Dominance of indigenous Saccharomyces uvarum in spontaneous wine fermentations conducted in the Okanagan Valley

by

Garrett McCarthy

B.Sc., The University of British Columbia, 2016

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

in

THE COLLEGE OF GRADUATE STUDIES

(Biology)

THE UNIVERSITY OF BRITISH COLUMBIA

(Okanagan)

July 2019

© Garrett McCarthy, 2019

i

The following individuals certify that they have read, and recommend to the College of Graduate Studies for acceptance, a thesis/dissertation entitled:

Dominance of Saccharomyces uvarum in spontaneous wine fermentations conducted in the Okanagan Valley

submitted by Garrett McCarthy in partial fulfillment of the requirements of

the degree of Master of Science

Dr. Dan Durall, Irving K. Barber School of Arts and Sciences Supervisor

Dr. Vivien Measday, Wine Research Centre, Faculty of Land and Food Systems Supervisor

Dr. Louise Nelson, Irving K. Barber School of Arts and Sciences Supervisory Committee Member

Dr. Sepideh Pakpour, School of Engineering University Examiner

ii

Abstract The majority of wines are produced by inoculated alcoholic fermentations using commercialized strains of Saccharomyces cerevisiae, yet there is a growing trend in winemaking to perform spontaneous fermentations, which rely on microbiota present on grape berries, and/or on winery surfaces and equipment. An advantage for spontaneous over inoculated fermentation is a more complex sensory profile due to a wider range of metabolites from differing yeast species, which may help to define the regional identity of the wine. Once the spontaneous fermentation progresses into the mid and late stages of fermentation, ethanol-tolerant S. cerevisiae strains usually dominate. Contrarily, previous studies in our lab showed that an indigenous yeast, Saccharomyces uvarum, can dominate over S. cerevisiae during spontaneous

Okanagan Chardonnay fermentations. My objectives were to: 1) determine if S. uvarum was again part of the fungal community in spontaneous Chardonnay fermentations; and if so; 2) develop an improved classification method for S. uvarum strains; 3) determine the degree of genetic diversity of the S. uvarum populations in spontaneous Chardonnay fermentations, which differ in their grape origin; and 4) determine whether S. uvarum was part of the fungal community on grapes from different vineyards of the Okanagan Valley wine region. Using

Illumina high-throughput sequencing, I found S. uvarum was again dominant over S. cerevisiae in all winery fermentations, similar to findings in 2015 from spontaneous fermentations in the same winery. Using culture-dependent methods, I performed S. uvarum strain analysis with a novel, 11-loci microsatellite multiplex screen, and used Bruvo genetic distance to classify multi- locus genotypes into strains. I identified over 200 multi-locus genotypes and classified them into over 50 unique strains from winery fermentations that differed significantly in composition between treatments comprising grapes from two Chardonnay vineyards. As well, high- throughput amplicon sequencing revealed the presence of S. uvarum throughout all four vineyard iii locations spread across the Okanagan Valley wine region. My results indicate there may be commercial interest in using S. uvarum as a potential alternative to S. cerevisiae, which is typically the species used in winery fermentations.

iv

Lay Summary

This thesis provides evidence that a yeast called Saccharomyces uvarum found from the winery environment can dominate alcoholic fermentations in the Okanagan Valley, even outcompeting the typical yeast used called Saccharomyces cerevisiae. The S. uvarum found in the Okanagan was also unexpectedly genetically diverse as compared with what has been seen before in the literature. Grapes were sourced from two different vineyards and followed into the same winery as the two treatments, where the fermentations were taken over mainly by the resident S. uvarum yeast at the winery. There were differences in S. uvarum strain composition between the two treatments. I also found that S. uvarum was present on grapes in four vineyards

(two were the vineyards followed into the winery), which were spread across the Okanagan

Valley wine region. Seeing how well it can complete the fermentations, certain strains of S. uvarum may be an alternative choice to S. cerevisiae strains when winemakers select yeast starters for Chardonnay fermentations.

v

Preface I was responsible for implementing wine fermentations according to the experimental design as well as collecting all the samples from Mission Hill Family Estate Winery and from four vineyards during the 2017 vintage for fungal community analysis. The fungal identification through culture-dependent and culture-independent methods were performed in the molecular lab at the University of British Columbia’s Okanagan campus. I was responsible for the majority of data collection from the winery and vineyard experimental designs, statistical analysis interpretation and writing the thesis, under the supervision of my co-supervisors Dr. Daniel

Durall and Dr. Vivien Measday. My supervisory committee member Dr. Louise Nelson also reviewed this thesis. Brianne Newman assisted with culture-dependent methods and collection of vineyard samples. Sydney Morgan assisted with culture-independent, high-throughput sequencing preparation, and analysis of the sequenced reads.

vi

Table of Contents Abstract ...... iii

Lay Summary ...... v

Preface ...... vi

Table of Contents ...... vii

List of Tables ...... x

List of Figures ...... xii

Acknowledgements ...... xiii

Dedication ...... xiv

1 Introduction ...... 1

1.1 Alcoholic fermentation of grape juice ...... 2

1.1.1 Inoculated fermentation ...... 2

1.1.2 Spontaneous fermentation ...... 3

1.2 Saccharomyces uvarum ...... 5

1.2.1 Saccharomyces uvarum and the Saccharomyces sensu stricto ...... 5

1.2.2 Introgressions into S. uvarum strains ...... 6

1.2.3 Holoarctic Saccharomyces uvarum history and geography ...... 7

1.3 Physiological differences between S. uvarum and S. cerevisiae ...... 8

1.3.1 Psychrotrophic nature of S. uvarum ...... 8

1.3.2 S. uvarum and S. cerevisiae influence on wine body sensory characters ...... 9

1.3.3 S. uvarum and S. cerevisiae influence on wine aroma sensory characters ...... 11

1.4 Identifying and characterizing S. uvarum through both species and strain typing analysis 12

1.4.1 Genotyping of S. uvarum strains ...... 12 vii

1.4.2 High-throughput amplicon sequencing of yeast species in grape and spontaneous wine

fermentations...... 14

1.5 Thesis objectives and hypotheses ...... 16

1.5.1 Background to objectives and hypotheses ...... 16

1.5.2 Objectives and hypotheses ...... 16

2 High genotypic diversity and dominance of indigenous Saccharomyces uvarum in spontaneous Chardonnay fermentations conducted at an Okanagan Valley winery ...... 20

2.1 Background ...... 20

2.2 Materials and Methods ...... 21

2.2.1 Spontaneous fermentation experimental design in the MHFE winery ...... 21

2.2.2 High throughput amplicon sequencing (HTAS) for analysis of species community

composition ...... 23

2.2.2.i Cleaning DNA ...... 23

2.2.2.ii Amplicon PCR (PCR1) protocol for Illumina HTAS...... 24

2.2.2.iii Index PCR (PCR2) and clean-up protocol for Illumina HTAS ...... 25

2.2.2.iv QIIME 2 species classification of Illumina Miseq data ...... 25

2.2.3 Development of PCR 11x-plex for microsatellite analysis of S. uvarum strains ...... 26

2.2.3.i Single colony isolation for S. uvarum ...... 26

2.2.3.ii PCR 11x-plex for microsatellite strain-typing of S. uvarum ...... 27

2.2.3.iii Genotyping S. uvarum and statistical analysis of strains...... 29

2.2.4 Statistical analysis of diversity and composition for S. uvarum strain populations and

fungal species composition ...... 31

2.2.5 Experimental design and grape processing for vineyard fungal species comparisons 32 viii

2.3 Results and Discussion ...... 36

2.3.1 Chemistry and kinetic parameters in winery fermentations ...... 36

2.3.2 Fungal community composition and diversity in winery fermentations ...... 39

2.3.2.i S. uvarum is a dominant species in fermentations ...... 39

2.3.2.ii Overall community composition and species diversity in fermentations ...... 42

2.3.3 Development and implementation of a S. uvarum multiplex microsatellite method ... 48

2.3.4 Genetic diversity in winery fermentations ...... 54

2.3.4.i A relatively low number of S. uvarum strains co-dominate fermentations ...... 54

2.3.4.ii Strain composition and diversity in fermentations ...... 56

2.3.5 Fungal community composition and S. uvarum presence in vineyards ...... 59

2.3.5.i S. uvarum identified in all four Okanagan valley vineyards ...... 59

2.3.5.ii Fungal species composition and diversity in vineyards...... 60

3 Conclusion ...... 66

3.1 Summary ...... 66

3.2 Novelty of the research ...... 68

3.3 Future research ...... 68

Bibliography ...... 70

Appendices ...... 86

Appendix A ...... 86

Appendix B ...... 92

Appendix C ...... 95

Appendix D ...... 96

ix

List of Tables

Table 2.2.1 Microsatellite loci used in either a 2x or 9x primer set mix for PCR amplification, concentration of primer and the volume used in each mix, and final concentration in 10 µL total for each PCR reaction...... 28

Table 2.2.2 Loci information for microsatellites primers and primer sequences...... 30

Table 2.2.3 Summary of vineyard collection sites...... 32

Table 2.3.1 Stage of fermentation for wine sampling of both treatments (Vineyard 2 grapes vs.

Vineyard 8 grapes) at MHFEW, with the number of days from harvest taken to reach each stage.

...... 36

Table 2.3.2 Mean wine sampling data and standard error of the mean (S.E.M) for spontaneous

Chardonnay fermentations in triplicate, of grapes sourced from Vineyard 2 or Vineyard 8, for the cold-settling vs. end of fermentation...... 38

Table 2.3.3 One-way PERMANOVA for the species composition between the treatments (V2 and V8), as well as between fermentation stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation...... 45

Table 2.3.4 Simpson’s Index of Diversity (1 – D) with S.E.M for species composition of each treatment (n = 3) at the stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation...... 47

Table 2.3.5 Repeated measures ANOVA of species diversity (Simpson’s Index of Diversity, 1 -

D) from Table 2.3.4, looking at the difference in treatment (n = 3), using 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation stages as repeated measures...... 47

Table 2.3.6 Eleven microsatellite loci for the Okanagan S. uvarum strains with the allele sizes and number of different alleles found...... 49 x

Table 2.3.7 One-way PERMANOVA for the S. uvarum strain composition between the treatments (V2 and V8), as well as between fermentation stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation...... 56

Table 2.3.8 Simpson’s Index of Diversity (1 – D) with S.E.M for S. uvarum strain composition of each treatment (n = 3) at the stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation...... 58

Table 2.3.9 Repeated measures ANOVA of S. uvarum population strain diversity (Simpson’s

Index of Diversity, 1 - D) from Table 2.3.4, looking at the difference in treatment (n = 3), using fermentation stage as the repeated measure ...... 58

Table 2.3.10 Simpson’s Index of Diversity (1 – D) with S.E.M for species composition of each vineyard (Vineyard 2 and 29, n = 5; Vineyard 8 and Vineyard 15, n = 6) on the grapes and juice after crush...... 61

Table 2.3.11 Post-hoc Tukey test on fungal diversity of Table 2.3.10 on the grapes and juice after crush of two vineyards in pairs out of the total of four vineyards: 2, 8, 15, and 29...... 62

Table 2.3.12 Pairwise PERMANOVA of fungal composition on the grapes and juice after crush of two vineyards in pairs out of the total of four vineyards: 2, 8, 15, and 29...... 62

xi

List of Figures

Figure 2.2.1 Sampling map layouts for Vineyards 2, 8, 15, and 29...... 35

Figure 2.3.1 Percent relative abundance + S.E.M of Saccharomyces (isolated from Wallerstein differential media-dependent) at 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation...... 39

Figure 2.3.2 Relative abundance of Illumina sequence reads for the most abundant species in the winery fermentations at all four stages of fermentation: cold-settling (CS), 1/3 sugar depletion,

2/3 sugar depletion, and end of fermentation, as well as the most abundant species from grapes of each corresponding vineyard...... 41

Figure 2.3.3 Principal coordinates analysis (PCoA) ordination comparing treatments V2 (blue) fungal composition against V8 (orange)...... 46

Figure 2.3.4 Unrooted phylogenetic tree using Bruvo distance for the 56 S. uvarum strains from the 2017 vintage, as well as S. uvarum strains CBS 7001, Spain; BMV58TM, Spain; CBS 395,

Netherlands; PYCC 6860, Hornby Island, Canada; and PYCC 6861, Hornby Island, Canada. .. 53

Figure 2.3.5 Relative abundance and S.E.M of the S. uvarum strains found in both treatments

(V2 and V8), with the fermentation stages combined...... 55

Figure 2.3.6 Principal coordinates analysis (PCoA) ordination comparing S. uvarum strain composition between the two fermentation treatments...... 57

Figure 2.3.7 Principal coordinates analysis (PCoA) ordination comparing fungal composition on grapes from four vineyards across the Okanagan Valley: Osoyoos Vineyard 2, blue; Oliver

Vineyard 8, orange; Naramata Vineyard 15, green; Kelowna Vineyard 29, purple...... 64

xii

Acknowledgements

Countless thanks to my supervisors, Dr. Daniel Durall and Dr. Vivien Measday, who took me in and allowed me to prosper and grow as a researcher, while providing wonderful guidance and mentorship. I would also like to thank my other supervisory committee member, Dr. Louise Nelson, for all her guidance as well.

I would like to thank the UBC Okanagan Biology Department, The BC Wine Grape Council, and the

National Science and Engineering Research Council (NSERC) Engage and Collaborative Research

Development (CRD) grants and Mission Hill Family Estate Winery for allowing me to use their winery and for providing supporting funds.

Thank you winemaker Alexandra Babynec at MHFEW, for welcoming me into the winery and all the help with sampling she provided, as well as for providing quality answers to any questions I had.

Thank you to Britney Johnston of the FADSS facility, who ran sequencing and fragment analysis for many, many isolates. Also, to the IBEST Genomics Resources Core facility at the University of

Idaho for providing support with Illumina Miseq sequencing.

Lastly, thank you to all members of the Durall Lab and UBC-Okanagan Biology Graduates, as well as the UBC-V Wine Research Centre members for also giving me guidance and support. Without them, I would not have been able to complete this thesis. A very special thanks, especially to Sydney

Morgan and Jay Martiniuk, for mentoring and helping with all aspects of lab techniques and planning my thesis.

xiii

Dedication

To my family, and especially my parents, whom I can always rely on. Thank you for all of your continuous support!

xiv

1 Introduction

The Okanagan Valley is located within the interior of British Columbia, Canada between the 49th and 50th parallels, making it one of the world’s most northern regions of winemaking. It has been producing wine and planting grapevines since the early 1860’s, starting in the Mission area of Kelowna, British Columbia (Schreiner, 2014). Since then, the wine-growing area has stretched to over 150 km in length, while expanding the vineyards and wineries to comprise over

8,000 acres of land (Schreiner, 2014). Most wineries within the Okanagan Valley use inoculated fermentations, whereby a single commercial strain of Saccharomyces cerevisiae is used as an inoculant; however, some wineries conduct spontaneous fermentations in addition to inoculated fermentations, and a few wineries conduct spontaneous fermentations in isolation from inoculated fermentations. A spontaneous fermentation is where uninoculated juice or must obtains fermenting yeast from grapes, winery air, or winery surfaces (Scholl et al., 2016), resulting in a fermentation conducted by a diversity of yeasts. These yeasts include different strains of S. cerevisiae, particularly in the later stages of fermentation, but may also include non-

Saccharomyces yeast such as Hanseniaspora, Pichia, and Metschnikowia (Fleet et al., 1984), and confusingly, some species belonging to the Saccharomyces genus, including Saccharomyces uvarum.

Within the Okanagan Valley, S. uvarum has been identified in both the vineyard and winery environments. In both 2013 and 2014, the Measday Lab at The University of British

Columbia (UBC)-Vancouver, surprisingly, discovered a high abundance of S. uvarum on Pinot

Gris grapes and in their associated spontaneous fermentations (Martiniuk and Measday, unpublished data) from the Okanagan Crush Pad (OCP) winery and vineyards; nearly half of

1 these isolates were identified as S. uvarum. In 2015, the Durall Lab at UBC Okanagan collaborated with Mission Hill Family Estates Winery (MHFEW) and also found that S. uvarum dominated their Chardonnay spontaneous fermentations and pied de cuve starters (Morgan and

Durall, unpublished data). Only one true strain of S. uvarum named ‘VELLUTO BMV58™’

(Lallemand, Montreal, Canada) has been commercialized, however, this strain is not available in the Canadian market yet. The unexpected dominance of this non-commercial yeast from spontaneous fermentations warrants further investigation to understand the potential origin, prominence and genetic diversity of S. uvarum in the Okanagan Valley wine region.

1.1 Alcoholic fermentation of grape juice

1.1.1 Inoculated fermentation

The majority of modern wines are produced through inoculated fermentation of grape juice or must using the yeast Saccharomyces cerevisiae, which metabolizes fructose and glucose into ethanol, carbon dioxide, and a wide diversity of secondary metabolites critical to a wine’s aroma and flavour (Knight et al., 2015). Yeast progression during alcoholic fermentation is characterized by a lag-phase due to stress of when yeast are first introduced into the grape juice, then, overcoming the stress of the juice (high sugar, low pH, etc.), the yeast begin to grow exponentially (Ferreira et al., 2017). A combination of high ethanol concentration and lack of fermentable sugars to consume causes stationary phase and some cell death after this exponential phase. Inoculated fermentation occurs when known, commercialized S. cerevisiae strains are introduced into the grape juice to perform the fermentation, and using inoculated fermentation has certain benefits, including the production of wine that is reproducible from one vintage to

2 another. In inoculated fermentations, stuck fermentations can be avoided by using S. cerevisiae strains that have a high tolerance to ethanol and an ability to withstand a low oxygen environment (Díaz et al., 2013; Ortiz et al., 2013). Most commercial S. cerevisiae are aggressively competitive towards indigenous strains found in the winery or vineyard. Because of this, the recognized microbial terroir may be lost due to dominance of commercial yeast strains, which may cause a reduction of the intricacy in a wine’s sensory profile and character (Capozzi et al., 2015).

1.1.2 Spontaneous fermentation

For thousands of years, winemakers have relied upon uninoculated or spontaneous fermentations to complete alcoholic fermentation. This fermentation relies mainly on yeasts originating from grapes in the vineyards, winery air, or winery surfaces (Scholl et al., 2016), and although it is less popular in modern winemaking, spontaneous fermentations allows for a diversity of S. cerevisiae strains, other Saccharomyces species, and several non-Saccharomyces genera (mainly in the early stages of fermentation) such as Hanseniaspora, Pichia, Candida,

Lachancea, Brettanomyces spp.; yeast-like fungi, for example, Aureobasidium pullalans can also be present (Fleet et al., 1984; Varela and Borneman 2017), which may result in a wine with a more unique sensory profile as compared to that of a guided, inoculated fermentation.

Uninoculated fermentations have a potential to aid in defining the microbial terroir of a wine by allowing the microbial community of the vineyard to be more influential in wine attributes than those found in guided fermentations (Bokulich et al., 2014; Knight et al., 2015). For example, post-harvest microbial communities from grapes that are unique to different viticulture regions, have been implicated in influencing the metabolite profiles of wine (Bokulich et al., 2016;

Knight et al., 2015). Other yeasts that may be present in the must derived from the vineyard or 3 already in the winery are Rhodotorula, Metschnikowia, and Torulaspora spp. (Fleet et al., 1984;

Romano et al., 2003). These resident non-Saccharomyces yeast may produce varying amounts of secondary metabolites compared with wine fermented using only commercial S. cerevisiae strains, so that these metabolites may positively influence a consumer’s sensory perception of a wine (Clemente-Jimenez et al., 2004). Some non-Saccharomyces, such as Hanseniaspora spp., may persist to the end of alcoholic fermentation (Morgan et al., 2019). Nevertheless, most non-

Saccharomyces often die off from an increased ethanol concentration and are replaced by

Saccharomyces cerevisiae, which typically dominate from early to late stages of alcoholic fermentation. However, it does appear that even if successful spontaneous fermentations occur, commercial S. cerevisiae used as inocula from previous vintages can adapt and evolve enological properties to a certain winery, appearing in higher abundance than S. cerevisiae strains that are indigenous to that winery’s region (Martini 2003; Morgan et al., 2017; Scholl et al., 2016). On the other hand, spontaneous fermentations may incur difficulties to winemakers as they are more prone to stuck fermentations, if commercial S. cerevisiae strains are absent. Saccharomyces species are relatively rare on grapes in the vineyard; roughly one in one-thousand grape berry surfaces contains Saccharomyces spp., but when the environment changes to a high sugar content, which occurs in berries with damaged skin to expose the sugary juice inside and/or grape must and juice, Saccharomyces spp. can flourish (Mortimer and Polsinelli, 1999).

Although S. cerevisiae is the typical Saccharomyces sp. that conducts alcoholic fermentation in spontaneous fermentations, Saccharomyces uvarum has also been identified as a species that can finish the fermentation, particularly in low-temperature conditions (Demuyter et al., 2004;

Naumov et al., 2000; Massoutier et al., 1998; Morgan et al., 2019).

4

1.2 Saccharomyces uvarum

1.2.1 Saccharomyces uvarum and the Saccharomyces sensu stricto

Saccharomyces uvarum is a species belonging to the Saccharomyces sensu stricto clade, or genus, yet is furthest related to S. cerevisiae. In addition to S. uvarum and S. cerevisiae, there are six other true species in the Saccharomyces sensu stricto complex: in order from least to most genetically similar to S. uvarum, the other Saccharomyces species are S. paradoxus, S. jurei, S. mikatae, S. kudriavzevii, S. arboricolus, and S. eubayanus (Borneman and Pretorius, 2015;

Naseeb et al., 2017). S. uvarum was first identified in circa 1894 from red currant juice, and first published in 1898 by M. W. Beijerinck (Nguyen and Boekhout, 2017). Currently, S. uvarum

Beijerinck 1898 is found in the Westerdijk Fungal Biodiversity Institute database, previously known as Centraalbureau voor Schimmelcultures, as the identifier CBS 395 (Vaughan Martini and Kurtzman, 1985). In 1985, S. uvarum was reduced to a synonym of S. bayanus due to supposed high recombination percentage (Vaughan Martini and Kurtzman, 1985), and later to S. bayanus var. uvarum, separating its distinctness from the existing variety S. bayanus var. bayanus (Naumov, 2000, 1996). However, as genomic studies have improved, Restriction

Fragment Length Polymorphism (PCR-RFLP) such as using the MET2 gene (Nguyen and

Gaillardin, 2005; Rainieri et al., 2006), Random Amplification of Polymorphic DNA (RAPD)

(Teresa Fernández-Espinar et al., 2003), Multiple Neutral Mutations Accumulation (MNMA)

(Nguyen and Gaillardin, 2005) and karyotyping (Nguyen and Gaillardin 2005; Rainieri et al.,

1999; Naumov et al., 2002; Kishimoto and Goto 1995) have all shown S. bayanus to be distinct from S. uvarum. Recent whole genome sequencing provides the strongest evidence that S. uvarum is its own separate species. Whole genome sequencing also has shown that S. bayanus is a hybrid between S. uvarum and Saccharomyces pastorianus (used as inoculum for lager beer),

5 which in itself is a hybrid cross between S. cerevisiae and S. eubayanus (Almeida et al., 2014;

Borneman and Pretorius 2015; Libkind et al., 2011; Nguyen et al., 2011; Pérez-Través et al.,

2014). The type strain for S. bayanus (CBS 380) has a genome comprised of roughly 67% S. uvarum to 33% S. eubayanus, with some S. cerevisiae genes (Libkind et al., 2011). This further lends credence to S. uvarum as its own species in that S. uvarum has been isolated from several natural sources, distinct from human interference in the winery, or other fermentative environments, whereas S. bayanus has yet to be discovered as a pure genome without hybridization from other Saccharomyces, and apart from an industrial fermentative environment

(Libkind et al., 2011). Thus, for taxonomic purposes, the restoration of S. uvarum Beijerinck,

1898 as a distinct species (Nguyen and Boekhout, 2017) will be adhered to in this thesis.

1.2.2 Introgressions into S. uvarum strains

S. eubayanus and S. uvarum are sister species and are both believed to have originated from the Southern Hemisphere (Almeida et al., 2014; Libkind et al., 2011). Introgressions, or introgressive hybridization through backcrossing of other Saccharomyces species with S. uvarum, commonly with S. eubayanus, are rarely found in naturally-sourced isolates or with any isolates from the Southern Hemisphere, but are present in some fermentation-derived strains

(Albertin et al., 2018; Almeida et al., 2014). These findings suggest that introgressions are human-influenced as they only take place within industrial fermentative settings. A distinct

Canadian population has been isolated from Quercus (oak) trees on Hornby Island, British

Columbia (Almeida et al., 2014; Masneuf-Pomarède et al., 2016) that appears native to North

America, because it lacks the genetic introgressions from S. eubayanus that were seen in

European S. uvarum strains from the Northern Hemisphere clade (Albertin et al., 2018; Almeida et al., 2014); although S. uvarum isolated from natural sources, like the type strain CBS 7001 6

(Nguyen et al., 2000; Vaughan Martini and Kurtzman, 1985) from the insect Mesophylax adopersus and those isolated from oak trees on Hornby Island, have pure genomes with no introgressions from other Saccharomyces. Nevertheless, 95% of Holarctic (the Northern

Hemisphere clade) S. uvarum possess introgressed regions across their genome; this group of isolates includes almost all European, fermentation-associated (wine, grape, or cider) strains, where introgression occurred in many different chromosomes, likely in a single event by ancestral S. eubayanus as this species has yet to have pure isolates discovered in Europe in modern times (Almeida et al., 2014; Libkind et al., 2011). Being in such geographic proximity and under the stressful conditions of fermentation (high osmotic pressures, anaerobic conditions, high ethanol concentrations, etc.), it is not unlikely that the majority of strains would eventually acquire beneficial genetic information from another species. Not only has S. eubayanus been introgressed, but a region of Saccharomyces kudriavzevii has been introgressed into one S. uvarum chromosome, where this introgression is present in almost all isolates of the Northern hemisphere, fermentation-associated S. uvarum (Almeida et al., 2014). This suggests again that geography and low-temperature preference influence the rate of introgression.

1.2.3 Holoarctic Saccharomyces uvarum history and geography

S. uvarum likely originated from a population bottleneck in Patagonia, where it is closely associated with Southern Beech trees (Nothofagus). However, in the Northern Hemisphere population, S. uvarum are less genetically diverse and less abundant than the two other

Nothofagus-associated populations, one population in Australasia and the other in South America

(Almeida et al., 2014; Sampaio and Gonçalves, 2008). The third S. uvarum population has migrated throughout the Northern Hemisphere (Almeida et al., 2014), and is also known as the

Holoarctic group as mentioned previously. This group includes natural S. uvarum populations 7 originating from Quercus (Oak) and almost all strains found from industrial fermentation environments, such as cider, beer, and wine isolates, where they are believed to have evolved with other Saccharomyces species, as evidenced through introgressions mentioned previously.

Holoarctic strains of S. uvarum have been isolated and identified from locales with cool climates around the world, such as New Zealand (Zhang et al., 2015), and Europe: specifically S. uvarum has been found in white wines from France (Demuyter et al., 2004; Masneuf-Pomarède et al.,

2016), and in eastern Europe in the countries of Hungary and Slovenia (Naumov et al., 2002). S. uvarum is not always restricted to white grapes and wines; it has been isolated from low- temperature, spontaneous fermentations of the ‘Amarone’ red grape varietal in Italy (Tosi et al.,

2009), and from many cider and beer fermentations (Almeida et al., 2014; Masneuf-Pomarède et al., 2016).

1.3 Physiological differences between S. uvarum and S. cerevisiae

1.3.1 Psychrotrophic nature of S. uvarum

Physiologically, S. uvarum exhibits superior cryotolerance compared with S. cerevisiae and can grow at temperatures as low as 1 °C, which has not been observed for S. cerevisiae; however, S. uvarum was not able to grow above 35 °C, whereas S. cerevisiae could grow up to

42 °C (Kishimoto and Goto, 1995). S. uvarum is regarded as one of the most psychrotrophic species in the Saccharomyces genus, and has an optimum growth temperature (~26 °C) considerably lower than for S. cerevisiae (~32 °C) (Salvadó et al., 2011). S. uvarum isolates from

New Zealand, as compared with typical S. cerevisiae commercial strains, were faster at alcoholic fermentation at 8 °C, and generally faster at 15 °C (Zhang et al., 2015). In cellar fermentations

8 kept at 12 °C in Alsace, France, it’s believed this cryotolerant attribute of several S. uvarum strains allowed domination for three consecutive years of fermentation (Demuyter et al., 2004).

These psychrotrophic traits may be explained by mitochondrial DNA differences in S. uvarum compared to S. cerevisiae, where mtDNA has been found to be associated with better cold tolerance (Li et al., 2019). As well, a higher production of ergosterol and fatty acid biosynthetic enzymes has been found in S. uvarum compared to S. cerevisiae, where ergosterol and some fatty acids are a part of the cold stress tolerance mechanism in eukaryotic cells (Blein-Nicolas et al.,

2013).

1.3.2 S. uvarum and S. cerevisiae influence on wine body sensory characters

S. uvarum may be able to ferment at lower temperatures, but it is most important, in terms of the winemaker’s point of view, to determine whether the yeast, which is used as an alternative to S. cerevisiae will spoil or even enhance the sensory profile of the wine. On more than one occasion, S. uvarum created the more preferred wine when compared to S. cerevisiae

(Tosi et al., 2009; Zhang et al., 2015). Based on the sensory profile of S. uvarum, including both effects upon taste and aroma, vintners should consider S. uvarum as a potential replacement to S. cerevisiae for producing unique, valuable wine, specifically for white wines as evidenced in the following.

At relatively low fermenting temperatures below 10 °C, it appears S. uvarum produces more ethanol than S. cerevisiae (Kishimoto et al., 1994), thus it could be recommended for fermentations requiring low temperatures but with a high alcohol yield. However, the consensus for temperatures above 10 °C, as in common winemaking practices of white wines, where fermentations are between 12 °C to 20 °C (Robinson, 2015), is that S. uvarum may have lower

9 ethanol tolerance, resulting in a fermentation with a lower ethanol concentration as compared with that of S. cerevisiae (Kishimoto et al., 1993; Masneuf-Pomarède et al., 2010; Origone et al.,

2018; Rainieri et al., 1998). As compared with S. cerevisiae, S. uvarum increases positive metabolic attributes by producing a higher amount of glycerol, which can influence the perception of sweetness and mouthfeel of the wine through viscosity change. However, glycerol needs to be around 28 g/L, as seen in Botrytis (noble rot infected) wines, in order for a detection in viscosity change (Noble and Bursick, 1984). It almost always appears that glycerol due to S. uvarum doesn’t truly reach this noticeable 28 g/L threshold for viscosity, but it is well within the limit of around 5 g/L needed to experience a sense of sweetness (Gawel et al., 2007; Goold et al.,

2017; Kishimoto and Goto 1995; Masneuf-Pomarède et al., 2010; Rainieri et al., 1998).

As well, higher glycerol production has been shown to be associated with a decrease in ethanol production (Remize et al., 1999), which could explain the phenomenon seen often with

S. uvarum, where S. uvarum wine has noticeably less ethanol than S. cerevisiae. This trait may become quite beneficial for winemakers as wines of the world are increasingly possessing higher ethanol concentrations, where higher ethanol can give negative sensory perceptions of

‘bitterness’ and ‘heat’, and can mask other important aromatics (Varela et al., 2015). Grapes are maturing quicker than usual in their growing season as a function of grape growing climates becoming warmer (Jones et al., 2005). More sugar in the grape berry leads to more fuel for the yeast to metabolize into ethanol. Finding strains from species like S. uvarum that appear to not fully ferment all sugar to ethanol, or ones that diverge fermentation pathways by producing other enologically desirable metabolites, is a powerful strategy for reducing ethanol concentration and maintaining quality wines. Research into high-alcohol red wines, seen commonly as with the

10 varietal Shiraz, have also begun looking at reduced ethanol by using non-Saccharomyces species

(Contreras et al., 2014), and S. uvarum could be an excellent candidate for such research.

1.3.3 S. uvarum and S. cerevisiae influence on wine aroma sensory characters

Compared to S. cerevisiae, not only does S. uvarum differentially affect the body, or how the wine tastes and feels in the mouth, but it affects the nose, or scent and aroma of wine as well.

Malic acid, the second most important acid in wine after tartaric acid, gives off the strong flavour of green apple, and a harsh acidity of some white wines or under ripe grapes (Robinson, 2015).

Although malic acid is mainly derived from grapes, the concentration has been shown to increase in wine by cryotolerant species like S. uvarum, because it is synthesized by S. uvarum rather than metabolized (Giudici et al., 1995; Rainieri et al., 1998). S. uvarum, as compared with S. cerevisiae, tends to produce higher levels of succinic acid and lower levels of acetic acid

(Masneuf-Pomarède et al., 2010), which may reduce chances of acetic acid spoilage. There are also reports that S. uvarum produces higher amounts of volatile sulphur aromas in Sauvignon

Blanc (Kishimoto et al., 1993; Masneuf-Pomarède et al., 2002; Origone et al., 2018). Because of this, Sauvignon Blanc fermented by S. uvarum has been given a unique aroma of

“Weissbier/wheat beer” and “cheese” compared to S. cerevisiae; in this particular case, winemakers preferred it over a wine fermented using S. cerevisiae (Zhang et al., 2015). At lower temperatures, higher amounts of aromatic compounds, such as isobutanol and amyl alcohols, have been detected in S. uvarum fermentations compared with S. cerevisiae (Csoma et al., 2010).

The rosy aroma of 2-phenylethanol and 2-phenylacetate (also giving off a rosy odor) produced by S. uvarum can be used as a key diagnostic tool to distinguish between S. uvarum and S. cerevisiae. Although 2-phenylethanol is seen as a beneficial aroma in moderation, it can overpower some of the other varietal aromas, if its concentration is too high (Masneuf-Pomarède 11 et al., 2010). The rose scent of 2-phenylethanol has an odor threshold in 90% water/10% ethanol of 10 mg/L, while 2-phenylacetate has an odor threshold of 0.25 mg/L in the same conditions

(Guth, 1997). Phenylalanine is the amino acid precursor for assembling 2-phenylethanol in which there is a significant upregulation in S. uvarum over S. cerevisiae for enzymes involved in the Ehrlich pathway for synthesizing phenylalanine (Bonciani et al., 2018). The reasons for these higher levels of other varietal aromatics could also be that S. uvarum, unlike S. cerevisiae yet similar to other non-Saccharomyces genera, has increased β-glucosidase activity, which is an enzyme heavily involved with releasing small aromatic volatile molecules (e.g. monoterpenes) from grapes.

1.4 Identifying and characterizing S. uvarum through both species and strain typing analysis

1.4.1 Genotyping of S. uvarum strains

Because S. uvarum has been isolated from a wide range of environments all around the world, it is important to measure just how diverse the populations of this species are in each of these niches. Measuring and identifying strain diversity is performed by isolating the yeast onto media (using a culture dependent method), extracting DNA, and collecting a molecular

‘fingerprint’ or genotype from different isolates. Strain diversity measures for S. uvarum have been performed with RAPD (GTG)5 fingerprinting (Naumova et al., 2011), however, this technique may underestimate the true diversity of a species and can lead to species grouping together closer than in reality (Ramírez-Castrillón et al., 2014). Single nucleotide polymorphisms

(SNPs) have also been used to categorize S. uvarum strains (Almeida et al., 2014), where this is

12 quickly becoming the optimal technique for strain-typing, as SNPs are dense and consist of constant, single base changes across the entire genome (Xing et al., 2005) not just in non-coding regions, therefore giving potential information about different alleles and the corresponding phenotypic results. With quicker and cheaper sequencing technology, SNPs appear to be the future of strain-typing. Currently, the prominent method for strain typing wine-associated S. cerevisiae is short-tandem repeat (STR) or microsatellite analysis; however, it has been used to limited extent in S. uvarum. Microsatellites are regions of the genome that are present in non- coding DNA. They consist of 2 - 6 base pair motif repeats that can be repeated in tandem up to approximately 100 times in an arbitrary fashion (Richard et al., 2008; Zhivotovsky and Feldman,

1995). Because of their high variability of repeats or in other words, high polymorphic behavior, microsatellites are useful for comparing different isolates at the strain-level. Compared to SNPs, one microsatellite region actually gives more information than a single SNP, as each SNP is based on a single-point mutation in a genome, whereas a microsatellite locus encompasses a region composed of different numbers of repeats between isolates (Daw et al., 2005). A lower number of microsatellite markers are then needed to produce similar information compared with

SNPs.

S. cerevisiae microsatellite markers are widely used for characterizing wine strains with whole databases being procured due to the hypervariability in S. cerevisiae (Legras et al., 2005;

Richards et al., 2009), yet microsatellites have been carried out for S. uvarum population analysis with mixed results. From a study looking at New Zealand S. uvarum populations, the ten microsatellite loci chosen showed a low number of unique genotypes (only 10 genotypes from 65 isolates) when compared to microsatellite genotypes in S. cerevisiae, suggesting microsatellites were not an ideal choice for strain-typing S. uvarum (Zhang et al., 2015). Of the 65 isolates 13 taken, only 15 (or ~23% of isolates) appeared to be heterozygous at one or more loci with one or more alleles, thus, ~77% of the isolates appeared homozygous. Another study saw low heterozygosity of S. uvarum based on nine completely different microsatellite markers, where again roughly 75% of all isolates world-wide were homozygous (Masneuf-Pomarède et al.,

2016). The reasoning for this appears that S. uvarum isn’t as genetically diverse between natural isolates and industrial isolates as seen in S. cerevisiae. Yet, these previously cited studies used microsatellite markers in S. uvarum that only consisted of 1 – 3 different alleles per loci (Zhang et al., 2015), and the other paper that examined S. uvarum world-wide found loci with an average of 7 different alleles, and one locus being the most polymorphic with 16 different allelic possibilities (Masneuf-Pomarède et al., 2016). These loci were selected as they showed the greatest number of polymorphisms within each study, as well in the case of loci from Zhang et al., (2015), they showed the greatest distances between allele lengths. However, S. uvarum microsatellite loci still give very poor genotype variability when compared to S. cerevisiae microsatellite loci, which have many loci with greater than 10 different alleles, and one locus with 32 allelic possibilities, doubling the allele possibilities seen in S. uvarum (Legras et al.,

2005).

1.4.2 High-throughput amplicon sequencing of yeast species in grape and spontaneous wine fermentations

If conducting spontaneous fermentations, most winemakers are unaware of the fungal microbes responsible for fermenting the juice or must; however, it could be advantageous to the winemaker if they knew what species were involved. The determination of the wine microbial community has been performed most often by culture-dependent methods, which involves plating the sample onto differential media, commonly Wallerstein Laboratory Nutrient Agar 14 medium (WL), which is based on the appearance of colonies, and allowing the yeast species present to grow into colonies, or cultures, where DNA can then be extracted (Pallmann et al.,

2001). The drawback of using a culture dependent method is that it can’t detect viable but not culturable (VBNC) yeast cells, including both non-Saccharomyces and S. cerevisiae, which have been found after alcoholic fermentation has completed (Divol and Lonvaud-Funel, 2005). Also, any dead or injured cells, perhaps from sulphur dioxide addition as this is a common antimicrobial added into fermentations to reduce spoilage organisms, may not grow and present with culture-dependent methods (Cocolin and Mills, 2003). In the vineyard, where surfaces of grapes have Saccharomyces cells as a minor presence, it becomes critical to find a method to detect the low frequency Saccharomyces when it does appear. These issues can be solved by using high-throughput amplicon sequencing, previously known as next-generation sequencing

(NGS), culture-independent methods such as the Illumina (previously Solexa) DNA sequencing platform (Bennett, 2004). Culture-independent methods involve directly extracting DNA from the wine sample without any plating, and then analyzing DNA using high-throughput sequencing methods (Bokulich et al., 2012). High-throughput amplicon sequencing, or HTAS for short, allows entire fungal community analysis by sequencing thousands of reads in parallel for all fungal species present. The sequences are based on universal barcodes, or regions of the genome that differ greatly between species; the most popular barcode for fungi, including most wine yeast, is the ITS1 (internal transcribed spacer 1) region of the genome (Bokulich and Mills,

2012). HTAS of wine yeast analysis has been used for yeast-grape associations between vineyards (Bokulich et al., 2014) as well as studies for potential wine spoilage organisms

(Bokulich et al., 2012), and for tracking changes to yeast populations throughout alcoholic fermentation (Bokulich et al., 2016; Morgan et al., 2019).

15

1.5 Thesis objectives and hypotheses

1.5.1 Background to objectives and hypotheses

Mission Hill Family Estate Winery (MHFEW), situated in West Kelowna, has been in business producing wine since 1981. However, wine has been produced at this location since

1966 (Schreiner 2005). MHFEW is one of the largest, independently-owned wine producers in the region. Together with MHFEW, this project was designed to look at research focusing on S. uvarum in the vineyards that are owned and operated by MHFEW, and in their winery located in the Okanagan Valley. Understanding the wine yeast community and its microbial populations, especially for an enologically significant species such as S. uvarum, will help winemakers of the

Okanagan make low-temperature, spontaneous, white wine management decisions in a more informed manner.

1.5.2 Objectives and hypotheses

Because S. uvarum was found on grapes from multiple vineyards and in spontaneous fermentations as a dominant yeast in more than one winery in different years (Martiniuk and

Measday, unpublished; Morgan and Durall, unpublished), I constructed a series of objectives that will provide more ecological and genetic information about S. uvarum, which may be important in helping to understand and develop a regional character of Okanagan wines.

Objective 1: To determine whether S. uvarum was part of the fungal community in two treatments of Chardonnay fermentations (conducted at MHFEW winery in 2017), which differ in their grape origin.

Hypothesis 1-a: S. uvarum will dominate spontaneous Chardonnay fermentations in 2017 as it did in 2015.

16

Rationale: In 2015, Morgan and Durall (unpublished) found at MHFEW that S. uvarum

had dominated their fermentations in the cellar at fermentations at 12 °C, even over

commercial S. cerevisiae. It was also found at an Alsatian winery that S. uvarum could

dominate fermentations for three straight years in the cellars at this temperature

(Demuyter et al., 2004).

Hypothesis 1-b: The two fermentation treatments, differing in their grape origin, will have similar species composition, relative abundance, and diversity during cold-settling and alcoholic fermentation.

Rationale: Saccharomyces spp. from the winery will eventually take over the

fermentations from non-Saccharomyces species present at the beginning of the

fermentations (Csoma et al., 2010; Morgan et al., 2019; Scholl et al., 2016). From

Hypothesis 1-a, I also expect that S. uvarum will be the dominant species, thus I expect

similar Saccharomyces spp. composition and diversity involved in both treatments when

fermentations occur at the same winery and during the same vintage, regardless of grape

origin.

Objective 2: To develop a multiplex microsatellite method that can accurately distinguish between S. uvarum genotypes and into strains.

Hypothesis 2: Within the strain population distinguished through this method, strains will be identified as indigenous and unique to the Okanagan Valley

17

Rationale: The only commercial strain of S. uvarum available is BMV58TM, which was

identified in Europe, and to date, BMV58 has never been used as inocula at Mission Hill

previously, suggesting any S. uvarum found will be non-commercial. Masneuf-Pomarède

et al., (2016) found that a Canadian population of S. uvarum was also unique compared to

any other world-wide strains. Zhang et al., 2015 found there were S. uvarum genotypes in

their fermentations that were unique to the New Zealand region. Our results will then be

similar, with a unique population found at this winery in the Okanagan Valley.

Objective 3: To determine the degree of genetic diversity of the S. uvarum populations in two low-temperature, spontaneous, Chardonnay winery fermentations, which differ in their grape origin.

Hypothesis 3-a: Both treatments will have fermentations dominated by a relatively low number of S. uvarum genotypes or strains.

Rationale: One study found only 10 different microsatellite genotypes out of 65 isolates

from 5 different fermentation sources (Zhang et al., 2015). For this study, most of the

genotypes were unique variants, found only as one isolate, and although multiple

genotypes were found in all sources, only 1 genotype was considered dominant for each

fermentation. Demuyter et al., (2004) found that a low number (less than three strains)

also dominated each of their fermentations. I predict the same effect, with only a few

strains dominating, will occur with the fermentations at MHFEW.

18

Hypothesis 3-b: The two fermentation treatments, with a difference of grape origin, will have similar S. uvarum strain populations, relative abundance and diversity.

Rationale: From Hypothesis 1-a, I expect S. uvarum to dominate the fermentations and if

the fermentations are in the same cellar at the same time, similar strains will appear in

both treatments. As well, it appears only a few strains will dominate the fermentations

(Zhang et al., 2015), so I can rationalize S. uvarum will act with similar abundances and

diversity in both treatments. It also appears that S. uvarum from the winery will be a

completely different population than that seen in the vineyard environment, so grape

origin will likely not have an effect (Demuyter et al., 2004), meaning the winery S.

uvarum population should be similar within the vintage.

Objective 4: To determine whether S. uvarum will be part of the fungal community in vineyards representing a broad region of the Okanagan Valley.

Hypothesis 4-a: S. uvarum will be identified in at least one of the vineyards surveyed in the

Okanagan Valley.

Rationale: Both of the following lab groups, (Martiniuk and Measday, unpublished) and

(Morgan and Durall, unpublished), have reported S. uvarum from grapes in two separate

vineyards in the Okanagan Valley. It can be hypothesized then that S. uvarum is present

in other vineyards as well.

Hypothesis 4-b: Most vineyards throughout the Okanagan Valley will have different fungal species composition, relative abundance and diversity on their grapes.

19

Rationale: As the grapes are coming from differing vineyards and regions separated

geographically in the Okanagan Valley, the yeast species involved in the juice from

grapes of different vineyards should show dissimilar patterns of yeast species diversity

and relative abundance (Bokulich et al., 2016; Miura et al., 2017).

2 High genotypic diversity and dominance of indigenous Saccharomyces uvarum in spontaneous Chardonnay fermentations conducted at an Okanagan Valley winery

2.1 Background

The majority of modern wines are produced through inoculated fermentation of grape juice using the yeast Saccharomyces cerevisiae, which metabolizes fructose and glucose into ethanol, carbon dioxide, and a wide diversity of secondary metabolites critical to a wine’s aroma and flavour (Knight et al., 2015). For thousands of years, winemakers have relied upon uninoculated or spontaneous fermentations to complete alcoholic fermentation. This fermentation relies mainly on yeasts originating from grapes in the vineyards, winery air, or winery surfaces (Scholl et al., 2016), and although it is less popular in modern winemaking, spontaneous fermentations allows for a diversity of S. cerevisiae strains, non-Saccharomyces genera (mainly in the early stages of fermentation), and other Saccharomyces species. Although

S. cerevisiae is the typical Saccharomyces sp. that conducts alcoholic fermentation in spontaneous fermentations, Saccharomyces uvarum has also been identified as a species that can

20 finish the fermentation, particularly in low-temperature conditions (Demuyter et al., 2004;

Massoutier et al., 1998; Morgan et al., 2019; Naumov et al., 2000).

Within the Okanagan Valley, S. uvarum has been identified in both the vineyard and winery environments. In 2015, the Durall Lab at UBC Okanagan collaborated with Mission Hill

Family Estates Winery (MHFE) and found that S. uvarum dominated their Chardonnay spontaneous fermentations and pied de cuve starters (Morgan and Durall, unpublished data), even over S. cerevisiae during alcoholic fermentation. The first objective of this chapter was to determine whether S. uvarum was part of the fungal community in Chardonnay fermentations that differ by origin of grapes in the Okanagan Valley, conducted at the winery in 2017, through high-throughput amplicon sequencing. Secondly, if S. uvarum was present in the fermentations, I would develop a novel microsatellite genotyping multiplex in order to determine unique strains in the Okanagan Valley where, thirdly, the degree of genetic diversity of the S. uvarum population would be assessed between treatments differing in their source (vineyard origin) of grapes. Fourthly, the fungal community of grapes from different vineyards in the Okanagan

Valley would be examined to view if S. uvarum is present in these vineyards.

2.2 Materials and Methods

2.2.1 Spontaneous fermentation experimental design in the MHFE winery

Two vineyards were harvested, and the grapes were brought to MHFEW, where the pressed grape juice was followed into new, La Garde 285 L stainless steel barrels (SML Stainless

Steel, Quebec, Canada), in triplicate, for a total of 6 barrels in the experiment. Vineyard 2 was harvested two weeks prior to Vineyard 8’s harvest (Table 2.3.1). Vineyard 8 was the same site

21 used in the 2015 Durall Lab study (Morgan and Durall, unpublished). A cold-temperature settling (CS) period between harvest and the racking off of the juice into the barrels occurred where the juice was held temporarily in large-steel holding tanks at 4 °C to allow solid grape matter to settle to the bottom of the tank, and the “CS” stage of sampling was taken when the juice was finally put into the 285 L barrels in the cellar. The juice was held at the low- temperature CS for different number of days as well as before the CS sample was collected; however, the alcoholic fermentations of both treatments (based on the origin of grapes) had not started at this stage because it took another week after placing the juice in the 285 L barrels for a noticeable change in °Bx to begin in both treatments. Fifty-mL samples were taken at a depth around 10 cm into each barrel, at four different stages of alcoholic fermentation as follows:

“cold-settling” of juice, or at a stage where sugar depletion had not started to occur with both vineyards starting around 22 °Bx, “1/3 sugar depletion” defined between 18 to 14 °Bx, “2/3 sugar depletion” defined between 10 to 6 °Bx, and the “end” of alcoholic fermentation, considered at 2 ± 0.1 °Bx remaining. For both V2 and V8 treatments, 20 ppm SO2 were added during CS, 250 ppm of Fermaid® K (Scott Laboratories, Pickering, Canada) complex yeast nutrient were added before I sampled the “1/3 sugar depletion” stage to provide adequate nutrient to growing yeast cells, and 100 ppm of THIAZOTE® (Laffort SA, Bordeaux, France) mineral nutrient were added just after I sampled the “1/3 sugar depletion” stage to maintain proper conditions for the yeast. The juice and wine chemical parameters for the “cold-settling” and

“end” of fermentation, respectively, were measured using a WineScanTM wine analyzer (Foss,

Hilleroed, Denmark) and are shown in Table 2.3.2. Cellar temperature was kept constantly at 12

°C for the entire fermentation in both treatments, and the temperature of both the fermentations began at 12 °C, yet ended at 14 °C. The samples were brought back to the University of British

22

Columbia – Okanagan BRAES molecular lab and plated through culture-dependent methods or kept at -80 °C for further high-throughput amplicon sequencing (culture-independent analysis).

2.2.2 High throughput amplicon sequencing (HTAS) for analysis of species community composition

2.2.2.i Cleaning DNA

Both vineyard and winery samples were thawed on ice, and then cleaned following a protocol modified from Zott et al., (2010). Samples were pelleted by centrifuging for 5 min at

13,200 rpm. Supernatant was discarded, resuspended in 1 mL of chilled 1 x phosphate-buffered saline, then centrifuged again for 5 min at 13,200 rpm. Supernatant was discarded again and resuspended in 500 µL of 50 mM EDTA pH 8.0 solution. Samples were mixed, and the entire sample was transferred to a FastPrep tube containing 0.5 mm of disruptor glass beads (Scientific

Industries, Bohemia, USA). Samples with beads were then put into a bead beater (30/s) for two rounds of 2.5 min, separated by 1 min on ice. Five hundred µL of Nuclei Lysis solution (Fisher,

Hampton, USA) were added and lysed in a bead beater (30/s) for 1 min. Samples were incubated for 10 min at 95 °C, and then centrifuged for 5 min at 13,200 rpm. Five hundred µL of the supernatant were then transferred to a new Eppendorf tube, with 250 µL of Protein Precipitation solution added afterwards (Fisher, Hampton, USA). Samples were then vortexed lightly and kept at room temperature (22 °C) for 15 min. Samples were then centrifuged at 13,200 rpm for 5 min.

Five hundred µL of this supernatant were then added to a new Eppendorf tube with 75 µL of

20% (w/v) polyvinylpyrrolidone solution (Sigma-Aldrich, St. Louis, USA). Samples were then pulse-vortexed for 10-20 seconds and centrifuged for 10 min at 13,200 rpm. Five hundred µL of the supernatant were then again transferred to a new Eppendorf tube with 300 µL of chilled 2- propanol (Sigma-Aldrich, St. Louis, USA). Tubes were inverted to mix several times and left for

23

15 min at room temperature (22 °C). Again, samples were centrifuged at 13,200 rpm for 2 min.

The supernatant was discarded, the pellet was resuspended in 1 mL of chilled 100% ethanol, centrifuged again at 13,200 rpm for 2 min, the supernatant discarded, and samples left to air-dry in a biosafety cabinet for 30 min. The final resuspension was in 50 µL TE buffer, and the samples of DNA were frozen at -80°C.

2.2.2.ii Amplicon PCR (PCR1) protocol for Illumina HTAS

PCR1 was performed to amplify a short fragment (150-250 bp) of the ITS1 region that maximized coverage of the region’s hypervariability using the forward primer BITS with a CS1 linker sequence, and the reverse primer B58S3 with CS2 linker sequence (Bokulich and Mills,

2013). Into a single PCR tube out of a 8 x 0.2 mL PCR strip tube, the following reagents were added: 12.75 µl of nuclease-free water, 5 µL of 5x GoTaq® Green Reaction Buffer (Promega,

Fitchburg, USA), 0.5 µL of 10 mM dNTPs, 2.5 µL of 25 mM MgCl2, 0.25 µL of GoTaq®

Polymerase at 5U/µL (Promega, Fitchburg, USA), 0.5 µL of BITS forward primer (10 µM), 0.5

µL of B58S3 reverse primer (10 µM) and 3 µL of the sample DNA template for a total of 25 µL.

The protocol for PCR1 was ran on an Applied Biosystems Veriti 96-Well Thermocycler (ABI,

Foster City, USA) as follows: 94 °C initial denaturation for 3 min (1 cycle); 94 °C denaturation for 40 sec, 54 °C annealing for 40 sec, 72 °C elongation for 40 sec (34 cycles); 72 °C final elongation for 10 min (1 cycle). PCR1 products were then run on a 1.2% sodium borate gel with

SYBR Safe DNA gel stain™ (Life Technologies, Carlsbad, USA), and visualized using a Gel

Logic400 Imaging System (Mandel, Rochester, USA) to confirm success. Samples that succeeded then underwent PCR2, whereas samples that failed repeated PCR1, and had varying amounts of DNA template added until successful.

24

2.2.2.iii Index PCR (PCR2) and clean-up protocol for Illumina HTAS

PCR2 occurred after successful PCR1 to attach unique Index P5 and P7 oligonucleotide combinations for each amplicon. Index PCR primers contained the CS1/CS2 linker sequence, the

P5/P7 Illumina® MiSeq adapter sequence, as well as an 8-nucleotide barcode sequence (Morgan et al., 2019). Into a single PCR tube from a 8 x 0.2 mL PCR strip tube, the following reagents were added: 15.25 µl of nuclease-free water, 5 µL of 5x GoTaq® Green Reaction Buffer

(Promega, Fitchburg, USA), 0.5 µL of 10 mM dNTPs, 2.5 µL of 25 mM MgCl2, 0.25 of µL

GoTaq® Polymerase at 5U/µL (Promega, Fitchburg, USA), 0.5 µL of P5 (10 µM), 0.5 µL of P7

(10 µM), and 0.5 µL of the sample PCR1 DNA template for a total of 25 µL. The protocol for

PCR2 was again run on an Applied Biosystems Veriti 96-Well Thermocycler (ABI, Foster City,

USA) as follows: 95 °C initial denaturation for 1 min (1 cycle); 95 °C denaturation for 30 sec, 62

°C annealing for 30 sec, 68 °C elongation for 1.5 min (12 cycles); 68 °C final elongation for 5 min (1 cycle). PCR2 products were checked on a 1.2% sodium borate gel to confirm PCR2 success, where successful samples (noted by an increase of 69 base pairs from the addition of the

P5/P7 adaptor and barcode sequence) were cleaned using the “PCR Clean Up” protocol from the

16S Metagenomic Sequencing Library Preparation guide (Illumina® Inc., San Diego, USA), but using only 27.5 µL of 10 mM Tris pH 8.0. Samples were then sent to IBEST Genomics Resource

Center (University of Idaho, Moscow, USA) for normalizing, pooling and paired-end sequencing

(300 bp) using an Illumina MiSeq Desktop Sequencer (Illumina® Inc., San Diego, USA)

2.2.2.iv QIIME 2 species classification of Illumina Miseq data

Processing, quality control, and analysis of the Illumina sequencing data began first by denoising using the ‘dada2’ package (Callahan et al., 2016) in R v3.5.1 (R Core Team, 2018), which removed forward and reverse primer sequences, and merged the forward and reverse reads

25 without trimming the sequences, due to the variability of the ITS region in length. The bioinformatics pipeline Quantitative Insights Into Microbial Ecology 2, or QIIME 2, v2018.11.0

(Bolyen et al., 2018) was then used to identify the species present, where sequences went through paired-end alignment using MAFFT (Katoh and Standley, 2013). A phylogenetic tree with a mid-point root was then created using FastTree 2 (Price et al., 2010). Sequences were classified down to the species-hypothesis level, between a threshold of 97% to 99%, by using a dynamic classifier software from UNITE v7.2 (Kõljalg et al., 2013). Any sequences that could not be identified to the order level, or any that had a frequency lower than 100 were removed.

The sampling depth was rarified to 20,000 sequences, which was chosen due to the sample with the lowest number of sequences. In the UNITE v7.2 database, S. uvarum is incorrectly still being classified as S. bayanus, and based on the evidence given in Chapter 1.2.1 (Nguyen and

Boekhout, 2017), I opted to call any matches to S. bayanus corrected as S. uvarum.

2.2.3 Development of PCR 11x-plex for microsatellite analysis of S. uvarum strains

2.2.3.i Single colony isolation for S. uvarum

Samples were plated in duplicate at each fermentation stage, after CS, in serial dilution

-4 -6 between 10 and 10 CFU/mL onto YEPD plates (1% w/w yeast extract, 1% w/w bacterial peptone, 2% w/w dextrose, 2% w/w agarose) with the addition of 0.01% v/v chloramphenicol

(Sigma-Aldrich, St. Louis, USA) to prevent bacterial growth of plates, as well as 0.015% v/v biphenyl (Sigma-Aldrich, St. Louis, USA) to prevent hyphal growth of mold and other fungi

(Castelluci 2010; Demuyter et al., 2004; Houck 1971; Martiniuk et al., 2016). Plates from the stages “1/3 sugar depletion”, “2/3 sugar depletion”, and “end of fermentation” were selected for single colony isolation from the plate with the lowest dilution number and the replicate with the

26 highest number of colonies counts between 30 and 300. Cold-settling stage samples were plated in duplicate at 10-1 CFU/mL, but still did not produce enough colonies between 30 – 300 for single colony isolation. From these selected plates, 47 single colony isolates were extracted and re-plated onto both gridded YEPD medium and Wallerstein Differential Medium (Sigma-

Aldrich, St. Louis, USA), as well as controls of both S. cerevisiae Lalvin BA11® (Lallemand,

Montreal, Canada), and S. uvarum CBS 7001 (Westerdijk Fungal Biodiversity Institute, Utrecht,

Netherlands). These Wallerstein and YEPD plates were placed into a 28 °C incubator for 48 hours, where colonies appeared as a cream colour based on the S. cerevisiae control, to a blueish- green, based on the S. uvarum control.

2.2.3.ii PCR 11x-plex for microsatellite strain-typing of S. uvarum

From the YEPD plates, 1 mm3 of each colony culture isolate was scraped off and put into

50 uL of HPLC water in 96 x 0.2 mL well PCR plates. 94 isolates were selected for each plate, with a positive using CBS 7001, and a negative with only HPLC water. DNA from each isolate was extracted by boiling the isolate culture at 95 °C for 15 minutes with an Applied Biosystems

Veriti 96-Well Thermocycler (ABI, Foster City, USA), then pelleting the cells at 10,000 rpm for

1 min, giving a concentration of DNA in the isolate supernatant around 25 ng/µL, based on

Nanodrop ND-1000 readings (ThermoFisher, Waltham, USA). Both Zhang et al., (2015) and

Masneuf-Pomarède et al., (2016) performed each of their PCR reactions with a single microsatellite primer pair, instead of multiplexing the primer sets together. I then attempted to multiplex our PCR reactions, but to use all 11 microsatellite loci together for strain-typing, the loci had to be divided into two reactions, one a 9x-multiplex, and the other in a 2x-duplex. Both multiplexes were developed using the S. uvarum strain CBS 7001 as the positive control.

27

Table 2.2.1 Microsatellite loci used in either a 2x or 9x primer set mix for PCR amplification, concentration of primer and the volume used in each mix, and final concentration in 10 µL total for each PCR reaction.

Primer- Name (F; Primer forward, and R; Concentration Volume Final Concentration in 10 reverse) (µM) (µL) µL PCR mix (µM) L2F2 10 0.24 0.24 2x L2R2 10 0.24 0.24 Primer L9F2 15 0.24 0.36 Mix L9R2 15 0.24 0.36 NB1F1 10 0.040 0.040 NB1R1 10 0.040 0.040 NB4F1 10 0.12 0.12 NB4R1 10 0.12 0.12 NB8F1 10 0.16 0.16 NB8R1 10 0.16 0.16 NB9F1 10 0.16 0.16 NB9R1 10 0.16 0.16 9x L1F2 10 0.12 0.12 Primer L1R2 10 0.12 0.12 Mix L3F2 10 0.30 0.30 L3R2 10 0.30 0.30 L4F2 15 0.030 0.045 L4R2 15 0.030 0.045 L7F2 15 0.035 0.053 L7R2 15 0.035 0.053 L8F2 15 0.030 0.045 L8R2 15 0.030 0.045

Zhang et al., 20151 Masneuf-Pomarède et al., 20162

For each reaction of the 2-plex, 5 uL of 2x QIAGEN Multiplex PCR Master Mix (Qiagen,

Hilden, Germany), 0.96 µL of the 2x primer mix (Table 2.2.1), 3.04 µL of dH2O, and 1 µL of 25 ng/µL isolate DNA (see above) were combined for 10 uL total into a 96 x 0.2 mL well PCR plate. For each reaction of the 9-plex, 5 uL of 2x QIAGEN Multiplex PCR Master Mix (Qiagen,

28

Hilden, Germany), 2 µL of the 9x primer mix (Table 2.2.1), 2 µL of dH2O, and 1 µL of 25 ng/µL isolate DNA (above) were combined for 10 µL total into a 96 x 0.2 mL well PCR plate.

Both primer mixes used the same PCR thermocycler protocol on an Applied Biosystems Veriti

96-Well Thermocycler (ABI, Foster City, USA): 97 °C initial denaturation for 4 min (1 cycle);

95 °C denaturation for 0.5 min, 54 °C annealing for 1 min, 72 °C elongation for 2 min (34 cycles); and 72 °C final elongation for 10 min (1 cycle). Successful amplification was confirmed by running spot-check samples (8 isolates per plate of 94, as well as negative and positive runs on a 1.2% sodium borate agarose gel with 1 x SYBR Safe DNA gel stain™ (Life Technologies,

Carlsbad, USA), and visualized using a Gel Logic 400 Imaging System (Mandel, Rochester, NY,

USA).

2.2.3.iii Genotyping S. uvarum and statistical analysis of strains

Plates underwent fragment analysis by capillary electrophoresis using Applied Biosystems

DNA Sequencing 3130XL machine (ABI, Foster City, USA). The following results were analyzed using Genemapper v4.0 (ABI, Foster City, USA), where the loci fragments were binned into appropriate allele lengths (Table 2.3.3), based on the repeat motif for each microsatellite locus (Table 2.2.2).

29

Table 2.2.2 Loci information for microsatellites primers and primer sequences.

Primer- Name F; forward, and 5’ to 3’ Primer Sequence and Fluorescent Dye Repeat Chromo R; reverse) (forward) Motif some L2F2 TGCCCTTCTTATTCTTGT-VIC ATT II 2x L2R2 GAAAATATCAACGCATTAAA Primer L9F2 AAAAAGCAACCTTAAAAGCAACA-PET ATT IX Mix L9R2 CTTTACGTAGGCTCATGGCA NB1F1 GTGCTCCATGGACTTGTATGAAGCAA-FAM ATG X NB1R1 GTTCGTTACCTTCAGTGCTC NB4F1 GTGCTCGACATTGTAAAAGCACAGCA-FAM TGT X NB4R1 ACGGGGCTTCTCTAGATATT NB8F1 GTGCTCTGCATGAAAGATTGTAAAGG-FAM TGT XVI NB8R1 TCCACAACGATATCAAGACA NB9F1 GTGCTCAAACAAGAAACTGTGGTCGT-FAM AT XV NB9R1 TGCTTTAATTTCAAGAAACA 9x L1F2 CGTGTTGAAGACATAATTG-FAM GT X Primer L1R2 AATCTGAACGACAGGAAT Mix L3F2 GTATGCATCACTATTTTTCG-FAM TA XI L3R2 AATTTGGTAATTTGAATGTG L4F2 GGACACTAGAGTTCGTCTCG-NED CTG XI L4R2 GCCACCACTATCAGTTCG L7F2 GTAGAATTCACCACAGGTC-NED TC XII L7R2 CCGTATATAAAACAGCACTT L8F2 CACGGCAATCAGCACATTT-NED GTT VIII L8R2 TGAAGTTTCATCATCGGCAA Zhang et al., 20151 Masneuf-Pomarède et al., 20162

Diploid genotypes were comprised of the total eleven microsatellite loci. The package

‘poppr’ v2.8.1 (Kamvar et al., 2014) for R v3.5.1 (R Core Team, 2018) was used for

microsatellite diversity analysis such as for statistical “strain” typing based on Bruvo genetic

distance (Bruvo et al., 2004), where a unique “strain” was defined as having a Bruvo Distance

greater than a threshold value of 0.3, when compared to all other isolates. Any isolates that had a

Bruvo distance below the 0.3 threshold were subsequently classified as the same “strain”. A

Bruvo distance of 0.3 was chosen as a higher minimum to attempt to reduce the number of

30 strains called, as seen from Martiniuk et al., (2016), where a distance of 0.25 was used. An unrooted, neighbour-joined phylogenetic tree was created from the Okanagan strains compared to the commercial strain VELLUTOTM BMV58 as well as the strain CBS 7001, using the package ‘ape’ v5.2 (Paradis and Schliep, 2019) and the function “find.clusters” in the package

‘adegenet’ v2.0.1 (Jombart et al., 2010) used k-means successive clustering for statistical clustering of subpopulations in the tree.

2.2.4 Statistical analysis of diversity and composition for S. uvarum strain populations and fungal species composition

Significant difference between chemical parameters for the treatments was performed using a two-tailed, Student’s t-test using the “t.test” function in the ‘stats’ package of R v3.5.1 (R

Core Team, 2018). The variances were found to be equal or unequal for the t-test as detemerined by a F-test (function “var.stats”). The package ‘vegan’ v2.5-3 (Oksanen et al., 2018) was used for finding the Simpson’s Index of Diversity (1 - D) of the S. uvarum strains and the species community, as well as Bray-Curtis dissimilarity analysis using the function “vegdist” between treatments, and for ordination, specifically for principal coordinate analysis, the function

“wcmdscale” was used for both strain (microsatellite data) and species (high-throughput amplicon sequencing data) analysis. The function ‘aov’ was used for repeated measures ANOVA of the Simpson’s Index of Diversity. When appropriate, a Tukey post-hoc test, with adjusted p- values for multiple comparisons using the Holm method, was performed to discern differences among treatments using the functions “lme” and “glht” in the packages ‘nmle’ v3.1-137

(Pinheiro et al., 2018) and ‘multcomp’ v1.4-8 (Hothorn et al., 2008), respectively. The function

“adonis” was performed for PERMANOVA (permutational multivariate analysis of variance) using the above Bray-Curtis dissimilarity to find significance between the treatments for both the

31

species and strain composition. The package ‘pairwiseAdonis’ (Martinez Arbizu, 2017) was used

for pairwise post-hoc tests with a Holm p-value adjustment for multiple comparisons when

necessary. Not all fermentations stages were able to be compared because at “cold-settling”

before fermentation, no Saccharomyces isolates were found for the culture-dependent strain

analysis, and HTAS showed significantly different results at the start when compared to any

other stage. I then removed the cold-settling stage from statistical analysis at it was obviously

different and decided to only statistically compare “1/3 sugar depletion, “2/3 sugar depletion”,

and “end”.

2.2.5 Experimental design and grape processing for vineyard fungal species comparisons

Four Chardonnay vineyards managed by MHFEW were selected for this project based on

their geographic location, sampling throughout the length of the Okanagan Valley. The vineyards

for the past two years of the project (2016 and 2017) were herbicide-free. The following list

contains the vineyard locations from furthest South to furthest North (Table 2.2.3).

Table 2.2.3 Summary of vineyard collection sites.

Closest Geographic Co-ordinates (Latitude, Date of Sample Number of Vineyard Municipality Longitude) Collection Rows of Vines 2 Osoyoos, BC 49.000603, -119.418712 09-04-17 45 8 Oliver, BC 49.221125, -119.559834 09-18-17 45 15 Naramata, BC 49.665243, -119.646790 10-02-17 11 29 Kelowna, BC 49.785950, -119.540236 09-28-17 13

Each vineyard block was subdivided into sampling sites based on the number of rows of

Chardonnay vines, as well as into “sections” (Figure 2.2.1). One section was defined as the vines

32 in between 4 posts in length. The distance in between 2 posts was about 15 feet apart, so one section with 4 posts in length had a total length equaling around 45 feet. Approximately 5 vines were located between any 2 posts, so that 15 vines in total were sampled between 4 posts.

Sampling occurred at least 3 posts inwards from the edge of each vineyard block and at least 2 rows away from neighbouring blocks to minimize potential contamination from roads and other blocks, respectively. Each sampling site was randomly generated from the sections, and from dividing the rows into groups of 6. The sampling began on the right side of the vineyard (sample

1) and continued left (up to sample 6). The sampling was performed by collecting 30 clusters of grapes per subsample, taking 15 clusters from either side of a lane that ran between 2 rows of vines. The clusters were cut off the vines aseptically, using two pairs of shears flame sterilized after being sprayed with 100% ethanol, and lit with a lighter. The clusters were then placed into a sterile plastic bag, and any clusters that had touched any surface besides the sterile shears

(outside the sterile bag, non-sterile parts of the shears) were discarded. Six replicate subsamples from each vineyard were collected, for 24 subsamples total.

33

34

Figure 2.2.1 Sampling map layouts for Vineyards 2, 8, 15, and 29. Each of the two conjoined red squares represent the generated site of collection for one sample, with the sample number also given at each site. On the horizontal axis, between each line corresponds to the row number of vines, and each vertical line is a lane that is in between the rows of vines. On the vertical axis are the sampling sections, where each horizontal line is a section division. One section between two lines is approximately 15 vines. One section corresponds to 15 vines on either side of the lane, thus 30 vines in total per section were sampled. The vineyard orientation is also shown in the top left corner of each map. Once the samples had been collected from the vineyards, the bags were transported on ice to the University of British Columbia – Okanagan and processed the same day in the BRAES soil laboratory. Each bag had the ~30 clusters inside gently crushed

35 and mixed by hand for ten minutes, then 2 x 1 mL samples of the juice were collected and frozen at -80 °C until future cleaning.

2.3 Results and Discussion

2.3.1 Chemistry and kinetic parameters in winery fermentations

From harvest to the end of fermentation, both treatments (here after shortened from

Vineyard 2 and Vineyard 8 to V2 and V8, respectively) were approximately 40 days in duration.

However, the “CS” period (between when the juice was put into the stainless-steel barrels and the start of the fermentation) was different. For V2, this period only lasted for 2 days, whereas in the case of V8, this period lasted for 8 days. The V2 treatment took 38 days from the start to end of alcoholic fermentation, over a week longer than the V8 treatment that took 29 days (Table

2.3.1). This may suggest a difference in yeast present due to kinetic differences of alcoholic fermentation and the duration of the CS.

Table 2.3.1 Stage of fermentation for wine sampling of both treatments (Vineyard 2 grapes vs.

Vineyard 8 grapes) at MHFEW, with the number of days from harvest taken to reach each stage.

Days from Harvest to Reach Each Stage for Treatments V2 and V8 Stage V2 V8 Harvest (-), 09-05-17 (-), 09-19-17 Cold-settling 2 8 1/3 sugar depletion 16 20 2/3 sugar depletion 25 26 End of fermentation 40 37

36

Wine parameters measured at the CS stage, before the start of fermentation, were significantly different between the two treatments, including pH, residual sugar, yeast assimilable nitrogen, and total SO2 (Table 2.3.2). Similar ethanol concentration, and residual sugars (both glucose and fructose) were seen at the end of fermentation, assuming alcoholic fermentation completion was comparable between treatments. Most other parameters were normal for wine alcoholic fermentation, except an irregular pattern was seen between both treatments and stages for pH.

For V2, the pH was kept consistent at 3.37 between stages. Titratable acidity increased over 40% from the cold-settling stage to end and only 10% of the malic acid was lost. However, V8 started at a pH of 3.31 far below V2 but the pH increased significantly - up to 3.41 - from the cold- settling stage to the end of fermentation (Table 2.3.2). For Vineyard 8, titratable acidity increased less than 10% and nearly 30% of the malic acid was lost for V8. This outcome could suggest that

V8 had microbial deacidification, the most common way for deacidification during alcoholic fermentation (Redzepovic et al., 2003), and that yeast could be responsible since the alcoholic fermentation was still progressing. Considering the high amount of malic acid lost in V8, and the pH significantly increasing at the end of fermentation, the V8 microbes, and potentially yeast, should be different than what was seen in the V2 fermentations.

37

Table 2.3.2 Mean wine sampling data and standard error of the mean (S.E.M) for spontaneous

Chardonnay fermentations in triplicate, of grapes sourced from Vineyard 2 or Vineyard 8, for the cold-settling vs. end of fermentation. Significant difference between treatments is noted by an asterisk across each row by a two-tailed Student’s t-test between treatments (α = 0.05), and the significant difference for pH between stages for only V8 is noted by a dagger.

Stage Wine Chemical Parameters V2 V8 pH* 3.37 ± 0.006 3.31 ± 0.003 Residual Sugar (°Bx)* 22.3 ± 0 22.0 ± 0.033 Yeast Assimilable Nitrogen (mg/L)* 77.7 ± 5.61 110.7 ± 3.93 Cold- Free SO2 (mg/L) 0 0 Settling Total SO2 (mg/L)* 3.0 ± 0 13.3 ± 0.33 Titratable Acidity (g/L)* 5.07 ± 0.033 7.20 ± 0 Malic Acid (g/L)* 2.20 ± 0 3.47 ± 0.033

pH 3.37 ± 0.012 3.41 ± 0.009† Residual Sugar (°Bx) 1.8 ± 0 1.7 ± 0 Free SO2 (mg/L) 0 0 Total SO2 (mg/L)* 23.0 ± 1.53 48.3 ± 1.67 Ethanol Content (%) 11.7 ± 0.10 11.3 ± 0.12 End Volatile Acidity (g/L)* 0.47 ± 3.33 x 10-3 0.38 ± 1.20 x 10-2 Titratable Acidity (g/L)* 7.20 ± 0.15 7.83 ± 0.033 Malic Acid (g/L)* 1.97 ± 0.033 2.40 ± 0.058 Fructose (g/L) 28.9 ± 1.12 27.1 ± 1.64 Glucose (g/L) 1.07 ± 0.13 1.37 ± 0.29

As mentioned previously, both V2 and V8 were treated with 20 ppm SO2 at the CS stage. V2 increased to a total of 23 ppm by the end of the fermentations, whereas V8 increased to total SO2 of 48 ppm, meaning significantly more SO2 must have been produced within the V8 fermentations, again suggesting a difference in yeast present, as varying yeast can produce greatly different amounts of SO2 during fermentation (Henick-Kling and Park 1994).

38

2.3.2 Fungal community composition and diversity in winery fermentations

2.3.2.i S. uvarum is a dominant species in fermentations

The Wallerstein differential medium showed that per fermentation stage, the clear majority (80-90% of the isolates for V2 and nearly 100% for V8) appeared to match the appearance of the S. uvarum control CBS 7001, while a minority of isolates (10-20% for V2 and less than 1% for V8) matched the S. cerevisiae control Lalvin BA11® (Figure 2.3.1).

V 2 V 8 S . c e re v is ia e ) S . u v a ru m

% 1 0 0

(

e

c

n

a

d

n

u b

5 0

A

e

v

i

t

a

l

e R

0

n n n n n n o o o o o o ti ti ti ti ti ti le le ta le le ta p p n p p n e e e e e e d d m d d m r r r r r r a a fe a a fe g g f g g f u u o u u o s s s s 3 3 d 3 3 d / / n / / n 1 2 e 1 2 e

Figure 2.3.1 Percent relative abundance + S.E.M of Saccharomyces (isolated from Wallerstein differential media-dependent) at 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation.

39

The dominance of S. uvarum found from the culture dependent method, was confirmed by culture-independent Illumina high-throughout amplicon sequencing (HTAS) (Appendix A;

Figure 2.3.2). For V2 and V8, using the culture independent method, approximately 97 and 83%, respectively, of the sequenced reads during the fermentation stages (not including CS) were identified as S. uvarum, but S. cerevisiae appeared at an even lower abundance than with the culture dependent method, with ~3% and less than 1% abundance, for V2 and V8, respectively.

40

V 2 V 8 S a c c h a ro m y c e s u v a ru m )

% A s p e rg illu s n ig e r

(

e

c E ry s ip h e n e c a to r n

a A lte rn a ria

d n

u M y c o s p h a e re lla ta s s ia n a b

A C la d o s p o riu m

e v

i H a n s e n ia s p o ra o s m o p h ila

t a

V 2 l V 8

S a c c h a ro m y c e s u v a ru m A u re o b a s id iu m p u llu la n s

e

) R

% A s p e rg illu s n ig e r C a n d id a

(

e E ry s ip h e n e c a to r c P e n ic illiu m . . . . n s M l l d s M l l d e F p p e F p p a p e e n Ap lte rn a ria e e n a P d d e a P d d e Is s a tc h e n k ia o rie n ta lis d r . . r . . g g n / g g / g g d u u d u u u r s s r M y c oss p h ase re lla ta s s ia n a E p ic o c c u m n ig ru m a a b y /3 /3 y /3 /3 e 1 2 e 1 2 A n n C la d o s p o riu m H a n s e n ia s p o ra u v a ru m i i

v v

e v

i H a n s e n ia s p o ra o s m o p h ila S a c c h a ro m y c e s c e re v is ia e

t a

V 2 l V 8 S a c c h a ro m y c e s u v a ru m A u re o b a s id iu m p u llu la n s D id y m e lla c e a e (fa m ily )

e

) R

% A s p e rg illu s n ig e r C a n d id a H a n s e n ia s p o ra g u illie rm o n d ii

(

e

c E ry s ip h e n e c a to r P e n ic illiu m W ic k e rh a m o m y c e s a n o m a lu s . . . . n s M l l s M l l e p p d e p p d

a F F p e e n p e e n R h o d o to ru la m u c ila g in o s a a P d d e a A lte Prn a rida d e Is s a tc h e n k ia o rie n ta lis d r . . r . . g g n / g g / g g d u u d u u U s tila g o h o rd e i u r s s r M y c os s p h sa e re lla ta s s ia n a E p ic o c c u m n ig ru m a a b y /3 /3 y /3 /3 e 1 2 e 1 2 A n n C la d o s p o riu m H a n s e n ia s p o ra u v a ru m M in o r F u n g i i i

v v

e v

i H a n s e n ia s p o ra o s m o p h ila S a c c h a ro m y c e s c e re v is ia e

t a

l A u re o b a s id iu m p u llu la n s D id y m e lla c e a e (fa m ily ) e

R C a n d id a H a n s e n ia s p o ra g u illie rm o n d ii V 2 V 8 P e n ic illiu m W ic k e rh a m o m y c e s a n o m a lu s M in o r F u n g i s l. l. s l. l. ) e M p p d e M p p d F e e n F e e n p P e p P e Is s a tc h e n k ia o rie n ta lis R h o d o to ru la m u c ila g in o s a a d d a d d % r . . r . . 100 U s tila g o h o rd e i /g g g /g g g ( d u u d u u E p i c o c c u m n ig ru m U s tila g o h o rd e i r s s r s s a a e y /3 /3 y /3 /3 e 1 2 e 1 2 c M in o r F u n g i R h o d o to ru la m u c ila g in o s a in in H a n s e n ia s p o ra u v a ru m

v v n

S a ca c h a ro m y c e s c e re v is ia e W ic k e rh a m o m y c e s a n o m a lu s d

D id y m e lla c e a e (fa m ily ) n

u H a n s e n ia s p o ra g u illie rm o n d ii H a n s e n ia s p o ra g u illie rm o n d ii b 50

W icA k e rh a m o m y c e s a n o m a lu s D id y m e lla c e a e (fa m ily )

R h oe d o to ru la m u c ila g in o s a v

i S a c c h a ro m y c e s c e re v is ia e

U s tt ila g o h o rd e i a

M inl o r F u n g i H a n s e n ia s p o ra u v a ru m e

R E p ic o c c u m n ig ru m

Is s a tc h e n k ia o rie n ta lis . . . . s S l l d s S l l d e C p p n e C p p n p e e e p e e e P e n ic illiu m a d d a d d r r r r r r g a a g a a 2 g g 8 g g C a n d id a d u u d u u r s s r s s a 3 3 a 3 3 y / / y / / e 1 2 e 1 2 A u re o b a s id iu m p u llu la n s in in V V H a n s e n ia s p o ra o s m o p h ila

C la d o s p o riu m Figure 2.3.2 Relative abundance of Illumina sequence reads for the most abundant species in the M y c o s p h a e re lla ta s s ia n a

winery fermentations at all four stages of fermentation: cold-settling (CS), 1/3 sugar depletion, A lte rn a ria

2/3 sugar depletion, and end of fermentation, as well as the most abundant species from grapes of E ry s ip h e n e c a to r

each corresponding vineyard. For all winery treatments and stages n = 3, except for V8 - CS, A s p e rg illu s n ig e r

S a c c h a ro m 41 y c e s u v a ru m which was n = 2. For the vineyard samples, Vineyard 2 had n = 5, and Vineyard 8 had n = 6. grey, labelled ‘Minor fungi’.

From both the culture-dependent and independent methods, I then accepted Hypothesis

1a that S. uvarum would be the dominant species isolated during fermentation and S. cerevisiae would be a non-dominant species. I hypothesized that S. uvarum would be the dominant species because our fermentations were conducted, and kept in the same cellar under the same conditions as those in 2015 (Morgan and Durall, unpublished), where S. uvarum started fermentation at 12

°C, and was dominant throughout all of the spontaneous fermentation stages. As in previous studies, S. uvarum has recently been shown to out-compete S. cerevisiae in mixed culture fermentations that were conducted at 12 °C (Su et al., 2019), and in a study from Alsace, S. uvarum dominated cellar fermentations for three consecutive years also at 12 °C (Demuyter et al., 2004).

2.3.2.ii Overall community composition and species diversity in fermentations

In both treatments, the fungal composition at CS did not resemble that of grapes from the vineyard; however, fungal composition between vineyards showed similarities in the form of the plant pathogens Erysiphe necator, Alternaria spp., and Mycosphaerella tassiana (Figure 2.3.2).

These three species were very abundant in both vineyards, but Vineyard 8 showed far greater evidence of Erysiphe necator infection. Despite appearing similar, Vineyard 2 and 8 did end up being significantly different in fungal composition (p = 0.015, α = 0.05; Table 2.3.12). The vineyard compositions were a vast contrast to the fungal composition in the winery fermentations, and even to the CS stage (Fig. 2.3.2), even in the case of V2, where the CS stage was sampled only 3 days after I had sampled the Vineyard 2 berries (Table 2.3.1). V8 treatments 42 had been sitting at the CS stage for nearly a week longer than the V2 treatments, leading to a completely different fungal profile than V2 with a very high abundance of Saccharomyces spp., especially S. uvarum. In the V8 treatment, S. uvarum had the 2nd highest percent relative abundance (15%) at the CS stage, which was extended to 8 days, and alcoholic fermentation had still not even begun (Table 2.3.2; Figure 2.3.2). The V8-CS stage was held at 4 °C, which also shows how S. uvarum is psychrotrophic with the ability to show high abundance in the juice even at this very low temperature. The relative high abundance of S. uvarum prior to alcoholic fermentation in the V8 treatment, as well as the ability to quickly dominate at an early stage of

1/3 sugar depletion in all fermentations, lends credence to a population that resides in the MHFE winery year to year, especially when this treatment had a substantially longer exposure to the winery environment at this cold-settling stage before alcoholic fermentation had even begun than did the V2 treatment. A resident winery population of S. uvarum is in line with previous literature, as a resident population was present in spontaneous fermentations of wine in an

Alsatian winery for three consecutive years (Demuyter et al., 2004). The most dominant species during the CS stage in the V8 fermentation were Candida spp. (~25% relative abundance) whereas in the V2 treatment, Aspergillus niger (at 60% relative abundance) was the dominant species.

The 2nd most dominant species in the V8 treatment, Hanseniaspora osmophila (at an average of just under 15% relative abundance for all fermentations stages, even including CS), was surprising because it did not appear at any noticeable abundance for V2, nor did it appear at all in the culture-dependent analysis of both treatments (Figure 2.3.1). H. osmophila does appear to have high-ethanol tolerance nearing 10% (v/v) (Granchi et al., 2002) and Hanseniaspora spp. in general have been shown to appear in wine with up to 12% (v/v) ethanol (Morgan et al.,

43

2019). Both treatments ended at around 11% ethanol (v/v) (Table 2.3.2), suggesting that the H. osmophila is not dead, but rather has possibly entered a VBNC (viable, but not culturable) state.

The genus Hanseniaspora has been documented to undergo a VBNC state in mixed- fermentations with Saccharomyces sp. (Morgan et al., 2019; Wang et al., 2016). Hanseniaspora spp. have been shown to decrease in abundance as SO2 increases; and at 40 ppm SO2,

Hanseniaspora spp. had less than 5% relative abundance in Okanagan Pinot gris fermentations

(Morgan et al., 2019). At the end stage of my V8 fermentations with over 40 ppm SO2, surprisingly, H. osmophila was seen at nearly triple the abundance as seen from Morgan et al.,

(2019), and curiously was not seen in the V2 fermentations with the lower SO2 of 23 ppm (Table

2.3.2). These results show strikingly different fungal compositions between fermentations that differ in length of CS and grape origin, with different chemical parameters of the juice. A

PERMANOVA comparing the two treatments was performed on the species composition at the

1/3 sugar depletion, 2/3 sugar depletion and end fermentation stages, confirming a difference in composition between the two treatments (degrees of freedom (D.f) = 17, p < 0.001; Table 2.3.3).

This difference was very likely due to H. osmophila in the V8 fermentations, but not in the V2.

44

Table 2.3.3 One-way PERMANOVA for the species composition between the treatments (V2 and V8), as well as between fermentation stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation. Results are based on 999 unrestricted permutations of raw data.

Significance is marked by an asterisk (α = 0.05). D.f = degrees of freedom.

Fungal species composition PERMANOVA D.f Sum of Squares Mean Square F-stats p-value Grape Origin (Treatment) 1 0.112 0.112 18.1 0.001* Residuals 16 0.099 6.20 x 10-3 - - Total 17 0.211 - - - Stage 2 5.90 x 10-3 2.95 x 10-3 0.215 0.840 Residuals 15 0.205 0.137 - - Total 17 0.211 - - -

Based on the principal coordinate analysis (PCoA) between V2 and V8 fungal composition, the

V8 treatment at the 1/3 sugar depletion, 2/3 sugar depletion, and end stages showed higher variability than that in the V2 treatment (Figure 2.3.3). This again illustrates the difference in fungal composition between the two treatments and that even in the same vintage, factors such as the winery environment can cause significant differences between spontaneous fermentations, as evidenced by the huge variability in V8 replicates, where V2 had nearly no difference between replicates.

45

Figure 2.3.3 Principal coordinates analysis (PCoA) ordination comparing treatments V2 (blue) fungal composition against V8 (orange). Each point represents one of replicate barrel (n = 3) at the three fermentation stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation. Dimension 1 explains 80% of the total variation, and Dimension 2 explains 4.5%.

In the case of species diversity, V8 had an average Simpson’s Index of Diversity of around 0.27, far greater than V2, which had an average of 0.06 (Table 2.3.4). However, even though H. osmophila was seen in such a large abundance in Vineyard 8, and hardly seen in

Vineyard 2, there still was no significant difference in Simpson’s Index of Diversity between treatments (D.f = 5, p < 0.06; Table 2.3.5). There was no difference in fungal species diversity between the three stages of fermentation and between the two treatments, although there were

46 differences in species composition between the two treatments, with one species (S. uvarum) clearly dominating both treatments (Table 2.3.5).

Table 2.3.4 Simpson’s Index of Diversity (1 – D) with S.E.M for species composition of each treatment (n = 3) at the stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation.

Simpson’s Index of Diversity (1 - D) ± S.E.M of fungal species Fermentation Stage Vineyard 2 Vineyard 8 1/3 sugar depletion 0.064 ± 4.99 x 10-3 0.210 ± 8.96 x 10-2 2/3 sugar depletion 0.061 ± 8.53 x 10-3 0.309 ± 3.92 x 10-2 end 0.061 ± 9.45 x 10-3 0.302 ± 0.125

Table 2.3.5 Repeated measures ANOVA of species diversity (Simpson’s Index of Diversity, 1 -

D) from Table 2.3.4, looking at the difference in treatment (n = 3), using 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation stages as repeated measures. There was no significant difference between species of each treatment (p = 0.06, α = 0.05). D.f = degrees of freedom.

Fungal Species Diversity ANOVA D.f Sum of Squares Mean Square F-value p-value Grape Origin (Treatment) 1 0.202 0.202 6.483 0.064 Residuals 4 0.125 0.031

I then rejected Hypothesis 1-b that V2 and V8, which differ in their vineyard origin yet are present in the same winery during the same vintage, will have similar species composition and relative abundance during the stages of alcoholic fermentation, but accepted that the

47 diversity between treatments was similar. All stages, including CS, ended up being significantly different between treatments for species composition; however, the diversity measure was not significantly different for the 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation stages likely due to the dominance of S. uvarum in both treatments, and the many minor species that were found in both treatments (Appendix A). Many additional factors, including differences in juice chemical parameters and length of cold-settling, could have contributed to these differences, as grape origin was not the only difference between treatments. Because the fungal composition of the grapes and at the CS stage were strikingly different between the two treatments, it illustrates that the winery environment factors have a stronger influence on the yeast species composition than does the grape origin, which is in line with previous studies

(Ciani et al., 2004; Díaz et al., 2013; Grangeteau et al., 2016).

2.3.3 Development and implementation of a S. uvarum multiplex microsatellite method

I was able to multiplex nine of the microsatellite loci primer sets together whereas two of the eleven loci had to be multiplexed separately; even so, multiplexing nine loci was a first in S. uvarum microsatellite genotyping. Isolates that presented a green colour on WL medium all amplified using the 11x S. uvarum microsatellite loci primers, confirming the green isolates as S. uvarum, whereas isolates that presented as a cream colour on WL medium (S. cerevisiae) did not amplify with the eleven S. uvarum microsatellite loci primers, except for one primer pair (NB8) at a fragment length of 293 bp, far outside of the range in S. uvarum (Table 2.3.6), confirming that ~90% of the primers were specific to S. uvarum and would not amplify with S. cerevisiae. I discovered, after running the 11x microsatellite loci genotype analysis on 576 S. uvarum isolates,

240 different multi-locus genotypes (MLGs). The number of alleles found for each locus, as well

48 as the sizes of the alleles of each microsatellite locus, are shown in Table 2.3.6. After applying the Bruvo Distance threshold of 0.3, the S. uvarum isolates were reduced to 56 representative, unique “strains” from the original 240 MLGs (Appendix B).

Table 2.3.6 Eleven microsatellite loci for the Okanagan S. uvarum strains with the allele sizes (in base pairs) and number of different alleles found.

Primer Pair Number of Alleles Allele Sizes NB1 3 206/209/212 NB4 3 335/344/350 NB8 3 412/439/448 NB9 3 88/114/122 L1 3 163/165/167 L2 4 284/287/296/299 L3 4 214/218/224/228 L4 4 300/306/318/339 L7 4 259/267/269/273 L8 5 208/211/214/220/247 L9 13 172/181/217/220/265/271/274/ 277/280/283/286/289/316

The three alleles of the NB primers are comparable to the number of alleles and sizes in

New Zealand S. uvarum (Zhang et al., 2015), except NB1 and NB9, which possess an extra allele size each (209 and 122 bp, respectively) for the Okanagan isolates. The L primers show slightly greater variability with most of the Okanagan microsatellites having four alleles, except L9, which I found to have thirteen different allelic possibilities. This is less than the isolates of

Masneuf-Pomarède et al., (2016), where L9 had sixteen alleles, although those isolates were again found world-wide and would likely contain more diversity than the distinct geographic area of the Okanagan Valley. The other L microsatellites had allele numbers also less than what was found previously by Masneuf-Pomarède et al., (2016). Interestingly, for microsatellites L8 49 and L9, the Okanagan isolates had allele sizes that were far larger and well out of the range of what was previously reported. For L8, the largest allele size previously was 225 base pairs (bp)

(Masneuf-Pomarède et al., 2016) while I found an allele at 247 bp. For L9, the largest allele size was 284 bp (Masneuf-Pomarède et al., 2016) while I found an allele at 316 bp. I also found most of our alleles, besides NB1, varied slightly from what was seen in the studies of Zhang et al.,

(2015), Masneuf-Pomarède et al., (2007), and Masneuf-Pomarède et al., (2016), but the changes were within one repeat motif. This variation was likely due to differences in the measurement of fragment size, and/or different software used to calculate fragment size and/or error associated with allele bin calling. Excitingly, our allele results suggest that I have genotypically unique S. uvarum strains from the Okanagan Valley as compared with isolates found in other parts of the world.

The 240 genotypes and 56 different strains found in this study were magnitudes greater than that found by Zhang et al., (2015). This previously conducted study from New Zealand on

S. uvarum in spontaneous Sauvignon Blanc fermentations found only 10 genotypes, which all had homozygous microsatellite alleles. Surprisingly, the number of strains with at least one loci of heterozygosity in our S. uvarum population (23 out of 56 strains, 41%) was also much higher compared with that found by Masneuf-Pomarède et al., (2016) and Zhang et al., (2015), where the strains sampled in both studies found were about 25% heterozygous, meaning that the

Okanagan strains had a greater degree of heterozygous variability. The unexpected high number of genotypes and unique alleles, as well as the findings reported in my study (at MHFEW in

2017) and in a previous study (at MHFEW in 2015) that S. uvarum dominated Chardonnay fermentations, support the idea of a cellar population, unique to the Okanagan Valley, that has developed slowly over time at this winery but has come to dominate uninoculated fermentations.

50

To put the MHFEW S. uvarum population that I found in perspective with those isolated from other parts of the world, I constructed a phylogenetic tree that included additional

Holoarctic strains: 1) CBS 7001, which is the natural, S. uvarum standard from Spain; 2)

VELLUTO BMV58TM, which also originated from Spain and is the only commercially available strain of S. uvarum; 3) CBS 395, which is the first strain of S. uvarum ever isolated, as mentioned in the introduction of this thesis, and 4) strains PYCC 6860 and PYCC 6861

(Portuguese Yeast Culture Collection, Caparica, Portugal), also known as ZP 555 and ZP 556, respectively (Almeida et al., 2014), which are two strains isolated from Quercus trees on Hornby

Island, British Columbia, Canada (Figure 2.3.4; Appendix B). The phylogenetic tree shows four clusters through k-means clustering, each with strains from the 2017 vintage; however, some of the clusters also contained the strains found around the world. Group A contained both CBS

7001 and BMV58TM, as well as containing Su. 103, one of the top five strains from the 2017 vintage, and other MHFEW strains (Figure 2.3.5). Group B contained the strain CBS 395, and appeared genotypically different from the other clusters while also containing some of the

MHFEW strains yet this cluster did not possess any dominant strains. The most dominant strain from the 2015 vintage (Morgan and Durall, unpublished) matched the genotype Su.58 from the

2017 vintage, which was found in Group B; however, Su.58 was not a dominant strain in 2017 and only appeared as the 7th most abundant in the 2017 vintage (Appendix A). Group C uniquely appears to be the only grouping that does not contain any world strains, and even possessed two of the most dominant strains, Su.102 and Su.160, even though Group C was more genetically similar to some of the world strains such as CBS 7001 and BMV58TM. Nevertheless, Group D contained the two other dominant strains (Su.13 and Su.79), and was possibly the most genetically isolated, as it was the cluster that contained the two Hornby Island strains, especially

51

PYCC 6861, which appeared very close to both Su.13 and Su.79 genetically. These PYCC strains are not associated with the winery environment and appear as natural S. uvarum isolates in Canada lacking the introgressions seen in many European wine-associated strains (Almeida et al., 2014), although this is consistent with literature that shows there is mixing between natural and fermentation-derived S. uvarum strains (Masneuf-Pomarède et al., 2016). The tree also shows clustering that does not follow the actual dendrogram assignments, meaning that I have a panmictic population showing some random mating events, where the MHFEW strains are not completely distinct subpopulations. Our tree shows that I have some strains that are the same

“strain” as in previous collections, for example, with a threshold Bruvo Distance minimum of

0.3, {PYCC 6861 and Su.69} would be considered the same strain, as would {PYCC 6860 and

Su.78}; {BMV58 and Su.164, Su.238}; and{CBS 7001 and Su.17}.

52

Figure 2.3.4 Unrooted phylogenetic tree using Bruvo distance for the 56 S. uvarum strains from the 2017 vintage, as well as S. uvarum strains CBS 7001, Spain; BMV58TM, Spain; CBS 395,

Netherlands; PYCC 6860, Hornby Island, Canada; and PYCC 6861, Hornby Island, Canada. A

Bruvo distance of 0.05 is shown for scale. The top 5 most abundant strains found from the 2017 vintage are circled (Su.13, Su.79, Su.102, Su.103, and Su.160; Figure 2.3.2), and k-means clustering differentiated four subpopulations: Group A, red; Group B, orange; Group C, blue;

Group D, green.

53

I can then accept Hypothesis 2 that a population of S. uvarum that appears indigenous specifically to the cellar of MHFEW in the Okanagan Valley has been identified. Even though a few Mission Hill strains match these genotypes from previous databases, I demonstrated here that most of the strains from the 2017 vintage are genetically distinct from previously identified

S. uvarum strains (Masneuf-Pomarède et al., 2016). Furthermore, the five most abundant strains

(Su.13, Su.79, Su.102, Su.103, and Su.160) isolated were distinctly unique at the microsatellite level from strains in previous literature (Appendix B). The uniqueness of these strains augment my unexpected finding that the Okanagan S. uvarum population is more genetically diverse than that reported in the literature (Zhang et al., 2015; Masneuf-Pomarède et al., 2016).

2.3.4 Genetic diversity in winery fermentations

2.3.4.i A relatively low number of S. uvarum strains co-dominate fermentations

Of the 56 S. uvarum strains, just five (Su.13, Su.79, Su.102, Su.103, and Su.160) comprised about 50% of the total population, and Su.13 was the most abundant strain in both treatments at ~18% relative abundance. (Figure 2.3.5; Appendix C). The five strains were present in both treatments, nevertheless, 2 of the 5 dominant strains (Su.79 and Su.103) were variable in their relative abundance between the treatments. Su.79 made up ~13% of the V2 relative abundance, however, it appeared only as a single isolate in V8. Contrarily, Su.103 made up 13% of the V8 relative abundance, while it consisted of < 1% of the V8 abundance. Twenty percent, or 11 of the 56 strains, only appeared once throughout the fermentations during the 2017 vintage (Appendix C).

54

S u .1 3 1 0 0 S u .1 6 0

) S u .7 9

%

(

e S u .1 0 3

c n

a S u .1 0 2

d n

u M in o r b

A 5 0

e

v

i

t

a

l

e R

0 V 2 V 8

Figure 2.3.5 Relative abundance and S.E.M of the S. uvarum strains found in both treatments

(V2 and V8), with the fermentation stages combined. 5 strains (Su.13, dark-blue; Su.160, purple;

Su.79, orange; Su.103, light-blue, and Su.102, green) made up approximately 50% of the total abundance of strains. The other 51 out of the 56 total strains are given the title ‘Minor’, grey.

Hypothesis 3-a can be accepted as our results were similar to those in Zhang et al.,

(2015), where only a small number of strains were dominant, but with multiple genotypes present in each of the different fermentations and many strains only appeared as a single isolate; however, in the MHFEW fermentations, fewer than five strains per treatment were seen together as co-dominant whereas for Zhang et al., (2015), there was clearly one major strain present per fermentation.

55

2.3.4.ii Strain composition and diversity in fermentations

A PERMANOVA analysis (D.f = 17, p < 0.001; Table 2.3.7) demonstrated that strain composition was significantly different between the treatments. The difference can be explained by the difference in Su.79 and Su.103 among the treatments and fermentation stages and the high number of strains (51 of 56) that appeared only once during the 2017 vintage. There was no significant difference between fermentation stages at 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation (D.f = 17, p = 0.964; Table 2.3.7), suggesting that the S. uvarum strain composition is established in the early stages of fermentation, and will remain consistent from the beginning until the end of alcoholic fermentation. From the principal coordinates analysis ordination of Figure 2.3.6, the variability of the replicates in the two treatments appears similarly dispersed and does not overlap in terms of strain composition between the two fermentation treatments.

Table 2.3.7 One-way PERMANOVA for the S. uvarum strain composition between the treatments (V2 and V8), as well as between fermentation stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation. Significance is marked by an asterisk (α = 0.05). D.f = degrees of freedom. Results are based on 999 unrestricted permutations of raw data.

Strain Composition PERMANOVA D.f Sum of Squares Mean Square F-stats p-value Vineyard (Treatment) 1 0.741 0.741 7.42 0.001* Residuals 16 1.598 0.099 - - Total 17 2.34 - - - Stage 2 0.145 0.073 0.496 0.964 Residuals 15 2.19 0.146 - - Total 17 2.34 - - -

56

V2

V8

Axis 12% = 2 explained

Axis 1 = 23%

explained Figure 2.3.6 Principal coordinates analysis (PCoA) ordination comparing S. uvarum strain composition between the two fermentation treatments. Each point represents one replicate barrel

(n = 3) at the three fermentation stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation. Dimension 1 explains 23% of the total variation, and Dimension 2 explains 12%.

The following additional factors, besides the treatment of vineyard origin, could also have influenced differences in strain composition. For example, treatments did occur at separate yet overlapping times during the 2017 vintage (Table 2.3.1), where V2 started fermentation three weeks prior to the start of V8 fermentation. The fermentation treatments differed significantly in juice chemical parameters, as previously discussed, at the cold-settling stage of the fermentations

(Table 2.3.2). Although all of the top 5 strains were present in both treatments, two of the top five strains (Su. 79 and Su.103) were present in significantly different abundances for each treatment. This was a likely a major cause for the significant difference between the populations

57 of each treatments, as well as over 35% of the 56 strains were found in only one of the two fermentation treatments (Appendix C). Overall, the Simpson’s Index of Diversity remained very low around 0.1 for all stages and between both treatments, meaning there wasn’t just one strain that was dominating the fermentations (Table 2.3.8), and there was no significant difference between the diversity of the treatments (D.f, = 16, p < 0.871; Table 2.3.9). As mentioned previously, I found 5 strains that could be considered dominant by accumulating to 50% of the total isolate identities.

Table 2.3.8 Simpson’s Index of Diversity (1 – D) with S.E.M for S. uvarum strain composition of each treatment (n = 3) at the stages of 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation.

Simpson’s Index of Diversity (1 - D) ± S.E.M for S. uvarum strains Fermentation Stage V2 V8 1/3 sugar depletion 0.112 ± 2.31 x 10-2 0.085 ± 8.31 x 10-3 2/3 sugar depletion 0.111 ± 2.58 x 10-2 0.121 ± 1.67 x 10-2 end 0.126 ± 2.71 x 10-2 0.130 ± 3.68 x 10-2

Table 2.3.9 Repeated measures ANOVA of S. uvarum population strain diversity (Simpson’s

Index of Diversity, 1 - D) from Table 2.3.4, looking at the difference in treatment (n = 3), using fermentation stage as the repeated measure (α = 0.05). D.f = degrees of freedom.

Strain Diversity ANOVA D.f Sum of Squares Mean Square F-value p-value Grape Origin (Treatment) 1 4.70 x 10-5 4.66 x 10-5 0.027 0.871 Residuals 15 2.55 x 10-2 1.70 x 10-3

58

I then rejected Hypothesis 3-b that V2 and V8, with a difference of grape origin, had similar S. uvarum strain composition, for reasons resembling the rejection of Hypothesis 1-b, as treatments were significantly different, this time, in strain population instead of species composition. I accepted that the diversity between treatments was similar as it was again not significantly different between treatments. Although Zhang et al., (2015) found only one truly dominant strain in each of their fermentations, I found co-dominance between 5 strains for total abundance, and that our most dominant strain was similar in abundance for both treatments, yet the 2nd most dominant strain for either V2 or V8 had significantly different relative abundances between treatments. Again, the diversity measure was not significantly different for the 1/3 sugar depletion, 2/3 sugar depletion, and end of fermentation stages likely due to the co-dominance of only 5 of 56 S. uvarum strains, and the many minor strains that were found in both treatments

(Appendix C). As mentioned previously, many additional factors, including differences in juice chemical parameters and length of cold-settling, could have contributed to these population differences, as grape origin was not the only difference between treatments, and as mentioned previously, grape origin is likely not a major factor that influences the yeast populations as evident through one study of S. uvarum populations in vineyards versus the winery environment which found that the populations were completely different (Demuyter et al., 2004).

2.3.5 Fungal community composition and S. uvarum presence in vineyards

2.3.5.i S. uvarum identified in all four Okanagan valley vineyards

Using sequence reads as a measure of relative abundance, Vineyard 2 (n = 5) had S. uvarum reads at an average relative abundance of 2.6%, Vineyard 15 (n = 6) was at 3.9%,

Vineyard 29 (n = 5) at 3.8%, but Vineyard 8 (n = 6) was less than 0.3% (Appendix D). These average relative abundance numbers also include a large amount of variation for each vineyard, 59 meaning that only 1, or possibly 2, of the total 5 or 6 subsamples actually contained S. uvarum.

Some of the grape clusters were picked may have included damaged berries, which would explain the number of reads of S. uvarum in only some of the subsamples as Saccharomyces is often found in damaged berries (Mortimer and Polsinelli 1999). However, this result does confirm the presence of S. uvarum in all sampled vineyards from Kelowna to Osoyoos, indicating its presence throughout the Okanagan Valley wine region. Since the vineyards are the source of grapes, and for each vintage, vineyard yeast are brought into MHFEW on the grapes, over time, S. uvarum may have immigrated from the Okanagan vineyards into MHFEW, establishing a resident population. However, prior to becoming a winery, MHFEW was used for cider production, where S. uvarum has been noted for its association with cider fermentations

(Almeida et al., 2014; Masneuf-Pomarède et al., 2016). It is possible the resident population of S. uvarum may have began to establish itself during this period of time. I can accept Hypothesis 4-a that S. uvarum will be identified in at least one of the vineyards surveyed in the Okanagan

Valley, since I actually found it in all four vineyards, which spanned the North-South boundaries of Okanagan Valley wine region.

2.3.5.ii Fungal species composition and diversity in vineyards.

Species diversity in the vineyard appeared to increase with vineyard size, but it decreased with higher latitude (Appendix D; Table 2.3.10). Vineyard 2 (Osoyoos) had the highest diversity, while Vineyard 29 (Kelowna) had the lowest. Vineyard 2 and Vineyard 8 were much larger vineyards (Figure 2.2.1; Table 2.2.3), with many more rows (both 45) than Vineyard 15 and 29

(both less than 15), which could explain why there was greater diversity in larger vineyards.

Oddly, the error between replicate sub-samples within each vineyard tended to increase with decreasing vineyard size and increasing latitude (Table 2.2.3; Table 2.3.10).

60

Table 2.3.10 Simpson’s Index of Diversity (1 – D) with S.E.M for species composition of each vineyard (Vineyard 2 and 29, n = 5; Vineyard 8 and Vineyard 15, n = 6) on the grapes and juice after crush.

Vineyard Simpson’s Index of Diversity (1 - D) ± S.E.M 2 0.848 ± 2.65 x 10-2 8 0.686 ± 4.79 x 10-2 15 0.532 ± 7.24 x 10-2 29 0.428 ± 0.135

The only vineyard that had significantly different species diversity was Vineyard 2 compared with Vineyard 15 and 29, but not compared to Vineyard 8 (Table 2.3.11). Vineyard 2 was the earliest vineyard to be sampled in the season, nearly a month before Vineyards 15 and 29 (Table

2.2.3); this temporal effect could explain the difference in diversity. However, Vineyard 8 was still sampled two weeks after Vineyard 2 (Table 2.2.3), meaning that the fungal species diversity is unlikely to be influenced by just one main factor, but rather multiple factors, where geographic distribution, temporal effects, and vineyard size could all play influential roles.

61

Table 2.3.11 Post-hoc Tukey test on fungal diversity of Table 2.3.10 on the grapes and juice after crush of two vineyards in pairs out of the total of four vineyards: 2, 8, 15, and 29. Vineyard

2 and 29, n = 5; Vineyard 8 and Vineyard 15, n = 6. An asterisk marks significantly different diversity between vineyards (α = 0.05).

Grapes fungal diversity post-hoc Tukey test Vineyards comparisons Holm adjusted p-value 29 – 15 0.429 2 – 15 0.022* 8 – 15 0.429 2 – 29 0.002* 8 – 29 0.076 2 – 8 0.429

Vineyard 2 and 8 were significantly different in their fungal composition (Table 2.3.12), even though they appeared similar when compared to the winery populations (Figure 2.3.5), whereas the grouping between Vineyard 15 and 29 was not significantly different (Table 2.3.12).

Table 2.3.12 Pairwise PERMANOVA of fungal composition on the grapes and juice after crush of two vineyards in pairs out of the total of four vineyards: 2, 8, 15, and 29. Vineyard 2 and 29, n

= 5; Vineyard 8 and Vineyard 15, n = 6. An asterisk marks significantly different diversity between to vineyards (α = 0.05). Results are based on 999 unrestricted permutations of raw data.

Pairwise PERMANOVA on grape fungal composition for the four vineyards Vineyard comparisons R2 F-model Holm adjusted p-value 29 – 15 0.314 4.12 0.079 2 – 15 0.357 5.00 0.012* 8 – 15 0.429 7.51 0.015* 2 – 29 0.645 14.6 0.016* 8 – 29 0.741 25.7 0.015* 2 – 8 0.479 8.28 0.015*

62

As seen in the PCoA plot, grouping of fungal composition was closest between Vineyards

2 and 8 when compared to the grouping of Vineyard 15 and 29 (Figure 2.3.7). There was also high variation between replicates belonging to Vineyard 15, and a large variation for Vineyard 2 as well, suggesting that within certain vineyards themselves, often the fungal composition is non- homogenous (Figure 2.3.7). Therefore, the majority of vineyards sampled throughout most of the

Okanagan Valley wine region had significantly distinct fungal compositions with insignificant differences in diversity, meaning the pattern of diversity with many species present in the vineyards was very similar amongst most of the vineyards, with only Vineyard 2 differing in terms of diversity compared to the diversity of both Vineyards 15 and 29. Vineyards 15 and 29 appeared to have fewer reads for most species present in comparison to Vineyard 2, thus were dominated by only a select few species compared to Vineyard 2, which had many species in high abundance for co-dominance (Appendix D).

63

Figure 2.3.7 Principal coordinates analysis (PCoA) ordination comparing fungal composition on grapes from four vineyards across the Okanagan Valley: Osoyoos Vineyard 2, blue; Oliver

Vineyard 8, orange; Naramata Vineyard 15, green; Kelowna Vineyard 29, purple. Each point represents one of replicate subsamples of grapes throughout the vineyard (n = 5, Vineyards 2 and

29; n = 6, Vineyards 8 and 15). Dimension 1 explains 46% of the total variation, and Dimension

2 explains 18%.

I can then accept Hypothesis 4-b that most vineyards will have different fungal species composition on their grapes, as I found that there were significant differences in pairwise comparisons for the four vineyard fungal compositions, except for one pairwise comparison

(Vineyard 29 – 15). This follows the literature (Bokulich et al., 2016; Miura et al., 2017) that geographical separation between vineyards will significantly influence fungal composition,

64 although the temporal effect of different harvest dates and the different vineyard sizes could also all play a part in the significant difference seen between vineyards. I rejected that different diversity measures between vineyards were seen, as the majority of pairwise comparions between the four vineyard were non-significant, except for Vineyard 2 compared to both

Vineyard 15 and 29.

65

3 Conclusion

3.1 Summary

In spontaneous, low-temperature (12 °C) alcoholic fermentations I found that S. uvarum dominated over all other fungal species (S. cerevisiae) even when the grape origin, juice chemistry, cold settling time, and fermentation start date differed between the fermentation treatments. This result was confirmed by both culture-dependent Wallerstein differential medium and by culture-independent HTAS, where S. uvarum had a relative abundance of yeast species during fermentation of at least 90%, and at least 80%, respectively for each method. There was no significant difference in S. uvarum strain population and species composition due to fermentation stage once alcoholic fermentation had begun; however, completely different species were present between treatments at the cold-settling stage of the fermentations, and from cold- settling compared to what was on the grapes directly from the vineyard. Even though both treatments (V2 vs. V8) were present in the same cellar, they produced significantly different species compositions, yet the diversity measured for both species was similar. Given that the winery fermentations at the cold-settling stage of the fermentations appeared completely different between the two treatments, and that the grapes from both vineyards showed a completely different yeast species profile than what was seen in the winery, it appears that the winery environment plays a far greater influence on S. uvarum in the fermentations than the vineyard environment does, as well, that this winery appears to have a residing population of S. uvarum that appears throughout both fermentations during the 2017 vintage.

For the first time, the extent of genetic diversity found in S. uvarum in the Okanagan Valley of Canada was found by using a novel, 11x microsatellite fingerprinting technique that was streamlined by splitting the reactions down into a 9x and a 2x microsatellite loci PCR

66 multiplexes. This microsatellite genotyping method identified an unexpectedly large number of strains, especially heterozygous strains, compared to strains found in previous literature, as well as the presence of alleles of S. uvarum not seen in any other S. uvarum world-wide to date, except at this winery in the Okanagan Valley. A phylogenetic tree suggests that some of the strains discovered are unique and indigenous to the Okanagan.

Of the 56 S. uvarum strains, just five made up 50% of the total population. The five strains were present in both treatments, nevertheless, 2 of the 5 dominant strains were variable among the treatments, and 20% of strains only appeared once throughout a particular stage of the fermentations, leading to significantly different strain compositions during alcoholic fermentation. There was no difference between diversity of the treatments nor between the stages of 1/3 sugar depletion, 2/3 sugar depletion, and the end of fermentation, suggesting the strain composition and diversity is established right at the 1/3 sugar depletion stage and it remained consistent until the end of fermentation.

All four vineyards across the Okanagan Valley wine region had S. uvarum present on the grapes in higher than anticipated abundance (an average of just under 3% abundance across the four vineyards), and the majority of vineyard comparisons were significantly different in terms of species composition, including all Vineyard 2 and Vineyard 8 pair-wise comparisons, whereas only the comparison between Vineyard 15 and 29 was not significant. However, most of the species diversity was not different between the different vineyards, except for Vineyard 2 which had significant diversity difference compared to Vineyard 15 and 29.

The results of this thesis show that S. uvarum can dominate spontaneous Okanagan

Chardonnay fermentations at 12 °C, and appear as a unique population to the Okanagan Valley.

Although we had higher genetic diversity of the S. uvarum strains than that reported in the

67 literature would suggest, only a small number of strains were dominant as hypothesized. This species is also found on Chardonnay grapes in vineyards throughout the Okanagan Valley wine region, thus it may have originated from these vineyards, where it then gradually established a resident population at MHFEW over the previous decades of winery activity.

3.2 Novelty of the research

For the first time, the extent of genetic diversity found in S. uvarum in the Okanagan

Valley of Canada was found by using a novel, 11x microsatellite genotype method that was streamlined by combining the reactions down into two PCR multiplexes. Microsatellite allele sizes never seen before in the literature were found from our population, and seeing that grapes of all four geographically separated vineyards contained S. uvarum, this suggests that I have a distinct Okanagan S. uvarum population of strains differing from any other viticultural region around the world. I show here that our Okanagan S. uvarum strains have the ability to dominate spontaneous Chardonnay fermentations at a low-temperature of 12 °C even over S. cerevisiae, suggesting they are more cryotolerant than S. cerevisiae. These findings may influence how winemakers perceive the notion of terroir in the Okanagan Valley when producing low- temperature, spontaneous fermentations.

3.3 Future research

The origin of the S. uvarum in the Okanagan Valley is still unknown, and whole-genome sequencing would help illustrate whether the strains discovered in this thesis are truly indigenous to the Okanagan or an evolutionary by-product of European S. uvarum that has migrated over

68 through wine making practice and equipment. Individual strain kinetic work looking at the most dominant S. uvarum strains discovered in this thesis and analyzing for chemical properties that affect sensory perception that appear different between Okanagan S. uvarum and commercial S. cerevisiae wine could potentially identify suitable Okanagan strains that can positively impact the wine quality and contribute to the sense of terroir. Mixed, co-inoculated fermentation studies with these S. uvarum strains and S. cerevisiae could also be beneficial, as it would better illustrate real life application for other wineries around the Okanagan, or even world wide.

69

Bibliography

Albertin, W., Chernova, M., Durrens, P., Guichoux, E., Sherman, D.J., Masneuf-Pomarède, I.,

Marullo, P., 2018. Many interspecific chromosomal introgressions are highly prevalent in

Holarctic Saccharomyces uvarum strains found in human-related fermentations. Yeast 35,

141–156. https://doi.org/10.1002/yea.3248

Almeida, P., Gonçalves, C., Teixeira, S., Libkind, D., Bontrager, M., Masneuf-Pomarède, I.,

Albertin, W., Durrens, P., Sherman, D.J., Marullo, P., Todd Hittinger, C., Gonçalves, P.,

Sampaio, J.P., 2014. A Gondwanan imprint on global diversity and domestication of wine

and cider yeast Saccharomyces uvarum. Nat. Commun. 5, 4044.

https://doi.org/10.1038/ncomms5044

Bennett, S., 2004. Solexa Ltd. Pharmacogenomics 5, 433–438.

https://doi.org/10.1517/14622416.5.4.433

Blein-Nicolas, M., Albertin, W., Valot, B., Marullo, P., Sicard, D., Giraud, C., Huet, S.,

Bourgais, A., Dillmann, C., de Vienne, D., Zivy, M., 2013. Yeast proteome variations

reveal different adaptive responses to grape must fermentation. Mol. Biol. Evol. 30, 1368–

1383. https://doi.org/10.1093/molbev/mst050

Bokulich, N.A., Collins, T.S., Masarweh, C., Allen, G., Heymann, H., Ebeler, S.E., Mills, D.A.,

2016. Associations among wine grape microbiome, metabolome, and fermentation behavior

suggest microbial contribution to regional wine characteristics. MBio 7, e00631-16.

https://doi.org/10.1128/MBIO.00631-16

Bokulich, N.A., Joseph, C.M.L., Allen, G., Benson, A.K., Mills, D.A., 2012. Next-generation

70

sequencing reveals significant bacterial diversity of botrytized wine. PLoS One 7, e36357.

https://doi.org/10.1371/journal.pone.0036357

Bokulich, N.A., Mills, D.A., 2013. Improved selection of internal transcribed spacer-specific

primers enables quantitative, ultra-high-throughput profiling of fungal communities. Appl.

Environ. Microbiol. 79, 2519–26. https://doi.org/10.1128/AEM.03870-12

Bokulich, N.A., Mills, D.A., 2012. Next-generation approaches to the microbial ecology of food

fermentations. BMB Rep. 45, 377–389. https://doi.org/10.5483/BMBRep.2012.45.7.148

Bokulich, N.A., Thorngate, J.H., Richardson, P.M., Mills, D.A., 2014. Microbial biogeography

of wine grapes is conditioned by cultivar, vintage, and climate. Proc. Natl. Acad. Sci. U. S.

A. 111, E139-48. https://doi.org/10.1073/pnas.1317377110

Bolyen, E., Rideout, J.R., Dillon, M.R., Bokulich, N.A., Abnet, C., Al-Ghalith, G.A., Alexander,

H., Alm, E.J., Arumugam, M., Asnicar, F., Bai, Y., Bisanz, J.E., Bittinger, K., Brejnrod, A.,

Brislawn, C.J., Brown, C.T., Callahan, B.J., Caraballo-Rodríguez, A.M., Chase, J., Cope,

E., Silva, R. Da, Dorrestein, P.C., Douglas, G.M., Durall, D.M., Duvallet, C., Edwardson,

C.F., Ernst, M., Estaki, M., Fouquier, J., Gauglitz, J.M., Gibson, D.L., Gonzalez, A.,

Gorlick, K., Guo, J., Hillmann, B., Holmes, S., Holste, H., Huttenhower, C., Huttley, G.,

Janssen, S., Jarmusch, A.K., Jiang, L., Kaehler, B., Kang, K. Bin, Keefe, C.R., Keim, P.,

Kelley, S.T., Knights, D., Koester, I., Kosciolek, T., Kreps, J., Langille, M.G., Lee, J., Ley,

R., Liu, Y.-X., Loftfield, E., Lozupone, C., Maher, M., Marotz, C., Martin, B.D.,

McDonald, D., McIver, L.J., Melnik, A. V, Metcalf, J.L., Morgan, S.C., Morton, J.,

Naimey, A.T., Navas-Molina, J.A., Nothias, L.F., Orchanian, S.B., Pearson, T., Peoples,

S.L., Petras, D., Preuss, M.L., Pruesse, E., Rasmussen, L.B., Rivers, A., Michael S

71

Robeson, I., Rosenthal, P., Segata, N., Shaffer, M., Shiffer, A., Sinha, R., Song, S.J., Spear,

J.R., Swafford, A.D., Thompson, L.R., Torres, P.J., Trinh, P., Tripathi, A., Turnbaugh, P.J.,

Ul-Hasan, S., Hooft, J.J. van der, Vargas, F., Vázquez-Baeza, Y., Vogtmann, E., Hippel, M.

von, Walters, W., Wan, Y., Wang, M., Warren, J., Weber, K.C., Williamson, C.H., Willis,

A.D., Xu, Z.Z., Zaneveld, J.R., Zhang, Y., Zhu, Q., Knight, R., Caporaso, J.G., 2018.

QIIME 2: reproducible, interactive, scalable, and extensible microbiome data science.

https://doi.org/10.7287/peerj.preprints.27295v2

Bonciani, T., De Vero, L., Giannuzzi, E., Verspohl, A., Giudici, P., 2018. Qualitative and

quantitative screening of the β -glucosidase activity in Saccharomyces cerevisiae and

Saccharomyces uvarum strains isolated from refrigerated must. Lett. Appl. Microbiol. 67,

72–78. https://doi.org/10.1111/lam.12891

Borneman, A.R., Pretorius, I.S., 2015. Genomic insights into the Saccharomyces sensu stricto

complex. Genetics 199, 281–91. https://doi.org/10.1534/genetics.114.173633

Bruvo, R., Michiels, N.K., D’Souza, T.G., Schulenberg, H., 2004. A simple method for the

calculation of microsatellite genotype distances irrespective of ploidy level. Mol. Ecol. 13,

2101–2106. https://doi.org/10.1111/j.1365-294X.2004.02209.x

Callahan, B.J., McMurdie, P.J., Rosen, M.J., Han, A.W., Johnson, A.J.A., Holmes, S.P., 2016.

DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13,

581–3. https://doi.org/10.1038/nmeth.3869

Capozzi, V., Garofalo, C., Chiriatti, M.A., Grieco, F., Spano, G., 2015. Microbial terroir and

food innovation: the case of yeast biodiversity in wine. Microbiol. Res. 181, 75–83.

https://doi.org/10.1016/J.MICRES.2015.10.005

72

Castelluci, F., 2010. Microbiological analysis of wines and musts Method OIV-MA-AS4-01

Type IV Method, in: Compendium of International Methods of Analysis - OIV. OIV, pp. 1–

32.

Ciani, M., Mannazzu, I., Marinangeli, P., Clementi, F., Martini, A., 2004. Contribution of

winery-resident Saccharomyces cerevisiae strains to spontaneous grape must fermentation.

Antonie Van Leeuwenhoek 85, 159–164.

https://doi.org/10.1023/B:ANTO.0000020284.05802.d7

Clemente-Jimenez, J.M., Mingorance-Cazorla, L., Martıneź -Rodrıguez,́ S., Heras-Vázquez, F.J.

Las, Rodrı́guez-Vico, F., 2004. Molecular characterization and oenological properties of

wine yeasts isolated during spontaneous fermentation of six varieties of grape must. Food

Microbiol. 21, 149–155. https://doi.org/10.1016/S0740-0020(03)00063-7

Cocolin, L., Mills, D.A., 2003. Wine yeast inhibition by sulfur dioxide: a comparison of culture-

dependent and independent methods, Am J Enol Vitic. 54, 125-130.

https://www.ajevonline.org/content/54/2/125

Contreras, A., Hidalgo, C., Henschke, P.A., Chambers, P.J., Curtin, C., Varela, C., 2014.

Evaluation of non-Saccharomyces yeasts for the reduction of alcohol content in wine. Appl.

Environ. Microbiol. 80, 1670–8. https://doi.org/10.1128/AEM.03780-13

Csoma, H., Zakany, N., Capece, A., Romano, P., Sipiczki, M., 2010. Biological diversity of

Saccharomyces yeasts of spontaneously fermenting wines in four wine regions:

Comparative genotypic and phenotypic analysis. Int. J. Food Microbiol. 140, 239–248.

https://doi.org/10.1016/J.IJFOODMICRO.2010.03.024

Daw, E.W., Heath, S.C., Lu, Y., 2005. Single-nucleotide polymorphism versus microsatellite

73

markers in a combined linkage and segregation analysis of a quantitative trait. BMC Genet.

6 Suppl 1, S32. https://doi.org/10.1186/1471-2156-6-S1-S32

Demuyter, C., Lollier, M., Legras, J.-L., Le Jeune, C., 2004. Predominance of Saccharomyces

uvarum during spontaneous alcoholic fermentation, for three consecutive years, in an

Alsatian winery. J. Appl. Microbiol. 97, 1140–1148. https://doi.org/10.1111/j.1365-

2672.2004.02394.x

Díaz, C., Molina, A.M., Nähring, J., Fischer, R., 2013. Characterization and dynamic behavior of

wild yeast during spontaneous wine fermentation in steel tanks and amphorae. Biomed Res.

Int. 2013, 540465. https://doi.org/10.1155/2013/540465

Divol, B., Lonvaud-Funel, A., 2005. Evidence for viable but nonculturable yeasts in botrytis-

affected wine. J. Appl. Microbiol. 99, 85–93. https://doi.org/10.1111/j.1365-

2672.2005.02578.x

Ferreira, D., Galeote, V., Sanchez, I., Legras, J.-L., Ortiz-Julien, A., Dequin, S., 2017. Yeast

multistress resistance and lag-phase characterisation during wine fermentation. FEMS Yeast

Res. 17. https://doi.org/10.1093/femsyr/fox051

Fleet, G.H., Lafon-Lafourcade, S., Ribéreau-Gayon, P., 1984. Evolution of yeasts and lactic acid

bacteria during fermentation and storage of bordeaux wines. Appl. Environ. Microbiol. 48,

1034–8.

Gawel, R., Sluyter, S. Van, Waters, E.J., 2007. The effects of ethanol and glycerol on the body

and other sensory characteristics of Riesling wines. Aust. J. Grape Wine Res. 13, 38–45.

https://doi.org/10.1111/j.1755-0238.2007.tb00070.x

74

Giudici, P., Zambonelli, C., Passarelli, P., Castellari, L., 1995. Improvement of wine

composition with cryotolerant Saccharomyces strains, Am J Enol Vitic. 46, 143-147.

https://www.ajevonline.org/content/46/1/143

Goold, H.D., Kroukamp, H., Williams, T.C., Paulsen, I.T., Varela, C., Pretorius, I.S., 2017.

Yeast’s balancing act between ethanol and glycerol production in low-alcohol wines.

Microb. Biotechnol. 10, 264–278. https://doi.org/10.1111/1751-7915.12488

Granchi, L., Ganucci, D., Messini, A., Vincenzini, M., 2002. Oenological properties of

Hanseniaspora osmophila and Kloeckera corticis from wines produced by spontaneous

fermentations of normal and dried grapes. FEMS Yeast Res. 2, 403–407.

https://doi.org/10.1111/j.1567-1364.2002.tb00110.x

Grangeteau, C., Gerhards, D., von Wallbrunn, C., Alexandre, H., Rousseaux, S., Guilloux-

Benatier, M., 2016. Persistence of two non-Saccharomyces yeasts (Hanseniaspora and

Starmerella) in the cellar. Front. Microbiol. 7, 268.

https://doi.org/10.3389/fmicb.2016.00268

Guth, H., 1997. Quantitation and sensory studies of character impact odorants of different white

wine varieties. J. Agric. Food Chem. 45, 3027–3032. https://doi.org/10.1021/jf970280a

Henick-Kling, T., Yun-Hee, P., 1994. Considerations for the use of yeast and bacterial starter

cultures: SO2 and timing of inoculation. Am. J. Enol. Vitic. 45, 464 LP – 469.

Hothorn, T., Bretz, F., Westfall, P., 2008. Simultaneous inference in general parametric models.

Biometrical J. 50, 346–363. https://doi.org/10.1002/bimj.200810425

Houck, L., 1971. Use of biphenyl for reducing Penicillium decay of stored citrus, Agricultural

75

Research Service.

Jombart, T., Devillard, S., Balloux, F., 2010. Discriminant analysis of principal components: a

new method for the analysis of genetically structured populations. BMC Genet. 11, 94.

https://doi.org/10.1186/1471-2156-11-94

Jones, G. V., White, M.A., Cooper, O.R., Storchmann, K., 2005. Climate change and global wine

quality. Clim. Change 73, 319–343. https://doi.org/10.1007/s10584-005-4704-2

Kamvar, Z.N., Tabima, J.F., Grünwald, N.J., 2014. Poppr : an R package for genetic analysis of

populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2, e281.

https://doi.org/10.7717/peerj.281

Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7:

improvements in performance and usability. Mol. Biol. Evol. 30, 772–80.

https://doi.org/10.1093/molbev/mst010

Kishimoto, M., Goto, S., 1995. Growth temperatures and electrophoretic karyotyping as tools for

practical discrimination of Saccharomyces bayanus and Saccharomyces cerevisiae. J. Gen.

Appl. Microbiol. 41, 239–247. https://doi.org/10.2323/jgam.41.239

Kishimoto, M., Oshida, A., Shinohara, T., Soma, E., Goto, S., 1994. Effect of temperature on

ethanol productivity and resistance of cryophilic wine yeasts. J. Gen. Appl. Microbiol. 40,

135–142. https://doi.org/10.2323/jgam.40.135

Kishimoto, M., Shinohara, T., Soma, E., Goto, S., 1993. Identification and enological

characteristics of cryophilic wine yeasts. J. Brew. Soc. Japan 88, 708–713.

https://doi.org/10.6013/jbrewsocjapan1988.88.708

76

Knight, S., Klaere, S., Fedrizzi, B., Goddard, M.R., 2015. Regional microbial signatures

positively correlate with differential wine phenotypes: evidence for a microbial aspect to

terroir. Sci. Rep. 5, 14233. https://doi.org/10.1038/srep14233

Kõljalg, U., Nilsson, R.H., Abarenkov, K., Tedersoo, L., Taylor, A.F.S., Bahram, M., Bates,

S.T., Bruns, T.D., Bengtsson-Palme, J., Callaghan, T.M., Douglas, B., Drenkhan, T.,

Eberhardt, U., Dueñas, M., Grebenc, T., Griffith, G.W., Hartmann, M., Kirk, P.M., Kohout,

P., Larsson, E., Lindahl, B.D., Lücking, R., Martín, M.P., Matheny, P.B., Nguyen, N.H.,

Niskanen, T., Oja, J., Peay, K.G., Peintner, U., Peterson, M., Põldmaa, K., Saag, L., Saar, I.,

Schüßler, A., Scott, J.A., Senés, C., Smith, M.E., Suija, A., Taylor, D.L., Telleria, M.T.,

Weiss, M., Larsson, K.-H., 2013. Towards a unified paradigm for sequence-based

identification of fungi. Mol. Ecol. 22, 5271–5277. https://doi.org/10.1111/mec.12481

Legras, J.-L., Ruh, O., Merdinoglu, D., Karst, F., 2005. Selection of hypervariable microsatellite

loci for the characterization of Saccharomyces cerevisiae strains. Int. J. Food Microbiol.

102, 73–83. https://doi.org/10.1016/J.IJFOODMICRO.2004.12.007

Libkind, Diego, Hittinger, C.T., Valério, E., Gonçalves, C., Dover, J., Johnston, M., Gonçalves,

P., Sampaio, J.P., 2011. Microbe domestication and the identification of the wild genetic

stock of lager-brewing yeast. Proc. Natl. Acad. Sci. U. S. A. 108, 14539–44.

https://doi.org/10.1073/pnas.1105430108

Martinez Arbizu, P., 2017. pairwiseAdonis: pairwise multilevel comparison using adonis.

Martini, A., 2003. Biotechnology of natural and winery-associated strains of Saccharomyces

cerevisiae. Int. Microbiol. 6, 207–209. https://doi.org/10.1007/s10123-003-0135-y

Martiniuk, J.T., Pacheco, B., Russell, G., Tong, S., Backstrom, I., Measday, V., 2016. Impact of

77

commercial strain use on Saccharomyces cerevisiae population structure and dynamics in

Pinot Noir vineyards and spontaneous fermentations of a canadian winery. PLoS One 11,

e0160259. https://doi.org/10.1371/journal.pone.0160259

Masneuf-Pomarède, I., Bely, M., Marullo, P., Lonvaud-Funel, A., Dubourdieu, D., 2010.

Reassessment of phenotypic traits for Saccharomyces bayanus var. uvarum wine yeast

strains. Int. J. Food Microbiol. 139, 79–86.

https://doi.org/10.1016/J.IJFOODMICRO.2010.01.038

Masneuf-Pomarède, I., Le Jeune, C., Durrens, P., Lollier, M., Aigle, M., Dubourdieu, D., 2007.

Molecular typing of wine yeast strains Saccharomyces bayanus var. uvarum using

microsatellite markers. Syst. Appl. Microbiol. 30, 75–82.

https://doi.org/10.1016/J.SYAPM.2006.02.006

Masneuf-Pomarède, I., Murat, M.-L., Naumov, G.I., Tominaga, T., Dubourdieu, D., 2002.

Hybrids Saccharomyces cerevisiae X Saccharomyces bayanus var. uvarum having a high

liberating ability of some sulfur varietal aromas of Vitis vinifera. OENO One 36, 205.

https://doi.org/10.20870/oeno-one.2002.36.4.965

Masneuf-Pomarède, Isabelle, Salin, F., Börlin, M., Coton, E., Coton, M., Le Jeune, C., Legras,

J.L., 2016. Microsatellite analysis of Saccharomyces uvarum diversity. FEMS Yeast Res.

16, fow002. https://doi.org/10.1093/femsyr/fow002

Massoutier, C., Alexandre, H., Feuillat, M., Charpentier, C., 1998. Isolation and characterization

of cryotolerant Saccharomyces strains. Vitis 37, 55–59.

Morgan, S.C., Scholl, C.M., Benson, N.L., Stone, M.L., Durall, D.M., 2017. Sulfur dioxide

addition at crush alters Saccharomyces cerevisiae strain composition in spontaneous

78

fermentations at two Canadian wineries. Int. J. Food Microbiol. 244, 96–102.

https://doi.org/10.1016/J.IJFOODMICRO.2016.12.025

Morgan, S.C., Tantikachornkiat, M., Scholl, C.M., Benson, N.L., Cliff, M.A., Durall, D.M.,

2019. The effect of sulfur dioxide addition at crush on the fungal and bacterial communities

and the sensory attributes of Pinot gris wines. Int. J. Food Microbiol. 290, 1–14.

https://doi.org/10.1016/J.IJFOODMICRO.2018.09.020

Mortimer, R., Polsinelli, M., 1999. On the origins of wine yeast. Res. Microbiol. 150, 199–204.

https://doi.org/10.1016/S0923-2508(99)80036-9

Naseeb, S., James, S.A., Alsammar, H., Michaels, C.J., Gini, B., Nueno-Palop, C., Bond, C.J.,

McGhie, H., Roberts, I.N., Delneri, D., 2017. Saccharomyces jurei sp. nov., isolation and

genetic identification of a novel yeast species from Quercus robur. Int. J. Syst. Evol.

Microbiol. 67, 2046–2052. https://doi.org/10.1099/ijsem.0.002013

Naumov, G.I., 2000. Saccharomyces bayanus var.uvarum comb, nov., a new variety established

by genetic analysis. Microbiology 69, 338–342. https://doi.org/10.1007/BF02756744

Naumov, G.I., 1996. Genetic identification of biological species in the Saccharomyces Sensu

stricto complex. J. Ind. Microbiol. Biotechnol. 17, 295–302.

https://doi.org/10.1007/BF01574704

Naumov, G.I., Masneuf, I., S. Naumova, E., Aigle, M., Dubourdieu, D., 2000. Association of

Saccharomyces bayanus var. uvarum with some French wines: genetic analysis of yeast

populations. Res. Microbiol. 151, 683–691. https://doi.org/10.1016/S0923-2508(00)90131-1

Naumov, G.I., Naumova, E.S., Antunovics, Z., Sipiczki, M., 2002. Saccharomyces bayanus var.

79

uvarum in Tokaj wine-making of Slovakia and Hungary. Appl. Microbiol. Biotechnol. 59,

727–730. https://doi.org/10.1007/s00253-002-1077-6

Naumova, E.S., Naumov, G.I., Michailova, Y. V., Martynenko, N.N., Masneuf-Pomarède, I.,

2011. Genetic diversity study of the yeast Saccharomyces bayanus var. uvarum reveals

introgressed subtelomeric Saccharomyces cerevisiae genes. Res. Microbiol. 162, 204–213.

https://doi.org/10.1016/j.resmic.2010.09.023

Nguyen, H.-V., Boekhout, T., 2017. Characterization of Saccharomyces uvarum (Beijerinck,

1898) and related hybrids: assessment of molecular markers that predict the parent and

hybrid genomes and a proposal to name yeast hybrids. FEMS Yeast Res. 17.

https://doi.org/10.1093/femsyr/fox014

Nguyen, H.-V., Gaillardin, C., 2005. Evolutionary relationships between the former species

Saccharomyces uvarum and the hybrids Saccharomyces bayanus and Saccharomyces

pastorianus; reinstatement of Saccharomyces uvarum (Beijerinck) as a distinct species.

FEMS Yeast Res. 5, 471–483. https://doi.org/10.1016/j.femsyr.2004.12.004

Nguyen, H.-V., Legras, J.-L., Neuvéglise, C., Gaillardin, C., 2011. Deciphering the hybridisation

history leading to the Lager lineage based on the mosaic genomes of Saccharomyces

bayanus strains NBRC1948 and CBS380. PLoS One 6, e25821.

https://doi.org/10.1371/journal.pone.0025821

Nguyen, H.-V., Lepingle, A., Gaillardin, C., 2000. Molecular typing demonstrates homogeneity

of Saccharomyces uvarum strains and reveals the existence of hybrids between S. uvarum

and S. cerevisiae, including the S. bayanus type strain CBS 380. Syst. Appl. Microbiol. 23,

71–85. https://doi.org/10.1016/S0723-2020(00)80048-X

80

Noble, A.C., Bursick, G.F., 1984. The Contribution of Glycerol to Perceived Viscosity and

Sweetness in White Wine. Am. J. Enol. Vitic. 35, 110–112.

https://www.ajevonline.org/content/35/2/110

Oksanen, J., Friendly, F.G.B.M., Kindt, R., Legendre, P., McGlinn, D., Minchin, P.R., O’Hara,

R.B., Simpson, G.L., Solymos, P., Stevens, M.H.H., Szoecs, E., Wagner, H., 2018. vegan:

community ecology package.

Origone, A.C., Rodríguez, M.E., Oteiza, J.M., Querol, A., Lopes, C.A., 2018. Saccharomyces

cerevisiae × Saccharomyces uvarum hybrids generated under different conditions share

similar winemaking features. Yeast 35, 157–171. https://doi.org/10.1002/yea.3295

Ortiz, M.J., Barrajón, N., Baffi, M.A., Arévalo-Villena, M., Briones, A., 2013. Spontaneous must

fermentation: Identification and biotechnological properties of wine yeasts. LWT - Food

Sci. Technol. 50, 371–377. https://doi.org/10.1016/J.LWT.2012.09.019

Pallmann, C.L., Brown, J.A., Olineka, T.L., Cocolin, L., Mills, D.A., Bisson, L.F., 2001. Use of

WL medium to profile native flora. Am. J. Enol. Vitic. 52, 198–203.

Paradis, E., Schliep, K., 2019. ape 5.0: an environment for modern phylogenetics and

evolutionary analyses in R. Bioinformatics 35, 526–528.

https://doi.org/10.1093/bioinformatics/bty633

Pérez-Través, L., Lopes, C.A., Querol, A., Barrio, E., 2014. On the complexity of the

Saccharomyces bayanus taxon: hybridization and potential hybrid speciation. PLoS One 9,

e93729. https://doi.org/10.1371/journal.pone.0093729

Pinheiro, J., Bates, D., DebRoy, S., Sarkar, D., Team, R.C., 2018. nlme: linear and nonlinear

81

mixed effects models.

Price, M.N., Dehal, P.S., Arkin, A.P., 2010. FastTree 2 – Approximately maximum-likelihood

trees for large alignments. PLoS One 5, e9490.

https://doi.org/10.1371/journal.pone.0009490

Rainieri, S., Kodama, Y., Kaneko, Y., Mikata, K., Nakao, Y., Ashikari, T., 2006. Pure and mixed

genetic lines of Saccharomyces bayanus and Saccharomyces pastorianus and their

contribution to the lager brewing strain genome. Appl. Environ. Microbiol. 72, 3968–74.

https://doi.org/10.1128/AEM.02769-05

Rainieri, S., Zambonelli, C., Hallsworth, J.E., Pulvirenti, A., Giudici, P., 1999. Saccharomyces

uvarum, a distinct group within Saccharomyces sensu stricto. FEMS Microbiol. Lett. 177,

177–185. https://doi.org/10.1016/S0378-1097(99)00259-1

Rainieri, S., Zambonelli, C., Tini, V., Castellari, L., Giudici, P., 1998. The Enological Traits of

Thermotolerant Saccharomyces Strains. Am. J. Enol. Vitic. 49.

Ramírez-Castrillón, M., Mendes, S.D.C., Inostroza-Ponta, M., Valente, P., 2014. (GTG)5 MSP-

PCR fingerprinting as a technique for discrimination of wine associated yeasts? PLoS One

9, e105870. https://doi.org/10.1371/journal.pone.0105870

Redzepovic, S., Orlic, S., Majdak, A., Kozina, B., Volschenk, H., Viljoen-Bloom, M., 2003.

Differential malic acid degradation by selected strains of Saccharomyces during alcoholic

fermentation. Int. J. Food Microbiol. 83, 49–61. https://doi.org/10.1016/S0168-

1605(02)00320-3

Remize, F., Roustan, J.L., Sablayrolles, J.M., Barre, P., Dequin, S., 1999. Glycerol

82

overproduction by engineered Saccharomyces cerevisiae wine yeast strains leads to

substantial changes in By-product formation and to a stimulation of fermentation rate in

stationary phase. Appl. Environ. Microbiol. 65, 143–9.

Richard, G.-F., Kerrest, A., Dujon, B., 2008. Comparative genomics and molecular dynamics of

DNA repeats in eukaryotes. Microbiol. Mol. Biol. Rev. 72, 686–727.

https://doi.org/10.1128/MMBR.00011-08

Richards, K.D., Goddard, M.R., Gardner, R.C., 2009. A database of microsatellite genotypes for

Saccharomyces cerevisiae. Antonie Van Leeuwenhoek 96, 355–359.

https://doi.org/10.1007/s10482-009-9346-3

Robinson, J., 2015. The Oxford Companion to Wine, 4th edn. ed. Oxford University Press.

https://doi.org/10.1093/acref/9780198705383.001.0001

Romano, P., Fiore, C., Paraggio, M., Caruso, M., Capece, A., 2003. Function of yeast species

and strains in wine flavour. Int. J. Food Microbiol. 86, 169–180.

https://doi.org/10.1016/S0168-1605(03)00290-3

Salvadó, Z., Arroyo-López, F.N., Guillamón, J.M., Salazar, G., Querol, A., Barrio, E., 2011.

Temperature adaptation markedly determines evolution within the genus Saccharomyces.

Appl. Environ. Microbiol. 77, 2292–302. https://doi.org/10.1128/AEM.01861-10

Sampaio, J.P., Gonçalves, P., 2008. Natural populations of Saccharomyces kudriavzevii in

Portugal are associated with oak bark and are sympatric with S. cerevisiae and S.

paradoxus. Appl. Environ. Microbiol. 74, 2144–52. https://doi.org/10.1128/AEM.02396-07

Scholl, C.M., Morgan, S.C., Stone, M.L., Tantikachornkiat, M., Neuner, M., Durall, D.M., 2016.

83

Composition of Saccharomyces cerevisiae strains in spontaneous fermentations of Pinot

Noir and Chardonnay. Aust. J. Grape Wine Res. 22, 384–390.

https://doi.org/10.1111/ajgw.12221

Schreiner, J., 2014. John Schreiner’s Okanagan wine tour guide : The wineries of British

Columbia’s interior., 5th ed. Whitecap Books Ltd.

Su, Y., Origone, A.C., Rodríguez, M.E., Querol, A., Guillamón, J.M., Lopes, C.A., 2019.

Fermentative behaviour and competition capacity of cryotolerant Saccharomyces species in

different nitrogen conditions. Int. J. Food Microbiol. 291, 111–120.

https://doi.org/10.1016/J.IJFOODMICRO.2018.11.020

Team, R.C., 2018. R: A Language and Environment for Statistical Computing.

Teresa Fernández-Espinar, M., Barrio, E., Querol, A., 2003. Analysis of the genetic variability in

the species of the Saccharomyces Sensu stricto complex. Yeast 20, 1213–1226.

https://doi.org/10.1002/yea.1034

Tosi, E., Azzolini, M., Guzzo, F., Zapparoli, G., 2009. Evidence of different fermentation

behaviours of two indigenous strains of Saccharomyces cerevisiae and Saccharomyces

uvarum isolated from Amarone wine. J. Appl. Microbiol. 107, 210–218.

https://doi.org/10.1111/j.1365-2672.2009.04196.x

Varela, C., Borneman, A.R., 2017. Yeasts found in vineyards and wineries. Yeast 34, 111–128.

https://doi.org/10.1002/yea.3219

Varela, C., Dry, P.R., Kutyna, D.R., Francis, I.L., Henschke, P.A., Curtin, C.D., Chambers, P.J.,

2015. Strategies for reducing alcohol concentration in wine. Aust. J. Grape Wine Res. 21,

84

670–679. https://doi.org/10.1111/ajgw.12187

Vaughan Martini, A., Kurtzman, C.P., 1985. Deoxyribonucleic Acid relatedness among species

of the genus Saccharomyces sensu stricto. Int. J. Syst. Bacteriol. 35, 508–511.

https://doi.org/10.1099/00207713-35-4-508

Wang, C., Mas, A., Esteve-Zarzoso, B., 2016. The nteraction between Saccharomyces cerevisiae

and non-Saccharomyces yeast during alcoholic fermentation is species and strain specific.

Front. Microbiol. 7, 502. https://doi.org/10.3389/fmicb.2016.00502

Xing, C., Schumacher, F.R., Xing, G., Lu, Q., Wang, T., Elston, R.C., 2005. Comparison of

microsatellites, single-nucleotide polymorphisms (SNPs) and composite markers derived

from SNPs in linkage analysis. BMC Genet. 6 Suppl 1, S29. https://doi.org/10.1186/1471-

2156-6-S1-S29

Zhang, H., Richards, K.D., Wilson, S., Lee, S.A., Sheehan, H., Roncoroni, M., Gardner, R.C.,

2015. Genetic characterization of strains of Saccharomyces uvarum from New Zealand

wineries. Food Microbiol. 46, 92–99. https://doi.org/10.1016/j.fm.2014.07.016

Zhivotovsky, L.A., Feldman, M.W., 1995. Microsatellite variability and genetic distances. Proc.

Natl. Acad. Sci. U. S. A. 92, 11549–52.

Zott, K., Claisse, O., Lucas, P., Coulon, J., Lonvaud-Funel, A., Masneuf-Pomarède, I., 2010.

Characterization of the yeast ecosystem in grape must and wine using real-time PCR. Food

Microbiol. 27, 559–567. https://doi.org/10.1016/J.FM.2010.01.006

85

Appendices

Appendix A Fungal community composition based on 20,000 sequenced ITS1 reads per sample, with V2 treatment (n = 3, except for the stage “cold-settling”, which had an n = 2) vs V8 treatment (n = 3) at four stages of fermentation: cold-settling (CS), 1/3 sugar depletion (1/3), 2/3 sugar depletion (2/3), and end of fermentation.

V2 V8 Fungi CS 1/3 2/3 end CS 1/3 2/3 end Cladosporium 15 ± 7 0.66 ± 0 ± 0 1 ± 1 380 ± 66 0 ± 0 0.66 ± 1.66 ± (unk. sp.) 0.66 0.66 0.88 Cladosporium 17 ± 1.33 ± 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 delicatulum 14.1 1.33 0.33 Mycosphaerella 24.33 ± 2.66 ± 0 ± 0 0 ± 0 27 ± 27 1.33 ± 80.66 ± 0 ± 0 tassiana 2.33 1.33 0.66 78.17 Aureobasidium 2531 ± 8 ± 6 ± 0.57 2.33 ± 169.5 ± 0 ± 0 19.33 ± 6.33 ± pullulans 106.22 1.15 2.33 29.5 12.91 3.28 Dothideaceae 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (family) 0.33 Hormonema 8.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 macrosporum 7.68 Pleosporales 3.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (order) 3.66 Epicoccum nigrum 40 ± 36 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.33 ± 0 ± 0 0.33 0.33 Neoascochyta 3.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 desmazieri 3.66 Didymellaceae 11 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (family) 6.08 Lophiotrema rubi 4 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 2.08 Phaeosphaeriaceae 25.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (family) 10.58 Alternaria 1.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 infectoria 1.33 Alternaria (unk. 24.66 ± 1 ± 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 sp.) 11.86 0.57 0.33 Sporormiaceae 103.66 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (family) ± 36.02 Venturia (unk. sp.) 3 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 1.73 Sarcinomyces 0.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 crustaceus 0.66

86

Appendix A Fungal community composition based on 20,000 sequenced ITS1 reads per sample, with V2 treatment (n = 3, except for the stage “cold-settling”, which had an n = 2) vs V8 treatment (n = 3) at four stages of fermentation: cold-settling (CS), 1/3 sugar depletion (1/3), 2/3 sugar depletion (2/3), and end of fermentation.

Aspergillus (unk. 65.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 sp.) 2.18 Aspergillus niger 11330 74 ± 1.66 ± 2 ± 2 14 ± 14 0 ± 0 0 ± 0 0 ± 0 ± 12.42 1.66 673.05 Aspergillus wentii 3 ± 3 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 Penicillium (unk. 1665.6 6.66 ± 0 ± 0 0 ± 0 2347 ± 0.66 ± 36 ± 0 ± 0 sp.) 6 ± 0.88 1273 0.66 27.49 261.82 Penicillium 0.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 bialowiezense 0.66 Penicillium 0.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 citreonigrum 0.66 Penicillium 3.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 citrinum 3.33 Penicillium 5.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 expansum 1.2 Penicillium 57.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 georgiense 7.33 Penicillium 2 ± 2 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 roqueforti Talaromyces 56.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 10.83 Phaeophyscia 110 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 orbicularis 110 Erysiphe necator 2.66 ± 0.33 ± 0 ± 0 0.66 ± 4 ± 4 1 ± 0.57 0 ± 0 1.33 ± 2.66 0.33 0.66 1.33 Helotiaceae 15.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (family) 6.35 Sclerotiniaceae 15.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (family) 11.92 Pyronema 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 domesticum 0.33 Tricharina 2.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 praecox 2.66 Hyphopichia 13 ± 13 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 burtonii Meyerozyma 95 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.66 ± 1.33 ± guilliermondii 11.78 0.66 1.33 Sporopachydermi 1.33 ± 0 ± 0 0 ± 0 0 ± 0 167 ± 0 ± 0 0 ± 0 0 ± 0 a lactativora 1.33 167

87

Appendix A Fungal community composition based on 20,000 sequenced ITS1 reads per sample, with V2 treatment (n = 3, except for the stage “cold-settling”, which had an n = 2) vs V8 treatment (n = 3) at four stages of fermentation: cold-settling (CS), 1/3 sugar depletion (1/3), 2/3 sugar depletion (2/3), and end of fermentation.

Dipodascaceae 11 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (family) 3.78 Metschnikowia 6.33 ± 0.66 ± 0 ± 0 1 ± 1 0 ± 0 0.66 ± 31 ± 14.33 ± chrysoperlae 6.33 0.66 0.66 26.15 7.62 Metschnikowia 1.66 ± 1.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 2.33 ± 0 ± 0 pulcherrima 1.66 1.66 2.33 Metschnikowia 0 ± 0 0 ± 0 0 ± 0 0 ± 0 7.5 ± 7.5 0.66 ± 27.33 ± 23.66 ± (unk. sp.) 0.66 27.33 13.04 Cyberlindnera 0 ± 0 0 ± 0 0 ± 0 1.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 jadinii 1.66 Wickerhamomyces 7.33 ± 1.66 ± 0 ± 0 0 ± 0 769 ± 4.66 ± 16.66 ± 203.33 ± anomalus 5.04 1.66 769 3.71 13.67 180.66 Kregervanrija 3.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 fluxuum 1.66 Pichia kluyveri 45 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 6.33 ± 11 ± 21.12 5.36 9.53 Pichia 47.33 ± 0 ± 0 0 ± 0 0 ± 0 164 ± 0 ± 0 11.33 ± 12.66 ± membranifaciens 18.88 164 8.95 9.38 Pichia terricola 32.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 1.66 ± 5 ± 2.64 16.73 1.66 Issatchenkia 2053.3 10.66 ± 5 ± 2.51 12.66 1 ± 1 0 ± 0 4.33 ± 10.33 ± orientalis 3 ± 1.76 ± 8.29 4.33 6.74 282.03 Kazachstania 1.33 ± 0.33 ± 0 ± 0 0 ± 0 49.5 ± 0 ± 0 0 ± 0 0 ± 0 aerobia 1.33 0.33 49.5 Lachancea 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 quebecensis 0.33 Saccharomyces 70.33 ± 19346 19375 ± 19367. 3251.5 ± 17493 ± 16293.66 15941 ± uvarum 7.17 ± 52.29 90.64 66 ± 551.5 1100 ± 587.94 1891.92 100.61 Saccharomyces 12 ± 533.33 608 ± 607 ± 1222.5 ± 146.33 ± 168.33 ± 221 ± cerevisiae 6.11 ± 38.47 89.76 109.04 245.5 17.13 99.99 71.59 Torulaspora 14.66 ± 0 ± 0 0 ± 0 0 ± 0 378.5 ± 10.33 ± 9 ± 6.02 15 ± 3.6 delbrueckii 8.11 5.5 0.88 Torulaspora 2.66 ± 0 ± 0 0 ± 0 0 ± 0 235.5 ± 19.33 ± 21.66 ± 46.66 ± pretoriensis 1.33 36.5 0.33 12.44 18.35 Candida (unk. sp.) 94 ± 3.33 ± 0 ± 0 0 ± 0 4689.5 ± 1.33 ± 9.33 ± 17.66 ± 33.72 3.33 241.5 0.88 2.6 11.72 Candida 12.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 orthopsilosis 9.06

88

Appendix A Fungal community composition based on 20,000 sequenced ITS1 reads per sample, with V2 treatment (n = 3, except for the stage “cold-settling”, which had an n = 2) vs V8 treatment (n = 3) at four stages of fermentation: cold-settling (CS), 1/3 sugar depletion (1/3), 2/3 sugar depletion (2/3), and end of fermentation.

Candida 510 ± 0.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 parapsilosis 58.64 0.66 Candida 0 ± 0 0 ± 0 0 ± 0 0 ± 0 212.5 ± 2.66 ± 22.66 ± 38.66 ± santamariae 212.5 1.45 10.26 32.16 Candida tropicalis 133.33 0 ± 0 0 ± 0 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 ± 28.7 0.33 Candida 6.66 ± 0 ± 0 0 ± 0 1 ± 1 56.5 ± 0 ± 0 0 ± 0 0 ± 0 viswanathii 6.17 56.5 Saccharomycetale 1.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 2.66 ± 12.33 ± s (family) 1.33 2.66 10.86 Hanseniaspora 4.66 ± 0 ± 0 0 ± 0 0 ± 0 1106 ± 0 ± 0 0 ± 0 0 ± 0 guilliermondii 2.33 266 Hanseniaspora 20 ± 2.66 ± 0 ± 0 0 ± 0 2161.5 ± 2318 ± 3020.33 3395.66 osmophila 12.85 2.66 849.5 1080.53 ± 672.24 ± 1741.91 Hanseniaspora 1.66 ± 2 ± 2 3.66 ± 2.66 ± 1568.5 ± 0 ± 0 0 ± 0 0 ± 0 uvarum 1.66 3.66 2.66 241.5 Hanseniaspora 0 ± 0 0 ± 0 0 ± 0 0 ± 0 21 ± 21 0 ± 0 0 ± 0 0 ± 0 valbyensis Diaporthe 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 189.66 ± 0 ± 0 189.66 Fusarium 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 3.66 ± 0.33 ± 3.66 0.33 Amphisphaeriacea 1.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 e (family) 1.33 Tulostoma 148 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 fimbriatum 63.94 Gymnopus 1.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 1.66 Coprinellus (unk. 24.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 sp.) 14.74 Coprinellus 157 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 xanthothrix 14.57 Coprinopsis 2 ± 2 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 lagopus Suillus quiescens 0 ± 0 0 ± 0 0 ± 0 0 ± 0 47.5 ± 0 ± 0 0 ± 0 0 ± 0 47.5 Schenella 6.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 pityophila 4.91 Antrodia 2.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 carbonica 2.66

89

Appendix A Fungal community composition based on 20,000 sequenced ITS1 reads per sample, with V2 treatment (n = 3, except for the stage “cold-settling”, which had an n = 2) vs V8 treatment (n = 3) at four stages of fermentation: cold-settling (CS), 1/3 sugar depletion (1/3), 2/3 sugar depletion (2/3), and end of fermentation.

Ganoderma 24.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 6.11 Lentinus 20 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 squarrosulus 9.45 Malassezia (unk. 0 ± 0 0 ± 0 0 ± 0 0 ± 0 13.5 ± 0 ± 0 2.33 ± 0 ± 0 sp.) 2.5 2.33 Malassezia 0 ± 0 0 ± 0 0 ± 0 0 ± 0 38 ± 20 0 ± 0 12.66 ± 0 ± 0 restricta 12.66 Malasseziales 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 1.33 ± 0 ± 0 (order) 1.33 Curvibasidium 0.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 cygneicollum 0.33 Rhodosporidiobol 7.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 us colostri 5.45 Rhodotorula 95.33 ± 1.33 ± 0 ± 0 0 ± 0 898 ± 0 ± 0 2.33 ± 13 ± 13 mucilaginosa 36.11 1.33 247 2.33 Cystofilobasidium 1 ± 1 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 macerans Guehomyces 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.33 ± 0 ± 0 pullulans 0.33 Udeniomyces 4.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 puniceus 3.38 Filobasidium 7.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 (unk. sp.) 2.84 Filobasidium 8 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 floriforme 4.35 Filobasidium 1.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.33 ± wieringae 0.66 0.33 Naganishia albida 35 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 2.66 ± 16.25 2.66 Naganishia 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 1.33 ± diffluens 1.33 Naganishia 1.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 friedmannii 1.33 Piskurozyma 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.66 ± 3.33 ± capsuligena 0.66 3.33 Holtermanniella 2 ± 2 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 takashimae Vishniacozyma 3 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 carnescens 2.08

90

Appendix A Fungal community composition based on 20,000 sequenced ITS1 reads per sample, with V2 treatment (n = 3, except for the stage “cold-settling”, which had an n = 2) vs V8 treatment (n = 3) at four stages of fermentation: cold-settling (CS), 1/3 sugar depletion (1/3), 2/3 sugar depletion (2/3), and end of fermentation.

Vishniacozyma 0.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 tephrensis 0.66 Vishniacozyma 17.33 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 victoriae 7.66 Cryptococcus 0.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 saitoi 0.66 Papiliotrema 6 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0.66 ± 0 ± 0 3.78 0.66 Ustilago hordei 1 ± 1 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 Mortierella 5 ± 5 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 elongata Mucor 2 ± 0.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 circinelloides 0.57 0.66 Rhizopus arrhizus 55.66 ± 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 23.59

91

Appendix B Multi-locus genotypes (MLGs) showing allele sizes for the representative 56 S. uvarum strains found from the 2017 vintage, after Bruvo Distance threshold application of 0.3, as well as the MLGs for the strains BMV58, CBS395, CBS 7001, PYCC 6860, and PYCC 6861.

92

Appendix B Multi-locus genotypes (MLGs) showing allele sizes for the representative 56 S. uvarum strains found from the 2017 vintage, after Bruvo Distance threshold application of 0.3, as well as the MLGs for the strains BMV58, CBS395, CBS 7001, PYCC 6860, and PYCC 6861.

93

Appendix B Multi-locus genotypes (MLGs) showing allele sizes for the representative 56 S. uvarum strains found from the 2017 vintage, after Bruvo Distance threshold application of 0.3, as well as the MLGs for the strains BMV58, CBS395, CBS 7001, PYCC 6860, and PYCC 6861.

94

Appendix C Relative abundance and standard error of the mean for the 56 S. uvarum strains found between the fermentation treatments (Vineyard 2 vs Vineyard 8) during the 2017 vintage.

S. uvarum relative strain abundance and SEM Strain Strain number Vineyard 2 Vineyard 8 number Vineyard 2 Vineyard 8 Su.3 0 ± 0 0.33 ± 0.33 Su.69 0.66 ± 0.66 2 ± 0.57 Su.4 0.33 ± 0.33 0 ± 0 Su.71 0.33 ± 0.33 0 ± 0 Su.6 3 ± 1.15 0.33 ± 0.33 Su.78 0.33 ± 0.33 0.33 ± 0.33 Su.8 2 ± 2 0.33 ± 0.33 Su.79 13.33 ± 2.72 0.33 ± 0.33 Su.11 0 ± 0 0.33 ± 0.33 Su.82 0 ± 0 0.66 ± 0.66 Su.13 17.66 ± 5.17 18 ± 1.52 Su.84 0.33 ± 0.33 0 ± 0 Su.16 1 ± 0.57 1 ± 0.57 Su.102 4.33 ± 0.33 5 ± 1 Su.17 0.66 ± 0.66 0.33 ± 0.33 Su.103 1 ± 0.57 12.66 ± 1.76 Su.23 1 ± 0.57 1 ± 0.57 Su.105 0.33 ± 0.33 0.33 ± 0.33 Su.28 1 ± 0.57 0.33 ± 0.33 Su.110 0 ± 0 0.66 ± 0.33 Su.29 0.66 ± 0.66 0.33 ± 0.33 Su.111 0.33 ± 0.33 0.33 ± 0.33 Su.30 0 ± 0 0.66 ± 0.66 Su.112 0 ± 0 0.66 ± 0.33 Su.33 0.33 ± 0.33 0.33 ± 0.33 Su.122 0 ± 0 0.33 ± 0.33 Su.34 0 ± 0 0.33 ± 0.33 Su.123 1.66 ± 1.2 0.33 ± 0.33 Su.36 1.66 ± 0.66 4.66 ± 2.18 Su.127 1.66 ± 0.66 4 ± 1.52 Su.37 0.66 ± 0.33 1 ± 0.57 Su.132 0.33 ± 0.33 1.66 ± 0.88 Su.38 0.33 ± 0.33 0.33 ± 0.33 Su.143 2 ± 0.57 3.33 ± 0.33 Su.44 0 ± 0 1 ± 0.57 Su.146 3.33 ± 1.76 0 ± 0 Su.47 1.66 ± 0.66 3.33 ± 1.33 Su.160 11.66 ± 2.33 10.33 ± 0.66 Su.49 1 ± 0.57 0 ± 0 Su.164 2 ± 0 0.33 ± 0.33 Su.51 0 ± 0 0.66 ± 0.33 Su.166 0 ± 0 0.33 ± 0.33 Su.58 2.33 ± 0.33 4 ± 0.57 Su.187 0 ± 0 2 ± 0 Su.59 0.33 ± 0.33 1.33 ± 0.33 Su.189 0 ± 0 0.33 ± 0.33 Su.60 0.66 ± 0.33 0.66 ± 0.33 Su.192 5 ± 1 0.33 ± 0.33 Su.61 1.66 ± 0.33 0 ± 0 Su.224 3.66 ± 1.76 3.66 ± 0.66 Su.64 0.66 ± 0.33 1.66 ± 0.88 Su.225 0.33 ± 0.33 1.33 ± 0.33 Su.65 0.33 ± 0.33 0 ± 0 Su.230 1 ± 0.57 1.33 ± 0.33 Su.68 0.33 ± 0.33 0 ± 0 Su.238 3 ± 1.52 1 ± 0.57

95

Appendix D Vineyard fungal community composition in the Okanagan Valley wine region from crushed Chardonnay grapes based on 20,000 sequenced reads per sample, for the four vineyards:

Vineyards 2, 29 (n = 5) and Vineyards 8, 15 (n = 6).

Vineyard fungal composition Fungi Vineyard 2 Vineyard 8 Vineyard 15 Vineyard 29 Phaeococcomyces (unk. sp.) 21.4 ± 12.29 2.83 ± 1.64 5.66 ± 4.7 0 ± 0 Botryosphaeriaceae (family) 24.8 ± 24.8 0 ± 0 0 ± 0 0 ± 0 Diplodia (unk. sp.) 13.2 ± 10.46 0.33 ± 0.33 0 ± 0 0 ± 0 Dothiorella 15.4 ± 13 0.5 ± 0.5 0 ± 0 0 ± 0 Ramimonilia apicalis 0 ± 0 0 ± 0 5.16 ± 3.66 0 ± 0 Capnodiales (order) 28.2 ± 18.23 1.16 ± 0.83 0 ± 0 0 ± 0 Phaeotheca fissurella 0 ± 0 5.83 ± 3.33 0 ± 0 0 ± 0 Cladosporium (unk. sp.) 178.6 ± 26.89 1669 ± 976.38 221.66 ± 105.17 0.2 ± 0.2 Cladosporium delicatulum 355.6 ± 93.9 582.16 ± 89.78 1511.66 ± 610.85 32 ± 27.6 Cladosporium fusiforme 0 ± 0 0.16 ± 0.16 19.83 ± 14.09 0 ± 0 Cladosporium halotolerans 4.8 ± 4.8 0 ± 0 0 ± 0 0 ± 0 Cladosporium ramotenellum 2.2 ± 1.42 4 ± 2.84 0 ± 0 0 ± 0 Mycosphaerellaceae (family) 7.4 ± 3.74 1 ± 1 0 ± 0 0 ± 0 Mycosphaerella tassiana 3855.2 ± 819.17 3484.66 ± 959.81 394.5 ± 161.02 21.4 ± 15.22 Capnodiales (order) 0 ± 0 2 ± 1.29 0 ± 0 0 ± 0 Dothideales (order) 17.6 ± 11.57 4.16 ± 2.63 0 ± 0 0 ± 0 Aureobasidiaceae (family) 6.4 ± 3.44 1.5 ± 0.95 22.33 ± 17.49 0 ± 0 Aureobasidium pullulans 1135.8 ± 281.31 1609.5 ± 337.59 6552.66 ± 2503.7 86.4 ± 55.54 Dothideaceae (family) 29.4 ± 29.4 2.66 ± 2.66 0 ± 0 0 ± 0 Celosporium (unk. sp.) 15.8 ± 14.82 2.83 ± 2 2.83 ± 2.83 0 ± 0 Dothidea (unk. sp.) 8.8 ± 4.45 0 ± 0 0 ± 0 0.2 ± 0.2 Endoconidioma populi 12 ± 7.35 5.16 ± 2.28 12.83 ± 6.06 0 ± 0 Hortaea werneckii 11.2 ± 11.2 0 ± 0 0 ± 0 0 ± 0 Dothioraceae (family) 0 ± 0 0 ± 0 5.16 ± 3.93 0 ± 0 Hormonema macrosporum 1.8 ± 1.8 2.5 ± 1.7 29.16 ± 15.3 0.4 ± 0.4 Perusta inaequalis 0 ± 0 2.83 ± 1.83 1.66 ± 1.66 0 ± 0 Sydowia polyspora 1 ± 0.63 0.16 ± 0.16 2.66 ± 2.29 0 ± 0 Dothideales (order) 0 ± 0 0.5 ± 0.5 4.5 ± 2.12 0 ± 0 Pleosporale (order) 3.2 ± 3.2 1 ± 1 0.16 ± 0.16 0 ± 0 Pyrenochaetopsis (unk. sp.) 260.4 ± 260.4 0 ± 0 0 ± 0 0 ± 0 Pyrenochaetopsis pratorum 43 ± 43 0 ± 0 0 ± 0 0 ± 0

96

Appendix D Vineyard fungal community composition in the Okanagan Valley wine region from crushed Chardonnay grapes based on 20,000 sequenced reads per sample, for the four vineyards:

Vineyards 2, 29 (n = 5) and Vineyards 8, 15 (n = 6).

Didymellaceae (family) 331.6 ± 215.78 188.83 ± 80.41 0.83 ± 0.83 0 ± 0 Ascochyta (unk. sp.) 2.2 ± 2.2 0 ± 0 2 ± 2 0 ± 0 Ascochyta medicaginicola var. 104.8 ± 104.8 0 ± 0 0 ± 0 0 ± 0 macrospora Epicoccum nigrum 2903.8 ± 1084 ± 277.42 105.66 ± 8.6 ± 4.97 592.74 52.09 Neoascochyta (unk. sp.) 8.8 ± 8.8 0 ± 0 0 ± 0 0 ± 0 Neoascochyta desmazieri 66 ± 54.64 3.83 ± 3.83 0.16 ± 0.16 0 ± 0 Didymellaceae (family) 74.2 ± 65.75 17.33 ± 4.06 4.5 ± 3.3 0 ± 0 Kalmusia variispora 0 ± 0 0 ± 0 4.5 ± 2.87 0 ± 0 Lophiostomataceae (family) 20 ± 12.73 1.66 ± 1.08 4.5 ± 4.5 0 ± 0 Lophiotrema rubi 0 ± 0 0 ± 0 3 ± 3 0 ± 0 Herpotrichia juniperi 4.2 ± 4.2 0 ± 0 0 ± 0 0 ± 0 Chaetosphaeronema (unk. sp.) 50 ± 25.94 0.16 ± 0.16 0 ± 0 1.6 ± 1.6 Phaeosphaeriaceae (family) 92.6 ± 27.01 42 ± 33.56 13 ± 7.52 0 ± 0 Alternaria breviramosa 6.2 ± 6.2 0 ± 0 0 ± 0 0 ± 0 Alternaria eureka 6.8 ± 6.8 2.33 ± 2.33 0 ± 0 0 ± 0 Alternaria infectoria 148.6 ± 59.27 62 ± 15.54 4.5 ± 3.07 0 ± 0 Alternaria rosae 22.2 ± 15.78 8.66 ± 4.55 0.33 ± 0.33 0 ± 0 Alternaria (unk. sp.) 5181.8 ± 1533.66 ± 230.5 ± 43.4 ± 1028.48 283.23 116.44 43.4 Comoclathris sedi 8.4 ± 8.4 1.5 ± 1.5 0.83 ± 0.83 0 ± 0 Comoclathris spartii 3.4 ± 3.4 0 ± 0 5 ± 5 0 ± 0 Curvularia (unk. sp.) 198 ± 42.5 4.16 ± 1.68 0.16 ± 0.16 3.6 ± 3.6 Curvularia hawaiiensis 47.6 ± 25.51 0 ± 0 0 ± 0 0 ± 0 Curvularia trifolii 20.8 ± 12.77 0 ± 0 0 ± 0 0 ± 0 Drechslera poae 22.4 ± 22.4 0 ± 0 0 ± 0 0 ± 0 Stemphylium (unk. sp.) 150 ± 127.36 33 ± 25.36 2.16 ± 2.16 0 ± 0 Pleosporales (family) 16 ± 16 0 ± 0 0.83 ± 0.83 0 ± 0 Chalastospora gossypii 1.8 ± 1.11 1.5 ± 1.02 0 ± 0 0 ± 0 Ochrocladosporium frigidarii 11 ± 11 0 ± 0 26.5 ± 13.69 0 ± 0 Thyrostroma cornicola 8.2 ± 8.2 0 ± 0 0 ± 0 0 ± 0 Preussia pilosella 45.6 ± 45.6 0 ± 0 0 ± 0 0 ± 0 Sporormiella leporina 0 ± 0 7.5 ± 7.5 0 ± 0 0 ± 0 Sporormiaceae (family) 152.4 ± 80.86 23.66 ± 14.88 2.66 ± 1.76 0 ± 0 Venturiales (order) 0 ± 0 0.5 ± 0.5 0 ± 0 0 ± 0 Venturia (unk. sp.) 3.8 ± 3.8 0 ± 0 0 ± 0 0 ± 0

97

Appendix D Vineyard fungal community composition in the Okanagan Valley wine region from crushed Chardonnay grapes based on 20,000 sequenced reads per sample, for the four vineyards:

Vineyards 2, 29 (n = 5) and Vineyards 8, 15 (n = 6).

Sarcinomyces crustaceus 19.6 ± 10.41 0.66 ± 0.49 3.66 ± 1.8 0 ± 0 Aspergillus (unk. sp.) 0.4 ± 0.4 1.5 ± 0.71 50.66 ± 49.67 0 ± 0 Aspergillus niger 0 ± 0 1.83 ± 1.47 36.83 ± 32.99 1.6 ± 1.6 Aspergillus wentii 0 ± 0 0 ± 0 98.66 ± 56.51 0 ± 0 Penicillium (unk. sp.) 39.8 ± 36.87 155.33 ± 98.01 2641.83 ± 10.8 ± 6.73 1648.59 Penicillium aurantiogriseum 0 ± 0 0 ± 0 3.5 ± 3.5 0 ± 0 Penicillium bialowiezense 0 ± 0 0 ± 0 14.66 ± 9.3 0 ± 0 Penicillium catenatum 0 ± 0 0 ± 0 43.16 ± 35.6 0 ± 0 Penicillium citrinum 0 ± 0 3.66 ± 3.66 0 ± 0 5.8 ± 5.8 Penicillium expansum 0 ± 0 0 ± 0 2.83 ± 2.83 0 ± 0 Thermomyces lanuginosus 4.2 ± 4.2 0 ± 0 0 ± 0 0 ± 0 Physcia (unk. sp.) 6.2 ± 3.95 0 ± 0 0 ± 0 0 ± 0 Erysiphe necator 217.2 ± 9141.16 ± 70.16 ± 38.75 151.4 ± 115.47 124.62 1400.9 Golovinomyces (unk. sp.) 8.4 ± 3.95 11 ± 7.89 0 ± 0 0 ± 0 Podosphaera (unk. sp.) 0 ± 0 20.83 ± 11.16 0 ± 0 0 ± 0 Podosphaera (unk. sp.) 19.8 ± 6.12 44.16 ± 13.61 8.16 ± 8.16 0 ± 0 Helgardia (unk. sp.) 9 ± 9 0 ± 0 0 ± 0 0 ± 0 Helotiaceae (family) 190.8 ± 46.2 1.5 ± 0.71 0 ± 0 1.8 ± 1.8 Claussenomyces (unk. sp.) 5.2 ± 5.2 0 ± 0 0 ± 0 0 ± 0 Tetracladium (unk. sp.) 1.4 ± 1.4 0 ± 0 0 ± 0 0 ± 0 Cadophora luteo-olivacea 309 ± 309 0 ± 0 0 ± 0 0 ± 0 Sclerotiniaceae (family) 128.2 ± 67.31 52.16 ± 29.05 42.66 ± 36.21 2 ± 1.22 Pezizales (order) 0 ± 0 0 ± 0 10.5 ± 10.5 0 ± 0 Pyronema domesticum 2.4 ± 2.4 0.5 ± 0.5 0 ± 0 0 ± 0 Tricharina praecox 0 ± 0 3 ± 3 0 ± 0 0 ± 0 Meyerozyma guilliermondii 48.2 ± 47.7 0 ± 0 1.16 ± 0.98 0 ± 0 Sporopachydermia 0 ± 0 0.66 ± 0.49 0 ± 0 0 ± 0 lactativora Dipodascaceae (family) 0 ± 0 0 ± 0 0 ± 0 1.8 ± 1.8 Metschnikowia chrysoperlae 2.8 ± 2.55 0.5 ± 0.5 10.66 ± 8.93 26.8 ± 11.71 Metschnikowia pulcherrima 0 ± 0 0 ± 0 206.16 ± 204.56 13.8 ± 6.06 Metschnikowia (unk. sp.) 7.6 ± 7.6 0 ± 0 1.33 ± 0.98 14.2 ± 14.2 Cyberlindnera jadinii 12.8 ± 12.8 0.16 ± 0.16 0 ± 0 1.8 ± 1.8 Wickerhamomyces anomalus 0 ± 0 0 ± 0 44.83 ± 30.4 1219.8 ± 818.23

98

Appendix D Vineyard fungal community composition in the Okanagan Valley wine region from crushed Chardonnay grapes based on 20,000 sequenced reads per sample, for the four vineyards:

Vineyards 2, 29 (n = 5) and Vineyards 8, 15 (n = 6).

Kregervanrija fluxuum 0 ± 0 0 ± 0 0 ± 0 8.6 ± 8.6 Pichia kluyveri 0.4 ± 0.4 0 ± 0 0 ± 0 81 ± 50.16 Pichia membranifaciens 0 ± 0 0 ± 0 2.33 ± 2.33 16 ± 15.75 Pichia terricola 0 ± 0 0 ± 0 0.33 ± 0.33 0 ± 0 Issatchenkia orientalis 0 ± 0 0 ± 0 13.16 ± 13.16 1.8 ± 1.8 Kazachstania aerobia 136.6 ± 136.6 0.66 ± 0.66 301.16 ± 121.72 0 ± 0 Lachancea quebecensis 0 ± 0 0 ± 0 0 ± 0 19.6 ± 19.6 Saccharomyces (unk. sp.) 8.8 ± 8.8 0 ± 0 0 ± 0 0 ± 0 Saccharomyces uvarum 521.6 ± 517.35 5.33 ± 5.33 772.16 ± 489.59 767.2 ± 531.01 Saccharomyces cerevisiae 322.2 ± 256.34 10.66 ± 5.38 5350.16 ± 13748.4 ± 3348.51 2428.52 Torulaspora delbrueckii 18.4 ± 18.4 0.5 ± 0.5 20.5 ± 12.96 84.8 ± 65.93 Torulaspora pretoriensis 0 ± 0 0 ± 0 336.5 ± 213.07 1356 ± 1134.01 Candida (unk. sp.) 0 ± 0 0 ± 0 1.83 ± 1.83 4.4 ± 4.4 Candida magnoliae 0 ± 0 0 ± 0 97.16 ± 97.16 0 ± 0 Candida sake 0 ± 0 0 ± 0 102.5 ± 79.24 598.4 ± 417.7 Candida santamariae 0 ± 0 0 ± 0 32.5 ± 21.29 503.6 ± 320.76 Candida sorbosivorans 0 ± 0 0 ± 0 12.33 ± 12.33 0 ± 0 Candida tropicalis 0 ± 0 0.16 ± 0.16 0 ± 0 0 ± 0 Candida viswanathii 0 ± 0 3.16 ± 3.16 0 ± 0 2.6 ± 2.6 Candida zeylanoides 0 ± 0 0 ± 0 0 ± 0 0.8 ± 0.8 Saccharomycetales (family) 4.8 ± 4.8 0 ± 0 6.5 ± 4.66 0 ± 0 Hanseniaspora 0 ± 0 0 ± 0 5.16 ± 5.16 119.4 ± 75 guilliermondii Hanseniaspora osmophila 0 ± 0 0 ± 0 20.83 ± 13.56 148 ± 143.05 Hanseniaspora uvarum 0.4 ± 0.4 0 ± 0 13.33 ± 13.33 734.8 ± 425.98 Acremonium (unk. sp.) 6 ± 6 0 ± 0 0.83 ± 0.54 0.8 ± 0.8 Nectriaceae (family) 110.6 ± 76.18 2.5 ± 1.2 0.83 ± 0.83 0 ± 0 Fusarium solani 1.8 ± 1.8 0.5 ± 0.5 0 ± 0 0 ± 0 Fusarium (unk. sp.) 138 ± 53.1 0 ± 0 0 ± 0 19.2 ± 12.09 Amphisphaeriaceae (family) 88.6 ± 26.46 3.33 ± 2.57 1.5 ± 1.5 0 ± 0 Apiosporaceae (family) 45 ± 45 0 ± 0 0 ± 0 0 ± 0 Microdochium (unk. sp.) 43 ± 43 0 ± 0 0 ± 0 0 ± 0 Coprinus foetidellus 7.4 ± 7.4 0 ± 0 0 ± 0 0 ± 0 Tulostoma fimbriatum 13.2 ± 8.32 0 ± 0 0 ± 0 0 ± 0

99

Appendix D Vineyard fungal community composition in the Okanagan Valley wine region from crushed Chardonnay grapes based on 20,000 sequenced reads per sample, for the four vineyards:

Vineyards 2, 29 (n = 5) and Vineyards 8, 15 (n = 6).

Bovista plumbea 12.6 ± 11.16 0 ± 0 0 ± 0 0 ± 0 Bovista tomentosa 0 ± 0 0 ± 0 5.16 ± 5.16 0 ± 0 Mycenastrum corium 2.8 ± 1.74 0 ± 0 0 ± 0 0 ± 0 Gymnopus (unk. sp.) 20.4 ± 14.87 0 ± 0 0 ± 0 0 ± 0 Coprinellus xanthothrix 40.4 ± 29.13 8.5 ± 3.17 0 ± 0 0 ± 0 Coprinopsis lagopus 11 ± 8.14 0 ± 0 0 ± 0 0 ± 0 Thanatephorus cucumeris 13.6 ± 13.6 0 ± 0 0 ± 0 0 ± 0 Schenella pityophila 3.6 ± 3.6 0 ± 0 1.83 ± 1.83 0 ± 0 Trametes hirsuta 11.8 ± 8.91 0 ± 0 0 ± 0 0 ± 0 Antrodia carbonica 0 ± 0 0 ± 0 5.66 ± 4.57 0 ± 0 Ganoderma (unk. sp.) 5.4 ± 4.91 10.83 ± 10.24 7.66 ± 5.01 0 ± 0 Fomes fomentarius 2.4 ± 2.4 0 ± 0 4.5 ± 4.5 0 ± 0 Lentinus squarrosulus 15.6 ± 12.48 0 ± 0 0 ± 0 0 ± 0 Peniophora (unk. sp.) 0 ± 0 0 ± 0 3.33 ± 3.33 0 ± 0 Cystobasidium pinicola 0 ± 0 0.33 ± 0.33 0 ± 0 0 ± 0 Tilletia puccinelliae 9 ± 3.47 0.33 ± 0.33 0 ± 0 0 ± 0 Malassezia (unk. sp.) 32.2 ± 32.2 0 ± 0 0 ± 0 0 ± 0 Malassezia globosa 0.8 ± 0.8 0 ± 0 0 ± 0 0 ± 0 Malassezia restricta 1.8 ± 1.2 0 ± 0 0 ± 0 5.4 ± 4.06 Malasseziales (order) 0.2 ± 0.2 0 ± 0 0 ± 0 0 ± 0 Leucosporidium (unk. sp.) 6.4 ± 4.35 0.5 ± 0.5 0 ± 0 0 ± 0 Microbotryum (unk. sp.) 1 ± 1 0.33 ± 0.33 3.83 ± 3.83 0 ± 0 Microbotryum anomalum 6.4 ± 4.5 1.16 ± 0.83 0 ± 0 0 ± 0 Spencerozyma crocea 51.8 ± 51.8 0 ± 0 0 ± 0 0 ± 0 Curvibasidium cygneicollum 0 ± 0 0.83 ± 0.65 3.33 ± 3.33 8 ± 5.69 Rhodosporidiobolus colostri 18.4 ± 9.93 0.5 ± 0.5 12.83 ± 5.68 2.2 ± 2.2 Rhodotorula (unk. sp.) 184.4 ± 184.4 0 ± 0 0 ± 0 2 ± 2 Rhodotorula babjevae 0 ± 0 0 ± 0 0 ± 0 16.2 ± 8.59 Rhodotorula mucilaginosa 0 ± 0 0 ± 0 1.5 ± 1.5 16 ± 10.75 Sporobolomyces roseus 3.2 ± 2.95 0 ± 0 2 ± 2 0 ± 0 Sporobolomyces salicinus 5 ± 5 2.83 ± 2.83 0 ± 0 0 ± 0 Melampsora epitea 14.2 ± 6.05 11.5 ± 5.43 5.33 ± 3.48 0 ± 0 Melampsora occidentalis 87.4 ± 37.57 3.66 ± 1.94 6 ± 6 0 ± 0 Pucciniastrum 12.4 ± 12.4 0 ± 0 0 ± 0 0 ± 0 goeppertianum Cystofilobasidium macerans 8.8 ± 3.92 2.83 ± 1.51 5.33 ± 2.41 0.4 ± 0.4 Guehomyces pullulans 0 ± 0 0 ± 0 0.83 ± 0.83 73.4 ± 58.31

100

Appendix D Vineyard fungal community composition in the Okanagan Valley wine region from crushed Chardonnay grapes based on 20,000 sequenced reads per sample, for the four vineyards:

Vineyards 2, 29 (n = 5) and Vineyards 8, 15 (n = 6).

Udeniomyces puniceus 5.4 ± 4.26 1.16 ± 0.98 9.33 ± 5.17 0 ± 0 Filobasidium (unk. sp.) 96.6 ± 34.03 12.16 ± 8.78 50.33 ± 18.3 0 ± 0 Filobasidium floriforme 18.6 ± 8.9 0.33 ± 0.33 0 ± 0 0 ± 0 Filobasidium magnum 61.4 ± 40.03 5.66 ± 3.02 38 ± 32.27 6.4 ± 4.22 Filobasidium oeirense 323.2 ± 323.2 0 ± 0 3.83 ± 3.83 0 ± 0 Filobasidium wieringae 43.4 ± 14.52 5 ± 3.14 5.5 ± 3.09 0 ± 0 Naganishia albida 19.2 ± 8.72 3 ± 2.29 44.66 ± 35.67 0 ± 0 Naganishia diffluens 4.2 ± 1.82 2.5 ± 2.12 3.66 ± 2.53 0 ± 0 Naganishia friedmannii 13.8 ± 13.8 1 ± 1 0 ± 0 4.2 ± 4.2 Holtermanniella takashimae 43.2 ± 24.78 1 ± 0.63 23.16 ± 19.85 0 ± 0 Vishniacozyma carnescens 0 ± 0 5 ± 4.61 0 ± 0 0 ± 0 Vishniacozyma dimennae 4.6 ± 4.6 0.83 ± 0.83 3.66 ± 3.1 0 ± 0 Vishniacozyma tephrensis 7.4 ± 7.4 1.66 ± 1.3 0.66 ± 0.66 0 ± 0 Vishniacozyma victoriae 46.6 ± 25.68 14 ± 4.33 21.33 ± 15.45 0 ± 0 Cryptococcus saitoi 0 ± 0 0 ± 0 19.83 ± 9.71 0 ± 0 Papiliotrema (unk. sp.) 0.2 ± 0.2 0 ± 0 0.33 ± 0.33 0 ± 0 Cryptococcus frias 0 ± 0 6 ± 2.22 25 ± 10.18 0.2 ± 0.2 Ustilago hordei 408.8 ± 55.1 10.66 ± 2.78 0 ± 0 0.8 ± 0.8 Wallemia muriae 0 ± 0 0 ± 0 0.5 ± 0.5 0 ± 0 Wallemia sebi 0 ± 0 0.66 ± 0.33 7.16 ± 4.74 0 ± 0 Mortierella oligospora 0 ± 0 5 ± 5 0 ± 0 0 ± 0 Mucor circinelloides 54.2 ± 54.2 11.5 ± 11.1 86.33 ± 44.62 0 ± 0 Rhizopus arrhizus 0 ± 0 0.33 ± 0.33 0 ± 0 0 ± 0

101