Dysregulation of the Wnt Signaling Pathway in the Development of Colorectal Cancer in HIV-Infected Patients

Dysregulation of the Wnt signaling pathway in the development of colorectal cancer in HIV-infected patients

Jennifer Marcy

August 2018

A Dissertation Presented to the Faculty of Drexel University College of Medicine in partial fulfillment of the Requirements for the Degree of Masters in Science in Molecular and Cellular Biology and Genetics

______Vanessa Pirrone, PhD Brian Wigdahl, PhD Assistant Professor Professor and Chair Microbiology and Immunology Microbiology and Immunology

______Todd Strochlic, PhD, VMD Assistant Professor Biochemistry and Molecular Biology

iii

DEDICATION

This master’s thesis is dedicated to the strong individuals who are responsible for creating brilliant minds and to populate a future of caring and responsible adults.

As a stay at home mom for 20 years, it has been a long journey to get to this stage.

I had a turning point when my kids were infants where I would say to myself “This is so boring hanging out with basically two pieces of Jello.” I gave myself a job title:

Brain Grower. My business plan involved finding new stimuli in the world every day so they could cultivate new synaptic connections and develop into contributing members of society. I did this for them, I did this for me. Thank you to my children for pushing me to be a better person and role model. You have truly enriched my life in ways you will never know.

If there was a single person who was responsible for showing me the ability to have a different life, it would be my ex-husband. He has given me the opportunity and kick in the ass that was needed so I could go into the world, reinvent, and discover myself.

In the end however, I have to dedicate this portion of my new life to my faithful companion and best friend, Nutmeg who has saved my life in more ways than one.

I truly appreciate every single one of you and I hope I have made you proud.

“What lies behind you and what lies before you are small matters compared to what lies within you”. – Ralph Waldo Emerson v

ACKNOWLEDGEMENTS

Thank you to all those who have, directly or indirectly, influenced the completion of this thesis. I would like to express my sincere gratitude to my mentor, Dr.

Vanessa Pirrone, for the continuous support of my studies and related research, for her patience, motivation, and immense knowledge. The door to Dr. Pirrone’s office was always open whenever I ran into a trouble spot or had a question. She consistently allowed this paper to be my own work but rescued me many times in these deep waters whenever I needed it. Besides my mentor, I would like to thank the rest of my thesis committee: Dr. Brian Wigdahl and Dr. Todd Strochlic, for their insightful comments, encouragement, and questions which incented me to widen my research from various perspectives. I would like to thank my friends for accepting nothing less than excellence from me. I thank my fellow lab mates for stimulating discussions and all the fun we have had in the last two years. Last but not least, I would like to thank my family: my children, my brother, sister, and parents for supporting me throughout these studies and my life in general.

TABLE OF CONTENTS

Chapter I: Gastrointestinal cancers in patients infected with HIV ...... 1

1.1. Abstract ...... 2

1.2. Introduction ...... 3

1.3. Human Immunodeficiency virus (HIV) ...... 4

1.4. Mechanism of cancer initiation ...... 10

1.5. Cancers of the gastrointestinal tract ...... 13

1.6. Interplay between oncogenic pathways within the GI tract and

potential HIV interacts within these pathways ...... 19

1.6.1 BMP ...... 20

1.6.2 Notch ...... 22

1.6.3 EGF pathway...... 28

1.6.4 Hedgehog signaling ...... 30

1.6.5 Wnt ...... 31

1.7. ART penetration ...... 34

1.8. Conclusion ...... 37

1.9. List of References ...... 39

Chapter II: Dysregulation of the Wnt signaling pathway in the development of colorectal cancer in HIV-infected patients ...... 52

2.1. Abstract ...... 53

2.2 Introduction ...... 54 vii

2.3. Materials and Methods ...... 59

2.3.1. Plasmid growth and purification ...... 59

2.3.2. Cell culture ...... 61

2.3.3. Transient transfection ...... 61

2.3.4. Microscope pictures ...... 62

2.3.5. Lentiviral production and transduction...... 62

2.3.6. Protein isolation ...... 62

2.3.7. Bicinchoninic acid assay ...... 62

2.3.8. RNA extraction ...... 63

2.3.9. Western blot ...... 63

2.3.10. Quantitative reverse transcription polymerase chain reaction

(RT-qPCR) ...... 63

2.3.11. TOP-/FOP-FLASH Wnt reporter ...... 64

2.4. Results ...... 64

2.4.1. Transfection of HCT116 cells ...... 65

2.4.2. Downstream gene product detection...... 67

2.4.3. Gene product detection utilizing quantitative reverse

transcription PCR (RT-qPCR) ...... 71

2.4.4. TOP/FOP Flash -catenin expression in HCT116 cells ...... 71

2.4.5. Nef affects downstream Wnt pathway protein expression in

HEK293T cells ...... 73

2.5. Discussion ...... 77

2.6. List of References ...... 83 viii

LIST OF FIGURES

Figure 1.1. Structures of polyanionic compounds assessed as systemic inhibitors

...... 24

Figure 1.2. Structures of polyanionic compounds assessed as microbicidal compounds ...... 27

Figure 1.3. Combination of inhibitors with different mechanisms of action to provide full protection from HIV-1 infection through sexual transmission ...... 35

Figure 2.1. Proof of transfection efficiency ...... 66

Figure 2.2. Cyclin D1 is not detected in HCT 116 colorectal cancer cells following transfection with HIV-1 Nef ...... 68

Figure 2.3. Downstream Wnt target gene c-myc expression ...... 70

Figure 2.4. C-myc and CyclinD1 expression in HCT116 cells ...... 72

Figure 2.5. -catenin expression in HCt116 and HEK293T cells...... 74

Figure 2.6. Wnt target gene expression in HEK293T cells ...... 76

Abstract

Dysregulation of the Wnt signaling pathway in the development of colorectal cancer in HIV-infected patients

Jennifer J. Marcy Vanessa Pirrone

With the advent of antiretroviral therapy (ART), patients with human immunodeficiency virus-1 (HIV-1) have experienced an improvement in morbidity and life expectancy. As this patient population ages, there has been evidence of an elevated risk and earlier onset of colonic neoplasia. The average age of developing colon cancer in HIV-1-infected patients is 48 compared to 60 in the general population. Moreover, the stage of colorectal cancer diagnosed in HIV-1- infected patients is more advanced compared to uninfected individuals. During primary HIV-1 infection, an observed loss of CD4+ T cells is seen in the gastrointestinal (GI) tract along with subsequent systemic immune hyperactivation.

Additionally, increased expression of proinflammatory cytokines in the GI tract during HIV-1 infection results in chronic mucosal inflammation. While HIV-induced immunodeficiency and immune activation certainly play a role, there are other possible avenues through which HIV-1 promotes the pathogenicity of oncogenesis. Many of the proteins produced upon viral genomic integration have been demonstrated to interact with components of various cellular pathways. In an effort to elucidate how viral and cellular interaction might aid in colorectal oncogenesis, this study investigates the HIV-1-encoded protein Negative x

Regulatory Factor (Nef) and its interaction within the Wnt signaling pathway. This pathway is critical within the gastrointestinal stem cell niche for its role in repopulating the intestinal tract lining. Upon dysregulation of the Wnt signaling pathway, -catenin begins to accumulate in the cytosol and translocates into the nucleus where is binds with transcription factors TCF/LEF leading to an increase in transcription/translation of several key target genes known to upregulate cellular proliferation. The Nef protein has been shown to directly bind to -catenin in

HEK293T cells. What has not been demonstrated is which gene products of the

Wnt signaling pathway are dysregulated in the presence of Nef. Understanding the molecular mechanisms behind how HIV may modulate the Wnt signaling pathway will be crucial to better understand the link between HIV and cancer. Therefore, these studies will proceed to examine how HIV-1-encoded Nef modulates the Wnt signaling pathway by interacting with the -catenin complex in colorectal carcinoma cells leading to accelerated colon tumor outgrowth.

Chapter I

Gastrointestinal cancers in patients infected with HIV

Jennifer Marcy, Alexander Allen, Brian Wigdahl, and Vanessa Pirrone

This chapter will be submitted as a review: Marcy, J. J., Allen, A. G., Rappaport, J., Wigdahl, B., Waldman, S., and V. Pirrone. Gastrointestinal cancers in patients infected with HIV. Journal of Clinical Oncology, manuscript in preparation, 2018.

These studies were supported by a SKCC Developmental Grant (Pirrone, PI). 2

1.1 Abstract

The global impact of the acquired immune deficiency syndrome (AIDS) epidemic is clearly evident. Around the world, there are now approximately 36.7 million people infected with the human immunodeficiency virus type 1 (HIV-1). With the introduction of antiretroviral therapy, patients are living longer and the face of HIV-

1 disease progression is changing. In general, patient viral loads have been greatly reduced with ART leaving other viral concerns at the forefront of current investigations, including examining viral reservoirs, addressing inflammatory dysregulation, and determining the continued role of viral proteins in dysregulation of cellular pathways. A number of patients are developing non-AIDS-defining cancers (NADC) it addition to the classical cancers that have been so commonly encountered before better therapies arrived in the clinical arena. Of these cancers, cancers of the gastrointestinal tract have been shown to be very prevalent. In addition to the potential role of immunodeficiency, modifiable cancer risk factors

(smoking, alcohol consumption, obesity and coinfection), and enhanced inflammation, there has also been significant research performed linking components of HIV-1 to the development of gastrointestinal cancers. In this regard, multiple HIV-1-encoded viral proteins have been shown to interact and potentially dysregulate components of common cellular pathways associated with cancer generation. In this review, we will discuss the relationship between the development of gastrointestinal cancers and HIV-1 infection in patients.

1.2 Introduction

At the end of 2016 it was estimated that approximately 36.7 million people worldwide were living with human immunodeficiency virus (HIV) (World Health

Organization, 2016). Of these, 19.7 million were receiving antiretroviral therapy

(ART) (World Health Organization, 2016). The introduction of ART in the developed world has dramatically changed HIV-1 disease progression, with many infected patients on ART living much longer because of more effective viral suppression and less cytoxicity. Patient viral loads can be greatly reduced with

ART; however there are a number of clinical challenges that remain to be investigated that include remaining viral reservoirs, addressing inflammatory dysregulation, and determining the continued role of viral proteins in dysregulation of cellular pathways. People living with HIV (PLWH) who are treated with antiretrovirals have an increased risk of developing non-AIDS-defining complications which include several types of cancer (Deeks and Phillips, 2009).

The increase in the prevalence of cancer may be due in part to persistent immunodeficiency and/or modifiable cancer risk factors (smoking, alcohol consumption, obesity and any of a number of coinfections encountered in the HIV-

1-infected patient population) (Park et al., 2016), however, PLWH also develop cancers prematurely compared to individuals that have not been infected with HIV-

1 (Deeks and Phillips, 2009).

While on ART, plasma viremia can be undetectable, however, this does not mean that viral replication may not be occurring within tissue compartments not efficiently reached by ART. For example, studies have determined that ART penetration into lymphoid tissues is not complete and allows a viral reservoir to be maintained, even when plasma viremia is undetectable (Estes et al., 2017). This same study demonstrated that the levels of T cells with viral RNA (vRNA+) varies in different organ tissues before and after ART initiation in rhesus macaques (RMs). The gastrointestinal (GI) tract in particular displays the highest levels of cells with vRNA+. Therefore, while on ART, low level HIV-1 replication is occurring in lymphoid tissues (LTs) and primarily in the GI tract. Low level HIV-1 replication in suppressed patients may be a risk factor for cancer in the GI region, especially over prolonged periods of time. This review aims to investigate gastrointestinal cancers and their prevalence in people living with HIV-1.

1.3 Human Immunodeficiency Virus (HIV)

Before investigating the interplay between GI cancers and HIV-1, it is helpful to understand HIV-1 pathogenesis and disease in general. It has been documented that HIV-1 most likely originated from zoonotic transmission of simian immunodeficiency (SIV) from nonhuman primates to humans in Africa via eating these animals and keeping them as pets (Hemelaar, 2012). The virus is transmitted between humans primarily through the blood and genital fluids and to newborns through infected mothers (Fevrier et al., 2011). The two most common 5 types of HIV are HIV-1 and HIV-2 and they are two distinct viruses (AVERT, 2018).

The most prevalent worldwide is HIV-1, accounting for 95% of all infections

(AVERT, 2018). Within HIV-1, there are four major groups, M,N,O,P, with group M being the most common and the group responsible for the majority of the worldwide epidemic (AVERT, 2018). Beyond the HIV-1 group M classification, there are nine subtypes which have been shown to also exist as recombinant forms, of which 89 have been identified (AVERT, 2018). For the purposes of this review, we will focus on the literature with HIV-1 group M which describes the majority of the global HIV population. HIV-1 has a direct pro-oncogenic effect, but not in a manner analogous to most other oncogenic retroviruses (Borges et al.,

2014; Flint and American Society for Microbiology.). HIV-1 is not a transforming virus that integrates into cellular oncogenes, that is, it does not encode for proteins derived from other cells, that promote oncogenesis (Flint and American Society for

Microbiology.). HIV-1 may, but does not always, upregulate transcription near a cellular oncogene site as several other oncogenic viruses do (Flint and American

Society for Microbiology.).

HIV-1 preferentially targets T lymphocytes with the receptor CD4 and either the co-receptor CCR5 or CXCR4 expressed on their surface, of which the greatest quantity reside in the gut (Appay and Sauce, 2008). One of the hallmarks of HIV-

1 infection is the depletion of CD4+ T cells particularly in gut-associated lymphoid tissue (GALT) via destruction of thymic structures which impair production of new

T cells, alteration of membrane permeability, mitochondrial dysfunction, and 6 heightened surface expression levels of death receptors because of increased immune activation (Fevrier et al., 2011). Severe destruction of CD4+ CCR5+ T cells in the GI tract during the acute phase of HIV-1 infection effectively reduces the total body CD4+ T-cell population, causing a strain on the maintenance of the

CD4+ T-cell pool (Brenchley et al., 2004; Coussens and Werb, 2002). This loss of

CD4+ T cells not only causes chronic immune activation and chronic inflammation, but the loss of T cells in the GALT eventually leads to a breakdown of mucosal integrity and direct destruction of the tight junctions in the epithelium leading to systemic microbial translocation (Mehandru, 2007). Microbial translocation of gut flora itself can lead to systemic immune activation (Brenchley and Douek, 2008).

Once inside the CD4+ T-cell, HIV-1 integrates into the host cell genome and has been shown to mediate an environment of abnormal immune activation, cellular dysfunction and inflammation resulting in chronic HIV-1 infection (Fevrier et al.,

2011). This chronic phase immune activation results in destruction of lymphoid tissue architecture, preventing the tissue’s ability to support normal lymphocyte homeostasis (Brenchley et al., 2004).

With the introduction of ART, people with HIV-1 are living decades longer than was originally the case when the disease was first described in the early 1980s. In fact, in 2013, a 20-year-old HIV-1-infected patient on ART in the United States was expected to live into their 70s, depending on how quickly ART was initiated

(Antiretroviral Therapy Cohort, 2017; Samji et al., 2013). However, long-term 7 comorbidities, including increased malignancies, have been observed at higher incidences as PLWH are living longer (Patel et al., 2008). PLWH have twice the risk of cancer than the general population (Patel et al., 2008). With increased ART usage, there has been a significant decrease in AIDS-defining cancers (ADC), but an increase in non-AIDS defining cancers (NADCs) such as melanoma, leukemia, liver, lung, anus, colon, and kidney cancers. The rates of cancer in persons infected with HIV-1 have been shown to be dependent on a few variables, such as viral load, CD4+ T-cell count, onset of ART during the course of disease, co-viral infection, and life style risk factors including intravenous drug use, men having sex with men, smoking, alcohol use, which are all more prevalent among people infected with HIV-1) (Dubrow et al., 2012).

The destruction of CD4+ T cells certainly plays a role in the increased incidence of cancer found in HIV-1-infected patients (Patel et al., 2008). However, certain types of cancer are of increased prevalent in individuals infected with HIV-1 as compared to the general population (Patel et al., 2008). This has suggested other, more direct causative mechanisms. HIV-1 infection has been shown to dysregulate cytokine production, growth factors and chemokine release from immune cells, inducing unnecessary proliferation of local cells not infection with HIV-1, such as endothelial, epithelial, and B cells, giving rise to neoplastic growth, potentiating tumorigenesis (Yamada and Alpers, 2009). Overproduction of pro-inflammatory cytokines alone can lead to a level of inflammation that potentiates tumorigenesis

(Coussens and Werb, 2002). When the body sustains an injury, normally platelets 8 aggregate at the site and initiate an inflammatory response, prompting monocytes to migrate to the site of inflammation via chemotactic response and mature into activated macrophages once in the tissue. Activated macrophages produce and secrete growth factors and cytokines which modulate tissue repair (Coussens and

Werb, 2002). Inflammation caused by the typical wound healing process is self- limiting, where production of proinflammatory cytokines has been shown to be balanced out by subsequent production of anti-inflammatory cytokines (Coussens and Werb, 2002). HIV-1 infection is known to dysregulate cytokines such as TNF,

IFN, IL-10, MCP-1, IL-23, IL-6 and IL-1, resulting in an overall proinflammatory environment (Shebl et al., 2012). Leukocytes and other phagocytic cells have been shown to be chemoattracted to areas of inflammation and infection and can induce

DNA damage through their generation of reactive oxygen and nitrogen species produced normally to fight infection (Coussens and Werb, 2002). Additionally, permanent genomic alterations such as point mutations, genomic rearrangements, and deletions in local proliferating cells can occur via leukocyte secretion of reactive oxygen and nitrogen species (Coussens and Werb, 2002). Specific point mutations observed in tumor cells have also been observed in chronic inflammatory diseases (Coussens and Werb, 2002). As inflammation has been shown to become chronic, immune resources become exhausted (Deeks, 2011).

In addition to dysregulation of cytokine release, accessory proteins encoded for by the HIV-1 provirus interfere with cellular processes. The HIV-1 transactivator protein Tat has been shown to impair tumor suppressor functions and modulate 9 cell cycle progression (De Falco et al., 2003). Tat is secreted from infected cells and taken up by local bystander cells, acting as a toxin to neighboring cells not infected with HIV-1 and causing apoptosis (Campbell et al., 2004). The depletion of CD4+ T cells is part of the process of HIV-1 pathogenesis, therefore, if Tat is eliciting apoptosis in neighboring cells and those cells are primarily T cells, as they are in the GI tract (the largest repository of immune cells in the human body), Tat is therefore playing a role in the depletion of T cells. This protein can also enter neighboring cells inducing the expression of genes encoding for CXCR4 and

CCR5, the coreceptors for HIV-1, used for viral entry into host cells, thereby affecting viral spread (Yamada and Alpers, 2009). Similarly, HIV-1 viral protein R

(Vpr) has been demonstrated to cause cell cycle arrest, producing DNA damage, promoting the probability of neoplasia and accelerating tumor progression

(Tachiwana et al., 2006). Vpr additionally induces activation of apoptosis in bystander cells, reducing the T-cell population (Stewart et al., 1997). It has also been demonstrated that Vpr inhibits nuclear factor kappa beta (NF-B). NF-B has been shown to control transcription of DNA, and in particular genes that control cell proliferation and cell survival, regulate the immune response to infection, and has been shown to be a component of many oncogenic pathways (Kogan et al.,

2013; Vlahopoulos, 2017). Constitutively active NF-B has been shown to keep cells proliferating and to protect cells from apoptosis (Vlahopoulos, 2017). HIV-1 negative factor (Nef) has been shown to be a protein secreted from infected cells in exosomes acting in part to deplete the local CD4+ T-cell population by inducing apoptosis in bystander cells in the gut because they help control homeostasis there 10

(Lenassi et al., 2010). Nef has also been shown to downregulate cell surface immune modulators such as, MHC class I and CD4. Downregulation of these receptors facilitated immune evasion via decreased detection of infected cells by

CD8 cytotoxic T lymphocyte (Contento et al., 2008; Zhu et al., 2014). Additionally, exogenous Nef has been shown to induce angiogenesis and tumorigenesis via induction of cellular proliferation (Zhu et al., 2014).

1.4 Mechanism of cancer initiation

As in the previous section, to begin discussing the interplay between GI cancers and HIV-1 pathogenesis and disease, it is helpful to understand the basic mechanisms of cancer. More than 100 different types of cancer exist, each displaying specific characteristics of the tissue from which it originated (Quail and

Joyce, 2013). Cancer has been shown to be the result of genome aberrations, which can cause DNA lesions (Pages and Fuchs, 2002). DNA lesions may be spontaneously induced by endogenous components such as reactive oxygen species, or induced by exogenous carcinogens such as UV or X-ray radiation

(Pages and Fuchs, 2002). These lesions can cause point mutations whether transitional or transversal, which either become silent mutations that do not effect amino acid coding, or become responsible for degeneracy of the genetic code

(Pages and Fuchs, 2002). Genomic aberrations can induce dysregulated cells which are permitted to grow out of control, not perform tumor suppressor functions, or fail to go through apoptosis when necessary (Quail and Joyce, 2013). 11

Only a small percentage of genetic mutations presented in the average cell will have an impact on health and longevity, but all cancer cells display genetic aberrations (Tran et al., 2015). Tran and coworkers identified up to 155 mutations in cells from nine patients with metastatic cancers originating in the GI system

(Tran et al., 2015). Cell cycle dysregulation, particularly checkpoint dysregulation, has been shown to be the most prevalent signature of tumorigenic cells (Stewart et al., 2003). Proper checkpoint control has been shown to give the cell time to detect genomic aberrations and allow cellular mechanisms to properly maintain genomic integrity, by either performing the necessary repairs or activating pathways for programmed cell death (Stewart et al., 2003). Loss of checkpoint control can result in replication of damaged DNA and formation of lesions with no repair options, ultimately creating genomic alterations (Paulovich et al., 1997;

Stewart et al., 2003). Insufficient checkpoints can make the cell unable to repair base mismatches, a mutation can be produced and the option for mismatch repair is lost (Paulovich et al., 1997). For example, dysregulation of the cell cycle regulator Rb has been shown to be present in many cancers, including breast, lung, and colorectal cancers (Witkiewicz and Knudsen, 2014)(Du and Searle,

2009). If a checkpoint fails and a modified base has been encountered at a replication fork, the replication machinery stops, and can essentially skip over this region and resume replication downstream of the damage, resulting in formation of a lesion in the daughter stand (Paulovich et al., 1997). Subsequent encounter of this lesion in the daughter cell can result in replication fork breakage, with 12 double-stranded DNA breaks causing chromosome instability, rearrangement, truncation, or loss of the chromosome altogether (Paulovich et al., 1997). Normally, given enough time, DNA repair proteins can remove or reverse DNA lesions, thereby avoiding replication of damaged DNA (Paulovich et al., 1997). In oncogenesis, the checkpoint complexes themselves (CDK-cyclins) may be mutated or mutations in regulators of these complexes can allow cancer cells to cycle erroneously (Yamada and Alpers, 2009). This has been shown to generate progeny cells different from their parent cell, potentiating genetic instability and allowing mutations to be carried on to more and more cells, a hallmark of oncogenesis (Yamada and Alpers, 2009).

Cancer cells can also influence healthy cells within their vicinity by releasing exosomes carrying proangiogenic proteins, Dicer, AGO2, and TRBP, used to mediate reprogramming of the target cell transcriptome (Melo et al., 2014). These exosomes also contain mRNAs, and high volumes of miRNAs, which use an RNA induced silencing complex (RISC) to post transcriptionally alter gene expression

(Melo et al., 2014). Cancerous cells can evade the immune system by using these exosomally received miRNAs from neighboring cancer cells to repress cGAS, which normally alerts the innate immune system to cytosolic DNA indicating a viral infection or tumorigenesis (Quail and Joyce, 2013). This allows tumor growth to proceed undetected (Quail and Joyce, 2013). Cancer cells can also release other tumor secreted factors, which serve to establish the tumor microenvironment, and promote tumorigenesis (Quail and Joyce, 2013). Ultimately, by release of these 13 exosomes, cancer cells can induce nearby cells to form blood vessels that supply the tumor with oxygen and nutrients (angiogenesis), setting the stage for metastasis (National Cancer Institute, 2017; Nishida et al., 2006). Angiogenesis is regulated by upregulation of angiogenic factors (VEGF, bFGF, angiogenin, TGF,

TGF, TNF, and others) (Nishida et al., 2006) and downregulation of inhibitors to vessel growth (angiostatin, endostatin, interferon, platelet factor IV, thrombospondin, and MMP1,-2,-3 among others) (Nishida et al., 2006).

Once primary cancer cells have been established and become angiogenic they can invade surrounding tissues, by making their way into the circulatory system

(blood or lymph) (National Cancer Institute, 2017). Once in circulation, cancerous cells can adhere along vascular walls, extravasate into tissues at a new location, and colonize into metastatic tumors (Lambert et al., 2017). Metastatic tumors retain characteristics specific to the primary tumor, which allows for the ability to determine the origin of the tumor, which helps to educate treatment options

(National Cancer Institute, 2017).

1.5 Cancers of the Gastrointestinal Tract

It is important to reiterate that the primary location of CD4+ T-cell depletion in regards to HIV-1 infection is in GALT, therefore, it is important to specifically focus on cancers of this region (Fevrier et al., 2011). The gastrointestinal (GI) tract, consisting of all structures between the mouth and the anus, has the largest 14 surface area of any organ in the human body, with approximately 400m2 of mucosal lining (Mehandru, 2007). This area is constantly exposed to foreign agents, hence, the GI tract contains the highest concentration of immune cells at these mucosal surfaces (Mehandru, 2007). The two main immune functions in the

GI tract include immune inductive sites, where T cells become educated (meaning they mature and express either CD4 or CD8 on their surfaces), and immune effector sites, where T cells neutralize foreign antigens (Mehandru, 2007).

Gastrointestinal cancers have been shown to include a group of cancers differing by location including the esophagus, stomach, biliary system, pancreas, small intestine, large intestine, rectum, and anus (Yamada and Alpers, 2009). This organ system has been shown to be the site of more cancers and is associated with more cancer-related deaths than any other system in the body (Yamada and Alpers,

2009). Worldwide regional rates of GI cancer vary due to differences in genetics, diets, gut flora, and typical mucosal infections (Yamada and Alpers, 2009). Not only do exogenous swallowed items come into contact with the gut, harmful molecules are also secreted, such as hydrochloric acid, digestive enzymes, and bile salts which can hydrolyze chemical bonds, cleave peptide bonds, and dissolve cell membranes, respectively (Pelaseyed et al., 2014). Because of the continuous bombardment of potentially harmful molecules, the mucal lining of the GI tract has been referred to as the first line of defense against pathogens (Pelaseyed et al.,

2014). It is when this the region becomes overwhelmed with not only daily challenges, but other sources of inflammation and attack such as a viral invasion, that the protective system can can become increasingly dysfunctional (Pelaseyed 15 et al., 2014). While there is evidence that chronic inflammation and immune activation can be propagated many GI cancers, a brief discussion of a few GI cancers in particular will elucidate other causative factors.

Stomach, or gastric cancer, is the fourth most prevalent cancer worldwide

(National Cancer Institute, 2014). Gastric cancer has a lower survival rate (31% survive after 5 years in the United States) (National Cancer Institute, 2014) than many other cancers because it often goes unnoticed until it has metastasized into other organs (Torpy et al., 2010). In the USA, over 50% of people recently diagnosed with stomach cancer have regional lymph node metastasis or involvement of adjacent organs (Bailey, 2011). The incidence of stomach cancer has been shown to be more prevalent among smokers, those with a high salt diet, and men (Torpy et al., 2010). Gastric cancers have been classified by location within the stomach, proximal includes the first three parts near the esophagus

(cardia, fundus, and corpus) and distal which includes the lower two regions of the stomach (antrum and pyloris) (American Cancer Society, 2017). Gastric cancers are additionally classified by tissue phenotype, intestinal or diffuse (Ma et al.,

2016). Intestinal type tumors display expansive growth, typically metastasize into the liver, most commonly occur in elderly males, exhibit a longer course, and have been typically associated with a better prognosis (Adachi et al., 2000; Ma et al.,

2016). Diffuse type tumors affect the main body of the stomach from the pyloric antrum to the fundus, display infiltrative growth, typically disseminate and grow into the peritoneal cavity, exhibit a shorter course, and are associated with a poor 16 prognosis (Ma et al., 2016). As these diffuse cancers progress from the innermost layer of the stomach (the mucosa) into the deeper layers (submucosa, muscularis propria, and subserosa), the staging becomes more advanced and the prognosis worse (American Cancer Society, 2017). There is a strong correlation between bacterial infection with Helicobacter pylori and incidence of stomach cancer, with

9 out of 10 lower gastric cancers attributed to H. pylori infection (Sitas, 2016). The major mechanism associated with this type of bacterial infection has been demonstrated to be a disruption of the host DNA repair functions, leading to mutagenesis in infected gastric mucosa (Sepulveda et al., 2010). Aside from H. pylori infection, specific genomic alterations are common to both intestinal and diffuse subtypes of gastric cancer, such as p53 mutation, cyclin E overexpression, and aberrant CD44 transcripts (Grabsch and Tan, 2013).

Separate from gastric cancers, intestinal cancers are broken down into cancers of the small intestine and large intestine or colon (American Cancer Society, 2018c).

This discussion will begin with cancers of the small intestine. The small intestines have been shown to be the prevalent site where vitamins, proteins, carbohydrates, and nucleic acids can be absorbed by enzymes secreted from the pancreas and bile from the liver (Cancer Treatment Centers of America, 2015). Tumors can often grow large enough to block the flow of food and affect absorption of nutrients

(Cancer Treatment Centers of America, 2015). Cancer in this region has been shown to be rare, accounting for fewer than 1 in 10 GI cancers, and has also been shown to occur more often in older people (American Cancer Society, 2018a). The 17 intestinal epithelium has been shown to consist of four basic cell types, enterocytes which function to absorb nutrients, goblet cells which secrete a mucus barrier to prevent passage of harmful foreign microorganisms and toxins, enteroendocrine cells which release gastrointestinal hormones, and tuft cells which are chemosensory cells that make up the microvilli or brush region (Groschwitz and

Hogan, 2009; Umar, 2010). As cells are exposed to gut contents they are shed, continuous self-renewal of stem cells from intestinal crypt Paneth cells helps to maintain this epithelium (Zhou et al., 2018). At the base of the intestinal crypt, a proliferative compartment of undifferentiated and rapid cycling cells has been shown to reside (Umar, 2010). As cells from this compartment differentiate they migrate towards the lumen, where they can be eventually shed from the surface

(Umar, 2010). Intestinal homeostasis has been shown to be a balance between stem cells, progeny differentiated cells, and the lumen microenvironment (Medema and Vermeulen, 2011). Normally, the entire lining of the intestine has been shown to be shed and renewed every 4-5 days with billions of cells lost and replenished

(Umar, 2010). Diet influences this process, as an increase in luminal nutrients has been shown to result in an increase of intestinal epithelium stem cell proliferation, total epithelial cells, villi length, and crypt depth (Zhou et al., 2018). Additionally, injured tissues must be repaired quickly through this same regenerative crypt migration process (Umar, 2010). Any dysregulation of the intestinal stem cell niche could lead to formation of an adenoma, or benign tumor, which can become an adenocarcinoma, or malignant tumor (Krausova and Korinek, 2012).

While colorectal cancer is often referred to as a single type of cancer, cancers of the colon and cancers of the rectum have been shown to have distinct etiologies

(Wei et al., 2004). Structurally, the large intestine has been broken down into the cecum, ascending colon, transverse colon, descending colon, rectum, and the anus (Canadian Cancer Society, 2018). The colon has been further subdivided into proximal and distal regions, which have also been shown to be structurally and physiologically different from each other (Li and Lai, 2009; Wei et al., 2004).

The primary functions of the colon and rectum have been shown to involve the absorbtion of water and nutrients, formation and storage of waste, and the removal of waste out of the body (Canadian Cancer Society, 2018). Basically, the colon and rectum have been shown to have different locations, functions, blood supply, drainage, innervation, pH levels, and arise from different embryonic tissue (Ma et al., 2016; Wei et al., 2004). The rectum is exposed to fecal matter in a more concentrated and direct manner and for a longer duration than the colon (Wei et al., 2004). In biopsies from patients with hereditary nonpolyposis colorectal cancer, it has been shown that 1349 gene expression differences existed between the ascending and descending colon (Glebov et al., 2003). Of the genes that have been shown to be differentially expressed, most control cell cycle, proliferation, cell death, stress response, and DNA damage repair and are implicated in EGR, TGF,

Wnt, Ras, insulin and integrin signaling pathways (Glebov et al., 2003). Colon cancers have been shown to have a higher number of KRAS and TP53 mutations, with higher c-myc expression, and have been shown to have more mismatch repair defective (30% vs 2%) than rectal cancers, of which 80-90% contain mutated APC 19

(Glebov et al., 2003). Chromosomal instability (CIN) has been shown to be more common in rectal tumors, whereas, microsatellite instability (MIS) and CpG island methylator phenotype (CIMP) tumors have been shown to be more common in the descending colon. Furthermore, colon cancers have a tendency to metastasize to the liver while rectal cancers have tended to metastasize to the lung, probably because they each have a different vascular supply, with the superior mesenteric artery draining the ascending colon, and rectal vasculature draining via the inferior mesenteric artery (Glebov et al., 2003). Because of the many differences between colon and rectal cancers, clinical treatment of each type of cancer in these locations has been different (Li and Lai, 2009). The approach to treatment has depended on the type and stage of cancer, possible side effects, and the overall health of the patient (Canadian Cancer Society, 2018). The most common treatments used have started with surgery to remove the tumor, followed by adjuvant chemotherapy and for rectal tumors radiation therapy (American Cancer

Society, 2018b).

In summary, several functional cellular processes have been shown to become dysregulated allowing the cancer to succeed; initially cellular growth and proliferation have been shown to go unchecked, with subsequent tumor development and vascularization enabling tumor cells to grow and eventually travel to distant locations within the body in order to become established in tissues far removed from the site of the initial tumor (Pelengaris et al., 2006). We have known that cancer can and does succeed in large numbers of people with 20 seemingly no other contributing factors. However, in PLWH, the immune system is deficient and has been shown to be less able to detect and destroy cancer cells or to fight off infections that can cause cancer, making these patients more likely to develop cancer than the average person not infected with HIV-1 (National

Cancer Institute, 2015).

1.6 Interplay between oncogenic pathways within the GI tract and potential

HIV interactions within these pathways

Previous studies have shown that within the intestinal stem cell niche there is a distinct microenvironment of morphogenic signals that play important roles in crypt maintenance (Medema and Vermeulen, 2011). The Wnt, Hedgehog (HH), bone morphogenetic pathway (BMP), and Notch signaling pathways operate within the

GI stem cell niche to create a hierarchy of development from the undifferentiated cells located at the bottom of the crypt to the differentiated cells located at the top of the villus (Vinson et al., 2016). Therefore, ligands of the Wnt and Notch pathways have been shown to be the highest at the base of the crypt and found at decreased levels as cells differentiate going up the villus where ligands of the BMP and HH pathways have been shown to be more active (Vinson et al., 2016).

Dysregulation of any of these pathways has been shown to impact tumorigenicity

(Vinson et al., 2016). Wnt has been shown to regulate -catenin and in the presence of a Wnt ligand, -catenin has been shown to localize to the nucleus and drives transcription (Medema and Vermeulen, 2011). Notch has been shown to 21 function in conjunction with Wnt to drive proliferation and has been shown to dictate lineage fate via Delta with Jagged ligand-mediated translocation of Notch intracellular domain (NICD) to the nucleus where it has been shown to drive transcription of Notch target genes (Medema and Vermeulen, 2011). BMPs have been shown to counteract proliferative Wnt signals, stopping proliferation and driving differentiation, via BMP receptors (BMPRs) and several SMAD phosphorylation events which have been shown to allow a SMAD complex to translocate to the nucleus and drive transcription of BMP target genes (Medema and Vermeulen, 2011). Hedgehog has also been shown to counteract Wnt proliferation signals via patched (PTCH) and smoothened (SMO) which have been shown to activate GLI transcription factors (act-GLI) to translocate to the nucleus and drive transcription of HH target genes (Medema and Vermeulen, 2011). The following sections will examine these pathways in more detail.

1.6.1 BMP

Stem cell homeostasis and differentiation has been shown to be regulated by extrinsic signals within stem cell niche microenvironments, some of which have been shown to be bone morphogenic proteins (BMPs) (He et al., 2004). BMPs have been documented to belong to the transformation growth factor beta (TGF) superfamily of regulatory proteins and consist of 30 secreted cytokines that signal through transmembrane serine/threonine kinase receptors to affect processes throughout the body including the differentiation of stem cells within their niches

(Wagner et al., 2010). The canonical pathway has been shown to be triggered 22 when a BMP binds to distinct receptors (BMPR1and BMPR2) leading to phosphorylation of SMAD proteins (SMAD1, -5,-8), which then forms a complex with SMAD4 and translocates to the nucleus where they have been shown to regulate gene expression (Wagner et al., 2010). In the intestinal stem cell niche,

BMP signaling has been shown to help balance stem cell self-renewal by inhibiting stem cell activation and expansion (He et al., 2004). BMP signaling has been shown to antagonize the Wnt pathway and as cells migrate towards the top of the intestinal stem cell niche, BMP signaling has been shown to increase along a gradient as Wnt signaling decreases, in effect inhibiting stem cell self-renewal while increasing differentiation (He et al., 2004). Dysregulation within the BMP pathway may lead to overactive proliferation and cancer (Blanco Calvo et al.,

2009). It has become a necessity to determine why mutations which inactivate components of the BMP pathway were found in human carcinomas (Farrall et al.,

2012). Because BMPs have been shown to be involved in maintaining quiescence within the stem cell niche and in the differentiation of these same cells later in the process, they may function as both tumor promoters and tumor suppressors based on the cell or tissue type and the amount of BMP determined to be present in the particular microenvironment (Blanco Calvo et al., 2009; Singh and Morris, 2010).

Inactivated BMP signaling has been demonstrated in 72 different colorectal cancer cell lines and has been observed in 70% of sporadic colorectal cancer tissues

(Wagner et al., 2010). A primary role of the BMP pathway has been pinpointed in the epithelial lining of the GI tract where loss of this signaling has been observed at the transition point between adenomas (which are benign) and carcinomas, 23 demonstrating that BMP loss was involved in progression of tumors rather than initiation (Hardwick et al., 2008).

As discussed above, dysregulation of the BMP pathway was detrimental in of itself, however, in conjunction with HIV, cancer progression driven by this pathway becomes even more detrimental. It has been demonstrated in human osteoblasts, which are cells responsible for bone formation and remodeling, that HIV-1 proteins p55-gag and gp120 significantly altered the secretion of regulatory proteins and transcription factor activity, affecting the ability of these cells to differentiate into functioning osteoblasts (Cotter et al., 2007). In addition, the interaction of the HIV-

1 protein Tat with osteoblasts has been shown to lead to the reduction of the BMP receptor (BMPR2) which has been speculated to lead to uncontrolled proliferation in aortic vascular smooth muscle cells (Caldwell et al., 2006). Another study has demonstrated that gp120 impairs -catenin trafficking and nuclear transcription in human osteoblasts leading to inhibition of differentiation and function of the osteoblasts (Butler et al., 2013). This was further supported by an observed impairment of mesenchymal stem cell differentiation into osteoblasts, a reduction in the osteoblast function and reduced bone formation rate in HIV-1-infected patients (Cotter et al., 2007; Serrano et al., 1995).

1.6.2 Notch

Notch signaling has been shown to maintain cell development, activates differentiation programs, and promotes or suppresses cell proliferation and apoptosis (Previs et al., 2015; Vinson et al., 2016). There are five known 24 transmembrane Notch ligands; delta-like proteins (DLL1, DLL3, DLL4) and Jagged proteins (JAG1, JAG2) (Vinson et al., 2016). These ligands have been shown to bind via direct cell-to-cell contact to four transmembrane Notch receptors (Notch1,

Notch2, Notch3, Notch4) (Vinson et al., 2016). Upon binding, two proteolytic cleavages have been shown to occur that are facilitated by ADAM protease and - secretase causing the release of an active intracellular domain (NICD) (Vinson et al., 2016). The NICD has been shown to translocate to the nucleus where it binds to the CSL/RBPJ transcription factor to activate transcription of a cell fate regulatory family of proteins, HES and HEY (Vinson et al., 2016). HES and HEY proteins have been shown to regulate apoptosis, cell cycle, proliferation, differentiation, neurogenesis and metabolism (Vinson et al., 2016). Subsequently,

NICD has been phosphorylated and ubiquitinated, and targeted for proteosomal degradation (Vinson et al., 2016). Colon and colorectal cancer cells have been shown to exhibit a 10-30 fold increase in Notch signaling, demonstrating dysregulation within this pathway (Vinson et al., 2016). Colorectal cancer cells also harness the Notch pathway for self-renewal, leading to tumorigenesis and metastasis (Vinson et al., 2016). The Notch and Wnt signaling pathways both operate at the same location and have demonstrated crosstalk, which has been shown to influence each pathway through modulation of ligands and receptors and other signaling intermediaries (Vinson et al., 2016).

The receptor Notch2 has been shown to contain an EGF-like domain within its structure that is a domain shown to exist on a widespread number of cellular 25 proteins (Shoham et al., 2003). Shoham et al. demonstrated that the HIV protein

Tat binds to EGF-like domains and can therefore, bind to Notch2, acting as a ligand and intervening with its physiological functions as part of the Notch signaling pathway (Shoham et al., 2003). Studies have demonstrated that over-activation of

Notch signaling leads to inappropriate neurogenesis via activation of the Hes1 gene and altering neuroprogenitor cell proliferation, migration, and differentiation

(Fan et al., 2016). While this interaction hasn’t been demonstrated in the GI tract, it has implicated HIV-1 protein interaction and dysregulation of a key pathway within this region.

1.6.3 EGF pathway

The epidermal growth factor (EGF) pathway has been shown to work together with the JAK/STAT pathway within the stem cell niche to promote stem cell proliferation and differentiation (Buchon et al., 2010). EGF receptors (EGFRs) have shown to be a part of a family of tyrosine kinase receptors that includes EGFR/HER-1, HER-

2, HER-3, and HER-4 which have been shown to be expressed in many cancers and are part of a signaling cascade serving to modulate growth, signaling, differentiation, adhesion, migration, and survival of cancer cells (Seshacharyulu et al., 2012). The EGF ligands Spitz, Keren, and Vein have been shown to bind to the EGFR leading to dimerization and autophosphorylation, creating docking sites for other signal transducers regulating a network of pathways, such as the

Ras/MAPK, PI3K/AKT, PLC-/PKC, and STAT signaling pathways, to promote 26 intestinal development, intestinal mucosa repair, decrease pathogen colonization, regulate tight junction components, and enhance mucin secretions (Tang et al.,

2016). Dysregulation of different regulatory elements in these pathways, such as overexpression of receptor or ligands, mutations leading to constitutive activation, inefficient inactivation mediated by clathrin-dependent endocytosis, or transactivation has been linked to hyperproliferative diseases such as cancer

(Prenzel et al., 2001). The EGFR family of tyrosine kinase receptors has often been overexpressed in both gastric and colorectal solid cancers (Lin et al., 2001).

In addition to activating several signaling pathways, EGFR has been shown to contain a transactivation domain and can translocate to the nucleus to act as a transcription factor and cause over proliferation via dysregulation of cell cycle genes, including cyclin D (Lin et al., 2001). Downregulation of EGFR signaling has been achieved through the internalization of activated receptors by clathrin- dependent endocytosis and subsequent lysosomal degradation and that is essential to terminate cell proliferation signals (Mizuno et al., 2005; Valiathan and

Resh, 2004).

It has been demonstrated that EGFR downregulation has been decreased when the HIV-1 Gag protein was present (Valiathan and Resh, 2004). The effect of this increased surface receptor presence was increased intracellular signaling and hyperactivation of several proliferative pathways leading to tumorigenesis

(Valiathan and Resh, 2004).

As discussed within the context of the Notch pathway, HIV-1 Tat has been shown to interact with EGF-like repeats, which have been named based on where they were first observed on EGF (Shoham et al., 2003). This has suggested that Tat interacts within the EGF pathway and could potentially upregulate cell cycle genes which would over activate proliferation and initiate tumor development.

1.6.4 Hedgehog signaling

In the GI tract, two members of the Hedgehog (HH) family of signaling proteins have been shown to be expressed, sonic hedgehog (SHH) and indian hedgehog

(IHH) (Wu et al., 2017). During embryonic development, these proteins have been shown to be part of a signaling cascade that aids in formation of many organs and tissues, including growth and differentiation in the GI tract (Wu et al., 2017). In adults, HH signaling has served as an integral part of maintaining homeostasis in intestinal epithelial cells (Wu et al., 2017). SHH has been shown to be the ligand that binds to the transmembrane receptor patched1 (PTCH1), causing it to release its inhibitory hold on another transmembrane receptor smoothened (SMO) (Wong et al., 2011). Upon release, SMO has been shown to modulate a cytoplasmic complex including suppressor of fused (SUFU) which has been shown to initiate signal transduction through induction of members of the glioma-associated (GLI) family of zinc-finger transcription factors, GLI1, GLI2, and GLI3 (Wong et al., 2011).

GLIs enter the nucleus and regulate transcription of target genes involved in proliferation and differentiation, cell survival, self-renewal, with components of the 28

HH pathway itself, providing positive and negative feedback for regulation of this pathway (McMillan and Matsui, 2012). In light of the pathway’s target gene functions and its feedback loop, it has been easy to see why inappropriate activation of the HH pathway has been demonstrated in several cancer types, including gastric and colon cancer (Song et al., 2011). SHH was also expressed in the thymus and modulates the development of thymocytes from CD4-CD8- to

CD4+CD8+ to CD4-CD8+ or CD4+CD8- (double-negative DN, to double-positive

DP, to single-positive SP), a critical step in T-cell maturation (Outram et al., 2000).

It has been the reduction of HH signaling via reduction of the SHH ligand, and the inhibition of SMO as a result, which has helped T cells mature from DP to SP cells

(Saldana et al., 2016). Constitutively active SHH not only has reduced the number of SP T cells but skews the CD4SP:CD8SP ratio with more CD8SP cells as a result

(Rowbotham et al., 2007). HIV-1 infection has been shown to upregulate the HH receptor PTCH1, which has been consistent with activation of the HH pathway and may affect the ratio of CD4SP:CD8SP (Lee-Huang et al., 2003). Gastric tumors have commonly displayed a loss-of-function mutation in PTCH1 or gain of function mutations in SMO (Wu et al., 2017).

In vitro, spheroids grown from human gastric cancer cell lines have been shown to display increased expression of mRNA of HH pathway target genes, SHH, PTCH, and GLI1 (Song et al., 2011). These HH target genes have been considered important markers of abnormal HH signaling activation (Song et al., 2011). A relationship between aberrant HH pathway activation and gastric cancer has been well established (Song et al., 2011). Similarly, it has been shown in PLWH that 29 non-AIDS defining cancers (NADCs) have occurred with an increased incidence, at younger ages, and regardless of CD4 T-cell count (Mbulaiteye et al., 2003). This has indicated that other mechanisms besides immunodeficiency have been involved in the etiology of these cancers. Furler et al. demonstrated that HIV-1 Tat binds to GLI2 in the HH pathway and may contribute to increased levels of the immunosuppressive factor TGF-1 which has bee n characteristic of HIV-1 disease progression (Furler and Uittenbogaart, 2012). It has been shown that HIV-

1-infected podocytes displayed an activated HH signaling pathway with increased expression of PTCH (Lan et al., 2017). Since aberrant HH signaling has been demonstrated in gastric tumors and HIV-1 has acted to upregulate members of the pathway feedback loop activation, it has standed to reason that the interaction between HIV-1 and HH signaling may be a putative cause of the observed increase of GI cancers in HIV-1-infected patients.

Within the GI tract there have been shown to be a plethora of cellular pathways with which HIV-1 proteins may interact with and subsequently dysregulate. Some of the pathways that have been shown to be affected by viral proteins may demonstrate crosstalk ability with other pathways. Ostensibly, the entire compartment and the entire body has been shown to be interrelated. This review attempted to explore some of the most critical pathways within the oncogenic process.

1.6.5 Wnt 30

The Wnt signaling pathway has been shown to regulate many cellular processes including cell fate determination, motility, polarity, primary axis formation, organogenesis, and stem cell renewal (Komiya and Habas, 2008). Dysregulated

Wnt signaling was detrimental to developing embryos causing skeletal defects and birth defects (Komiya and Habas, 2008). Additionally, dysregulated Wnt signaling was also causative for many cancers including breast, skin, and colon (Komiya and Habas, 2008). The canonical Wnt signaling pathway was triggered when a secreted Wnt glycoprotein was shown to bind to the extracellular domain of the receptor Frizzled (Fz) and a co-receptor called low-density-lipoprotein-related protein 5/6 (LRP5/6) (Fig. 1) (Komiya and Habas, 2008). It was here that, during development, a number of Wnt antagonists were shown to bind to and regulate

Wnt ligands and prevent their interaction with Fz or LRP5/6 (Komiya and Habas,

2008). These antagonists are Dickkopf (Dkk), Wnt-inhibitor protein (WIF), soluble

Frizzled-related proteins (SFRP), Cerebrus, Frzb, and Wise (Komiya and Habas,

2008). Their purpose has been shown to limit and create a gradient of Wnt signaling for pattern formation during embryogenesis (Komiya and Habas, 2008).

After binding to Fz and LRP5/6 the signal was shown to be transduced to

Dishevelled (Dsh, Dvl), LRP5/6 was shown to be phosphorylated by CK1 or GSK3, and a protein complex including Axin was recruited and shown to bind to LRP5/6

(Komiya and Habas, 2008). When bound to LRP5/6 this complex induced stabilization of -catenin, which was then shown to be translocated to the nucleus to mediate transcription of target genes via association with TCF/LEF transcription 31

Figure 1

Figure 1. The canonical Wnt signaling pathway: The canonical Wnt signaling pathway in the “Off,” position with no Wnt ligand bound to receptors Frizzled and LRP5/6. The destruction complex consisting of APC, Axin, CK1, and GSK3 target -catenin for proteasomal degradation via a series of phosphorylation events. “On,” with a Wnt ligand bound to cellular receptors, the destruction complex members are held at the cell membrane, and therefore, do not phosphorylate - catenin, causing it to accumulate in the cytoplasm and translocate into the nucleus, where it transactivates transcription of Wnt target genes.

32 factors (Komiya and Habas, 2008). Target genes have included those involved in oncogenesis such as c-myc, and cyclinD1 (Komiya and Habas, 2008). In the absence of a Wnt ligand, cytoplasmic -catenin has been shown to be degraded by a destruction complex, which also was shown to include Axin, APC, GSK3, and

CK1 (now not bound to LRP5/6), and this complex targeted -catenin for ubiquitination and proteosomal degradation (Komiya and Habas, 2008). Wnt signaling and downstream -catenin- induced gene transcription has been shown to be dysregulated in many cancers (Polakis, 2000). Mutations in APC and other members of the destruction complex have been observed in colorectal tumors

(Polakis, 2000). Mutations directly in -catenin and activators of -catenin have been detected in melanomas, gastric cancer hepatocellular carcinomas, and hair follicle tumors (Polakis, 2000). BMP signaling has been shown to antagonize

Wnt/-catenin, therefore, mutations in the BMP pathway may cause Wnt signaling to be hyperactive and initiate tumorigenesis (Farrall et al., 2012).

Impaired -catenin trafficking has been demonstrated in cells exposed to the HIV-

1 protein, gp120 (Butler et al., 2013). It has been thought that gp120 associates with Wnt antagonist, Dkk1, and has been shown to mediate a degenerative process in human osteoblasts by interfering with Wnt signaling (Butler et al., 2013).

HIV-1 viral protein U (Vpu) has been shown to increase the release of nascent virions from the cellular membrane and mediate degradation of the CD4 receptor in the ER, thus promoting pathogenesis (Besnard-Guerin et al., 2004; Salim and 33

Ratner, 2008). Additionally, Vpu has been shown to stabilize -catenin and lead to its nuclear accumulation, resulting in enhanced TCF activity and upregulation of c- myc and cyclin D1 and other genes implicated in a number of cancers, including those in the GI tract (Salim and Ratner, 2008; Tetsu and McCormick, 1999).

The HIV-1 negative regulatory factor (Nef) has been shown to be an essential accessory protein mediating viral pathogenicity (Fackler and Baur, 2002). Nef has been shown to interact with cellular proteins involved in T-cell receptor signaling and in trafficking of cell-surface receptors such as CD4 and MHC (Weiser et al.,

2013). Nef has been shown to act as an adaptor between the host major histocompatibility complex class I (MHC I) and clathrin adaptor protein (AP-1) which shuttles MHC I to the endosomal pathway to be degraded (Bresnahan et al.,

1998). By degrading MHC I the virus has been shown to evade cytotoxic T lymphocytes and to establish infection in a greater number of cells (Weiser et al.,

2013). Nef has also been shown to downregulate the cell surface receptor, CD4, which has been shown to prevent premature cell death by avoiding superinfection of one cell (Lama et al., 1999). With respect to GI cancers, Weiser et al. has demonstrated that Nef can bind directly to -catenin, the key transcriptional activator in the Wnt signaling pathway (Fig. 2) (Weiser et al., 2013). This study confirmed Nef as a viral ligand of -catenin in an in vitro pulldown assay. They further suggested that Nef could compete for the same binding site as TCF (Weiser et al., 2013). The interaction of Nef with -catenin has implicated the viral protein

Figure 2

Figure 2. Potential Nef interaction in the canonical Wnt pathway The HIV-1 protein, Nef interacts with -catenin directly or with -catenin destruction complex member(s), allowing -catenin to accumulate in the cytoplasm, translocate to the nucleus, and transactivate transcription of Wnt target genes.

35 in upregulation of the Wnt pathway and the observed elevated risk and earlier onset of colonic neoplasia in PLWH (Lu et al., 2014; Weiser et al., 2013).

Recently, a humanized mouse model infected with HIV-1 demonstrated significantly increased colon cancer outgrowth and increased epithelial cell proliferation (Lu et al., 2014). This study determined that -catenin activation was increased in the human colon cancer cell line, HCT116, and in vivo in tumors of mice infected with HIV-1 (Lu et al., 2014). Mutations in the Wnt pathway proteins such as APC and -catenin have been linked to an increase in the number and size of a number of intestinal tumors (Bienz and Clevers, 2000). Oncogenic - catenin mutations have been found in most colon cancers with wild-type APC (Lu et al., 2014). These mutations have been shown to initiate the neoplastic process, resulting in the accumulation of mutations in other growth control genes (Sparks et al., 1998). APC has been shown to contain a nuclear export signal (NES), which can transport -catenin out of the nucleus when it is bound to APC (Bienz and

Clevers, 2000). When there are mutations in APC it can no longer export -catenin from the nucleus, allowing it to accumulate inside the nucleus, where it continues to stimulate Wnt target gene transcription (Bienz and Clevers, 2000). At least two

Wnt target genes are cell cycle promoting genes, c-myc and cyclin D1. When dysregulated, these genes can promote tumorigenesis (Bienz and Clevers, 2000).

1.7 ART penetration

Subsequent to examining the above important pathways with regards to GI cancers, a discussion of ART has significant merit. With 400m2 of mucosal lining the GI tract has been shown to represent the largest compartment of immune cells, while the peripheral blood contains only 2-5% of all lymphocytes (Mehandru et al.,

2004). The T cells within the GI tract have been shown to be maintained in an activated state due to the region’s continuous exposure to food and microbial antigens. The percentage of CD4+ CCR5+ T cells within the GI tract has been shown to be higher than in the peripheral blood, making this region more susceptible to HIV-1 infection (Mehandru et al., 2004). In fact, studies have demonstrated a significant and preferential depletion of CD4+ T cells within the GI mucosa during the acute phase of HIV-1 infection (Mehandru et al., 2004).

Antiretrovirals (ARVs) have been shown to substantially restore the CD4+ T cells in circulating blood, however, not in the gut compartment (Mavigner et al., 2012).

Additionally, after 5 years of ART, a significant number of patients have displayed a greater CD4+ T-cell loss remaining in the GI mucosa (Mehandru et al., 2004).

While patients have been shown to have a reduced viral load in PBMCs while on

ART, the virus continues to replicate in the GALT and innate/adaptive immunity has not been not fully restored in this region (Fletcher et al., 2014). This may be why people with HIV-1 have a higher than normal incidence of NADCs (Mbulaiteye et al., 2003). All of this becomes quite concerning in light of a study demonstrating a decrease of ARV drug concentration within gut lymphatic tissue (Fig. 3) (Fletcher et al., 2014). It has become evident that measuring viral load in PBMCs does not accurately reflect viral production in LTs (Estes et al., 2017)(Fletcher et al., 2014). 37

The next goal has been to determine why drug concentrations are disparate between the blood and lymphatic compartments and how that can be altered.

Recently, it has been suggested that the CD4+ T-cell population has not been fully restored within the gut compartment of PLWH due to lack of recruitment (Mavigner et al., 2012). CCR9 and integrin 47 have been shown to be “gut-homing” receptors (Mavigner et al., 2012). The CCR9 ligand, CCL25, has been shown to be expressed solely in the small intestine and the integrin 47 ligand, MAdCAM-

1, has been shown to be expressed along the entire intestine (Mavigner et al.,

2012). The expression of these receptors marks a T-cell population which will likely migrate to the intestines (Mavigner et al., 2012). It has been demonstrated that

47 was complexed with CD4 and HIV-1 gp120 binds to 47 (Cicala et al.,

2009). CD4+ 47+ T cells are CCR5high and CXCR4low and are metabolically active,

Figure 3

Figure 3. ART penetration is diminished in the gastrointestinal tract of HIV- 1-infected patients. In ART treated HIV-1-infected patients, there has been shown to be a differential between the gastrointestinal tract and the peripheral blood with respect to virus replication and ART penetration. ARV levels are higher in the peripheral blood and as such viral replication is held in check and there is little to no virus replication. In contrast, within the gastrointestinal tract, ARV does not penetrate to high levels, which allows for viral replication to occur. Within this region, there has been shown to be an active H(V-1 infection and virus production due to the low concentration of ARV.

39 making this population more susceptible to HIV-1 infection (Cicala et al., 2009).

The affinity of gp120 for 47 links the early phase of HIV-1 infection to the gut and allows HIV-1 to infect activated T cells which are critical for viral progression

(Cicala et al., 2009). Normally, T cells displaying these gut homing receptors would migrate from the blood to the GALT, however, in PLWH CCL25 expression has been observed at lower levels in the intestine. This could cause defective gut homing, perhaps causative of the observed lack of repletion of T cells in the GALT, owing to deficient immune reconstitution despite ART (Cicala et al., 2009;

Mavigner et al., 2012).

1.8 Conclusion

HIV-1-infected patients have been shown exhibit an increased incidence and an earlier onset NADCs, GI cancers specifically. This has suggested that other factors are at play besides immunodeficiency. As discussed in this review, there has been evidence of viral protein and cellular protein interactions in PLWH. In light of HIV-

1-infected patients having an increased life span due to effective ARV therapy, it has become increasingly obvious that the virus impacts many other biological systems and pathways and that ART has not penetrated all infected compartments equally well. Several studies have demonstrated that viral proteins from HIV-1 interact with many cellular proteins and cause dysregulation of important pathways

(MacPherson et al., 2010; Pinney et al., 2009).

Elucidating viral/cellular protein interactions is of great importance to prevent HIV-

1-associated diseases such as cancer. There have been many demonstrated viral/cellular protein interactions in key intestinal homeostatic pathways specifically, as described above. Further investigation into the role of HIV-1 as a factor in the increased incidence of GI cancers at an earlier onset in PLWH as compared to the general population has been needed. Lastly, ART penetration into the gut needs to be increased to perhaps limit HIV-1 protein interactions in this important tissue that likely harbors significant amounts of infectious virus despite many effective therapies.

List of References

Adachi, Y., Yasuda, K., Inomata, M., Sato, K., Shiraishi, N., Kitano, S., 2000. Pathology and prognosis of gastric carcinoma: well versus poorly differentiated type. Cancer 89, 1418-1424.

American Cancer Society, 2017. About Stomach Cancer.

American Cancer Society, 2018a. Key Statistics for Small Intestine Cancer.

American Cancer Society, 2018b. Treatment of Rectal Cancer by Stage.

American Cancer Society, 2018c. What is a Small Intestine Cancer?

Antiretroviral Therapy Cohort, C., 2017. Survival of HIV-positive patients starting antiretroviral therapy between 1996 and 2013: a collaborative analysis of cohort studies. Lancet HIV 4, e349-e356.

Appay, V., Sauce, D., 2008. Immune activation and inflammation in HIV-1 infection: causes and consequences. J Pathol 214, 231-241.

AVERT, 2018. HIV Strains and Types.

Bailey, C., 2011. Stomach cancer. BMJ Clin Evid 2011.

Besnard-Guerin, C., Belaidouni, N., Lassot, I., Segeral, E., Jobart, A., Marchal, C., Benarous, R., 2004. HIV-1 Vpu sequesters beta-transducin repeat-containing protein (betaTrCP) in the cytoplasm and provokes the accumulation of beta- catenin and other SCFbetaTrCP substrates. J Biol Chem 279, 788-795.

Bienz, M., Clevers, H., 2000. Linking colorectal cancer to Wnt signaling. Cell 103, 311-320. 42

Blanco Calvo, M., Bolos Fernandez, V., Medina Villaamil, V., Aparicio Gallego, G., Diaz Prado, S., Grande Pulido, E., 2009. Biology of BMP signalling and cancer. Clin Transl Oncol 11, 126-137.

Borges, A.H., Dubrow, R., Silverberg, M.J., 2014. Factors contributing to risk for cancer among HIV-infected individuals, and evidence that earlier combination antiretroviral therapy will alter this risk. Curr Opin HIV AIDS 9, 34-40.

Brenchley, J.M., Douek, D.C., 2008. HIV infection and the gastrointestinal immune system. Mucosal Immunol 1, 23-30.

Brenchley, J.M., Schacker, T.W., Ruff, L.E., Price, D.A., Taylor, J.H., Beilman, G.J., Nguyen, P.L., Khoruts, A., Larson, M., Haase, A.T., Douek, D.C., 2004. CD4+ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract. J Exp Med 200, 749-759.

Bresnahan, P.A., Yonemoto, W., Ferrell, S., Williams-Herman, D., Geleziunas, R., Greene, W.C., 1998. A dileucine motif in HIV-1 Nef acts as an internalization signal for CD4 downregulation and binds the AP-1 clathrin adaptor. Curr Biol 8, 1235- 1238.

Buchon, N., Broderick, N.A., Kuraishi, T., Lemaitre, B., 2010. Drosophila EGFR pathway coordinates stem cell proliferation and gut remodeling following infection. BMC Biol 8, 152.

Butler, J.S., Dunning, E.C., Murray, D.W., Doran, P.P., O'Byrne, J.M., 2013. HIV- 1 protein induced modulation of primary human osteoblast differentiation and function via a Wnt/beta-catenin-dependent mechanism. J Orthop Res 31, 218-226.

Caldwell, R.L., Gadipatti, R., Lane, K.B., Shepherd, V.L., 2006. HIV-1 TAT represses transcription of the bone morphogenic protein receptor-2 in U937 monocytic cells. J Leukoc Biol 79, 192-201.

Campbell, G.R., Pasquier, E., Watkins, J., Bourgarel-Rey, V., Peyrot, V., Esquieu, D., Barbier, P., de Mareuil, J., Braguer, D., Kaleebu, P., Yirrell, D.L., Loret, E.P., 2004. The glutamine-rich region of the HIV-1 Tat protein is involved in T-cell apoptosis. J Biol Chem 279, 48197-48204. 43

Canadian Cancer Society, 2018. The Colon and Rectum.

Cancer Treatment Centers of America, 2015. Intestinal Cancer Symptoms.

Cicala, C., Martinelli, E., McNally, J.P., Goode, D.J., Gopaul, R., Hiatt, J., Jelicic, K., Kottilil, S., Macleod, K., O'Shea, A., Patel, N., Van Ryk, D., Wei, D., Pascuccio, M., Yi, L., McKinnon, L., Izulla, P., Kimani, J., Kaul, R., Fauci, A.S., Arthos, J., 2009. The integrin alpha4beta7 forms a complex with cell-surface CD4 and defines a T-cell subset that is highly susceptible to infection by HIV-1. Proc Natl Acad Sci U S A 106, 20877-20882.

Contento, R.L., Molon, B., Boularan, C., Pozzan, T., Manes, S., Marullo, S., Viola, A., 2008. CXCR4-CCR5: a couple modulating T cell functions. Proc Natl Acad Sci U S A 105, 10101-10106.

Cotter, E.J., Malizia, A.P., Chew, N., Powderly, W.G., Doran, P.P., 2007. HIV proteins regulate bone marker secretion and transcription factor activity in cultured human osteoblasts with consequent potential implications for osteoblast function and development. AIDS Res Hum Retroviruses 23, 1521-1530.

Coussens, L.M., Werb, Z., 2002. Inflammation and cancer. Nature 420, 860-867.

De Falco, G., Bellan, C., Lazzi, S., Claudio, P., La Sala, D., Cinti, C., Tosi, P., Giordano, A., Leoncini, L., 2003. Interaction between HIV-1 Tat and pRb2/p130: a possible mechanism in the pathogenesis of AIDS-related neoplasms. Oncogene 22, 6214-6219.

Deeks, S.G., 2011. HIV infection, inflammation, immunosenescence, and aging. Annu Rev Med 62, 141-155.

Deeks, S.G., Phillips, A.N., 2009. HIV infection, antiretroviral treatment, ageing, and non-AIDS related morbidity. Bmj 338, a3172.

Du, W., Searle, J.S., 2009. The rb pathway and cancer therapeutics. Curr Drug Targets 10, 581-589. 44

Dubrow, R., Silverberg, M.J., Park, L.S., Crothers, K., Justice, A.C., 2012. HIV infection, aging, and immune function: implications for cancer risk and prevention. Curr Opin Oncol 24, 506-516.

Estes, J.D., Kityo, C., Ssali, F., Swainson, L., Makamdop, K.N., Del Prete, G.Q., Deeks, S.G., Luciw, P.A., Chipman, J.G., Beilman, G.J., Hoskuldsson, T., Khoruts, A., Anderson, J., Deleage, C., Jasurda, J., Schmidt, T.E., Hafertepe, M., Callisto, S.P., Pearson, H., Reimann, T., Schuster, J., Schoephoerster, J., Southern, P., Perkey, K., Shang, L., Wietgrefe, S.W., Fletcher, C.V., Lifson, J.D., Douek, D.C., McCune, J.M., Haase, A.T., Schacker, T.W., 2017. Defining total-body AIDS-virus burden with implications for curative strategies. Nat Med 23, 1271-1276.

Fackler, O.T., Baur, A.S., 2002. Live and let die: Nef functions beyond HIV replication. Immunity 16, 493-497.

Fan, Y., Gao, X., Chen, J., Liu, Y., He, J.J., 2016. HIV Tat Impairs Neurogenesis through Functioning As a Notch Ligand and Activation of Notch Signaling Pathway. J Neurosci 36, 11362-11373.

Farrall, A.L., Riemer, P., Leushacke, M., Sreekumar, A., Grimm, C., Herrmann, B.G., Morkel, M., 2012. Wnt and BMP signals control intestinal adenoma cell fates. Int J Cancer 131, 2242-2252.

Fevrier, M., Dorgham, K., Rebollo, A., 2011. CD4+ T cell depletion in human immunodeficiency virus (HIV) infection: role of apoptosis. Viruses 3, 586-612.

Fletcher, C.V., Staskus, K., Wietgrefe, S.W., Rothenberger, M., Reilly, C., Chipman, J.G., Beilman, G.J., Khoruts, A., Thorkelson, A., Schmidt, T.E., Anderson, J., Perkey, K., Stevenson, M., Perelson, A.S., Douek, D.C., Haase, A.T., Schacker, T.W., 2014. Persistent HIV-1 replication is associated with lower antiretroviral drug concentrations in lymphatic tissues. Proc Natl Acad Sci U S A 111, 2307-2312.

Flint, S.J., American Society for Microbiology., Principles of virology : molecular biology, pathogenesis, and control.

Furler, R.L., Uittenbogaart, C.H., 2012. GLI2 regulates TGF-beta1 in human CD4+ T cells: implications in cancer and HIV pathogenesis. PLoS One 7, e40874. 45

Glebov, O.K., Rodriguez, L.M., Nakahara, K., Jenkins, J., Cliatt, J., Humbyrd, C.J., DeNobile, J., Soballe, P., Simon, R., Wright, G., Lynch, P., Patterson, S., Lynch, H., Gallinger, S., Buchbinder, A., Gordon, G., Hawk, E., Kirsch, I.R., 2003. Distinguishing right from left colon by the pattern of gene expression. Cancer Epidemiol Biomarkers Prev 12, 755-762.

Grabsch, H.I., Tan, P., 2013. Gastric cancer pathology and underlying molecular mechanisms. Dig Surg 30, 150-158.

Groschwitz, K.R., Hogan, S.P., 2009. Intestinal barrier function: molecular regulation and disease pathogenesis. J Allergy Clin Immunol 124, 3-20; quiz 21- 22.

Hardwick, J.C., Kodach, L.L., Offerhaus, G.J., van den Brink, G.R., 2008. Bone morphogenetic protein signalling in colorectal cancer. Nat Rev Cancer 8, 806-812.

He, X.C., Zhang, J., Tong, W.G., Tawfik, O., Ross, J., Scoville, D.H., Tian, Q., Zeng, X., He, X., Wiedemann, L.M., Mishina, Y., Li, L., 2004. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling. Nat Genet 36, 1117-1121.

Hemelaar, J., 2012. The origin and diversity of the HIV-1 pandemic. Trends Mol Med 18, 182-192.

Kogan, M., Deshmane, S., Sawaya, B.E., Gracely, E.J., Khalili, K., Rappaport, J., 2013. Inhibition of NF-kappaB activity by HIV-1 Vpr is dependent on Vpr binding protein. J Cell Physiol 228, 781-790.

Komiya, Y., Habas, R., 2008. Wnt signal transduction pathways. Organogenesis 4, 68-75.

Krausova, M., Korinek, V., 2012. Signal transduction pathways participating in homeostasis and malignant transformation of the intestinal tissue. Neoplasma 59, 708-718. 46

Lama, J., Mangasarian, A., Trono, D., 1999. Cell-surface expression of CD4 reduces HIV-1 infectivity by blocking Env incorporation in a Nef- and Vpu- inhibitable manner. Curr Biol 9, 622-631.

Lambert, A.W., Pattabiraman, D.R., Weinberg, R.A., 2017. Emerging Biological Principles of Metastasis. Cell 168, 670-691.

Lan, X., Wen, H., Cheng, K., Plagov, A., Marashi Shoshtari, S.S., Malhotra, A., Singhal, P.C., 2017. Hedgehog pathway plays a vital role in HIV-induced epithelial- mesenchymal transition of podocyte. Exp Cell Res 352, 193-201.

Lee-Huang, S., Zhang, L., Huang, P.L., Chang, Y.T., Huang, P.L., 2003. Anti-HIV activity of olive leaf extract (OLE) and modulation of host cell gene expression by HIV-1 infection and OLE treatment. Biochem Biophys Res Commun 307, 1029- 1037.

Lenassi, M., Cagney, G., Liao, M., Vaupotic, T., Bartholomeeusen, K., Cheng, Y., Krogan, N.J., Plemenitas, A., Peterlin, B.M., 2010. HIV Nef is secreted in exosomes and triggers apoptosis in bystander CD4+ T cells. Traffic 11, 110-122.

Li, F.Y., Lai, M.D., 2009. Colorectal cancer, one entity or three. J Zhejiang Univ Sci B 10, 219-229.

Lin, S.Y., Makino, K., Xia, W., Matin, A., Wen, Y., Kwong, K.Y., Bourguignon, L., Hung, M.C., 2001. Nuclear localization of EGF receptor and its potential new role as a transcription factor. Nat Cell Biol 3, 802-808.

Lu, R., Wu, S., Zhang, Y., Xia, Y., Huelsmann, E.J., Lacek, A.T., Nabatiyan, A., Richards, M.H., Narasipura, S.D., Lutgen, V., Chen, H., Kaufman, H.L., Chen, D., Al-Harthi, L., Zloza, A., Sun, J., 2014. HIV infection accelerates gastrointestinal tumor outgrowth in NSG-HuPBL mice. AIDS Res Hum Retroviruses 30, 677-684.

Ma, J., Shen, H., Kapesa, L., Zeng, S., 2016. Lauren classification and individualized chemotherapy in gastric cancer. Oncol Lett 11, 2959-2964. 47

MacPherson, J.I., Dickerson, J.E., Pinney, J.W., Robertson, D.L., 2010. Patterns of HIV-1 protein interaction identify perturbed host-cellular subsystems. PLoS Comput Biol 6, e1000863.

Mavigner, M., Cazabat, M., Dubois, M., L'Faqihi, F.E., Requena, M., Pasquier, C., Klopp, P., Amar, J., Alric, L., Barange, K., Vinel, J.P., Marchou, B., Massip, P., Izopet, J., Delobel, P., 2012. Altered CD4+ T cell homing to the gut impairs mucosal immune reconstitution in treated HIV-infected individuals. J Clin Invest 122, 62-69.

Mbulaiteye, S.M., Biggar, R.J., Goedert, J.J., Engels, E.A., 2003. Immune deficiency and risk for malignancy among persons with AIDS. J Acquir Immune Defic Syndr 32, 527-533.

McMillan, R., Matsui, W., 2012. Molecular pathways: the hedgehog signaling pathway in cancer. Clin Cancer Res 18, 4883-4888.

Medema, J.P., Vermeulen, L., 2011. Microenvironmental regulation of stem cells in intestinal homeostasis and cancer. Nature 474, 318-326.

Mehandru, S., 2007. The Gastrointestinal Tract in HIV-1 Infection: Questions, Answers, and More Questions. Physicians’ Research Network 12, 1-10.

Mehandru, S., Poles, M.A., Tenner-Racz, K., Horowitz, A., Hurley, A., Hogan, C., Boden, D., Racz, P., Markowitz, M., 2004. Primary HIV-1 infection is associated with preferential depletion of CD4+ T lymphocytes from effector sites in the gastrointestinal tract. J Exp Med 200, 761-770.

Melo, S.A., Sugimoto, H., O'Connell, J.T., Kato, N., Villanueva, A., Vidal, A., Qiu, L., Vitkin, E., Perelman, L.T., Melo, C.A., Lucci, A., Ivan, C., Calin, G.A., Kalluri, R., 2014. Cancer exosomes perform cell-independent microRNA biogenesis and promote tumorigenesis. Cancer Cell 26, 707-721.

Mizuno, E., Iura, T., Mukai, A., Yoshimori, T., Kitamura, N., Komada, M., 2005. Regulation of epidermal growth factor receptor down-regulation by UBPY- mediated deubiquitination at endosomes. Mol Biol Cell 16, 5163-5174. 48

National Cancer Institute, 2014. Cancer Stat Facts: Stomach Cancer.

National Cancer Institute, 2015. Immunosuppression

National Cancer Institute, 2017. Metastatic Cancer.

Nishida, N., Yano, H., Nishida, T., Kamura, T., Kojiro, M., 2006. Angiogenesis in cancer. Vasc Health Risk Manag 2, 213-219.

Outram, S.V., Varas, A., Pepicelli, C.V., Crompton, T., 2000. Hedgehog signaling regulates differentiation from double-negative to double-positive thymocyte. Immunity 13, 187-197.

Pages, V., Fuchs, R.P., 2002. How DNA lesions are turned into mutations within cells? Oncogene 21, 8957-8966.

Park, L.S., Hernandez-Ramirez, R.U., Silverberg, M.J., Crothers, K., Dubrow, R., 2016. Prevalence of non-HIV cancer risk factors in persons living with HIV/AIDS: a meta-analysis. AIDS 30, 273-291.

Patel, P., Hanson, D.L., Sullivan, P.S., Novak, R.M., Moorman, A.C., Tong, T.C., Holmberg, S.D., Brooks, J.T., Adult, Adolescent Spectrum of Disease, P., Investigators, H.I.V.O.S., 2008. Incidence of types of cancer among HIV-infected persons compared with the general population in the United States, 1992-2003. Ann Intern Med 148, 728-736.

Paulovich, A.G., Toczyski, D.P., Hartwell, L.H., 1997. When checkpoints fail. Cell 88, 315-321.

Pelaseyed, T., Bergstrom, J.H., Gustafsson, J.K., Ermund, A., Birchenough, G.M., Schutte, A., van der Post, S., Svensson, F., Rodriguez-Pineiro, A.M., Nystrom, E.E., Wising, C., Johansson, M.E., Hansson, G.C., 2014. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunol Rev 260, 8- 20. 49

Pelengaris, S., Khan, M., Blasco, M.a.A., 2006. The molecular biology of cancer. Blackwell Pub.,, Malden, MA, pp. 1 online resource (x, 531 pages).

Pinney, J.W., Dickerson, J.E., Fu, W., Sanders-Beer, B.E., Ptak, R.G., Robertson, D.L., 2009. HIV-host interactions: a map of viral perturbation of the host system. AIDS 23, 549-554.

Polakis, P., 2000. Wnt signaling and cancer. Genes Dev 14, 1837-1851.

Prenzel, N., Fischer, O.M., Streit, S., Hart, S., Ullrich, A., 2001. The epidermal growth factor receptor family as a central element for cellular signal transduction and diversification. Endocr Relat Cancer 8, 11-31.

Previs, R.A., Coleman, R.L., Harris, A.L., Sood, A.K., 2015. Molecular pathways: translational and therapeutic implications of the Notch signaling pathway in cancer. Clin Cancer Res 21, 955-961.

Quail, D.F., Joyce, J.A., 2013. Microenvironmental regulation of tumor progression and metastasis. Nat Med 19, 1423-1437.

Rowbotham, N.J., Hager-Theodorides, A.L., Cebecauer, M., Shah, D.K., Drakopoulou, E., Dyson, J., Outram, S.V., Crompton, T., 2007. Activation of the Hedgehog signaling pathway in T-lineage cells inhibits TCR repertoire selection in the thymus and peripheral T-cell activation. Blood 109, 3757-3766.

Saldana, J.I., Solanki, A., Lau, C.I., Sahni, H., Ross, S., Furmanski, A.L., Ono, M., Hollander, G., Crompton, T., 2016. Sonic Hedgehog regulates thymic epithelial cell differentiation. J Autoimmun 68, 86-97.

Salim, A., Ratner, L., 2008. Modulation of beta-catenin and E-cadherin interaction by Vpu increases human immunodeficiency virus type 1 particle release. J Virol 82, 3932-3938.

Samji, H., Cescon, A., Hogg, R.S., Modur, S.P., Althoff, K.N., Buchacz, K., Burchell, A.N., Cohen, M., Gebo, K.A., Gill, M.J., Justice, A., Kirk, G., Klein, M.B., Korthuis, P.T., Martin, J., Napravnik, S., Rourke, S.B., Sterling, T.R., Silverberg, M.J., Deeks, S., Jacobson, L.P., Bosch, R.J., Kitahata, M.M., Goedert, J.J., Moore, 50

R., Gange, S.J., North American, A.C.C.o.R., Design of Ie, D.E.A., 2013. Closing the gap: increases in life expectancy among treated HIV-positive individuals in the United States and Canada. PLoS One 8, e81355.

Sepulveda, A.R., Yao, Y., Yan, W., Park, D.I., Kim, J.J., Gooding, W., Abudayyeh, S., Graham, D.Y., 2010. CpG methylation and reduced expression of O6- methylguanine DNA methyltransferase is associated with Helicobacter pylori infection. Gastroenterology 138, 1836-1844.

Serrano, S., Marinoso, M.L., Soriano, J.C., Rubies-Prat, J., Aubia, J., Coll, J., Bosch, J., Del Rio, L., Vila, J., Goday, A., et al., 1995. Bone remodelling in human immunodeficiency virus-1-infected patients. A histomorphometric study. Bone 16, 185-191.

Seshacharyulu, P., Ponnusamy, M.P., Haridas, D., Jain, M., Ganti, A.K., Batra, S.K., 2012. Targeting the EGFR signaling pathway in cancer therapy. Expert Opin Ther Targets 16, 15-31.

Shebl, F.M., Yu, K., Landgren, O., Goedert, J.J., Rabkin, C.S., 2012. Increased levels of circulating cytokines with HIV-related immunosuppression. AIDS Res Hum Retroviruses 28, 809-815.

Shoham, N., Cohen, L., Yaniv, A., Gazit, A., 2003. The Tat protein of the human immunodeficiency virus type 1 (HIV-1) interacts with the EGF-like repeats of the Notch proteins and the EGF precursor. Virus Res 98, 57-61.

Singh, A., Morris, R.J., 2010. The Yin and Yang of bone morphogenetic proteins in cancer. Cytokine Growth Factor Rev 21, 299-313.

Sitas, F., 2016. Twenty five years since the first prospective study by Forman et al. (1991) on Helicobacter pylori and stomach cancer risk. Cancer Epidemiol 41, 159-164.

Song, Z., Yue, W., Wei, B., Wang, N., Li, T., Guan, L., Shi, S., Zeng, Q., Pei, X., Chen, L., 2011. Sonic hedgehog pathway is essential for maintenance of cancer stem-like cells in human gastric cancer. PLoS One 6, e17687. 51

Sparks, A.B., Morin, P.J., Vogelstein, B., Kinzler, K.W., 1998. Mutational analysis of the APC/beta-catenin/Tcf pathway in colorectal cancer. Cancer Res 58, 1130- 1134.

Stewart, S.A., Poon, B., Jowett, J.B., Chen, I.S., 1997. Human immunodeficiency virus type 1 Vpr induces apoptosis following cell cycle arrest. J Virol 71, 5579- 5592.

Stewart, Z.A., Westfall, M.D., Pietenpol, J.A., 2003. Cell-cycle dysregulation and anticancer therapy. Trends Pharmacol Sci 24, 139-145.

Tachiwana, H., Shimura, M., Nakai-Murakami, C., Tokunaga, K., Takizawa, Y., Sata, T., Kurumizaka, H., Ishizaka, Y., 2006. HIV-1 Vpr induces DNA double- strand breaks. Cancer Res 66, 627-631.

Tang, X., Liu, H., Yang, S., Li, Z., Zhong, J., Fang, R., 2016. Epidermal Growth Factor and Intestinal Barrier Function. Mediators Inflamm 2016, 1927348.

Tetsu, O., McCormick, F., 1999. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398, 422-426.

Torpy, J.M., Lynm, C., Glass, R.M., 2010. JAMA patient page. Stomach cancer. JAMA 303, 1771.

Tran, E., Ahmadzadeh, M., Lu, Y.C., Gros, A., Turcotte, S., Robbins, P.F., Gartner, J.J., Zheng, Z., Li, Y.F., Ray, S., Wunderlich, J.R., Somerville, R.P., Rosenberg, S.A., 2015. Immunogenicity of somatic mutations in human gastrointestinal cancers. Science 350, 1387-1390.

Umar, S., 2010. Intestinal stem cells. Curr Gastroenterol Rep 12, 340-348.

Valiathan, R.R., Resh, M.D., 2004. Expression of human immunodeficiency virus type 1 gag modulates ligand-induced downregulation of EGF receptor. J Virol 78, 12386-12394. 52

Vinson, K.E., George, D.C., Fender, A.W., Bertrand, F.E., Sigounas, G., 2016. The Notch pathway in colorectal cancer. Int J Cancer 138, 1835-1842.

Vlahopoulos, S.A., 2017. Aberrant control of NF-kappaB in cancer permits transcriptional and phenotypic plasticity, to curtail dependence on host tissue: molecular mode. Cancer Biol Med 14, 254-270.

Wagner, D.O., Sieber, C., Bhushan, R., Borgermann, J.H., Graf, D., Knaus, P., 2010. BMPs: from bone to body morphogenetic proteins. Sci Signal 3, mr1.

Wei, E.K., Giovannucci, E., Wu, K., Rosner, B., Fuchs, C.S., Willett, W.C., Colditz, G.A., 2004. Comparison of risk factors for colon and rectal cancer. Int J Cancer 108, 433-442.

Weiser, K., Barton, M., Gershoony, D., Dasgupta, R., Cardozo, T., 2013. HIV's Nef interacts with beta-catenin of the Wnt signaling pathway in HEK293 cells. PLoS One 8, e77865.

Witkiewicz, A.K., Knudsen, E.S., 2014. Retinoblastoma tumor suppressor pathway in breast cancer: prognosis, precision medicine, and therapeutic interventions. Breast Cancer Res 16, 207.

Wong, H., Alicke, B., West, K.A., Pacheco, P., La, H., Januario, T., Yauch, R.L., de Sauvage, F.J., Gould, S.E., 2011. Pharmacokinetic-pharmacodynamic analysis of vismodegib in preclinical models of mutational and ligand-dependent Hedgehog pathway activation. Clin Cancer Res 17, 4682-4692.

World Health Organization, 2016. HIV/AIDS Data and Statistics.

Wu, C., Zhu, X., Liu, W., Ruan, T., Tao, K., 2017. Hedgehog signaling pathway in colorectal cancer: function, mechanism, and therapy. Onco Targets Ther 10, 3249- 3259.

Yamada, T., Alpers, D.H., 2009. Textbook of gastroenterology, 5th ed. Blackwell Pub.,, Chichester, West Sussex ; Hoboken, NJ, pp. 1 online resource (2 volumes (xxi, 3440, cxi pages)). 53

Zhou, W., Ramachandran, D., Mansouri, A., Dailey, M.J., 2018. Glucose stimulates intestinal epithelial crypt proliferation by modulating cellular energy metabolism. J Cell Physiol 233, 3465-3475.

Zhu, X., Guo, Y., Yao, S., Yan, Q., Xue, M., Hao, T., Zhou, F., Zhu, J., Qin, D., Lu, C., 2014. Synergy between Kaposi's sarcoma-associated herpesvirus (KSHV) vIL- 6 and HIV-1 Nef protein in promotion of angiogenesis and oncogenesis: role of the AKT signaling pathway. Oncogene 33, 1986-1996.

Chapter II

HIV-1 Nef differentially modulates the Wnt signaling pathway within various cell lines

Jennifer Marcy, Alexander Allen, Jeffrey Rappaport, Scott Waldman, Brian Wigdahl, and Vanessa Pirrone

This chapter will be submitted as part of a primary research manuscript: Marcy, J. J., Allen, A. G., Rappaport, J., Wigdahl, B., Waldman, S., and V. Pirrone. Dysregulation of the Wnt signaling pathway in the development of colorectal cancer in HIV-1-infected patients. Journal of Acquired Immunodeficiency Syndrome, manuscript in preparation, 2018.

These studies were supported by a SKCC Developmental Grant (Pirrone, PI). 1

2.1 Abstract

New cases of human immunodeficiency virus type 1 (HIV-1) have been holding steady at about two million infections per year since 2005. The advent of antiretroviral therapy (ART) has realized a significant improvement in the life expectancy of the HIV-1-infected patient population. As these patients age, other ramifications of the virus have become important relative to their quality of life.

During the course of HIV-1 infection, a loss of CD4+ T cells has been documented in the gastrointestinal tract along with increased expression of proinflammatory cytokines and systemic immune hyperactivation, leading to a reduction in the quality of the immune response. Viral proteins produced subsequent to provirus integration interact with a number of host cell pathways ultimately affecting critical cellular processes that can create an oncogenic microenvironment. An increased incidence of colorectal cancer at a younger age than is typical for the general population has been observed. Research into how HIV-1 proteins affect cellular gene expression with regard to known pro-oncogenic pathways is critical towards understanding how HIV-1 promotes colorectal cancer in people living with the virus. Dysregulation of the canonical Wnt signaling pathway has been shown to have pro-oncogenic effects. It has been demonstrated that the HIV-1 protein Nef interacts with -catenin in the canonical Wnt signaling pathway. The downstream effects of this interaction have yet to be elucidated. Understanding how Nef modulates the Wnt signaling pathway can shed light on the link between HIV-1 and colorectal cancer. This study aims to examine the resultant effects of HIV-1 encoded Nef within the Wnt signaling pathway. 2

2.2 Introduction

It is estimated that 36.7 million people worldwide are living with HIV, with almost

21 million of those infected patients receiving antiretroviral therapy (ART) as of

June, 2017 (UNAIDS, 2016). The introduction of ART has dramatically changed

HIV disease progression, with many patients living much longer as a result of more effective therapeutic intervention. Patient viral loads can be greatly reduced with

ART, opening opportunities to investigate other consequences associated with viral infection including the formation of viral reservoirs, inflammation and associated signaling pathways, and the continued role of viral proteins in the dysregulation of cellular pathways at many levels. Additionally, people living with

HIV who are treated with ART have an increased risk of developing non-AIDS defining complications, which include cardiac abnormalities, dysfunction in the brain, GI tract, and other organ systems along with several types of non-AIDS- defining cancers, (Deeks and Phillips, 2009). This increase in the prevalence of non-AIDS related cancer may be due in part to persistent immunodeficiency and/or modifiable cancer risk factors, such as smoking, alcohol consumption, obesity and coinfection (Park et al., 2016). However, people living with HIV also develop cancers prematurely as compared to the general population, which merits further investigation with respect to the mechanism(s) behind this increased incidence, earlier age of appearance, and level of severity at the time of diagnosis (Deeks and Phillips, 2009).

While on ART, plasma viremia has been shown to be undetectable in a vast majority of effectively treated HIV-1-infected patients, however, this does not mean that viral replication has not been continuing to occur in non-plasma compartments and a number of studies have been reported that indicate the viral replication has been ongoing while HIV-1-infected patients were on suppressive therapy with replication occurring in proviral DNA reservoirs less well penetrated by ART. In this regard, studies have been reported that ART penetration into lymphoid tissues has not been complete which has allowed a viral reservoir to be maintained there, even when plasma viremia has been to be undetectable (Estes et al., 2017). In addition, it has been demonstrated that the presence of CD4+ T cells containing viral RNA

(vRNA+) has varied in different organ tissues before and after the introduction of

ART in rhesus macaques (RMs), with gastrointestinal lymphoid-associated tissue

(GALT) displaying 98.8% of the body’s vRNA+ after ART (Estes et al., 2017).

Therefore, while on ART, low level HIV replication has been shown to occur in lymphoid tissues (LTs) and primarily in the LTs of the gastrointestinal (GI) tract.

Over time, low level HIV-1 replication in suppressed patients has been shown to be a risk factor for cancer in the GI tract (Hernandez-Ramirez et al., 2017).

Low level viral replication becomes detrimental as this has allowed a steady level of viral proteins to be synthesized which than have been shown to interact within many cellular pathways. The Wnt signaling pathway has been shown to regulate many cellular processes including cell fate determination, motility, organogenesis, and stem cell renewal (Komiya and Habas, 2008). Dysregulated Wnt signaling has 4 been shown to be detrimental to developing embryos, causing skeletal and birth defects (Komiya and Habas, 2008). Additionally, dysregulated Wnt signaling has been shown to be causative with respect to the development of many cancers including breast, skin, and colon (Komiya and Habas, 2008).

The canonical Wnt signaling pathway has been shown to be initiated when a secreted Wnt glycoprotein binds to the extracellular domain of the receptor Frizzled

(Fz) and a co-receptor, low-density-lipoprotein-related protein 5/6 (LRP5/6)

(Komiya and Habas, 2008). It has been shown to be at these receptors that a number of Wnt antagonists have been shown to bind to and regulate Wnt ligands by preventing their interaction with Fz or LRP5/6 (Komiya and Habas, 2008). The purpose of these antagonistshas been shown to regulate the pathway, thereby, creating a gradient of Wnt signaling (Komiya and Habas, 2008). After binding to

Fz and LRP5/6, the signal has been shown to be transduced to Dishevelled (Dvl),

LRP5/6 an subsequently phosphorylated by casein kinase 1 (CK1) or Glycogen

Synthase Kinase 3 (GSK3), along with a protein complex that has been shown to include Adenomatous Polyposis Coli (APC) and Axin is recruited and binds to

LRP5/6 (Komiya and Habas, 2008). When bound to LRP5/6, this complex has been shown to induce stabilization of -catenin, which can then translocate to the nucleus to mediate transcription of target genes by complexing with TCF/LEF transcription factors (Komiya and Habas, 2008). In the absence of a Wnt ligand, cytoplasmic -catenin has been shown to be targeted for proteasomal degradation via phosphorylation and ubiquitination by a destruction complex, which has been 5 shown to include Axin, APC, GSK3, and CK1 (now not bound to LRP5/6) (Komiya and Habas, 2008). Wnt signaling and downstream -catenin induced gene transcription has been shown to be dysregulated in many cancers (Polakis, 2000)

(Zhan et al., 2017); (Gang et al., 2014). Mutations in -catenin, APC, and activators of -catenin have been detected in colorectal tumors, melanomas, gastric cancer, hepatocellular carcinomas, and hair follicle tumors (Polakis, 2000); (Pohl et al.,

2017); (Xue et al., 2016); (Rishikaysh et al., 2014).

There are a plethora of target genes regulated by the Wnt signaling pathway, several of which have been shown to be to be upregulated in colon cancer, including: c-myc, cyclinD, Tcf-1, LEF1, PPardelta, c-jun, fra-1, uPAR, MMP-7,

Axin2, Nr-CAM, ITF-2, Gastrin, CD44, EphB/ephrin-B, BMP4, claudin-1, Survivin,

VEGF, FGF18, Hath1, Met, endothelin-1, c-myc binding protein, L1 neural adhesion, and Id (Nusse, 2018); (Kim et al., 2017); (Herbst et al., 2014). While all of the above genes have been shown to be associated with colon cancer, this study has been limited to c-myc and cyclinD1, Axin2, SP5, EGF5, and CDKN1A).

These genes have been selected for this investigation based on their roles in cell cycle progression and proliferation.

The cyclin D1 protein has been shown to be required to complex with its tissue- specific catalytic partner, either cyclin dependent kinase 4 or 6 (CDK4 and CDK6), during the G1 to S transition, thus contributing to temporal coordination of mitotic events (Diehl, 2002). Due to its role in cell cycle progression, it is clear why 6 dysregulation of this protein promotes oncogenesis. Cyclin D1 overexpression has been observed in primary breast cancers (Barnes and Gillett, 1998), pituitary adenomas (Hibberts et al., 1999), head and neck carcinomas (Corbett, 1989), and hereditary non-polyposis colorectal cancer (Kong et al., 2000). C-myc has been shown to be a transcription factor important as a regulator of cell growth, differentiation, and cell death, and as such, dysregulation of c-myc has been shoen to play a central role in tumorigenesis (Haggerty, 2011). As a transcription factor,

SP5 has been shown to operate within the nucleus to regulate proliferation and differentiation functions of the cell, and to coordinate pattern changes during embryogenesis (Chen et al., 2006). Additionally, SP5 has been shown to upregulate the cell cycle inhibitor p27. In other cancer cell lines, SP5 has been shown to be upregulated, however, in HCT116 cells it has been demonstrated that

SP5 expression is downregulated, thus limiting the downstream-mediated growth arrest facilitated by p27 an ultimately leading to tumorigenesis (Chen et al., 2006;

Miyamoto et al., 2018). Axin2 has been shown to act as a scaffolding protein within the Wnt signaling pathway and to be essential for the degradation of -catenin, thereby modulating Wnt-dependent cellular functions. Dysfunction of Axin2 has resulted in an increase in nuclear -catenin concentrations and can upregulate

Wnt target genes fostering tumorigenesis (Liu et al., 2000). The CDKN1A gene has been shown to encode for an inhibitor of cyclin-cyclin-dependent kinase2/4 complexes, functionally regulating cell cycle progression at G1. -catenin has been shown to regulate CDKN1A expression indirectly via Wnt signaling pathway expression of c-myc which goes on to repress the CDKN1A gene. Therefore, 7 upregulation of c-myc has been shown to lead to downregulation of CDKN1A resulting in proliferation activation (Rohrs et al., 2009). LGR5 has been shown to be exclusively expressed in cycling crypt base Paneth cells within the intestine

(Haegebarth and Clevers, 2009). LGR5 has been reported to serve in regulating cell adhesion by restricting stem cells to their intestinal niche (Walker et al., 2011).

Previous studies have determined that loss of LGR5 occurs when the Wnt pathway is hyperactivated and contributes to invasiveness (Walker et al., 2011).

HIV-1 proteins have been shown to interact within cellular pathways, including the

Wnt signaling pathway (Marx and Alian, 2015). When human cells become infected with HI1, the HIV-1 genome has been shown to be integrated into the host genome, so that as cellular division proceeds, viral proteins are transcribed and translated along with cellular proteins (Lusic and Siliciano, 2017); (Marx and Alian,

2015). The HIV-1 protein Nef has been shown to be essential for maintaining high viral loads during infection as well as determining the pathogenicity of the virus

(Deacon et al., 1995; Kestler et al., 1991). Previous studies have demonstrated that Nef contains a sequence pattern and structural binding motif that make it structurally compatible with -catenin and as such interacts within the Wnt pathway, likely affecting cell proliferation and potentially promoting oncogenesis

(Weiser et al., 2013). While a Nef/-catenin interaction has been experimentally documented in HEK293 cells (Weiser et al., 2013), the downstream implications of this intraction have not been demonstrated. This study aims to elucidate the impact of HIV-1 Nef on the gene products of the Wnt signaling pathway. While 8 certainly immunodeficiency is a factor in the etiology of GI cancers observed in

HIV-1-infected patients, examination of the downstream effects of viral and cellular protein interactions will be important in elucidating the possible mechanisms associated with these events warrant further investigation.

2.3 Methods

2.3.1 Plasmid growth and purification

The pCI NL4-3 Nef-HA-WT plasmid was purchased from Addgene provided by Dr.

Warner Greene (Addgene plasmid # 24162) (Geleziunas et al., 2001). The purchased stab was streaked an agarose +Amp plate and incubated at 37C overnight. A single colony was isolated and used to expand the plasmid volume.

The Maxi prep plasmid purification assay was performed (Qiagen Plasmid Maxi

Assay, Catalog Number 12162). The final DNA concentration (616 ng/l) of the preparation was determined by a Nanodrop analysis.

A 6148 bp GFP plasmid was generously provided by Dr. Michael Bouchard

(pcDNA 3.1- backbone). pcDNA-GFP, has been shown to contain a N-terminally

Flag-tagged GFP cloned into the pcDNA3.1(-) vector. Full-length GFP was PCR amplified from pGFP-HBx (Addgene Catalog Number 24931). The construct was used to express a N-terminal Flag-tagged GFP, using oligonucleotides containing terminal restriction enzyme sites XhoI or ApaI. The forward primer used was

5'-ATCGGGCCCTCTCGAGAGATGGTGAGCAAGGGCGAGGAG-3', 9 and the reverse primer used was

5'-

TATGATATCGCCCCCTCCGCCACCTCCGCCACCTCCGCCTTGTACAGCTCG

TCCATGCCGAG-3'. A glycerol stock was streaked on an agarose +Amp plate and incubated at 37C overnight. A single colony was isolated and used to expand the plasmid volume. Maxi prep plasmid purification assay (Qiagen Plasmid Maxi

Procedure, Catalog Number 12162) was performed and the DNA concentration

(1258ng/l) was determined by Nanodrop analysis.

A c-myc plasmid agar stab was purchased from Addgene obtained from Dr. Xin

Chen (c-myc-PT3EF1a plasmid Catalog Number 92046) and used to streak an agarose +Amp plate and incubated at 37C overnight. A single colony was isolated and used to expand the plasmid volume. Maxi prep plasmid purification assay

(Qiagen Plasmid Maxi Kit, Catalog Number 12162) was performed and the final

DNA concentration (885ng/l) was determined by Nanodrop analysis.

The cyclinD1 plasmid stab obtained from Addgene and provided by Dr. Yue Xiong

(pCMV-Cyclin D1 plasmid Catalog Number 19927) and used to streak a agarose

+Amp plate and incubate at 37C overnight. A single colony was isolated and used to expand the plasmid volume. Maxi prep plasmid purification assay (Qiagen

Plasmid Maxi Procedure, Catalog Number 12162) was performed and the final

DNA concentration (405ng/l) was determined by Nanodrop analysis.

2.3.2 Cell Culture

The HCT116 cell line was obtained from ATCC (ATCC CCL-247) and maintained in DMEM with FBS (10%) and Penicillin/Streptomycin (1%) solution, and housed in a T75 flask incubated at 37C with 5% CO2. Cells were used for transfection between passage 4 and 20.

2.3.3 Transient Transfection

HCT116 cells were seeded in a 6-well plate at 5x105 cells per well. Lipofectamine

3000 assay procedure (Catalog Number L3000015) was used to transfect requisite plasmids into HCT116 cells. The transfection reaction contained Optimem, (125

l) was along with lipofectamine transfection reagent (7.5 l), P3000 (5 l), and plasmid DNA (2500 ng) calculated based on concentrations determined by

Nanodrop analysis. The volumes of each DNA preparation included in the reactions included GFP plasmid DNA (1258 l), HA-Nef plasmid DNA (616 l), c- myc plasmid DNA (885 l), and cyclin D (1405 l). Transfection was performed in the absence or presence of Phorbol Myristate Acetate (PMA), which was added 3 hours after plasmid transfections.

2.3.4 Microscopic analysis

The CellSens program was used to determine the transfection efficiency at 4X and

10X based on the GFP FITC channel. Using this procedure, the transfection efficiency was determined to be 70-80%.

2.3.5 Lentiviral Production and Transduction

HEK293T cells were plated on a petri dish (10 cm) at 2 x 106 cells/dish with of

DMEM (10 ml), FBS (10%), Penicillin/Streptomycin solution (10 ml), and for transfection of lentivirus using CaCl2 and HBS, with 6 g of TOP or FOP plasmid, packaging plasmid (pCMV-dR8.2-dvpr, 6 g), and envelope plasmid (pVSVG, 3

g).

2.3.6 Protein Isolation

RIPA (300 l) and Halt protease inhibitor (10%) were added to each well containing

HCT116 cells seeded on a 6-well plate. Wells were incubated on ice for 5 minutes.

A rubber scraper was used to gather cells along with RIPA reagent at the bottom of the tilted plate. This solution was harvested in Eppendorf tubes (1.7 ml) .

2.3.7 Bicinchoninic Acid Assay (BCA)

The BCA procedure (Pierce Cat #23225) was used to measure total protein concentration compared to a protein standard as described by the manufacturer.

This information was subsequently used to determine proper protein loading volumes for western immunoblotting.

2.3.8 RNA Extraction

RNeasy RNA extraction procedure (Cat No./ID: 74104) was used to extract and isolate RNA for use in RT-qPCR as previously described by the manufacturer.

2.3.9 Western Immunoblot Analysis

Protein extract were used in reactions with primary antibodies for HA. The antibodies used were directed against HIV-1 Nef, c-myc, cyclinD1, CD44, Met,

TCF, LEF, and c-jun (Cell Signaling Kit no. 8655). All proteins were expressed as a result of the Wnt signaling pathway being turned on and -catenin localizing to the nucleus where it has been shown to bind with TCF/LEF to activate transcription.

2.3.10 Quantitative Reverse transcription polymerase chain reaction (RT- qPCR)

DNase treatment (Promega Catalog Number M6101) was performed on RNA extracts from untransfected HCT116 cells as well as Nef and GFP transfected

HCT116 cells using a Thermo-Cycler (Applied BioSystems: GeneAmp PCR

System 9700) for a total of 40 minutes as previously described by the manufacturer.

Reverse transcription was performed using the procedure previously described by the manufacturer (Applied BioSystems Catalog Number 4368814). The procedure involved a reaction containing RT buffer, dNTPs, RT random primers, and

Multiscribe, reacted with RNA extracts using the same Thermo-Cycler for a total of 135 minutes.

qPCR performed on cDNAs using a TaqMan Gene Expression Master Mix

(Applied BioSystems Catalog Number 4369016), and primer probe sets for beta- 13 actin (ThermoFisher Hs01060665_g1), c-myc (ThermoFisher Hs00153408_m1), cyclinD1 (ThermoFisher Hs_00765553_m1), SP5 (ThermoFisher

Hs01370227_mH), CDKN1A (ThermoFisher Hs00355782_m1), Axin2

(ThermoFisher Hs00610344_m1), and LGR5 (Thermofisher Hs00969422_m1).

Assays were run for 90 minutes on Applied Biosystems 7500 Fast Dx Real-Time

PCR System (Thermo Fisher Catalog Number 4406985). CT analysis was performed on the final results.

2.3.11 TOP-/FOP-FLASH Wnt reporter

Hct116 cells were transduced with the TOP-FLASH or FOP-FLASH Wnt reporter lentiviral plasmids (obtained from Dr. Scott Waldman at Jefferson University,

Philadelphia, PA) containing wild-type (TOP) or mutant (FOP) TCF binding sites.

Reporter activity was assayed using the SecretePair Dual Luminescence Assay procedure as previously described by the manufacturer (GeneCopoeia Catalog

Number LF031). After initial TOP/FOP transduction, HCT116 cells were transduced with sh-catenin. Additionally, TOP/FOP-transduced cells were transfected with the Nef and GFP plasmids as described above. The SecretePair

Dual Luminescence Assay Procedure was used again to assess the Wnt pathway

-catenin readout with Nef and GFP.

2.4 Results

2.4.1 Transfection of HCT116 Cells 14

HCT116 cells have been shown to have a 3 bp deletion at Ser45 in the -catenin target site for phosphorylation by GSK3, which tags -catenin for prosomal degradation. This heterozygous mutation should hyperactivate -catenin with its complex with TCF/LEF1 leading to transcriptional activation. In an effort to determine how HIV-1 Nef interacts within the Wnt signaling pathway HCT116, colorectal carcinoma cells were transfected with the protein. Through several alterations of transfection conditions, optimization of transfection efficiency to 80% in the HCT116 cell line was achieved as evidenced by fluorescent microscopy (Fig.

2.1a). Following transfection with the HA-tagged Nef plasmid, the cell lysates were assessed for the presence of Nef via western immunoblotting utilizing an antibody directed against the HA-tag on the Nef protein. The HA tagged HIV-1 protein Nef was detected in a western immunoblot assay of the transfected HCT116 cell protein lysates at 24 hours post transfection (Fig. 2.1b). This result demonstrated that the transfection of the HIV-1 Nef-HA plasmid was successful, in that the protein was produced in these cells subsequent to transfection. As a loading control to demonstrate that the transfection procedure or the protein did not have adverse effects on the cells, cell lysates from transfected cells were assessed for

GAPDH expression by Western blotting. As determined by this assay, GADPH expression was found to be consistent across all transfection conditions, demonstrating that neither the process of transfection nor the proteins being expressed had an adverse effect on the cells being utilized (Fig 2.1c). These results clearly demonstrated that a very high transfection efficiency of HCT116 cells had been achieved. 15

Figure 2.1

HCT116 Nef HCT116

Mock

GFP Ladder HA-Nef 27kDa

GFP

HCT116 Nef HCT116 Ladder

c Mock

GAPDH 35.8kDa

Figure 2.1. HCT116 cells transfected efficiently. (a) Fluorescent microscopic analysis of HCT116 cells transfected with GFP plasmid performed to validate transfection efficiency. (b) Western immunoblot image of GAPDH at 35.8 kDa. (c) Western immunoblot of the HA tagged Nef protein at 27 kDa.

2.4.2 Downstream gene product detection

The cyclin D1 protein has been shown to be required to complex with its tissue specific catalytic partner, either cyclin dependent kinase 4 or 6 (CDK4 and CDK6), during the G1 phase of the cell cycle and the transition to S phase, thus contributing to temporal coordination of mitotic events (Diehl, 2002). Due to its role in cell cycle progression, it has clearly been shown that dysregulation of this protein can potentiate oncogenesis. Due to the role of cyclin D1 overexpression in the observation of multiple cancers, we sought to determine whether cyclin D1 was dysregulated in the human colorectal carcinoma cell line, HCT116, following exposure to the HIV-1 Nef protein. Subsequent to transfection of HCT116 cells with Nef, a western immunoblot assay was run on the protein extracts collected 24 hours post transfection (Fig. 2.2). Unfortunately, cyclin D1 was not detected in either untransfected cells or HIV-1 Nef-transfected cells. While this seems contrary to the demonstrated role of cyclin D1 dysregulation in the oncogenic process, further investigation into the detection of cyclin D1 in cell lines, as previously reported in the literature and in personal communication with colleagues, it has been demonstrated that many colorectal cell lines do not display cyclinD1 at all.

While cyclinD1 has remained a target gene of interest, dysregulation of this protein may only be evident when utilizing primary cells, and therefore further investigation involving this protein in colorectal cancer will not involve experimentation in cell lines.

Figure 2.2

Figure 2.2. Cyclin D1 was not detected in HCT116 colorectal cancer cells following transfection with HIV-1 Nef. Cell lysates were collected from HCT116 colorectal cancer cells. Lysates were collected 24 hours post transfection from untransfected cells, cells transfected with the GFP containing control plasmid, and cells transfected with the HIV-1 Nef-HA expressing plasmid. While both GAPDH and HIV-1 Nef-HA were readily detected via western immunoblotting, cyclin D1 was not detected in the HCT116 protein cell lysates from both the control/non- transfected cells as well as the Nef-transfected cells.

In addition to cyclin D1, levels of c-myc were also assessed for potential dysregulation in the presence of HIV-1 Nef. C-myc has been shown to be a transcription factor important in regulating cell growth, differentiation, and cell death, and as such, it has been shown to play a central role in tumorigenesis

(Haggerty, 2011). Following transfection of HCT116 cells, the levels of the cellular gene product c-myc were assessed via western immunoblotting. Cell lysates were prepared at 24 hours post transfection from untransfected control cells, cells transfected with the GFP control plasmid, and cells transfected with a plasmid containing HIV-1 Nef-HA. C-myc did not produce a very robust signal in the western immunoblot assay. Additionally, densitometry of the western immunoblot did not reveal significant differences in the levels of c-myc when compared to the untransfected control, GFP plasmid transfected, and the HIV-1 Nef-HA transfected cell lysates. This result has suggested that Nef does not result in dysregulation of c-myc expression in the HCT116 colorectal cancer cells (Fig. 2.3b). However, the low expression level of c-myc within the assay has suggested that the level of c- myc may being assessed at the wrong time point, or that western immunoblotting may not be a sensitive enough assay to assess c-myc expression in this in this particular cell phenotype. These results prompted additional analysis using a more sensitive assay system, quantitative reverse transcription PCR (RT-qPCR).

Figure 2.3

c-myc

GFP

Mock

Ladder

HCT116 Nef

c-myc Optical density Optical

Mock GFP Nef

Figure 2.3. Downstream Wnt target gene c-myc expression. Subsequent to transfection with Nef, c-myc expression was examined in HCT116 cells. (a) Western immunoblot image displays c-myc expression in mock HCT116 cells in comparison to Nef transfected HCT116 cells. (b) Densitometry analysis of protein lysate from western immunoblot results obtained from HCT116 cells indicated that c-myc expression was only upregulated to a small extent. n=1

2.4.3 Gene product detection utilizing quantitative reverse transcription PCR (RT-qPCR)

In order to quantitatively detect the expression of specific genes of interest that are involved in generation of the cancer phenotype and potentially dysregulated by the presence of HIV-1 Nef, RT-qPCR was performed on RNA isolated from untransfected control HCT116 cells, cells tranfected with the GFP control plasmid, and cells transfected with the HIV-1 Nef-HA expression plasmid. In addition, PMA was also added three hours after transfection in an effort to stimulate the Wnt pathway. No significant difference in c-myc or cyclinD1 expression was observed between the control untransfected cells and the Nef-transfected cells (Fig. 2.4).

RT-qPCR was also run on HCT116 total RNA with primers to detect SP5,

CDKN1A, LGR5, and Axin2 expression with inconclusive results (data not shown).

2.4.4 TOP/FOP Flash -catenin expression in HCT116 cells

Basal levels of β-catenin signaling in HCT116 cells were examined by measuring the transcriptional activity of a β-catenin-responsive luciferase reporter (TOP/FOP

Flash). HCT116 cells were transduced with a luciferase construct containing four native T-cell factor/lymphoid enhancer-binding factor (TCF/LEF) binding sites

(TOP flash) or its negative-control counterpart (FOP flash) containing four mutated

LEF/TCF binding sites. Luciferase activity was evaluated 24 hours post transduction and normalized to secreted alkaline phosphatase (SEAP) using the

Secrete-Pair Dual Luminescence Assay procedure (Genecopoeia Catalog

Number LF031). In the HCT116 cell line, there appears to be a very low level of - catenin driven activation 53

Figure 2.4

HCT116 c-myc/cyclinD1 expression 1.2

1 1 1

0.8 0.77 0.77

0.6 c-myc cyclinD1

0.4

0.2

0 cells only + Nef

Figure 2.4 C-myc and CyclinD1 expression in HCT116 cells. RT-qPCR results of c-myc and cyclinD1 expression in HCT116 cells in the absence or presence of transfection of Nef shows does not downregulate either c-Myc or CyclineD1 expression in HCT cells.

54 of the Wnt signaling pathway as evidenced by the difference between the negative control FOP measurement and the -catenin activity reporter TOP value (Fig. 2.5).

Continuing with the HCT116 cells transduced with the TOP/FOP lentiviral vectors, these cells were transfected with Nef and the Secrete-Pair Dual Luminescence

Assay was performed again. This assay revealed a fold increase to un-transfected

HCT116 cells in -catenin activity upon transfection of Nef (Fig. 2.5). This increase was not significant but could suggest a low-level increase in -catenin activity in colorectal cancer cells in the presence of Nef. A low-level increase in -catenin activity over time in conjunction with a deficient immune response could result in a more tumorigenic microenvironment. In light of the fact that people living with HIV-

1 are living much longer than in the 1980s, small increases in cellular proliferation may cause tumors to be initiated and flourish over time.

2.4.5 Nef affects downstream Wnt pathway protein expression in HEK293T cells

Upon determining that both c-myc, cyclin D1, as well as other genes in the - catenin pathway do not appear to be dysregulated by Nef to any great extent, in addition to the low level of -catenin expression in the HCT116 cells, we proceeded to compare the HCT116 cell line to a different cell line with perhaps a somewhat different physiological profile. The HEK293T cell line originated from human embryonic kidney cells, which have been stably transfected with the SV40 large T antigen 55

Figure 2.5

HCT116 -catenin HEK293T -catenin Expression expression 25 15

TOP TOP 20 18.53 17.57 10.25 FOP 10 FOP 15

10 5 2.14 5 1.56 1.65 1.36 0.65 0.21 0.16 0 0 Supernatant 1:10 dilution Cells only TOP 1:10

HCT116 +Nef -catenin expression 25

20.42 TOP 19.56 20 17.85 17.19 16.84 FOP 15.78 15

RLU 10

5 1.92 1.50 1.19 1.02 1.20 0.86 0 CO GFP NEF CO 1:10 GFP 1:10 NEF 1:10

Figure 2.5. -catenin expression in HCt116 and HEK293T cells. TOP-/FOP- Flash: The TOP-/FOP-Flash reporter system was used to determine -catenin expression in HCT116 cells in the absence or presence of Nef. Transfection with Nef-expressing plasmid resulted in no significant difference in expression was observed in the HCT116 cells, however significant differences were observed in HEK293T cells (not shown). 56

(DeCaprio et al., 1988). Within the HEK293T cell line the SV40 large T antigen acts to bind and inactivate retinoblastoma (pRb) and p53 tumor suppressor genes, leading the cell out of G1 and into S phase, promoting DNA replication (DeCaprio et al., 1988). These mechanisms model a tumorigenic outcome, however, it must be noted that these are not always the same mechanisms observed in tumor cell lines derived from actual human colorectal tumors. Colorectal cancer is typically due to chromosomal instability, CpG island methylator phenotype, and/or microsatellite instability (Tariq and Ghias, 2016). In an effort to compare the endogenous HCT116 cancer cell line with an induced cancer cell line, HEK293T cells were assayed for Wnt target gene expression in the absence or presence of

Nef. The purpose of this investigation is to begin to understand whether Nef may be operative within an established cancer or is an initiator of tumorigenesis in a

“non-canonical cancerous” cell. C-myc expression was upregulated by 3.6-fold upon transfection of Nef (Fig. 2.6a). Additionally, Axin2 expression was upregulated 8.2-fold upon Nef transfection (Fig. 2.6b). The genes for these proteins are targets in the Wnt signaling pathway and suggest a dysregulation of this pathway by Nef in HEK293T cells.

Figure 2.6

a c-myc in HEK293Ts 5 . 4.604

т)

C (ΔΔ

- 2 2^

1 1

0 Control Transfected with Nef

Axin2 in HEK293Ts b 10 9.182

т)

C (ΔΔ

- 4 2^

2 1

0 Control Transfected with Nef

Figure 2.6. Wnt target gene expression in HEK293T cells by RT-qPCR. Total RNA was collected from HEK293T cells which had been transfected with Nef. The RNA was used in RT-qPCR to assess protein expression in comparison to untransfected cells. Wnt target gene expression of both c-myc and Axin2 were upregulated when cells are transfected with Nef.( a) c-myc expression shows a 3.6 fold increase in HEK293T cells transfected with Nef. (b) Axin2 expression shows an 8.1 fold increase in HEK293T cells transfected with Nef. n=1

2.5 Discussion

Previous studies have demonstrated that HIV-1 Nef has the capability of binding

-catenin due to similar binding motifs within the protein structures(Weiser et al.,

2013). Additionally these studies have shown increased -catenin activity in

TOP/FOP Flash reporter and Co-IP assays in HEK293T cells (Weiser et al., 2013).

The current study aimed to determine if a similar interaction occurred in HCT116 colorectal carcinoma cells and how such an interaction might impact downstream

Wnt/-catenin target gene expression. Using the TOP/FOP Flash reporter assay we did not find significant upregulation of -catenin activity in HCT116 cells. A previous study used nuclear extracts to detect low levels of -catenin/TCF complexes within the HCT116 cell line and suggested that there could be an excess of the TCF monomer (Crawford et al., 1999). The TOP-Flash reporter plasmid has been described as functionally binding to TCF subsequent to the binding of the TCF/-catenin complex. One of the target genes of the Wnt signaling pathway is TCF itself. If -catenin activity in HCT116 cells is hyperactivated due to the determined heterozygous mutation in -catenin and a downstream product of the -catenin/TCF complex co-transcriptional activation has been shown to be

TCF, then an overabundance of TCF could be produced. If TCF has been shown to be in excess and the TOP/FOP Flash reporter plasmid system has be depend on binding to the -catenin/TCF complex, then perhaps the possible alteration of nuclear -catenin as a result of exposure to Nef would further enhance TCF expression to a point that the -catenin expression would not reach appropriate levels when compared to TCF via a circular feedback mechanism. 59

Within the HCT116 cell line we could not determine a significant downstream effect of HIV-1 Nef on Wnt pathway target gene expression of CyclinD1, c-myc, SP5,

Axin2, CDKN1A, or LGR5. However, this result is not consistent with the above speculation, and should be more thoroughly investigated. Previous studies by other investigators have demonstrated differences in gene expression between isogenic colorectal carcinoma cell lines, and consequently additional studies focused on the impact of HIV-1 Nef in other colorectal carcinoma cell lines are clearly warranted.

HEK293T cells have previously been examined with respect to -catenin activity and dysregulation of the Wnt signaling pathway by HIV-1 Nef. In this regard, a large difference in activation was observed (Weiser et al., 2013). This cell line mechanistically acts in a tumorigenic manner, but not necessarily via the same mechanism as the HCT116 colorectal cancer tumor cells. While the SV40 T antigen inactivates pRb and p53 tumor suppressor genes in HEK293T cells

(DeCaprio et al., 1988), the mechanism of dysregulated cellular proliferation in

HCT116 cells has been reported to be a heterozygous three base pair deletion in the -catenin gene (CTNNB1) resulting in the loss of a highly conserved serine residue at position 45 which has been suggested to be one of the target binding sites for the enzyme GSK3 (Ilyas et al., 1997). GSK3 has a critical role in the destruction complex within the Wnt signaling pathway centered on phosphorylating

-catenin, thus, targeting it for proteosomal degradation. The inability of GSK3 to 60 perform its phosphorylation task would allow -catenin to accumulate in the cytosol and translocate to the nucleus where it has been shown to bind to TCF/LEF1, serving to upregulate transcription of Wnt pathway target genes. Many of these gene targets are involved in regulation of cell proliferation. Due to the -catenin mutation and subsequent mechanistic alterations within the Wnt signaling pathway, we would have expected HCT116 cells to show dysregulation of many downstream Wnt pathway target genes. However, this was not the case, causing speculation on why this has been observed. Perhaps the heterozygous mutation within the cell line is not as impactful as would have been expected. The other wild type allele for -catenin may be compensatory and allow for at least close to baseline degradation of the protein. The baseline -catenin activity of this cell line is low to begin with, as evidenced by our TOP/FOP Flash reporter system. This has prompted the conclusion that perhaps a -catenin and Nef interaction would have more prominent effects in other colorectal carcinoma cell lines where the baseline Wnt pathway activity was higher. It has been reported in the SW480 colorectal carcinoma cell line that -catenin/TCF regulated transcription is constitutively active ((Morin et al., 1997). Therefore, the SW480 cell line might be a better candidate to evaluate HIV-1 Nef with respect to Wnt signaling pathway dysfunction.

The basic mechanistic differences in the etiology of tumorigenesis between the

HEK293T and HCT116 cell lines, and perhaps many other isogenic colorectal cell lines, may account for the fact that no apparent Wnt pathway dysregulation has 61 been observe in the HCT116 cell line, while the HEK293T has significant dysregulation when transduced with HIV-1 Nef (Weiser et al., 2013). This result needs to be investigated more thoroughly within the HCT116 cell line and additionally in other isogenic colorectal cell lines.

These studies have demonstrated a need to further determine the requisite cellular physiology of selected cell lines, as well as to further determine which gene products and signaling pathways relating to the initiation, promotion, and maintenance of the cancer phenotype are important with respect to the impact of

HIV-1 Nef on neoplastic state of a given cellular phenotype. It has been demonstrated in several colorectal cancer cell lines that there is obvious variation among tumorigenic mechanisms, such as chromosomal instability, CpG island methylator phenotype, and/or microsatellite instability methylation, leading to significant differences in downstream protein expression (Tariq and Ghias, 2016).

Examination of all of these mechanisms and the effects on protein expression has been and will continue to be crucial to understanding how each representative cell line might interact with Nef and what the downstream effects might be and how these interactions relate to the larger picture of cancer biology. The NanoString pancancer panel is an assay that can be used to determine which of 13 specific known cancer pathways are dysregulated by a transfected protein. The advantage of NanoString over other next generation sequencing techniques is the ability to detect single mRNA transcripts without the need for amplification allowing limited processing, reducing the introduction of RNA degradation and other biases 62 observed in methods based on the use of polymerase chain reaction technologies.

The assay is as simple as mixing total RNA (100 ng) into a solution with a probe mixture. Each individual mRNA transcript is assigned a unique barcode and bound to a pair of probes, enabling sensitive detection of single mRNA molecules within the sample without the need for amplification. Due to the wide array of dysregulated pathways within cancer cell lines and variation of underlying mechanistic causes associated with each cellular phenotype, it would be most beneficial to perform this assay on a “non-cancerous” cell line or better yet, primary cells, where known cancer pathways are not dysregulated. The NanoString pancancer panel of gene expression could reveal how Nef affects gene expression of 770 genes within 13 cancer associated pathways, including the Wnt pathway.

For this assay total RNA would be collected from Nef-transfected cells and control cells. Because isogenic colorectal cancer cell lines each contain unique characteristics and protein expression patterns, determination of which cell line(s) to transfect would be a crucial decision for the NanoString assay. The limiting factor of this assay is that while it reveals what pathways are affected by Nef, this would be only within the tested cell line. Complete baseline information known about the cell line would be best for this assay. While HEK293T cells are not a colorectal carcinoma cell line, they have been used extensively for decades and an abundance of information is known about them. A complete literature review of the Wnt pathway baseline protein expression within the HEK293T cell line is most likely available and is necessary to begin the investigation of how Nef impacts these cellular pathways. The Nef protein has been shown to interact with -catenin 63 in HEK293T cells, however, the downstream effects of this interaction have not been examined. Transduction of HEK293T cells with the TOP/FOP lentiviral vector has shown a large amount of -catenin activity within the cell line. Transfection of

HEK293T cells with Nef and examination of the downstream effects of this HIV-1 protein, via total RNA collection and RT-qPCR has been initially investigated in this study. Prior to NanoString gene expression analysis, optimization of RT-qPCR with these cells and further investigation of Nef effects in HEK293T cells with the addition of Wnt conditioned media to activate the Wnt pathway as a positive control would be a logical next step.

People living with HIV-1 have an increased incidence of colorectal cancer. It would be interesting to investigate Nef as an initiator of cancer. This would require primary cell experiments. A complete literature review of primary cell characteristics would initially direct this study. These studies would require cells from healthy and tumor tissues from current. Initial Wnt pathway gene expression analysis of these primary cells via RT-qPCR would be important to establish baseline pathway activity. Deliver of Nef into these cells would provide one approach to elucidate how cells from healthy tissue versus cells from tumor tissue within the same patient are affected by Nef.

No one can afford to get complacent about HIV. In 2015 both the Massachusetts and Indiana Departments of Health reported an uptick in the number of new HIV-

1 infections seen in IV drug users, due, in part, to the national opioid epidemic 64

(Indiana State Department of Health, 2016; Massachusetts Department of Public

Health, 2017). With more new cases of HIV-1 on the horizon and patients who receive ART living relatively long lives, the investigations into comorbidities such as cancer are paramount. 65

2.6 List of References

Barnes, D.M., Gillett, C.E., 1998. Cyclin D1 in breast cancer. Breast Cancer Res Treat 52, 1-15.

Chen, Y., Guo, Y., Ge, X., Itoh, H., Watanabe, A., Fujiwara, T., Kodama, T., Aburatani, H., 2006. Elevated expression and potential roles of human Sp5, a member of Sp transcription factor family, in human cancers. Biochem Biophys Res Commun 340, 758-766.

Corbett, W.T., 1989. The College of Veterinary Medicine at North Carolina State University. Its role in North Carolina's health care system. N C Med J 50, 607-611.

Crawford, H.C., Fingleton, B.M., Rudolph-Owen, L.A., Goss, K.J., Rubinfeld, B., Polakis, P., Matrisian, L.M., 1999. The metalloproteinase matrilysin is a target of beta-catenin transactivation in intestinal tumors. Oncogene 18, 2883-2891.

Deacon, N.J., Tsykin, A., Solomon, A., Smith, K., Ludford-Menting, M., Hooker, D.J., McPhee, D.A., Greenway, A.L., Ellett, A., Chatfield, C., Lawson, V.A., Crowe, S., Maerz, A., Sonza, S., Learmont, J., Sullivan, J.S., Cunningham, A., Dwyer, D., Dowton, D., Mills, J., 1995. Genomic structure of an attenuated quasi species of HIV-1 from a blood transfusion donor and recipients. Science 270, 988-991.

DeCaprio, J.A., Ludlow, J.W., Figge, J., Shew, J.Y., Huang, C.M., Lee, W.H., Marsilio, E., Paucha, E., Livingston, D.M., 1988. SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell 54, 275-283.

Deeks, S.G., Phillips, A.N., 2009. HIV infection, antiretroviral treatment, ageing, and non-AIDS related morbidity. BMJ 338, a3172.

Diehl, J.A., 2002. Cycling to cancer with cyclin D1. Cancer Biol Ther 1, 226-231.

Gang, E.J., Hsieh, Y.T., Pham, J., Zhao, Y., Nguyen, C., Huantes, S., Park, E., Naing, K., Klemm, L., Swaminathan, S., Conway, E.M., Pelus, L.M., Crispino, J., Mullighan, C.G., McMillan, M., Muschen, M., Kahn, M., Kim, Y.M., 2014. Small- molecule inhibition of CBP/catenin interactions eliminates drug-resistant clones in acute lymphoblastic leukemia. Oncogene 33, 2169-2178.

Geleziunas, R., Xu, W., Takeda, K., Ichijo, H., Greene, W.C., 2001. HIV-1 Nef inhibits ASK1-dependent death signalling providing a potential mechanism for protecting the infected host cell. Nature 410, 834-838.

Haegebarth, A., Clevers, H., 2009. Wnt signaling, lgr5, and stem cells in the intestine and skin. Am J Pathol 174, 715-721.

Haggerty, L.M., 2011. Proetion Structure. Nova Science Publisher’s, Hauppauge, NY.

Herbst, A., Jurinovic, V., Krebs, S., Thieme, S.E., Blum, H., Goke, B., Kolligs, F.T., 2014. Comprehensive analysis of beta-catenin target genes in colorectal carcinoma cell lines with deregulated Wnt/beta-catenin signaling. BMC Genomics 15, 74.

Hernandez-Ramirez, R.U., Shiels, M.S., Dubrow, R., Engels, E.A., 2017. Cancer risk in HIV-infected people in the USA from 1996 to 2012: a population-based, registry-linkage study. Lancet HIV 4, e495-e504.

Hibberts, N.A., Simpson, D.J., Bicknell, J.E., Broome, J.C., Hoban, P.R., Clayton, R.N., Farrell, W.E., 1999. Analysis of cyclin D1 (CCND1) allelic imbalance and overexpression in sporadic human pituitary tumors. Clin Cancer Res 5, 2133-2139.

Ilyas, M., Tomlinson, I.P., Rowan, A., Pignatelli, M., Bodmer, W.F., 1997. Beta- catenin mutations in cell lines established from human colorectal cancers. Proc Natl Acad Sci U S A 94, 10330-10334.

Indiana State Department of Health, 2016. HIV OUTBREAK IN SOUTHEASTERN INDIANA.

Kestler, H.W., 3rd, Ringler, D.J., Mori, K., Panicali, D.L., Sehgal, P.K., Daniel, M.D., Desrosiers, R.C., 1991. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65, 651-662.

Kim, J.H., Park, S.Y., Jun, Y., Kim, J.Y., Nam, J.S., 2017. Roles of Wnt Target Genes in the Journey of Cancer Stem Cells. Int J Mol Sci 18.

Komiya, Y., Habas, R., 2008. Wnt signal transduction pathways. Organogenesis 4, 68-75.

Kong, S., Amos, C.I., Luthra, R., Lynch, P.M., Levin, B., Frazier, M.L., 2000. Effects of cyclin D1 polymorphism on age of onset of hereditary nonpolyposis colorectal cancer. Cancer Res 60, 249-252.

Liu, W., Dong, X., Mai, M., Seelan, R.S., Taniguchi, K., Krishnadath, K.K., Halling, K.C., Cunningham, J.M., Boardman, L.A., Qian, C., Christensen, E., Schmidt, S.S., 67

Roche, P.C., Smith, D.I., Thibodeau, S.N., 2000. Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating beta-catenin/TCF signalling. Nat Genet 26, 146-147. Lusic, M., Siliciano, R.F., 2017. Nuclear landscape of HIV-1 infection and integration. Nat Rev Microbiol 15, 69-82.

Marx, A., Alian, A., 2015. The Road Less Traveled: HIV's Use of Alternative Routes through Cellular Pathways. J Virol 89, 5204-5212.

Massachusetts Department of Public Health, 2017. HIV New Cases among IDUs Alert / Mass Dept of Health - Massachusetts Department of Public Health raises level of concern about increased HIV transmission through injection drug use, in light of the current epidemic of opiate/opioid misuse and recent observations.

Miyamoto, M., Hayashi, T., Kawasaki, Y., Akiyama, T., 2018. Sp5 negatively regulates the proliferation of HCT116 cells by upregulating the transcription of p27. Oncol Lett 15, 4005-4009.

Morin, P.J., Sparks, A.B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., Kinzler, K.W., 1997. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 275, 1787-1790.

Nusse, R., 2018. the Wnt homepage.

Park, L.S., Hernandez-Ramirez, R.U., Silverberg, M.J., Crothers, K., Dubrow, R., 2016. Prevalence of non-HIV cancer risk factors in persons living with HIV/AIDS: a meta-analysis. AIDS 30, 273-291.

Pohl, S.G., Brook, N., Agostino, M., Arfuso, F., Kumar, A.P., Dharmarajan, A., 2017. Wnt signaling in triple-negative breast cancer. Oncogenesis 6, e310.

Polakis, P., 2000. Wnt signaling and cancer. Genes Dev 14, 1837-1851.

Rishikaysh, P., Dev, K., Diaz, D., Qureshi, W.M., Filip, S., Mokry, J., 2014. Signaling involved in hair follicle morphogenesis and development. Int J Mol Sci 15, 1647-1670.

Rohrs, S., Kutzner, N., Vlad, A., Grunwald, T., Ziegler, S., Muller, O., 2009. Chronological expression of Wnt target genes Ccnd1, Myc, Cdkn1a, Tfrc, Plf1 and Ramp3. Cell Biol Int 33, 501-508.

Tariq, K., Ghias, K., 2016. Colorectal cancer carcinogenesis: a review of mechanisms. Cancer Biol Med 13, 120-135.

UNAIDS, 2016. Fact Sheet - Latest statistics on the status of the AIDS epidemic.

Walker, F., Zhang, H.H., Odorizzi, A., Burgess, A.W., 2011. LGR5 is a negative regulator of tumourigenicity, antagonizes Wnt signalling and regulates cell adhesion in colorectal cancer cell lines. PLoS One 6, e22733.

Weiser, K., Barton, M., Gershoony, D., Dasgupta, R., Cardozo, T., 2013. HIV's Nef interacts with beta-catenin of the Wnt signaling pathway in HEK293 cells. PLoS One 8, e77865.

Xue, G., Romano, E., Massi, D., Mandala, M., 2016. Wnt/beta-catenin signaling in melanoma: Preclinical rationale and novel therapeutic insights. Cancer Treat Rev 49, 1-12.

Zhan, T., Rindtorff, N., Boutros, M., 2017. Wnt signaling in cancer. Oncogene 36, 1461-1473.