R., Pittas, A., Feng, Y., Koutsos, M. I., Qiao, L., Staiano-Coico, L., Shiff, S. I.,

and Rigas, B. Effects of nonsteroidal anti-inflammatory drugs on proliferation and on

induction of apoptosis in colon cancer cells by a prostaglandin-independent pathway.

Biochem Pharmacol, 52: 237-245,1996.

139. Kundu, N. and Fulton, A. M. Selective cyclooxygenase (COX)-l or COX-2 inhibitors

control metastatic disease in a murine model of breast cancer. Cancer Res, 62: 2343-

2346,2002.

140. Lehmann, J. M., Lenhard, J. M., Oliver, B. B., Ringold, G. M., and Kliewer, S. A.

Peroxisome proliferator-activated receptors alpha and gamma are activated by

indomethacin and other non-steroidal anti-inflammatory drugs. J. Biol. Chem., 272:

3406-3410,1997. 134

141. Shureiqi, I., Jiang, W., Fisher, S. M., Xu, X., Chen, D., Lee, J. J., Lotan, R., and

Lippman, S. M. GATA-6 transcriptional regulation of 15-lipoxygenase-1 during

NSAID-induced apoptosis in colorectal cancer cells. Cancer Res., 62: 1178-1183, 2002.

142. Takahashi, T., Ogawa, Y., Kitaoka, K., Tani, T., Uemura, Y., Taguchi, H., Kobayashi,

T., Seguchi, H., Yamamoto, H., and Yoshida, S. Selective COX-2 inhibitor regulates

the MAP kinase signaling pathway in human osteoarthritic chondrocytes after induction

of nitric oxide. Int. J. Mol. Med., 15: 213-219, 2005.

143. Arico, S., Pattingre, S., Bauvy, C, Gane, P., Barbat, A., Codogno, P., and Ogier-Denis,

E. Celecoxib induces apoptosis by inhibiting 3-phosphoinositide-dependent protein

kinase-1 activity in the humancolon cancer HT-29 cell line. J. Biol. Chem., 277: 27613-

27621,2002.

144. Kopp, E. and Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin.

Science, 265: 956-959, 1994.

145. Law, B. K., Waltner-Law, M. E., Entingh, A. J., Chytil, A., Aakre, M. E., Norgaard, P.,

and Moses, H. L. Salicylate-induced growth arrest is associated with inhibition of

p70s6k and down-regulation of c-myc, cyclin Dl, cyclin A, and proliferating cell

nuclear antigen. J. Biol. Chem., 275: 38261-38267, 2000.

146. Herrmann, C, Block, C, Geisen, C, Haas, K., Weber, C, Winde, G., Moroy, T., and

Muller, O. Sulindac sulfide inhibits Ras signaling. Oncogene, 17: 1769-1776, 1998.

147. Thompson, H. J., Jiang, C, Lu, J., Mehta, R. G., Piazza, G. A., Paranka, N. S.,

Pamukcu, R., and Ahnen, D. J. Sulfone metabolite of sulindac inhibits mammary

carcinogenesis. Cancer Res, 57: 267-271, 1997. 135

148. Su, B., Diaz-Cruz, E. S., Landini, S., and Brueggemeier, R. W. Novel sulfonanilide

analogues suppress aromatase expression and activity in breast cancer cells independent

of COX-2 inhibition. J Med Chem, 49: 1413-1419, 2006.

149. Teh, S. H., Hill, A. K., Foley, D. A., McDermott, E. W., O'Higgins, N. J., and Young,

L. S. COX inhibitors modulate bFGF-induced cell survival in MCF-7 breast cancer

cells. J Cell Biochem, 91: 796-807, 2004.

150. van Wijngaarden, J., van Beek, E., van Rossum, G., van der Bent, C, Hoekman, K., van

der Pluijm, G., van der Pol, M. A., Broxterman, H. J., van Hinsbergh, V. W., and

Lowik, C. W. Celecoxib enhances doxorubicin-induced cytotoxicity in MDA-MB231

cells by NF-kappaB-mediated increase of intracellular doxorubicin accumulation. Eur J

Cancer, 43: 433-442, 2007.

151. Kumar, R., Vadlamudi, R. K., and Adam, L. Apoptosis in mammary gland and cancer.

Endocr Relat Cancer, 7: 257-269, 2000.

152. Tsujii, M. and DuBois, R. N. Alterations in cellular adhesion and apoptosis in epithelial

cells overexpressing prostaglandin endoperoxide synthase 2. Cell, 83: 493-501, 1995.

153. Sul, H. S. and Wang, D. Nutritional and hormonal regualtion of enzymes in fat

synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate

acyltransferase gene transcription. Annu. Rev. Nutr., 18: 331-351, 1998.

154. Wakil, S. J., Stoops, J. K., and Joshi, V. C. Fatty acid synthesis and its regulation. Annu

Rev Biochem, 52: 537-579, 1983.

155. Hatzivassiliou, G., Zhao, F., Bauer, D. E., Andreadis, C, Shaw, A. N., Dhanak, D.,

Hingorani, S. R., Tuveson, D. A., and Thompson, C. B. ATP citrate lyase inhibition can

suppress tumor cell growth. Cancer Cell, 8: 311-321, 2005. 136

156. Zhou, W., Simpson, P. J., McFadden, J. M, Townsend, C. A., Medghalchi, S. M.,

Vadlamudi, A., Pinn, M. L., Ronnett, G. V., and Kuhajda, F. P. Fatty acid synthase

inhibition triggers apoptosis during S phase in human cancer cells. Cancer Res, 63:

7330-7337,2003.

157. Pizer, E. S., Wood, F. D., Heine, H. S., Romantsev, F. E., Pasternack, G. R., and

Kuhajda, F. P. Inhibition of fatty acid synthesis delays disease progression in a

xenograft model of ovarian cancer. Cancer Res, 56: 1189-1193, 1996.

158. Kuhajda, F. P., Jenner, K., Wood, F. D., Hennigar, R. A., Jacobs, L. B., Dick, J. D., and

Pasternack, G. R. Fatty acid synthesis: a potential selective target for antineoplastic

therapy. Proc Natl Acad Sci USA, 91: 6379-6383, 1994.

159. Thupari, J. N., Landree, L. E., Ronnett, G. V., and Kuhajda, F. P. C75 increases

peripheral energy utilization and fatty acid oxidation in diet-induced obesity. Proc Natl

Acad Sci USA, 99: 9498-9502, 2002.

160. Kridel, S. J., Axelrod, F., Rozenkrantz, N., and Smith, J. W. Orlistat is a novel inhibitor

of fatty acid synthase with antitumor activity. Cancer Res, 64: 2070-2075, 2004.

161. Ackroff, K. and Sclafani, A. Effects of the lipase inhibitor orlistat on intake and

preference for dietary fat in rats. Am J Physiol, 271: R48-54, 1996.

162. Liu, B., Wang, Y., Fillgrove, K. L., and Anderson, V. E. Triclosan inhibits enoyl-

reductase of type I fatty acid synthase in vitro and is cytotoxic to MCF-7 and SKBr-3

breast cancer cells. Cancer Chemother Pharmacol, 49: 187-193, 2002.

163. Tian, W. X. Inhibition of fatty acid synthase by polyphenols. Curr Med Chem, 13: 967-

977, 2006. 137

164. Hillgartner, F. B., Salati, L. M., and Goodridge, A. G. Physiological and molecular

mechanisms involved in nutritional regulation of fatty acid synthesis. Physiol Rev, 75:

47-76, 1995.

165. Lakshmanan, M. R., Nepokroeff, C. M., and Porter, J. W. Control of the synthesis of

fatty-acid synthetase in rat liver by insulin, glucagon, and adenosine 3':5' cyclic

monophosphate. ProcNatl Acad Sci USA, 69: 3516-3519,1972.

166. Paulauskis, J. D. and Sul, H. S. Hormonal regulation of mouse fatty acid synthase gene

transcription in liver. J Biol Chem, 264: 574-577, 1989.

167. Soncini, M, Yet, S. F., Moon, Y., Chun, J. Y., and Sul, H. S. Hormonal and nutritional

control of the fatty acid synthase promoter in transgenic mice. J Biol Chem, 270:

30339-30343, 1995.

168. Adamson, A. W., Suchankova, G., Rufo, C, Nakamura, M. T., Teran-Garcia, M.,

Clarke, S. D., and Gettys, T. W. Hepatocyte nuclear factor-4alpha contributes to

carbohydrate-induced transcriptional activation of hepatic fatty acid synthase. Biochem

J, 399: 285-295, 2006.

169. Fleischmann, M. and Iynedjian, P. B. Regulation of sterol regulatory-element binding

protein 1 gene expression in liver: role of insulin and protein kinase B/cAkt. Biochem J,

349: 13-17, 2000.

170. Liang, G., Yang, J., Horton, J. D., Hammer, R. E., Goldstein, J. L., and Brown, M. S.

Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice

with selective deficiency of sterol regulatory element-binding protein-lc. J Biol Chem,

277: 9520-9528, 2002. 138

171. Shimano, H., Yahagi, N., Amemiya-Kudo, M., Hasty, A. H., Osuga, J., Tamura, Y.,

Shionoiri, F., Iizuka, Y., Ohashi, K., Harada, K., Gotoda, T., Ishibashi, S., and Yamada,

N. Sterol regulatory element-binding protein-1 as a key transcription factor for

nutritional induction of lipogenic enzyme genes. J Biol Chem, 274: 35832-35839, 1999.

172. Kim, J. B., Sarraf, P., Wright, M., Yao, K. M., Mueller, E., Solanes, G., Lowell, B. B.,

and Spiegelman, B. M. Nutritional and insulin regulation of fatty acid synthetase and

leptin gene expression through ADD1/SREBP1. J Clin Invest, 101: 1-9, 1998.

173. Foretz, M., Pacot, C, Dugail, I., Lemarchand, P., Guichard, C, Le Liepvre, X.,

Berthelier-Lubrano, C, Spiegelman, B., Kim, J. B., Ferre, P., and Foufelle, F.

ADDl/SREBP-lc is required in the activation of hepatic lipogenic gene expression by

glucose. Mol Cell Biol, 19: 3760-3768, 1999.

174. Azzout-Marniche, D., Becard, D., Guichard, C, Foretz, M., Ferre, P., and Foufelle, F.

Insulin effects on sterol regulatory-element-binding protein-lc (SREBP-lc)

transcriptional activity in rat hepatocytes. Biochem J, 350 Pt 2: 389-393, 2000.

175. Roth, G., Kotzka, J., Kremer, L., Lehr, S., Lohaus, C, Meyer, H. E., Krone, W., and

Muller-Wieland, D. MAP kinases Erkl/2 phosphorylate sterol regulatory element-

binding protein (SREBP)-la at serine 117 in vitro. J Biol Chem, 275: 33302-33307,

2000.

176. Wang, D. and Sul, H. S. Insulin stimulation of the fatty acid synthase promoter is

mediated by the phosphatidylinositol 3-kinase pathway. Involvement of protein kinase

B/Akt. J. Biol. Chem., 273: 25420-25426, 1998.

177. Latasa, M. J., Moon, Y. S., Kim, K. H., and Sul, H. S. Nutritional regulation of the fatty

acid synthase promoter in vivo: sterol regulatory element binding protein functions 139

through an upstream region containing a sterol regulatory element. Proc Natl Acad Sci

USA, 97: 10619-10624, 2000.

178. Stoeckman, A. K. and Towle, H. C. The role of SREBP-lc in nutritional regulation of

lipogenic enzyme gene expression. J Biol Chem, 277: 27029-27035, 2002.

179. Latasa, M. J., Griffin, M. J., Moon, Y. S., Kang, C, and Sul, H. S. Occupancy and

function of the -150 sterol regulatory element and -65 E-box in nutritional regulation of

the fatty acid synthase gene in living animals. Mol Cell Biol, 23: 5896-5907, 2003.

180. Magana, M. M., Koo, S. H., Towle, H. C, and Osborne, T. F. Different sterol

regulatory element-binding protein-1 isoforms utilize distinct co-regulatory factors to

activate the promoter for fatty acid synthase. J Biol Chem, 275: 4726-4733, 2000.

181. Klemm, D. J., Roesler, W. J., Boras, T., Colton, L. A., Felder, K., and Reusch, J. E.

Insulin stimulates cAMP-response element binding protein activity in HepG2 and 3T3-

Ll cell lines. J. Biol. Chem., 273: 917-923, 1998.

182. Wang, D. and Sul, H. S. Upstream stimulatory factors bind to insulin response sequence

of the fatty acid synthase promoter. USF1 is regulated. J Biol Chem, 270: 28716-28722,

1995.

183. Casado, M., Vallet, V. S., Kahn, A., and Vaulont, S. Essential role in vivo of upstream

stimulatory factors for a normal dietary response of the fatty acid synthase gene in the

liver. J Biol Chem, 274: 2009-2013, 1999.

184. Ishii, S., Iizuka, K., Miller, B. C, and Uyeda, K. Carbohydrate response element

binding protein directly promotes lipogenic enzyme gene transcription. Proc Natl Acad

Sci USA, 101: 15597-15602, 2004. 140

185. Iizuka, K., Bruick, R. K., Liang, G., Horton, J. D., and Uyeda, K. Deficiency of

carbohydrate response element-binding protein (ChREBP) reduces lipogenesis as well

as glycolysis. Proc Natl Acad Sci USA, 101: 7281-7286, 2004.

186. Wang, D. and Sul, H. S. Upstream stimulatory factor binding to the E-box at -65 is

required for insulin regulation of the fatty acid synthase promoter. J Biol Chem, 272:

26367'-2637'4,1997.

187. Xiong, Y., Collins, Q. F., An, J., Lupo, E., Jr., Liu, H. Y., Liu, D., Robidoux, J., Liu, Z.,

and Cao, W. p38 mitogen-activated protein kinase plays an inhibitory role in hepatic

lipogenesis. J Biol Chem, 282: 4975-4982, 2007.

188. Kim, H. J., Takahashi, M., and Ezaki, O. Fish oil feeding decreases mature sterol

regulatory element-binding protein 1 (SREBP-1) by down-regulation of SREBP-lc

mRNA in mouse liver. A possible mechanism for down-regulation of lipogenic enzyme

mrnas. J Biol Chem, 274: 25892-25898, 1999.

189. Thewke, D. P., Panini, S. R., and Sinensky, M. Oleate potentiates oxysterol inhibition

of transcription from sterol regulatory element-1-regulated promoters and maturation of

sterol regulatory element-binding proteins. J Biol Chem, 273: 21402-21407, 1998.

190. Xu, J., Nakamura, M. T., Cho, H. P., and Clarke, S. D. Sterol regulatory element

binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A

mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats. J

Biol Chem, 274: 23577-23583, 1999.

191. Yahagi, N., Shimano, H., Hasty, A. H., Amemiya-Kudo, M., Okazaki, H., Tamura, Y.,

Iizuka, Y., Shionoiri, F., Ohashi, K., Osuga, J., Harada, K., Gotoda, T., Nagai, R.,

Ishibashi, S., and Yamada, N. A crucial role of sterol regulatory element-binding 141

protein-1 in the regulation of lipogenic gene expression by polyunsaturated fatty acids. J

Biol Chem, 274: 35840-35844,1999.

192. Nakatani, T., Kim, H. J., Kaburagi, Y., Yasuda, K., and Ezaki, O. A low fish oil inhibits

SREBP-1 proteolytic cascade, while a high-fish-oil feeding decreases SREBP-1 mRNA

in mice liver: relationship to anti-obesity. J Lipid Res, 44: 369-379, 2003.

193. Moon, Y. S., Latasa, M. J., Griffin, M. J., and Sul, H. S. Suppression of fatty acid

synthase promoter by polyunsaturated fatty acids. J Lipid Res, 43: 691-698, 2002.

194. Sekiya, M., Yahagi, N., Matsuzaka, T., Najima, Y., Nakakuki, M., Nagai, R., Ishibashi,

S., Osuga, J., Yamada, N., and Shimano, H. Polyunsaturated fatty acids ameliorate

hepatic steatosis in obese mice by SREBP-1 suppression. Hepatology, 38: 1529-1539,

2003.

195. Teran-Garcia, M., Adamson, A. W., Yu, G., Rufo, C., Suchankova, G., Dreesen, T. D.,

Tekle, M., Clarke, S. D., and Gettys, T. W. Polyunsaturated fatty acid suppression of

fatty acid synthase (FASN): evidence for dietary modulation of NF-Y binding to the

Fasn promoter by SREBP-1 c. Biochem J, 402: 591-600, 2007.

196. Dentin, R., Benhamed, F., Pegorier, J. P., Foufelle, F., Viollet, B., Vaulont, S., Girard,

J., and Postic, C. Polyunsaturated fatty acids suppress glycolytic and lipogenic genes

through the inhibition of ChREBP nuclear protein translocation. J Clin Invest, 115:

2843-2854, 2005.

197. Lopez, M., Lelliott, C. J., Tovar, S., Kimber, W., Gallego, R., Virtue, S., Blount, M.,

Vazquez, M. J., Finer, N., Powles, T. J., O'Rahilly, S., Saha, A. K., Dieguez, C, and

Vidal-Puig, A. J. Tamoxifen-induced anorexia is associated with fatty acid synthase 142

inhibition in the ventromedial nucleus of the hypothalamus and accumulation of

malonyl-CoA. Diabetes, 55: 1327-1336, 2006.

198. Thupari, J. N., Kim, E. K., Moran, T. H., Ronnett, G. V., and Kuhajda, F. P. Chronic

C75 treatment of diet-induced obese mice increases fat oxidation and reduces food

intake to reduce adipose mass. Am J Physiol Endocrinol Metab, 287: E97-E104, 2004.

199. Cha, S. H., Hu, Z., Chohnan, S., and Lane, M. D. Inhibition of hypothalamic fatty acid

synthase triggers rapid activation of fatty acid oxidation in skeletal muscle. Proc Natl

Acad Sci USA, 102: 14557-14562, 2005.

200. Cha, S. H., Hu, Z., and Lane, M. D. Long-term effects of a fatty acid synthase inhibitor

on obese mice: food intake, hypothalamic neuropeptides, and UCP3. Biochem Biophys

Res Commun, 317: 301-308, 2004.

201. Tu, Y., Thupari, J. N., Kim, E. K., Pinn, M. L., Moran, T. H., Ronnett, G. V., and

Kuhajda, F. P. C75 alters central and peripheral gene expression to reduce food intake

and increase energy expenditure. Endocrinology, 146: 486-493, 2005.

202. Du, Y. T., Wang, X., Wu, X. D., and Tian, W. X. Keemun black tea extract contains

potent fatty acid synthase inhibitors and reduces food intake and body weight of rats via

oral administration. J Enzyme Inhib Med Chem, 20: 349-356, 2005.

203. Ikeda, I., Hamamoto, R., Uzu, K., Imaizumi, K., Nagao, K., Yanagita, T., Suzuki, Y.,

Kobayashi, M., and Kakuda, T. Dietary gallate esters of tea catechins reduce deposition

of visceral fat, hepatic triacylglycerol, and activities of hepatic enzymes related to fatty

acid synthesis in rats. Biosci Biotechnol Biochem, 69: 1049-1053, 2005. 143

204. Schmid, B., Rippmann, J. F., Tadayyon, M., and Hamilton, B. S. Inhibition of fatty acid

synthase prevents preadipocyte differentiation. Biochem Biophys Res Commun, 328:

1073-1082,2005.

205. Kuhajda, F. P., Piantadosi, S., and Pasternack, G. R. Haptoglobin-related protein (Hpr)

epitopes in breast cancer as a predictor of recurrence of the disease. N Engl J Med, 321:

636-641,1989.

206. Jensen, V., Ladekarl, M., Holm-Nielsen, P., Melsen, F., and Soerensen, F. B. The

prognostic value of oncogenic antigen 519 (OA-519) expression and proliferative

activity detected by antibody MIB-1 in node-negative breast cancer. J Pathol, 176: 343-

352, 1995.

207. Rashid, A., Pizer, E. S., Moga, M., Milgraum, L. Z., Zahurak, M., Pasternack, G. R.,

Kuhajda, F. P., and Hamilton, S. R. Elevated expression of fatty acid synthase and fatty

acid synthetic activity in colorectal neoplasia. Am J Pathol, 150: 201-208, 1997.

208. Visca, P., Alo, P. L., Del Nonno, F., Botti, C., Trombetta, G., Marandino, F., Filippi, S.,

Di Tondo, U., and Donnorso, R. P. Immunohistochemical expression of fatty acid

synthase, apoptotic-regulating genes, proliferating factors, and ras protein product in

colorectal adenomas, carcinomas, and adjacent nonneoplastic mucosa. Clin Cancer Res,

5:4111-4118,1999.

209. Rossi, S., Graner, E., Febbo, P., Weinstein, L., Bhattacharya, N., Onody, T., Bubley, G.,

Balk, S., and Loda, M. Fatty acid synthase expression defines distinct molecular

signatures in prostate cancer. Mol Cancer Res, 1: 707-715, 2003. 144

210. Pflug, B. R., Pecher, S. M., Brink, A. W., Nelson, J. B., and Foster, B. A. Increased

fatty acid synthase expression and activity during progression of prostate cancer in the

TRAMP model. Prostate, 57: 245-254, 2003.

211. Swinnen, J. V., Roskams, T., Joniau, S., Van Poppel, H., Oyen, R., Baert, L., Heyns,

W., and Verhoeven, G. Overexpression of fatty acid synthase is an early and common

event in the development of prostate cancer. Int J Cancer, 98: 19-22, 2002.

212. Evert, M., Schneider-Stock, R., and Dombrowski, F. Overexpression of fatty acid

synthase in chemically and hormonally induced hepatocarcinogenesis of the rat. Lab

Invest, 85: 99-108, 2005.

213. Nemoto, T., Terashima, S., Kogure, M., Hoshino, Y., Kusakabe, T., Suzuki, T., and

Gotoh, M. Overexpression of fatty acid synthase in oesophageal squamous cell

dysplasia and carcinoma. Pathobiology, 69: 297-303, 2001.

214. Turyn, J., Schlichtholz, B., Dettlaff-Pokora, A., Presler, M., Goyke, E., Matuszewski,

M., Kmiec, Z., Krajka, K., and Swierczynski, J. Increased activity of glycerol 3-

phosphate dehydrogenase and other lipogenic enzymes in human bladder cancer. Horm

Metab Res, 35: 565-569, 2003.

215. Milgraum, L. Z., Witters, L. A., Pasternack, G. R., and Kuhajda, F. P. Enzymes of the

fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clin

Cancer Res, 3: 2115-2120, 1997.

216. Esslimani-Sahla, M., Thezenas, S., Simony-Lafontaine, J., Kramar, A., Lavaill, R.,

Chalbos, D., and Rochefort, H. Increased expression of fatty acid synthase and

progesterone receptor in early steps of human mammary carcinogenesis. Int J Cancer,

120: 224-229, 2007. 145

217. Hennigar, R. A., Pochet, M., Hunt, D. A., Lukacher, A. E., Venema, V. J., Seal, E., and

Marrero, M. B. Characterization of fatty acid synthase in cell lines derived from

experimental mammary tumors. Biochim Biophys Acta, 1392: 85-100, 1998.

218. Alii, P. M., Pinn, M. L., Jaffee, E. M, McFadden, J. M., and Kuhajda, F. P. Fatty acid

synthase inhibitors are chemopreventive for mammary cancer in neu-N transgenic mice.

Oncogene, 24: 39-46, 2005.

219. Cognault, S., Germain, E., Bougnoux, P., and Lhuillery, C. Fatty acid synthase gene

expression in rat mammary carcinoma. Lipids, 34 Suppl: S223, 1999.

220. Alo, P. L., Visca, P., Marci, A., Mangoni, A., Botti, C, and Di Tondo, U. Expression of

fatty acid synthase (FAS) as a predictor of recurrence in stage I breast carcinoma

patients. Cancer, 77: 474-482,1996.

221. Alo, P. L., Visca, P., Trombetta, G., Mangoni, A., Lenti, L., Monaco, S., Botti, C,

Serpieri, D. E., and Di Tondo, U. Fatty acid synthase (FAS) predictive strength in

poorly differentiated early breast carcinomas. Tumori, 85: 35-40,1999.

222. Wang, Y., Kuhajda, F. P., Li, J. N., Pizer, E. S., Han, W. F., Sokoll, L. J., and Chan, D.

W. Fatty acid synthase (FAS) expression in human breast cancer cell culture

supernatants and in breast cancer patients. Cancer Lett, 167: 99-104, 2001.

223. Nakamura, I., Kimijima, I., Zhang, G. J., Onogi, H., Endo, Y., Suzuki, S., Tuchiya, A.,

Takenoshita, S., Kusakabe, T., and Suzuki, T. Fatty acid synthase expression in

Japanese breast carcinoma patients. Int J Mol Med, 4: 381-387, 1999.

224. Menendez, J. A., Mehmi, I., Atlas, E., Colomer, R., and Lupu, R. Novel signaling

molecules implicated in tumor-associated fatty acid synthase-dependent breast cancer

cell proliferation and survival: Role of exogenous dietary fatty acids, p53- 146

P21WAF1/CIP1, ERK1/2 MAPK, p27KIPl, BRCA1, and NF-kappaB. Int J Oncol, 24:

591-608, 2004.

225. Sinilnikova, O. M., Ginolhac, S. M., Magnard, C, Leone, M., Anczukow, O., Hughes,

D., Moreau, K., Thompson, D., Coutanson, C, Hall, J., Romestaing, P., Gerard, J. P.,

Bonadona, V., Lasset, C, Goldgar, D. E., Joulin, V., Venezia, N. D., and Lenoir, G. M.

Acetyl-CoA carboxylase alpha gene and breast cancer susceptibility. Carcinogenesis,

25: 2417-2424, 2004.

226. Kuhajda, F. P. Fatty-acid synthase and human cancer: new perspectives on its role in

tumor biology. Nutrition, 16: 202-208, 2000.

227. Jackowski, S. Coordination of membrane phospholipid synthesis with the cell cycle. J

Biol Chem, 269: 3858-3867, 1994.

228. Menendez, J. A., Oza, B. P., Colomer, R., and Lupu, R. The estrogenic activity of

synthetic progestins used in oral contraceptives enhances fatty acid synthase-dependent

breast cancer cell proliferation and survival. Int J Oncol, 26: 1507-1515, 2005.

229. Kalkhoven, E., Kwakkenbos-Isbrucker, L., de Laat, S. W., van der Saag, P. T., and van

der Burg, B. Synthetic progestins induce proliferation of breast tumor cell lines via the

progesterone or estrogen receptor. Mol Cell Endocrinol, 102: 45-52, 1994.

230. Pizer, E. S., Chrest, F. J., DiGiuseppe, J. A., and Han, W. F. Pharmacological inhibitors

of mammalian fatty acid synthase suppress DNA replication and induce apoptosis in

tumor cell lines. Cancer Res, 58: 4611-4615, 1998.

231. Knowles, L. M., Axelrod, F., Browne, C. D., and Smith, J. W. A fatty acid synthase

blockade induces tumor cell-cycle arrest by down-regulating Skp2. J Biol Chem, 279:

30540-30545, 2004. 147

232. Menendez, J. A., Vellon, L., and Lupu, R. Antitumoral actions of the anti-obesity drug

orlistat (XenicalTM) in breast cancer cells: blockade of cell cycle progression,

promotion of apoptotic cell death and PEA3-mediated transcriptional repression of

Her2/neu (erbB-2) oncogene. Ann Oncol, 16: 1253-1267, 2005.

233. Pizer, E. S., Jackisch, C, Wood, F. D., Pasternack, G. R., Davidson, N. E., and

Kuhajda, F. P. Inhibition of fatty acid synthesis induces programmed cell death in

human breast cancer cells. Cancer Res, 56: 2745-2747, 1996.

234. Menendez, J. A., Oza, B. P., Atlas, E., Verma, V. A., Mehmi, I., and Lupu, R. Inhibition

of tumor-associated fatty acid synthase activity antagonizes estradiol- and tamoxifen-

induced agonist transactivation of estrogen receptor (ER) in human endometrial

adenocarcinoma cells. Oncogene, 23: 4945-4958, 2004.

235. Menendez, J. A. and Lupu, R. RNA interference-mediated silencing of the p53 tumor-

suppressor protein drastically increases apoptosis after inhibition of endogenous fatty

acid metabolism in breast cancer cells. Int J Mol Med, 15: 33-40, 2005.

236. Menendez, J. A., Vellon, L., Mehmi, I., Oza, B. P., Ropero, S., Colomer, R., and Lupu,

R. Inhibition of fatty acid synthase (FAS) suppresses HER2/neu (erbB-2) oncogene

overexpression in cancer cells. Proc Natl Acad Sci U S A, 101: 10715-10720, 2004.

237. Kumar-Sinha, C, Ignatoski, K. W., Lippman, M. E., Ethier, S. P., and Chinnaiyan, A.

M. Transcriptome analysis of HER2 reveals a molecular connection to fatty acid

synthesis. Cancer Res, 63: 132-139, 2003.

238. Liu, X., Shi, Y., Giranda, V. L., and Luo, Y. Inhibition of the phosphatidylinositol 3-

kinase/Akt pathway sensitizes MDA-MB468 human breast cancer cells to cerulenin-

induced apoptosis. Mol Cancer Ther, 5: 494-501, 2006. 148

239. Thupari, J. N., Pinn, M. L., and Kuhajda, F. P. Fatty acid synthase inhibition in human

breast cancer cells leads to malonyl-CoA-induced inhibition of fatty acid oxidation and

cytotoxicity. Biochem Biophys Res Commun, 285: 217-223, 2001.

240. Pizer, E. S., Thupari, J., Han, W. F., Pinn, M. L., Chrest, F. J., Frehywot, G. L.,

Townsend, C. A., and Kuhajda, F. P. Malonyl-coenzyme-A is a potential mediator of

cytotoxicity induced by fatty-acid synthase inhibition in human breast cancer cells and

xenografts. Cancer Res, 60: 213-218, 2000.

241. Alirol, E. and Martinou, J. C. Mitochondria and cancer: is there a morphological

connection? Oncogene, 25: 4706-4716, 2006.

242. Heiligtag, S. J., Bredehorst, R., and David, K. A. Key role of mitochondria in cerulenin-

mediated apoptosis. Cell Death Differ, 9: 1017-1025, 2002.

243. Chajes, V., Cambot, M., Moreau, K., Lenoir, G. M., and Joulin, V. Acetyl-CoA

carboxylase alpha is essential to breast cancer cell survival. Cancer Res, 66: 5287-5294,

2006.

244. Sabine, J. R., Abraham, S., and Chaikoff, I. L. Control of lipid metabolism in

hepatomas: insensitivity of rate of fatty acid and cholesterol synthesis by mouse

hepatoma BW7756 to fasting and to feedback control. Cancer Res, 27: 793-799, 1967.

245. Ookhtens, M., Kannan, R., Lyon, I., and Baker, N. Liver and adipose tissue

contributions to newly formed fatty acids in an ascites tumor. Am J Physiol, 247: R146-

153, 1984.

246. Obeid, O. A. and Emery, P. W. Lipid metabolism in cachectic tumor-bearing rats at

different stages of tumor growth. Nutr Cancer, 19: 87-98, 1993. 149

247. Menendez, J. A., Ropero, S., Mehmi, I., Atlas, E., Colomer, R., and Lupu, R.

Overexpression and hyperactivity of breast cancer-associated fatty acid synthase

(oncogenic antigen-519) is insensitive to normal arachidonic fatty acid-induced

suppression in lipogenic tissues but it is selectively inhibited by tumoricidal alpha-

linolenic and gamma-linolenic fatty acids: a novel mechanism by which dietary fat can

alter mammary tumorigenesis. Int J Oncol, 24: 1369-1383, 2004.

248. Yang, Y. A., Han, W. F., Morin, P. J., Chrest, F. J., and Pizer, E. S. Activation of fatty

acid synthesis during neoplastic transformation: role of mitogen-activated protein

kinase and phosphatidylinositol 3-kinase. Exp Cell Res, 279: 80-90, 2002.

249. Yang, Y. A., Morin, P. J., Han, W. F., Chen, T., Bornman, D. M., Gabrielson, E. W.,

and Pizer, E. S. Regulation of fatty acid synthase expression in breast cancer by sterol

regulatory element binding protein-lc. Exp Cell Res, 282: 132-137, 2003.

250. Menendez, J. A., Vellon, L., and Lupu, R. DNA topoisomerase Ilalpha (TOP2A)

inhibitors up-regulate fatty acid synthase gene expression in SK-Br3 breast cancer cells:

in vitro evidence for a 'functional amplicon' involving FAS, Her-2/neu and TOP2A

genes. Int J Mol Med, 18: 1081-1087, 2006.

251. Zhang, D., Tai, L. K., Wong, L. L., Chiu, L. L., Sethi, S. K., and Koay, E. S. Proteomic

study reveals that proteins involved in metabolic and detoxification pathways are highly

expressed in HER-2/neu-positive breast cancer. Mol Cell Proteomics, 4: 1686-1696,

2005.

252. Joyeux, C, Rochefort, H., and Chalbos, D. Progestin increases gene transcription and

messenger ribonucleic acid stability of fatty acid synthetase in breast cancer cells. Mol

Endocrinol, 3: 681-686, 1989. 150

253. Martel, P. M., Bingham, C. M., McGraw, C. J., Baker, C. L., Morganelli, P. M., Meng,

M. L., Armstrong, J. M., Moncur, J. T., and Kinlaw, W. B. S14 protein in breast cancer

cells: direct evidence of regulation by SREBP-lc, superinduction with progestin, and

effects on cell growth. Exp Cell Res, 312: 278-288,2006.

254. Chambon, M., Rochefort, H., Vial, H. J., and Chalbos, D. Progestins and androgens

stimulate lipid accumulation in T47D breast cancer cells via their own receptors. J

Steroid Biochem, 33: 915-922,1989.

255. Magnard, C, Bachelier, R., Vincent, A., Jaquinod, M, Kieffer, S., Lenoir, G. M., and

Venezia, N. D. BRCA1 interacts with acetyl-CoA carboxylase through its tandem of

BRCT domains. Oncogene, 21: 6729-6739, 2002.

256. Moreau, K., Dizin, E., Ray, H., Luquain, C, Lefai, E., Foufelle, F., Billaud, M., Lenoir,

G. M., and Venezia, N. D. BRCA1 affects lipid synthesis through its interaction with

acetyl-CoA carboxylase. J Biol Chem, 281: 3172-3181, 2006.

257. Menendez, J. A., Mehmi, I., Verma, V. A., Teng, P. K., and Lupu, R. Pharmacological

inhibition of fatty acid synthase (FAS): a novel therapeutic approach for breast cancer

chemoprevention through its ability to suppress Her-2/neu (erbB-2) oncogene-induced

malignant transformation. Mol Carcinog, 41: 164-178, 2004.

258. Safe, S. and Abdelrahim, M. Sp transcription factor family and its role in cancer. Eur J

Cancer, 41: 2438-2448, 2005.

259. Moon, Y. A., Kim, K. S., Cho, U. H., Yoon, D. J., and Park, S. W. Characterization of

regulatory elements on the promoter region of human ATP-citrate lyase. Exp Mol Med,

31: 108-114,1999. 151

260. Daniel, S. and Kim, K. H. Spl mediates glucose activation of the acetyl-CoA

carboxylase promoter. J Biol Chem, 271: 1385-1392,1996.

261. Xiong, S., Chirala, S. S., and Wakil, S. J. Sterol regulation of human fatty acid synthase

promoter I requires nuclear factor-Y- and Sp-1-binding sites. Proc Natl Acad Sci USA,

97: 3948-3953, 2000.

262. Everts, B., Wahrborg, P., and Hedner, T. COX-2-specific inhibitors—the emergence of a

new class of analgesic and anti-inflammatory drugs. Clin. Rheumatol., 19: 331-343,

2000.

263. Rice, P. L., Goldberg, R. J., Ray, E. C, Driggers, L. J., and Ahnen, D. J. Inhibition of

extracellularsignal-regulated kinase 1/2 phosphorylation and induction of apoptosis by

sulindac metabolites. Cancer Res., 61: 1541-1547, 2001.

264. Guerre-Millo, M., Gervois, P., Raspe, E., Madsen, L., Poulain, P., Derudas, B., Herbert,

J.-M., Winegar, D. A., Willson, T. M., Fruchart, J.-C, Berge, R. K., and Staels, B.

Peroxisome proliferator-activated receptor alpha activators improve insulin sensitivity

and reduce adiposity. J. Biol. Chem., 275: 16638-16642, 2000.

265. Chaput, E., Saladin, R., silvestre, M, and Edgar, A. D. Fenofibrate and rosiglitazone

lower serum triglycerides with opposing effects on body weight. Biochem. Biophys.

Res. Commun., 271: 445-450, 2000.

266. Yuan, M., Konstantopoulos, N., Lee, J., Hansen, L., Li, Z.-W., Karin, M., and Shoelson,

S. E. Reversal of obesity- and diet-induced insulin resistance with salicylates or targeted

disruption of Ikkbeta. Science, 293: 1673-1677, 2001. 152

267. Kawamori, T., Rao, C. V., Seibert, K., and Reddy, B. S. Chemopreventive activity of

celecoxib, a specific cyclooxygenase-2 inhibitor, against colon carcinogenesis. Cancer

Res., 58: 409-412,1998.

268. Fisher, S. M., Lo, H. H., Gordon, G. B., Seibert, K., Kelloff, G., Lubet, R. A., and

Conti, C. J. Chemopreventive activity of celecoxib, a specific cyclooxygenase-2

inhibitor, and indomethacin against ultraviolet light-induced skin carcinogenesis. Mol.

Carcinog., 25: 231-240, 1999.

269. Green, S. PPAR: a mediator of peroxisome proliferator action. Mutat Res, 333: 101-

109, 1995.

270. Gregoire, F. M., Zhang, Q., Smith, S. J., Tong, C, Ross, D., Lopez, H., and West, D. B.

Diet-induced obesity and hepatic gene expression alterations in C57BL/6J and ICAM-1-

deficient mice. Am J Physiol Endocrinol Metab, 282: E703-E713, 2002.

271. Osei-Hyiaman, D., DePetrillo, M., Pacher, P., Liu, J., Radaeva, S., Batkai, S., Harvey-

White, J., Mackie, K., Offertaler, L., Wang, L., and Kunos, G. Endocannabinoid

activation at hepatic CB1 receptors stimulates fatty acid synthesis and contributes to

diet-induced obesity. J Clin Invest, 115: 1298-1305, 2005.

272. Becker, W., Kluge, R., Kantner, T., Linnartz, K., Korn, M., Tschank, G., Plum, L.,

Giesen, K., and Joost, H. G. Differential hepatic gene expression in a polygenic mouse

model with insulin resistance and hyperglycemia: evidence for a combined

transcriptional dysregulation of gluconeogenesis and fatty acid synthesis. J Mol

Endocrinol, 32: 195-208, 2004. 153

273. Hirosumi, J., Tuncman, G., Chang, L., Gorgun, C. Z., Uysal, K. T., Maeda, K., Karin,

M., and Hotamisligil, G. S. A central role for JNK in obesity and insulin resistance.

Nature, 420: 333-336,2002.

274. Asins, G., Rosa, J. L., Serra, D., Gil-Gomez, G., Ayte, J., Bartrons, R., Tauler, A., and

Hegardt, F. G. Gene expression of enzymes regulating ketogenesis and fatty acid

metabolism in regenerating rat liver. Biochem. J., 299: 65-69, 1994.

275. Westwick, J. K., Weitzel, C., Leffert, H. L., and Brenner, D. A. Activation of Jun kinase

is an early event in hepatic regeneration. J. Clin. Invest., 95: 803-810, 1995.

276. Oakes, N. D., Thalen, P. G., Jacinto, S. M., and Ljung, B. Thiazolidinediones increase

plasma - adipose tissue FFA exchange capacity and enhance insulin-mediated control of

systematic FFA availability. Diabetes, 50: 1158-1165, 2001.

277. Lu, S., Yu, G., Zhu, Y., and Archer, M. C. Cyclooxygenase-2 overexpression in MCF-

10F human breast epithelial cells inhibits proliferation, apoptosis and differentiation,

and causes partial transformation. Int. J. Cancer, 116: 847-852, 2005.

278. Swinnen, J. V., Esquenet, M., Goossens, K., Heyns, W., and Verhoeven, G. Androgens

stimulate fatty acid synthase in the human prostate cancer cell line LNCaP. Cancer Res.,

57: 1086-1090, 1997.

279. Vanhaesebroeck, B. and Alessi, D. R. The PI3K-PDK1 connection: more than just a

road to PKB. Biochem. J., 346: 561-576, 2000.

280. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B.,

and Cohen, P. Characterization of a 3-phosphoinositide-dependent protein kinase which

phosphorylates and activates protein kinase Balpha. Curr. Biol., 7: 261-269, 1997. 154

281. Tan, Y., Rouse, J., Zhang, A., Cariati, S., Cohen, P., and Comb, M. J. FGF and stress

regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP

kinase-2. EMBO J., 15: 4629-4642,1996.

282. Haberny, S. L. and Carr, K. D. Food restriction increases NMD A receptor-mediated

calcium-calmodulin kinase II and NMDA receptor/extracellular signal-regulated kinase

1/2-mediated cyclic amp response element-binding protein phosphorylation in nucleus

accumbens upon D-l dopamine receptor stimulation in rats. Neuroscience, 132: 1035-

1043,2005.

283. Samuel, V. T., Liu, Z. X., Qu, X., Elder, B. D., Bilz, S., Befroy, D., Romanelli, A. J.,

and Shulman, G. I. Mechanism of hepatic insulin resistance in non-alcoholic fatty liver

disease. J. Biol. Chem., 279: 32345-32353, 2004.

284. Chiang, C. T., Weng, M. S., Lin-Shiau, S. Y., Kuo, K. L., Tsai, Y. J., and Lin, J. K. Pu-

erh tea supplementation suppresses fatty acid synthase expression in the rat liver

through downregulating Akt and JNK signalings as demonstrated in human hepatoma

HepG2 cells. Oncol Res, 16: 119-128, 2005.

285. Bennett, B. L., Sasaki, D. T., Murray, B. W., O'Leary, E. C, Sakata, S. T., Xu, W.,

Leisten, J. C, Motiwala, A., Pierce, S., Satoh, Y., Bhagwat, S. S., Manning, A. M., and

Anderson, D. W. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase.

Proc. Natl. Acad. Sci. U. S. A., 98: 13681-13686, 2001.

286. Schoonjans, K., Staels, B., and Auwerx, J. Role of the peroxisome proliferator-activated

receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression.

J. Lipid. Res., 37: 905-925, 1996. 155

287. Minnich, A., Tian, N., Byan, L., and Bilder, G. A potent PPARalpha agonist stimulates

mitochondrial fatty acid beta-oxidation in liver and skeletal muscle. Am. J. Physiol.

Endocrinol. Metab., 280: E270-E279, 2001.

288. McGarry, J. D., Mills, S. E., Long, C. S., and Foster, D. W. Observations on the affinity

for carnitine, and malonyl-CoA sensitivity, of carnitine palmitoyltransferase I in animal

and human tissues. Demonstration of the presence of malonyl-CoA in non-hepatic

tissues of the rat. Biochem. J., 214: 21-28, 1983.

289. Richelsen, B., Pedersen, S. B., Kristensen, K., Borglum, J. D., Norrelund, H.,

Christiansen, J. S., and Jorgensen, J. O. Regulation of lipoprotein lipase and hormone-

sensitive lipase activity and gene expression in adipose and muscle tissue by growth

hormone treatment during weight loss in obese patients. Metabolism, 49: 906-911,

2000.

290. Mater, M. K., Thelen, A. P., and Jump, D. B. Arachidonic acid and PGE2 regulation of

hepatic lipogenic gene expression. J. Lipid Res., 40: 1045-1052, 1999.

291. Richelsen, B. Release and effects of prostaglandins in adipose tissue. Prostaglandins

Leukotrienes Essent. Fatty Acids, 47: 171-182, 1992.

292. Mater, M. K., Pan, D., Bergen, W. G., and Jump, D. B. Arachidonic acid inhibits

lipogenic gene expression in 3T3-L1 adipocytes through a prostanoid pathway. J. Lipid

Res.,J9: 1327-1334,1998.

293. Borglum, J. D., Richelsen, B., Darimont, C, Pedersen, S. B., and Negrel, R. Expression

of the two isoforms of prostaglandin endoperoxide synthase (PGHS-land PGHS-2)

during adipose cell differentiation. Mol. Cell. Endocrinol., 131: 67-77, 1997. 156

294. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F.,

Holmes, A. B., McCormick, F., and Hawkins, P. T. Dual role of phosphatidylinositol-

3,4,5-trisphosphate in the activation of protein kinase B. Science, 277: 567-570, 1997.

295. Herzig, S., Hedrick, S., Morantte, I., Koo, S. H., Galimi, F., and Montminy, M. CREB

controls hepatic lipid metabolism through nuclear hormone receptor PPAR-gamma.

Nature, 426: 190-193, 2003.

296. Steffel, J., Hermann, M., Greutert, H., Gay, S., Luscher, T. F., Ruschitzka, F., and

Tanner, F. C. Celecoxib decreases endothelial tissue factor expression through

inhibition of c-Jun terminal NH2 kinase phosphorylation. Circulation, 111: 1685-1689,

2005.

297. Han, Z., Boyle, D. L., Chang, L., Bennett, B., Karin, M., Yang, L., Manning, A. M., and

Firestein, G. S. c-Jun N-terminal kinase is required for metalloproteinase expression and

joint destruction in inflammatory arthritis. J. Clin. Invest., 108: 73-81, 2001.

298. Nguyen, M. T., Satoh, H., Favelyukis, S., Babendure, J. L., Imamura, T., Sbodio, J. I.,

Zalevsky, J., Dahiyat, B. I., Chi, N. W., and Olefsky, J. M. JNK and tumor necrosis

factor-alpha mediate free fatty acid-induced insulin resistance in 3T3-L1 adipocytes. J.

Biol. Chem., 280: 35361-35371, 2005.

299. Qu, W., Bortner, C. D., Sakurai, T., Hobson, M. J., and Waalkes, M. P. Acquisition of

apoptotic resistance in arsenic-induced malignant transformation: role of the JNK signal

transduction pathway. Carcinogenesis, 23: 151-159, 2002.

300. Liang, Q., Bueno, O. F., Wilkins, B. J., Kuan, C. Y., Xia, Y., and Molkentin, J. D. c-Jun

N-terminal kinases (JNK) antagonize cardiac growth through cross-talk with

calcineurin-NFAT signaling. EMBO J., 22: 5079-5089, 2003. 157

301. Gelderblom, M., Eminel, S., Herdegen, T., and Waetzig, V. c-Jun N-terminal kinases

(JNKs) and the cytoskeleton—functions beyond neurodegeneration. Int. J. Dev.

Neurosci., 22: 559-564, 2004.

302. Mamdani, M., Juurlink, D. N., Lee, D. S., Rochon, P. A., Kopp, A., Naglie, G., Austin,

P. C, Laupacis, A., and Stukel, T. A. Cyclo-oxygenase-2 inhibitors versus non-selective

non-steroidal anti-inflammatory drugs and congestive heart failure outcomes in elderly

patients: a population-based cohort study. Lancet, 363: 1751-1756, 2004.

303. Solomon, S. D., McMurray, J. J., Pfeffer, M. A., Wittes, J., Fowler, R., Finn, P.,

Anderson, W. F., Zauber, A., Hawk, E., and Bertagnolli, M. Cardiovascular risk

associated with celecoxib in a clinical trial for colorectal adenoma prevention. N. Engl.

J. Med., 352: 1071-1080, 2005.

304. Leo, C, Faber, S., Hentschel, B., Hockel, M., and Horn, L. C. The status of

cyclooxygenase-2 expression in ductal carcinoma in situ lesions and invasive breast

cancer correlates to cyclooxygenase-2 expression in normal breast tissue. Ann Diagn

Pathol, 10: 327-332, 2006.

305. Russo, J., Calaf, G., and Russo, I. H. A critical approach to the malignant

transformation of human breast epithelial cells with chemical carcinogens. Crit Rev

Oncog, 4: 403-417, 1993.

306. Soule, H. D., Maloney, T. M., Wolman, S. R., Peterson, W. D., Jr., Brenz, R., McGrath,

C. M., Russo, J., Pauley, R. J., Jones, R. F., and Brooks, S. C. Isolation and

characterization of a spontaneously immortalized human breast epithelial cell line,

MCF-10. Cancer Res, 50: 6075-6086, 1990. 158

307. Jones, D. A., Carlton, D. P., Mclntyre, T. M., Zimmerman, G. A., and Prescott, S. M.

Molecular cloning of human prostaglandin endoperoxide synthase type II and

demonstration of expression in response to cytokines. J Biol Chem, 268: 9049-9054,

1993.

308. Eckert, L. B., Repasky, G. A., Ulku, A. S., McFall, A., Zhou, H., Sartor, C. I., and Der,

C. J. Involvement of Ras activation in human breast cancer cell signaling, invasion, and

anoikis. Cancer Res, 64: 4585-4592, 2004.

309. Wang, M., Liu, Y. E., Ni, J., Aygun, B., Goldberg, I. D., and Shi, Y. E. Induction of

mammary differentiation by mammary-derived growth inhibitor-related gene that

interacts with an omega-3 fatty acid on growth inhibition of breast cancer cells. Cancer

Res, 60: 6482-6487, 2000.

310. Ward, K. R., Zhang, K. X., Somasiri, A. M., Roskelley, C. D., and Schrader, J. W.

Expression of activated M-Ras in a murine mammary epithelial cell line induces

epithelial-mesenchymal transition and tumorigenesis. Oncogene, 23: 1187-1196, 2004.

311. Li, Y. J., Song, R., Korkola, J. E., Archer, M. C, and Ben-David, Y. Cyclin Dl is

necessary but not sufficient for anchorage-independent growth of rat mammary tumor

cells and is associated with resistance of the Copenhagen rat to mammary

carcinogenesis. Oncogene, 22: 3452-3462, 2003.

312. Detre, S., Riddler, S., Salter, J., A'Hern, R., Dowsett, M., and Johnston, S. R.

Comparison of the selective estrogen receptor modulator arzoxifene (LY353381) with

tamoxifen on tumor growth and biomarker expression in an MCF-7 human breast

cancer xenograft model. Cancer Res, 63: 6516-6522, 2003. 159

313. Richards, J. A., Petrel, T. A., and Brueggemeier, R. W. Signaling pathways regulating

aromatase and cyclooxygenases in normal and malignant breast cells. J Steroid

Biochem Mol Biol, 80: 203-212,2002.

314. Sheng, H., Shao, J., Morrow, J. D., Beauchamp, R. D., and DuBois, R. N. Modulation

of apoptosis and Bcl-2 expression by prostaglandin E2 in human colon cancer cells.

Cancer Res, 58: 362-366, 1998.

315. Frisch, S. M. and Francis, H. Disruption of epithelial cell-matrix interactions induces

apoptosis. J Cell Biol, 124: 619-626, 1994.

316. Boudreau, N. and Bissell, M. J. Extracellular matrix signaling: integration of form and

function in normal and malignant cells. Curr Opin Cell Biol, 10: 640-646,1998.

317. Watanabe, T., Satoh, FL, Togoh, M., Taniguchi, S., Hashimoto, Y., and Kurokawa, K.

Positive and negative regulation of cell proliferation through prostaglandin receptors in

NIH-3T3 cells. J Cell Physiol, 169: 401-409,1996.

318. DuBois, R. N., Shao, J., Tsujii, M., Sheng, FL, and Beauchamp, R. D. Gl delay in cells

overexpressing prostaglandin endoperoxide synthase-2. Cancer Res, 56:12>3-131, 1996.

319. Trifan, O. C, Smith, R. M., Thompson, B. D., and Hla, T. Overexpression of

cyclooxygenase-2 induces cell cycle arrest. Evidence for a prostaglandin-independent

mechanism. J Biol Chem, 274: 34141-34147,1999.

320. Sherr, C. J. Cancer cell cycles. Science, 274: 1672-1677, 1996.

321. Qiu, L. Q., Sinniah, R., and Hsu, S. I. Role of differential and cell type-specific

expression of cell cycle regulatory proteins in mediating progressive glomerular injury

in human IgA nephropathy. Lab Invest, 84: 1112-1125, 2004. 160

322. Yasmeen, A., Berdel, W. E., Serve, H., and Muller-Tidow, C. E- and A-type cyclins as

markers for cancer diagnosis and prognosis. Expert Rev Mol Diagn, 3: 617-633, 2003.

323. Frisch, S. M. and Screaton, R. A. Anoikis mechanisms. Curr Opin Cell Biol, 13: 555-

562,2001.

324. Streuli, C. H. and Gilmore, A. P. Adhesion-mediated signaling in the regulation of

mammary epithelial cell survival. J Mammary Gland Biol Neoplasia, 4: 183-191, 1999.

325. Reddig, P. J. and Juliano, R. L. Clinging to life: cell to matrix adhesion and cell

survival. Cancer Metastasis Rev, 24: 425-439, 2005.

326. Li, G., Fridman, R., and Kim, H. R. Tissue inhibitor of metalloproteinase-1 inhibits

apoptosis of human breast epithelial cells. Cancer Res, 59: 6267-6275, 1999.

327. Meiners, S., Brinkmann, V., Naundorf, H., and Birchmeier, W. Role of morphogenetic

factors in metastasis of mammary carcinoma cells. Oncogene, 16: 9-20, 1998.

328. Russo, J., Hu, Y. F., Silva, I. D., and Russo, I. H. Cancer risk related to mammary gland

structure and development. Microsc Res Tech, 52: 204-223, 2001.

329. Shan, L., Yu, M., Schut, H. A., and Snyderwine, E. G. Susceptibility of rats to

mammary gland carcinogenesis by the food-derived carcinogen 2-amino-l-methyl-6-

phenylimidazo[4,5-b]pyridine (PhIP) varies with age and is associated with the

induction of differential gene expression. Am J Pathol, 165: 191-202, 2004.

330. Kiemer, A. K., Takeuchi, K., and Quinlan, M. P. Identification of genes involved in

epithelial-mesenchymal transition and tumor progression. Oncogene, 20: 6679-6688,

2001.

331. Thiery, J. P. Epithelial-mesenchymal transitions in development and pathologies. Curr

Opin Cell Biol, 15: 740-746, 2003. 161

332. Brown, A. M, Wildin, R. S., Prendergast, T. J., and Varmus, H. E. A retrovirus vector

expressing the putative mammary oncogene int-1 causes partial transformation of a

mammary epithelial cell line. Cell, 46: 1001-1009,1986.

333. Clavel-Chapelon, F. and Gerber, M. Reproductive factors and breast cancer risk. Do

they differ according to age at diagnosis? Breast Cancer Res Treat, 72: 107-115, 2002.

334. Lu, S. and Archer, M. C. Celecoxib decreases fatty acid synthase expression via down-

regulation of c-Jun N-terminal kinase-1. Exp Biol Med (Maywood), 232: 643-653,

2007.

335. Korkola, J. E., Wood, G. A., and Archer, M. C. Cyclin Dl expression during rat

mammary tumor development and its potential role in the resistance of the Copenhagen

rat. Breast Cancer Res, 1: 88-94, 1999.

336. Heath, R. J., Li, J., Roland, G. E., and Rock, C. O. Inhibition of the Staphylococcus

aureus NADPH-dependent enoyl-acyl carrier protein reductase by triclosan and

hexachlorophene. J Biol Chem, 275: 4654-4659, 2000.

337. Bhargava, H. N. and Leonard, P. A. Triclosan: applications and safety. Am J Infect

Control, 24: 209-218, 1996.

338. Lu, S. J., Laroye, G., and Archer, M. C. Mammary tumor induction by N-methyl-N-

nitrosourea in genetically resistant Copenhagen rats. Cancer Res, 52: 5037-5041, 1992.

339. Thompson, H. J. and Adlakha, H. Dose-responsive induction of mammary gland

carcinomas by the intraperitoneal injection of 1-methyl-1-nitrosourea. Cancer Res, 51:

3411-3415,1991.

340. Russo, J. and Russo, I. H. Experimentally induced mammary tumors in rats. Breast

Cancer Res Treat, 39: 7-20, 1996. 162

341. Loftus, T. M., Jaworsky, D. E., Frehywot, G. L., Townsend, C. A., Ronnett, G. V.,

Lane, M. D., and Kuhajda, F. P. Reduced food intake and body weight in mice treated

with fatty acid synthase inhibitors. Science, 288: 2379-2381, 2000.

342. Clegg, D. J., Wortman, M. D., Benoit, S. C, McOsker, C. C, and Seeley, R. J.

Comparison of central and peripheral administration of C75 on food intake, body

weight, and conditioned taste aversion. Diabetes, 51: 3196-3201, 2002.

343. Rodriguez-Burford, C, Lubet, R. A., Steele, V. E., Eto, I., Bandy, M., Juliana, M. M.,

Weiss, H. L., Grizzle, W. E., Kelloff, G. J., and Grubbs, C. J. Effects of acute and

chronic body weight gain reductions in the evaluation of agents for efficacy in

mammary cancer prevention. Oncol Rep, 8: 373-379, 2001.

344. Pizer, E. S., Lax, S. F., Kuhajda, F. P., Pasternack, G. R., and Kurman, R. J. Fatty acid

synthase expression in endometrial carcinoma: correlation with cell proliferation and

hormone receptors. Cancer, 83: 528-537,1998.

345. Li, J. N., Mahmoud, M. A., Han, W. F., Ripple, M., and Pizer, E. S. Sterol regulatory

element-binding protein-1 participates in the regulation of fatty acid synthase

expression in colorectal neoplasia. Exp Cell Res, 261: 159-165, 2000.

346. Kuhajda, F. P., Pizer, E. S., Li, J. N., Mani, N. S., Frehywot, G. L., and Townsend, C.

A. Synthesis and antitumor activity of an inhibitor of fatty acid synthase. Proc Natl

Acad Sci USA, 97: 3450-3454, 2000.

347. Guo, C. B., Cui, N. H., Yu, G. Y., Liu, D. X., Meng, S. C, and Song, Q. Effects of

cerulenin on the endogenous fatty acid synthetic activity in squamous cell carcinoma of

the oral cavity. J Oral Maxillofac Surg, 61: 909-912, 2003. 163

348. Innocenzi, D., Alo, P. L., Balzani, A., Sebastiani, V., Silipo, V., La Torre, G., Ricciardi,

G., Bosman, C, and Calvieri, S. Fatty acid synthase expression in melanoma. J Cutan

Pathol, 30: 23-28, 2003.

349. Camassei, F. D., Jenkner, A., Rava, L., Bosman, C, Francalanci, P., Donfrancesco, A.,

Alo, P. L., and Boldrini, R. Expression of the lipogenic enzyme fatty acid synthase

(FAS) as a predictor of poor outcome in nephroblastoma: an interinstitutional study.

Med Pediatr Oncol, 40: 302-308, 2003.

350. Rossi, S., Ou, W., Tang, D., Bhattacharya, N., Dei Tos, A. P., Fletcher, J. A., and Loda,

M. Gastrointestinal stromal tumours overexpress fatty acid synthase. J Pathol, 209: 369-

375, 2006.

351. Agostini, M., Silva, S. D., Zecchin, K. G., Coletta, R. D., Jorge, J., Loda, M., and

Graner, E. Fatty acid synthase is required for the proliferation of human oral squamous

carcinoma cells. Oral Oncol, 40: 728-735, 2004.

352. Gabrielson, E. W., Pinn, M. L., Testa, J. R., and Kuhajda, F. P. Increased fatty acid

synthase is a therapeutic target in mesothelioma. Clin Cancer Res, 7: 153-157, 2001.

353. Wang, L., Wei, D., Huang, S., Peng, Z., Le, X., Wu, T. T., Yao, J., Ajani, J., and Xie,

K. Transcription factor Spl expression is a significant predictor of survival in human

gastric cancer. Clin Cancer Res, 9: 6371-6380, 2003.

354. Shi, Q., Le, X., Abbruzzese, J. L., Peng, Z., Qian, C. N., Tang, H., Xiong, Q., Wang, B.,

Li, X. C, and Xie, K. Constitutive Spl activity is essential for differential constitutive

expression of vascular endothelial growth factor in human pancreatic adenocarcinoma.

Cancer Res, 61: 4143-4154, 2001. 164

355. Abdelrahim, M., Baker, C. H., Abbruzzese, J. L., and Safe, S. Tolfenamic acid and

pancreatic cancer growth, angiogenesis, and Sp protein degradation. J Natl Cancer Inst,

98: 855-868,2006.

356. Zannetti, A., Del Vecchio, S., Carriero, M. V., Fonti, R., Franco, P., Botti, G., D'Aiuto,

G., Stoppelli, M. P., and Salvatore, M. Coordinate up-regulation of Spl DNA-binding

activity and urokinase receptor expression in breast carcinoma. Cancer Res, 60: 1546-

1551,2000.

357. Gartel, A. L., Goufman, E., Najmabadi, F., and Tyner, A. L. Spl and Sp3 activate p21

(WAF1/CIP1) gene transcription in the Caco-2 colon adenocarcinoma cell line.

Oncogene, 19: 5182-5188, 2000.

358. Maeno, T., Tanaka, T., Sando, Y., Suga, T., Maeno, Y., Nakagawa, J., Hosono, T., Sato,

M., Akiyama, H., Kishi, S., Nagai, R., and Kurabayashi, M. Stimulation of vascular

endothelial growth factor gene transcription by all trans retinoic acid through Spl and

Sp3 sites in human bronchioloalveolar carcinoma cells. Am J Respir Cell Mol Biol, 26:

246-253,2002.

359. Black, A. R., Black, J. D., and Azizkhan-Clifford, J. Spl and kruppel-like factor family

of transcription factors in cell growth regulation and cancer. J Cell Physiol, 188: 143-

160,2001.

360. Zhang, J., Zhu, Z. G., Ji, J., Yuan, F., Yu, Y. Y., Liu, B. Y., and Lin, Y. Z.

Transcription factor Spl expression in gastric cancer and its relationship to long-term

prognosis. World J Gastroenterol, 11: 2213-2217, 2005.

361. Wright, C, Angus, B., Napier, J., Wetherall, M., Udagawa, Y., Sainsbury, J. R.,

Johnston, S., Carpenter, F., and Home, C. H. Prognostic factors in breast cancer: 165

immunohistochemical staining for SP1 and NCRC 11 related to survival, tumour

epidermal growth factor receptor and oestrogen receptor status. J Pathol, 153: 325-331,

1987.

362. Athanikar, J. N., Sanchez, H. B., and Osborne, T. F. Promoter selective transcriptional

synergy mediated by sterol regulatory element binding protein and Spl: a critical role

for the Btd domain of Spl. Mol Cell Biol, 17: 5193-5200,1997.

363. Galaktionov, K., Lee, A. K., Eckstein, J., Draetta, G., Meckler, J., Loda, M., and Beach,

D. CDC25 phosphatases as potential human oncogenes. Science, 269: 1575-1577, 1995.

364. Kallstrom, H., Lindqvist, A., Pospisil, V., Lundgren, A., and Rosenthal, C. K. Cdc25A

localisation and shuttling: characterisation of sequences mediating nuclear export and

import. Exp Cell Res, 303: 89-100, 2005.

365. Iavarone, A. and Massague, J. Repression of the CDK activator Cdc25A and cell-cycle

arrest by cytokine TGF-beta in cells lacking the CDK inhibitor pi5. Nature, 387: 417-

422,1997.

366. Cangi, M. G., Cukor, B., Soung, P., Signoretti, S., Moreira, G., Jr., Ranashinge, M.,

Cady, B., Pagano, M., and Loda, M. Role of the Cdc25A phosphatase in human breast

cancer. J Clin Invest, 106: 753-761,2000.

367. Ray, D., Terao, Y., Fuhrken, P. G., Ma, Z. Q., DeMayo, F. J., Christov, K., Heerema, N.

A., Franks, R., Tsai, S. Y., Papoutsakis, E. T., and Kiyokawa, H. Deregulated CDC25A

expression promotes mammary tumorigenesis with genomic instability. Cancer Res, 67:

984-991,2007. 166

368. Ray, D., Terao, Y., Nimbalkar, D., Hirai, H., Osmundson, E. C, Zou, X., Franks, R.,

Christov, K., and Kiyokawa, H. Hemizygous disruption of Cdc25A inhibits cellular

transformation and mammary tumorigenesis in mice. Cancer Res, 67: 6605-6611, 2007.

369. Ru Lee, W., Chen, C. C, Liu, S., and Safe, S. 17beta-estradiol (E2) induces cdc25A

gene expression in breast cancer cells by genomic and non-genomic pathways. J Cell

Biochem, 99: 209-220, 2006.

370. Abdelrahim, M., Samudio, I., Smith, R., 3rd, Burghardt, R., and Safe, S. Small

inhibitory RNA duplexes for Spl mRNA block basal and estrogen-induced gene

expression and cell cycle progression in MCF-7 breast cancer cells. J Biol Chem, 277:

28815-28822,2002.

371. Abdelrahim, M., Smith, R., 3rd, Burghardt, R., and Safe, S. Role of Sp proteins in

regulation of vascular endothelial growth factor expression and proliferation of

pancreatic cancer cells. Cancer Res, 64: 6740-6749, 2004.

372. Joseph, S. B., Laffitte, B. A., Patel, P. H., Watson, M. A., Matsukuma, K. E., Walczak,

R., Collins, J. L., Osborne, T. F., and Tontonoz, P. Direct and indirect mechanisms for

regulation of fatty acid synthase gene expression by liver X receptors. J Biol Chem,

277: 11019-11025,2002.

373. Chintharlapalli, S., Papineni, S., Ramaiah, S. K., and Safe, S. Betulinic acid inhibits

prostate cancer growth through inhibition of specificity protein transcription factors.

Cancer Res, 67: 2816-2823, 2007.

374. Maor, S., Mayer, D., Yarden, R. I., Lee, A. V., Sarfstein, R., Werner, H., and Papa, M.

Z. Estrogen receptor regulates insulin-like growth factor-I receptor gene expression in 167

breast tumor cells: involvement of transcription factor Spl. J Endocrinol, 191: 605-612,

2006.

375. Zhang, C, Shin, D. J., and Osborne, T. F. A simple promoter containing two Spl sites

controls the expression of sterol-regulatory-element-binding protein la (SREBP-la).

Biochem J, 386: 161-168, 2005.

376. Ishibashi, H., Nakagawa, K., Onimaru, M., Castellanous, E. J., Kaneda, Y., Nakashima,

Y., Shirasuna, K., and Sueishi, K. Spl decoy transfected to carcinoma cells suppresses

the expression of vascular endothelial growth factor, transforming growth factor betal,

and tissue factor and also cell growth and invasion activities. Cancer Res, 60: 6531-

6536, 2000.

377. Grinstein, E., Jundt, F., Weinert, I., Wernet, P., and Royer, H. D. Spl as Gl cell cycle

phase specific transcription factor in epithelial cells. Oncogene, 21: 1485-1492, 2002.

378. Chen, F., Zhang, F., Rao, J., and Studzinski, G. P. Ectopic expression of truncated Spl

transcription factor prolongs the S phase and reduces the growth rate. Anticancer Res,

20: 661-667, 2000.

379. Hong, J., Samudio, I., Liu, S., Abdelrahim, M., and Safe, S. Peroxisome proliferator-

activated receptor gamma-dependent activation of p21 in Panc-28 pancreatic cancer

cells involves Spl and Sp4 proteins. Endocrinology, 145: 5774-5785, 2004.

380. Sikder, D. and Kodadek, T. Genomic studies of transcription factor-DNA interactions.

Curr Opin Chem Biol, 9: 38-45, 2005.

381. Swinnen, J. V., Heemers, H., Deboel, L., Foufelle, F., Heyns, W., and Verhoeven, G.

Stimulation of tumor-associated fatty acid synthase expression by growth factor 168

activation of the sterol regulatory element-binding protein pathway. Oncogene, 19:

5173-5181,2000.

382. Swinnen, J. V., Ulrix, W., Heyns, W., and Verhoeven, G. Coordinate regulation of

lipogenic gene expression by androgens: evidence for a cascade mechanism involving

sterol regulatory element binding proteins. Proc Natl Acad Sci USA, 94: 12975-12980,

1997.

383. Deng, X., Yellaturu, C, Cagen, L., Wilcox, H. G., Park, E. A., Raghow, R., and Elam,

M. B. Expression of the rat sterol regulatory element-binding protein-lc gene in

response to insulin is mediated by increased transactivating capacity of specificity

protein l(Spl). J Biol Chem, 282: 17517-17529, 2007.

384. Bennett, M. K., Lopez, J. M., Sanchez, H. B., and Osborne, T. F. Sterol regulation of

fatty acid synthase promoter. Coordinate feedback regulation of two major lipid

pathways. J Biol Chem, 270: 25578-25583, 1995.

385. Lee, M. G. and Pedersen, P. L. Glucose metabolism in cancer: importance of

transcription factor-DNA interactions within a short segment of the proximal region og

the type II hexokinase promoter. J Biol Chem, 278: 41047-41058, 2003.

386. Koduri, S., Goldhar, A. S., and Vonderhaar, B. K. Activation of vascular endothelial

growth factor (VEGF) by the ER-alpha variant, ERDelta3. Breast Cancer Res Treat, 95:

37-43, 2006.

387. Zannetti, A., Del Vecchio, S., Romanelli, A., Scala, S., Saviano, M., Cali, G., Stoppelli,

M. P., Pedone, C, and Salvatore, M. Inhibition of Spl activity by a decoy PNA-DNA

chimera prevents urokinase receptor expression and migration of breast cancer cells.

Biochem Pharmacol, 70: 1277-1287, 2005. 169

388. Khatlani, T. S., Wislez, M., Sun, M., Srinivas, H., Iwanaga, K., Ma, L., Hanna, A. E.,

Liu, D., Girard, L., Kim, Y. H., Pollack, J. R., Minna, J. D., Wistuba, II, and Kurie, J.

M. c-Jun N-terminal kinase is activated in non-small-cell lung cancer and promotes

neoplastic transformation in human bronchial epithelial cells. Oncogene, 26: 2658-

2666, 2007.

389. Kaiser, R. A., Liang, Q., Bueno, O., Huang, Y., Lackey, T., Klevitsky, R., Hewett, T.

E., and Molkentin, J. D. Genetic inhibition or activation of JNK1/2 protects the

myocardium from ischemia-reperfusion-induced cell death in vivo. J Biol Chem, 280:

32602-32608, 2005.

390. Tachibana, H., Perrino, C, Takaoka, H., Davis, R. J., Naga Prasad, S. V., and Rockman,

H. A. JNK1 is required to preserve cardiac function in the early response to pressure

overload. Biochem Biophys Res Commun, 343: 1060-1066, 2006.

391. Zhu, X., Raina, A. K., Rottkamp, C. A., Aliev, G., Perry, G., Boux, H., and Smith, M.

A. Activation and redistribution of c-jun N-terminal kinase/stress activated protein

kinase in degenerating neurons in Alzheimer's disease. J Neurochem, 76: 435-441,

2001.

392. Ferencik, M., Novak, M., Rovensky, J., and Rybar, I. Alzheimer's disease, inflammation

and non-steroidal anti-inflammatory drugs. Bratisl Lek Listy, 102: 123-132, 2001.

393. Muller-Decker, K., Neufang, G., Berger, I., Neumann, M., Marks, F., and

Furstenberger, G. Transgenic cyclooxygenase-2 overexpression sensitizes mouse skin

for carcinogenesis. Proc Natl Acad Sci USA, 99: 12483-12488, 2002. 170

394. Neufang, G., Furstenberger, G., Heidt, M., Marks, F., and Muller-Decker, K. Abnormal

differentiation of epidermis in transgenic mice constitutively expressing

cyclooxygenase-2 in skin. Proc Natl Acad Sci USA, 98: 7629-7634, 2001.

395. Katajisto, P., Vallenius, T., Vaahtomeri, K., Ekman, N., Udd, L., Tiainen, M., and

Makela, T. P. The LKB1 tumor suppressor kinase in human disease. Biochim Biophys

Acta, 7775:63-75,2007.

396. Wei, C, Amos, C. I., Rashid, A., Sabripour, M., Nations, L., McGarrity, T. J., and

Frazier, M. L. Correlation of staining for LKB1 and COX-2 in hamartomatous polyps

and carcinomas from patients with Peutz-Jeghers syndrome. J Histochem Cytochem,

51: 1665-1672,2003.

397. Zhou, W., Han, W. F., Landree, L. E., Thupari, J. N., Pinn, M. L., Bililign, T., Kim, E.

K., Vadlamudi, A., Medghalchi, S. M., El Meskini, R., Ronnett, G. V., Townsend, C.

A., and Kuhajda, F. P. Fatty acid synthase inhibition activates AMP-activated protein

kinase in SKOV3 human ovarian cancer cells. Cancer Res, 67: 2964-2971, 2007.

398. Hammamieh, R., Chakraborty, N., Miller, S. A., Waddy, E., Barmada, M., Das, R.,

Peel, S. A., Day, A. A., and Jett, M. Differential effects of omega-3 and omega-6 Fatty

acids on gene expression in breast cancer cells. Breast Cancer Res Treat, 101: 7-16,

2007.

399. Chajes, V., Sattler, W., Stranzl, A., and Kostner, G. M. Influence of n-3 fatty acids on

the growth of human breast cancer cells in vitro: relationship to peroxides and vitamin-

E. Breast Cancer Res Treat, 34: 199-212, 1995. 171

400. Kim, J. H., Hubbard, N. E., Ziboh, V., and Erickson, K. L. Attenuation of breast tumor

cell growth by conjugated linoleic acid via inhibition of 5-lipoxygenase activating

protein. Biochim Biophys Acta, 1736: 244-250, 2005.

401. Perez, E. and Muss, H. B. Optimizing adjuvant chemotherapy in early-stage breast

cancer. Oncology (Williston Park), 19: 1759-1767; discussion 1768, 1772-1754, 1777-

1758,2005.

402. Varshochi, R., Halim, F., Sunters, A., Alao, J. P., Madureira, P. A., Hart, S. M., Ali, S.,

Vigushin, D. M., Coombes, R. C, and Lam, E. W. ICI182,780 induces p21Wafl gene

transcription through releasing histone deacetylase 1 and estrogen receptor alpha from

Spl sites to induce cell cycle arrest in MCF-7 breast cancer cell line. J Biol Chem, 280:

3185-3196,2005.

403. Hong, C, Kim, H. A., Firestone, G. L., and Bjeldanes, L. F. 3,3'-Diindolylmethane

(DIM) induces a G(l) cell cycle arrest in human breast cancer cells that is accompanied

by Spl-mediated activation of p21(WAFl/CIPl) expression. Carcinogenesis, 23: 1297-

1305, 2002.

404. Lou, Z., O'Reilly, S., Liang, H., Maher, V. M., Sleight, S. D., and McCormick, J. J.

Down-regulation of overexpressed spl protein in human fibrosarcoma cell lines inhibits

tumor formation. Cancer Res, 65: 1007-1017, 2005.

405. Zhu, G. H., Lenzi, M., and Schwartz, E. L. The Spl transcription factor contributes to

the tumor necrosis factor-induced expression of the angiogenic factor thymidine

phosphorylase in human colon carcinoma cells. Oncogene, 21: 8477-8485, 2002.

406. Borgatti, M., Boyd, D. D., Lampronti, I., Bianchi, N., Fabbri, E., Saviano, M.,

Romanelli, A., Pedone, C, and Gambari, R. Decoy molecules based on PNA-DNA 172

chimeras and targeting Spl transcription factors inhibit the activity of urokinase-type

plasminogen activator receptor (uPAR) promoter. Oncol Res, 15: 373-383, 2005.

407. Jaiswal, A. S., Balusu, R., and Narayan, S. 7,12-Dimethylbenzanthracene-dependent

transcriptional regulation of adenomatous polyposis coli (APC) gene expression in

normal breast epithelial cells is mediated by GC-box binding protein Sp3.

Carcinogenesis, 27: 252-261, 2006.

408. Davidson, T. G. Conventional treatment of hypercalcemia of malignancy. Am J Health

Syst Pharm, 58 Suppl 3: S8-15, 2001.

409. Wang, D. and Dubois, R. N. Prostaglandins and cancer. Gut, 55: 115-122, 2006.

410. Kuhajda, F. P. Fatty acid synthase and cancer: new application of an old pathway.

Cancer Res, 66: 5977-5980, 2006.

411. Bode, A. M. and Dong, Z. Targeting signal transduction pathways by chemopreventive

agents. Mutat Res, 555: 33-51, 2004.

412. Kim, Y. S. and Milner, J. A. Targets for indole-3-carbinol in cancer prevention. J Nutr

Biochem, 16: 65-73, 2005.

413. Watanabe, K., Kawamori, T., Nakatsugi, S., Ohta, T., Ohuchida, S., Yamamoto, H.,

Maruyama, T., Kondo, K., Ushikubi, F., Narumiya, S., Sugimura, T., and Wakabayashi,

K. Role of the prostaglandin E receptor subtype EP1 in colon carcinogenesis. Cancer

Res, 59: 5093-5096, 1999.

414. Sonoshita, M, Takaku, K., Sasaki, N., Sugimoto, Y., Ushikubi, F., Narumiya, S.,

Oshima, M., and Taketo, M. M. Acceleration of intestinal polyposis through

prostaglandin receptor EP2 in Apc(Delta 716) knockout mice. Nat Med, 7: 1048-1051,

2001. 173

415. Mutoh, M., Watanabe, K., Kitamura, T., Shoji, Y., Takahashi, M., Kawamori, T., Tani,

K., Kobayashi, M., Maruyama, T., Kobayashi, K., Ohuchida, S., Sugimoto, Y.,

Naramiya, S., Sugimura, T., and Wakabayashi, K. Involvement of prostaglandin E

receptor subtype EP(4) in colon carcinogenesis. Cancer Res, 62: 28-32,2002.

416. Oshima, M., Murai, N., Kargman, S., Arguello, M., Luk, P., Kwong, E., Taketo, M. M.,

and Evans, J. F. Chemoprevention of intestinal polyposis in the Apcdelta716 mouse by

rofecoxib, a specific cyclooxygenase-2 inhibitor. Cancer Res, 61: 1733-1740, 2001.

417. Sheehan, K. M., Sheahan, K., O'Donoghue, D. P., MacSweeney, F., Conroy, R. M.,

Fitzgerald, D. J., and Murray, F. E. The relationship between cyclooxygenase-2

expression and colorectal cancer. JAMA, 282: 1254-1257, 1999.

418. Fenwick, S. W., Toogood, G. J., Lodge, J. P., and Hull, M. A. The effect of the selective

cyclooxygenase-2 inhibitor rofecoxib on human colorectal cancer liver metastases.

Gastroenterology, 125: 716-729, 2003.

419. Iwama, T., Akasu, T., Utsunomiya, J., and Muto, T. Does a selective cyclooxygenase-2

inhibitor (tiracoxib) induce clinically sufficient suppression of adenomas in patients

with familial adenomatous polyposis? A randomized double-blind placebo-controlled

clinical trial. Int J Clin Oncol, 11: 133-139, 2006.

420. Kerr, D. J., Dunn, J. A., Langman, M. J., Smith, J. L., Midgley, R. S., Stanley, A.,

Stokes, J. C, Julier, P., Iveson, C, Duvvuri, R., and McConkey, C. C. Rofecoxib and

cardiovascular adverse events in adjuvant treatment of colorectal cancer. N Engl J Med,

357: 360-369, 2007.

421. Williams, C. S., Mann, M., and DuBois, R. N. The role of cyclooxygenases in

inflammation, cancer, and development. Oncogene, 18: 7908-7916, 1999. 174

422. Li, J. N., Gorospe, M., Chrest, F. J., Kumaravel, T. S., Evans, M. K., Han, W. F., and

Pizer, E. S. Pharmacological inhibition of fatty acid synthase activity produces both

cytostatic and cytotoxic effects modulated by p53. Cancer Res, 61: 1493-1499, 2001.

423. Appleby, S. B., Ristimaki, A., Neilson, K., Narko, K., and Hla, T. Structure of the

human cyclo-oxygenase-2 gene. Biochem J, 302 (Pt 3): 723-727, 1994.

424. Xu, K. and Shu, H. K. EGFR activation results in enhanced cyclooxygenase-2

expression through p38 mitogen-activated protein kinase-dependent activation of the

Spl/Sp3 transcription factors in human gliomas. Cancer Res, 67: 6121-6129, 2007.