INHERITANCE of CHLOROPLAST DNA (Cpdna) in LOBELIA SIPHILITICA

INHERITANCE OF CHLOROPLAST DNA (cpDNA) IN LOBELIA SIPHILITICA

A thesis submitted to the Kent State University Honors College in partial fulfillment of the requirements for General Honors

Alicia Durewicz

May, 2012

Thesis written by

Alicia Durewicz

Approved by

______, Advisor

______, Chair, Department of Biological Sciences

Accepted by

______, Dean, Honors College

TABLE OF CONTENTS

LIST OF FIGURES...... iv

LIST OF TABLES...... v

ACKNOWLEDGMENTS...... vi

CHAPTER

I. INTRODUCTION...... 1-9

II. METHODS...... 10-27

III. RESULTS...... 28-32

IV. CONCLUSION AND DISCUSSION...... 33-41

REFERENCES...... 42-45

APPENDICES...... 46-52

A. List of parental sequence motifs found...... 46-48

B. List of crosses, with parent and offspring sequence motifs...... 49-52

iii

LIST OF FIGURES

Figure 1. Lobelia siphilitica...... 9

Figure 2. Map of Lobelia siphilitica populations surveyed...... 11

Figure 3. Schematic of the chloroplast psbK-rps16 region...... 12

Figure 4. Direction and location of amplification and sequencing primers...... 18

Figure 5. Repeat unit transition matrix...... 22

Figure 6 Types of organellar inheritance...... 25

Figure 7. Evidence for heteroplasmic offspring...... 26

Figure 8. Frequency of inheritance types observed...... 30

Figure 9. Diversity of inheritance types among crosses...... 32

LIST OF TABLES

Table 1. List of primers used in sequencing and polymerase chain reactions...... 17

Table 2. Unique minisatellite repeat units found in this study...... 21

Table 3. Unique minisatellite repeat motifs...... 23

ACKNOWLEDGMENTS

It is a pleasure to thank all those who have made my senior honors thesis possible.

First and foremost, I owe my deepest gratitude to my Advisor, Dr. Andrea Case. Her continuous motivation, patience, and guidance has made this project possible and a success. I would also like to thank the members of my defense committee, Dr. Soumitra

Basu, Dr. Gail Fraizer, and Dr. Helen Piontkivska, for their assistance with this endeavor.

Many thanks towards Dr. Christina Caruso and the University of Guelph for use of their greenhouse and facilities, and Dr. Eric Knox for sharing his knowledge about Lobelia siphilitica's chloroplast genome. I am also grateful to graduate students Hannah Madson and Eric Floro for their immeasurable assistance and advice. Thank you to the Honor's

College for providing undergraduates with this opportunity to challenge themselves and show their fullest potential. Lastly, I would like to thank my family and friends, but especially my parents and brother. They have been by my side throughout this entire process and have provided me with everlasting love, understanding, and support. Thank you all, without your encouragement and collaboration, this thesis would not have been possible. Thank you again.

CHAPTER I

INTRODUCTION

In eukaryotes, such as plants and animals, modes of inheritance differ among the distinct genomes within the cell. In general, nuclear genomes are inherited bi-parentally.

Mendelian laws state that half of the offspring's nuclear DNA is inherited from the mother, and the other half is inherited from the father. However, organellar (mitochondria and chloroplast) genomes are usually uniparentally inherited. This is considered to be a rule with few exceptions across all eukaryotes (Birky, 1995), and forms the basis for many assumptions about the evolution of cytoplasmic and nuclear genomes.

In 1909, two researchers (Baur, 1909 and Correns, 1909 as cited in Birky, 1995 and Xu, 2005) were the first to document patterns of organellar inheritance in two plant species: Pelargonium zonale (Geraniaceae) and Mirabilis jalapa (Nyctaginaceae).

Correns (1909, as cited in Birky, 1995) observed chloroplast inheritance by mating wild type (green) mothers with mutant (variegated green and white) males. His findings showed uniparental inheritance (receiving only one parent's genome) of the chloroplast phenotype. All of the offspring displayed the mother's green phenotype and did not show evidence of the father's variegated phenotype. It was Baur (1909, as cited in Birky, 1995) who noticed offspring of P. zonale inherited chloroplasts from either the mother only, the father only, or from both parents. Much later, Kuroiwa et al. (1992) discovered that the variegation in these, and many other plants, was due to a mutation in the chloroplast genome. Since mitochondria and chloroplasts play a vital role in the life of a cell,

1 2

mutations can possibly increase or decrease the fitness and survival of individuals. The idea of alternative inheritance patterns led researchers to focus on the distinct genomes located in these important organelles, and discover the possibilities of why different patterns exist.

The main hypothesis for uniparental cytoplasmic inheritance is based on the consequences of interactions between the nucleus and the organelles to the organism

(Law and Hutson, 1992; Burt and Trivers, 2006). Burt and Trivers (2006) posit that during early evolution of the cell, if two precursors to organelles (mitochondrial precursors in their review) were present in the cytoplasm, the more "selfish" precursor would have proliferated. By "selfish" genome, they mean, the smaller of the two, which replicates the quickest, and becomes the more dominant because of its replication advantage. However, this "selfish" genome could have been detrimental to the cell. If it replicated faster because it was missing important genes, such as DNA coding for metabolic processes, the host cell would be at a disadvantage. Thus, natural selection favored mechanisms enforcing uniparental inheritance. Cells with only one organellar genome would have no within-individual conflict, and have a higher chance of passing on this pattern of inheritance to future generations.

Limiting the presence of these "selfish" genomes is not the only benefit to uniparental inheritance. Heteroplasmy, the occurrence of two or more unique organellar genomes, may also have detrimental effects on an individual even if they replicate at the same rate. The first consequence of having two distinct organellar genomes could result in miscommunication between the nuclear genome and the organellar genomes in

question. Schwartz and Vissing (2002) published data on a 28-year old man who had paternal mitochondria in his muscle cells, but maternal mitochondria in all other cells.

This would not normally be a problem, but the paternal line had a two-nucleotide base pair (bp) deletion that caused him to have troubles with exercising. Additional studies have associated many mitochondrial diseases with heteroplasmy (reviewed in Chinnery and Turnbull, 2000 and Chinnery et al., 2002). In these cases, a mutant and a wild-type mitochondrial DNA (mtDNA) coexist within the cells. It is these mtDNA mutations, which have been linked to a variety of diseases such as Kearns-Sayre syndrome (Zeviani et al., 1988; Moraes et al., 1989), diabetes, and deafness (Reardon et al. 1992).

The second consequence of heteroplasmy does not harm the individual, but rather, changes how biologists track the evolution of a species through individual lines of descent (Galtier et al., 2009). Geneticists assume uniparental inheritance when using organellar genetic markers to study maternal lineages of a single species or find a single most recent common ancestor of multiple species. In human studies, the mitochondrial

DNA is used to ascertain a person's nationality of origin (Ayala, 1995; Behar et al.,

2008). In most cases, uniparental inheritance of organellar genomes is maternal.

However, if heteroplasmy is present, the mode of inheritance is not necessarily uniparental. Although heteroplasmy can be produced de novo through mutation within a host, it seems more likely that both haplotypes will be passed on to subsequent generations if the heteroplasmy results from a previous occurrence of bi-parental inheritance or paternal leakage (when an individual inherits the organellar genome from both the father and the mother). There have been few studies looking at how

heteroplasmy arises (Pearl et al., 2009). But, for a de novo mutation to be passed to future generations, this mutation must occur in germ line cells. Otherwise, the two haplotypes will be lost when the organism dies. However, if a mother and father both pass on their haplotypes to an offspring, there is a greater chance that the two genomes will be present in most of the somatic and germ line cells since both haplotypes are found in the zygote.

If the mode of inheritance is different than once thought, studies based on genome inheritance could be misinterpreted (Avise et al., 1987; Dumolin et al., 1995).

Furthermore, if non-uniparental inheritance occurs at appreciable frequencies in all eukaryotes, then evolutionary geneticists must revisit assumptions based on the rules and cellular regulation of organellar inheritance.

In the past decade, studies and reviews provide overwhelming evidence that organellar genomes almost always follow strict uniparental inheritance (Birky, 1995), although it is not always maternal, and can differ between organelles. In the plant kingdom, gymnosperm mitochondrial DNA (mtDNA) is predominantly inherited from the maternal parent, while the chloroplast DNA (cpDNA) is paternally inherited (Neale and Sederoff, 1989; Xu, 2005). In contrast, various inheritance studies on angiosperms

(flowering plants) have shown both organellar genomes almost always following strict maternal inheritance (Sears, 1980; Corriveau and Coleman, 1988). With overwhelming evidence of strict uniparental organelle inheritance, alternative patterns are not normally tested (Ellis et al., 2008).

Recently, researchers have delved into the possibility of alternate patterns of organellar inheritance within the flowering plants. Several studies have provided

evidence of non-maternal inheritance where individuals exhibited paternal leakage, bi- parental inheritance (Hansen et al., 2007; Ellis et al., 2008), and heteroplasmy (Johnson and Palmer, 1989; Frey et al., 2005; Floro, 2011) in several species of plants. Since inheritance testing has not been a priority in the past, the prevalence and frequency of non-maternal inheritance across flowering plants is not yet known. With this new evidence, researchers must now focus on documenting inheritance patterns across species, and not limiting data collection to only model organisms such as Arabidopsis thaliana (Brassicaceae), Zea mays (Poaceae), and Medicago truncatula (Fabaceae)

(Wege et al., 2007).

The goal of this Honors Thesis project is to describe patterns of chloroplast inheritance in the plant species, Lobelia siphilitica (Lobeliaceae). This species was chosen because preliminary data suggested the potential for non-maternal inheritance of the chloroplast genome (Dr. Eric Knox, Indiana University, unpublished data). Dr. Knox collected four naturally pollinated maternal families from one population in Indiana and sequenced the highly variable region psbK-rps16 of the chloroplast genome. In three of the families, not all of the offspring had the same haplotype as their mother. If strict maternal inheritance was followed in this species, all offspring should all have matched each other and their mother.

My Honors project was designed to test the rule of maternal inheritance in the chloroplast genome in L. siphilitica. Based on preliminary data, I predicted that chloroplast inheritance may not be strictly maternal in this species. I used DNA sequencing to characterize a single intergenic chloroplast region (psbK-rps16) in a large

sample of individuals. This region is a second reason why L. siphilitica was chosen as the ideal study species—the locus contains a hypervariable imperfect 49-bp minisatellite locus. Minisatellites are a classification of VNTRs (variable number of tandem repeats) that range from 10 to 64 bases. These VNTRs are copies of the same repeat found in the non-coding region of the DNA. (Conner and Hartl, 2004). In the L. siphilitica cp microsatellite, the number of repeats ranges from two to 11, and the repeat pattern is imperfect, meaning that each repeat unit can have a different motif sequence. This results in very high variability among individuals, and makes it easy to identify a large number of unique haplotypes as well as identify heteroplasmic individuals by their sequences. By crossing two individuals with different chloroplast haplotypes, then sequencing their offspring, I could definitively observe which parent's haplotype(s) were inherited.

A range of different types of inheritance patterns is possible. I first categorized them into uniparental versus bi-parental. Uniparental inheritance falls into three subcategories: maternal, paternal, and uniparental with heteroplasmy (the offspring receives one or both genomes from a heteroplasmic parent). Individuals with uniparental inheritance will inherit their genome from only one parent—either from the mother or the father. Furthermore, uniparental inheritance with heteroplasmy can be broken down into two more subcategories: uniparental inheritance with known heteroplasmy, and uniparental inheritance with cryptic heteroplasmy. Individuals in the first category will have a mother who is known to be heteroplasmic, and the offspring will have either one or both of the mother's genomes. In the second category, mothers are assumed to be cryptically heteroplasmic when the offspring do not match the mother or father.

However, since paternal inheritance is rare, it is more likely the mother had two haplotypes and only passed on the non-detected haplotype. The offspring receive one of the mother's two genomes, but during analysis of the mother, only one genome was found. Individuals with bi-parental inheritance will have two distinct genomes, one from the mother and one from the father.

Lastly, Lobelia siphilitica was chosen for this study because of the unique way that sex is determined. This species follows a type of dimorphic breeding system found in plants called gynodioecy. Populations of gynodioecious plants are made up of female and hermaphrodite sexes (Bailey and Delph, 2007). In most gynodioecious plants, sex is determined by an interaction between genes in the mitochondrial genome and alleles in the nuclear genome. Females arise if they carry cytoplasmic male sterility (CMS) genes in their mitochondrial genome; the expression of CMS genes cause the organism to become male sterile and have a female phenotype (Figure 1B). At the same time, the nuclear genome can carry genes called fertility restorers that restore the male phenotype, even when CMS genes are present in the mitochondria (Delph et al., 2006; McCauley and Bailey, 2009). Since femaleness is linked to the mitochondrial genome, finding evidence of non-maternal inheritance of either cytoplasmic genome would shed light on how sex ratios evolve in natural populations (Wade and McCauley 2005; McCauley and

Olson, 2008).

By sequencing chloroplast DNA from parental and offspring tissue from Lobelia siphilitica, I addressed the following questions:

1. What is the common form of chloroplast inheritance in L. siphilitica?

2. How often is heteroplasmy found in L. siphilitica?

3. Do populations exhibit different frequencies of inheritance types?

Figure 1. Lobelia siphilitica

Figure 1A shows a hermaphroditic individual found in a natural population. Figure 1B illustrates the difference between a female flower, and a hermaphrodite flower. The hermaphrodite flower (top) has a grey anther cylinder filled with viable pollen grains, while the female flower (bottom) has a white, vestigial anther cylinder that contains no pollen. Photos by Hannah Madson, A, and Maia Bailey, B, (used with permission).

CHAPTER II

METHODS

Lobelia siphilitica, commonly known as Great Blue Lobelia, is an herbaceous perennial found throughout eastern North America near water sources, such as lakes, rivers, and wet meadows. This species produces small (3 cm long) blue flowers from July through September, and is predominantly pollinated by bumblebees (Johnston, 1991a;

Caruso, 2006). Even though the species is gynodioecious (having both female and hermaphrodite gendered individuals in populations) and self-compatible, hermaphrodites do not normally self-pollinate (Johnston, 1991b). This was important when selecting a species for doing a series of controlled cross-pollinations, so contamination of results due to self-pollination would not be an issue. However, perfect flowers were emasculated

(male parts removed) prior to all hand pollinations.

The inheritance of cpDNA was analyzed through controlled crosses between parents with different cp genomes, and this study was performed in three stages:

• Stage One: mothers from six L. siphilitica populations were crossed with fathers

from 12 populations (Figure 2) under favorable greenhouse conditions.

• Stage Two: the parents were harvested and sequenced at cp locus psbK-rps16

(Figure 3). Sequencing of the parents was done to find 48 crosses with parents

having distinct cp genomes. The parental cp must be different to ensure the

offspring's haplotype can be associated with their maternal and/or paternal

parents.

10 11

Figure 2. Map of Lobelia siphilitica populations surveyed

Circles represent 19 natural Lobelia siphilitica populations in Illinois, Indiana, Ohio and

Ontario. Seeds (parental generation) were collected from field plants (grandparent generation) for use in controlled crosses. Purple circles represent source populations for female dams, green circles represent source populations for hermaphroditic sires, and circles with both colors represent populations of both dams and sires. Population abbreviations are shown in blue text.

Figure 3. Schematic of the chloroplast psbK-rps16 region

This schematic shows the intergenic region being analyzed in this study. Three functional genes and one unknown open reading frame (ORF262) are represented by the boxes: psbK, found in photosystem II; trnQ, a glutamine-specific transfer RNA; rps16, a ribosomal protein subunit. The open triangle represents a 94-bp repeat. The green triangle represents a hypervariable minisatellite locus.

• Stage Three: tissue from 4-14 offspring per cross (mean=6 offspring, total N=54

crosses) was collected and sequenced.

Stage One. Seeds (referred to as the parent generation) were collected separately from 89

L. siphilitica plants (hereafter the grandparent generation) in each of 19 natural populations across Illinois, Indiana, Ohio and Ontario (Figure 3), including the Indiana population (YW) was where non-maternal inheritance was initially observed. These seeds were grown to maturity in a greenhouse at the University of Guelph, Ontario, Canada.

When the parental individuals reached the adult stage, several floral buds were collected into individual bags filled with silica gel desiccant and sent to Kent State University for

DNA extraction and sequencing (Stage Two). These bags were labeled with the population name, grandmother's identification number, and a unique number identifying the parent plant. The remaining buds were used in controlled crosses as either a dam or a sire. Figure 1 identifies populations according to which individuals were used as dams

(female plants) and which individuals were used as sires (hermaphrodite plants). All of the dam populations contained females, while many of the sire populations did not contain females.

Stage Two. I started my research at this stage once the parental tissue was received from the University of Guelph. Chloroplast DNA was extracted (as described below) from the

bud tissue, sequenced, and characterized based on cp haplotype. At this stage, seeds

(referred to as the offspring generation) from the controlled crosses in Stage One were individually planted in the same greenhouse conditions as the parent generation.

Stage Three. Shortly after germination, 6 whole seedlings from each cross were collected and bulked by cross into bags of silica gel desiccant. These were labeled with cross identification numbers and sent to Kent State University. Upon arrival, the dry seedlings were separated and placed into separate bags. Since the seedlings were dried, separation was done with extreme care. Sterilized forceps were used to handle the plants. Once a plant was separated from the bulk, it was immediately placed into a separate silica bag and assigned a unique identification number. To prevent contamination, only whole individuals were placed in individual bags. Any debris from broken tissue was discarded, and before the next cross was separated the lab bench was cleaned with a kimwipe soaked in ethanol. The offspring were then prepared for DNA extraction and sequenced

(as described below).

Some crosses did not have enough viable tissue for the extraction process, or the crosses showed peculiar sequencing results, so a second shipment of 6 to 8 larger individuals from each cross were sent to KSU to increase the sample size. These individuals were placed into separate bags and labeled with identification numbers prior to shipping. Upon arrival, DNA was extracted and analyzed in the same manner as the previous parents and offspring.

Basic DNA Extraction Protocol: Extraction protocol was modified from the CTAB procedure appropriate for extracting DNA in 96-well plate format. Individuals were placed in single wells of 96-well plates and stored in a -80°C freezer for at least 24 hours prior to extracting the DNA. This was done to ensure the specimens were completely frozen before tissue disruption. The bead-beating tissue grinder used for extraction was a

Genogrinder 2000 (Spex Sample Prep, Metuchen, NJ, USA), and samples were ground at a rate of 500 beats per minute. Samples were left in a freezer overnight for while cleaning with isopropanol. After the tubes air dried overnight, they were eluted with 100µL of nanopure H2O was added to each tube. This was then kept in the refrigerator for 24 hours so a 1:10 dilution plate of working stock DNA could be made and used as a template for

PCR. After creation of the dilution plate, the original plate was kept in the -20°C freezer.

The more complete and extensive protocol is available at the following website: http://openwetware.org/wiki/Mimulus:DNA_Extraction_Protocol.

Parental Tissue Extraction: For each parental plant, 1-2 flower buds were placed in individual wells of a 96-well plate to provide enough tissue for proper extraction. The

CTAB used was a specific mixture for corolla tissue and the mixture is as follows:

100mM Tris (pH 8), 1.4 M NaCl, 20mM EDTA, and 2% CTAB. Later extractions of remaining parental tissue required one bud to be placed in individual wells. This was done to find evidence of vegetative sorting and help record instances of heteroplasmy.

Offspring Tissue Extraction: Offspring tissue samples ranged from whole individuals 1-4 cm in total length (for those collected as seedlings), to large leaves around

6 cm in length. All tissue was leaf tissue and the specific CTAB mixture used was:

100mM Tris (pH 8), 1.42 M NaCl, 20mM EDTA, 2% CTAB, 2% PVP 20, and 5mM ascorbic acid.

Polymerase Chain Reactions (PCR). For PCR, a master mix was made to carry out the reaction: 15.4µL of aH2O, 2.5µL of 10x reaction buffer, 2.0µL of MgCl2, 0.5µL of dNTPs (10µM), 1.0µL of forward (F) primer (5µM), 1.0µL of reverse (R) primer (5µM), and 0.1µL of GoTaq DNA polymerase (Promega Corporation, Fitchburg, WI, USA).

Table 1 shows all forward and reverse primers used in these reactions. Figure 4 shows the areas and direction the primers amplified. PCR tubes were then set up in a plate on ice and 22.5µL of master mix was added to each tube. Then, 2.5µL of template DNA from the dilution plate was placed into individual PCR tubes. The tubes were then centrifuged briefly and put into thermocycler. The profile for the thermocyler is as follows: step one

90°C for 5 minutes, step two 94°C for 30 seconds, step three 53°C for 20 seconds, step four 72°C for 1 minute and 30 seconds, step five 72°C for 5 minutes, step six 4°C until needed. Steps two through four were repeated thirty-five times until proceeding to step 5.

Gels were then run to confirm if the PCR reaction ran correctly.

Table 1. List of primers used in sequencing and polymerase chain reactions

Forward Primer Names Sequence

[2] Lt013173R(297)psbK 5'-AAAAAAGCATAGGCCTCGGG-3'

[8] LsA012737R(425)B2 5’-GGGTTTTTGAAGTTCCATCGG-3’

[12] LsA013054R(328)B2 5'-ATGTATAGTTGCTAACAGAGCC-3'

Reverse Primers Names

[9] LsA012641F(426)B2 5’-CAAATAAGAGTATATGCACGAATAGC-3’

[10] Lt011571F(427)rps16 5’-GCAACGATTYGATAAGCCGC-3’

[15] Inteseqfor10 5’-AGTCATTGGTTCAGTCGGTA-3’

[331] LsA011964F(331)B2 5’-CCGTTCCGGTGTTGCCCTACC-3’

This table shows the primers used in the PCR reactions and sequencing. The full name is given in the first column, with the short name in brackets, and the sequence of the primer is in the second column starting with the 5' end. Primers 9 and 2 were used to detect a

DNA template in samples that were difficult to amplify. All other primers were used to amplify the psbK-rps16 region needed for analysis. Refer to Figure 4 for direction and location of primers. Primer 331 was used in sequencing all individuals. A basic Sanger reaction requires mixing the double-stranded product, a primer (I used primer 331), deoxynucleotide triphosphates (dNTPs), fluorescently labeled dideoxynucleotide triphosphates (ddNTPs), and a DNA polymerase.

Figure 4. Direction and location of amplification and sequencing primers

The area shown is the 49-bp minisatellite and 94bp-repeat section of psbK-rps16. For a full schematic, refer back to Figure 2 for the general location of the repeat and Table 1 for details about each primer. The arrows indicate the direction of amplification for each primer. To amplify the region, one forward primer (2, 12, or 8) must be used in conjunction with a reverse primer (9, 331, 15, or 10). Primers 9 and 2 were used to confirm DNA was present in samples where we had difficulty amplifying the minisatellite region.

Sanger Sequencing Reactions. Successful PCR products and negative controls were sent to MacrogenUSA (Rockville, MD, USA) to be sequenced using chain-terminator sequencing and run on a 3730xl DNA Analyzer (Applied Biosystems, Carlsbad, CA,

USA). Plates were prepared by loading 10µL of double-stranded PCR product to individual wells. Full plates (96 samples of successful PCR products) and a 1:5 dilution of primer 331 were sent within two weeks of completing the PCR reactions. The primer and polymerase initiate strand synthesis, and either add a dNTP or a fluorescently labeled ddNTP to the new single strand of DNA. If a ddNTP is added, synthesis of that strand ceases. Dideoxynucleotide triphosphates terminate the chain due to the absence of the 3' hydroxyl group. Without the 3' hydroxyl group, a new phosphodiester bond cannot be formed, thus terminating replication. This reaction is repeated multiple times to ensure a ddNTP is added at each position along the template sequence. After the reaction completes, the sequencer analyzes and records the color and intensity given off by each fragment.

Analysis of Sequencing Results. Results in ABI Format were downloaded via the internet.

Once the file was received, the individual sequences were imported into the program

Sequencher (GeneCodes, Ann Arbor, MI, USA). To identify individual base pairs, the

Sequencher program displayed the information from MacrogenUSA as a chromatogram. The colors used for base pairs are as follows: black for guanine, blue for cytosine, green for adenine, and red for thymine. The higher the peak, the stronger the signal given by the base found at that location. The ends of the sequences were

automatically trimmed to cut out the unusable beginning and ending regions. In these areas, the peaks are not recognizable due to the primers binding to and releasing from the

DNA template. Parental sequences were placed into a large "parents only" contig and aligned by eye against a consensus strand.

All sequences for parents were grouped into contigs. These were unambiguously aligned at an area where all sequences were identical. Then, the 49bp-repeats and other unique sequence markers were marked in the consensus sequence for later haplotype identification. If one strand had fewer repeats, a gap was inserted into the individual strand to allow the ending sequences (which also do not differ among individuals) to align. More sequences were then added, and gaps were appropriately addressed. This was done until all the parental sequences were imported into the contig.

Offspring sequences were prepared similarly to the parents. The ends were trimmed and imported into a separate "offspring only" contig. Again, the consensus strand was labeled to aid in haplotype identification.

Next, the offspring and parents were given haplotype repeat motifs. The parental sequences were identified and named using BLAST, and manual identification. I identified each motif in individual sequences and assigned a letter to each repeat unit of the motif (Table 2). Table 3 shows all sequence motifs found in the parents and offspring.

Appendix A shows all parents and their haplotype sequence-motifs.

Then, a third and final Sequencher project was created with separate contigs for each cross. Mother, father, and offspring sequences of the appropriate cross were imported into individual contigs and aligned. This was done to better visualize which

Table 2. Unique minisatellite repeat units found in this study

Identifier Sequence of individual 49 base pair minisatellite repeat units A ACTTTCTTTTCTATTTTCATGTTATATTCGCGAATTTAATTTTTTATTA B ACTTTCTTTTCTATTTTCATGGTATATTCGCGAATTTAATTTTTTATTA C ACTTTCTTTTCGATTTTCATGGTATATTCGCGAATTTAATTTTTTATTA D ACTTTCTTTTCGATTTTCATGGTATATTCGCGAATTTAATTTTTTTTTA F ACTTTCTTTTCTATTTTCATGTTATATTCGCGAATTTAATTTTTTTTTT G ACTTTATTTTCTATTTTCATGTTATATTCGCGAATTTAATTTTTTATTA H ACTTTATTTTCTATTTTCATGTTATATTCGCGAATATAATTTTTTATTA J ACTTTATTTTCTATTTTCATGTGAAATTCGCGAATATAATTTTTTATTA K ACTTTCTTTTCTATTTTCATGTGAAATTCGCGAATATAATTTTTTATTA L ACTTTATTTTCTATTTTCATGTGAAATTCGCGAATTTAATTTTTTATTA M ACTTTCTTTTCTATTTTCATGTGAAATTCGCGAATTTAATTTTTTATTA

This table shows the sequences of 11 different 49-bp repeat units in the minisatellite region that were observed in this study. All individuals in the study were given a haplotype motif identifier based on the number and sequence of the repeat units. The number of repeat units ranged from two to 11, and there were 31 unique motifs in total

(see Table 3). The red letters in the each sequence indicate a point mutation relative to sequence A.

Figure 5. Repeat unit transition matrix

This network illustrates the point mutations that distinguish the sequences of unique 49- bp repeat units of an imperfect minisatellite locus in the cp genome of Lobelia siphilitica.

The letters inside the squares are the haplotype identifiers corresponding to the sequences in Table 2. The lines connecting the vertices each represent a single point mutation; letters identify the alternate nucleotide bases and the numbers indicate the position of the mutation within the 49-bp sequence.

Table 3. Unique minisatellite repeat motifs

Sequence Motifs BBB BD BBBB CCCC BBBBB CCCCCD BBBBBB JAKKKAKGK BBBBBBB JAKKKKKAKGK BBBBBBBB JGKAK BBBCCCCD JGKGK BBCCCCCBD JGKGKGK BBCCCCD JGKKKGKAK BCCBCCC JGKKKGKGK BCCCBCCC JGKKKJKGKAK BCCCC JGKMKAK BCCCCC JGKMKAKAK BCCCCCCC KGKGKGKGK BCCCCCCCCC KGKKKGK BCCCCD

Table 3 shows all unique haplotype sequence-motifs found in the study. The length ranges from 2-11 repeats. A total of 31 unique haplotypes were found in this study.

parent the offspring matched, and confirm haplotype analysis from the offspring only and parent only contigs. Refer to Appendix B for a list of all parent and offspring haplotypes by cross.

Lastly, individuals were screened for how many and whose genomes they inherited (Figure 6). Individuals were marked as homoplasmic (having only one visible cp genome- either maternal or paternal) if every base pair had only one colored peak, heteroplasmic (having two copies of the cp genome) if base-pair locations had two distinct peaks (Figure 7), or cryptically heteroplasmic if some offspring did not match either parent. It is possible that the father could have been cryptically heteroplasmic and the offspring experienced paternal inheritance. We assumed the mother was cryptically heteroplasmic if the offspring's repeat motif was found elsewhere in the population and not found in the father's population. Also, we would have assumed a father was cryptically heteroplasmic if the offspring's repeat motif matched motifs found in the paternal population and not the maternal population. The offspring would have then been classified as paternal inheritance with cryptic heteroplasmy. A final explanation is a de novo mutation in the minisatellite between generations resulting in a unique haplotype in the offspring. I could distinguish cryptic heteroplasmy from de novo mutation using sequence variation outside of the minisatellite, which should be identical with de novo mutation, but not necessarily with heteroplasmy. A library of complete psbK-rps16 sequences for each unique haplotype was available in the Case lab at Kent State (H.J.

Madson, unpublished data).

Figure 6. Types of organellar inheritance

Figure 6 illustrates the different types of inheritance found in offspring of Lobelia siphilitica. Squares=mothers, circles=fathers, and triangles=offspring. Symbol colors represent unique cp haplotypes; solid symbols indicate a single haplotype was detected

(homoplasmy) and split symbol colors indicate two haplotypes were detected (known heteroplasmy). Dashed lines indicate potential biparental inheritance during a previous generation leading to either observed or cryptic heteroplasmy. A, B, and C show three types of maternal inheritance: (A) all offspring receive the mother's haplotype; (B and C) offspring receive one or both of a heteroplasmic mother's known or cryptic haplotypes;

(D) paternal inheritance in one of four offspring; (E) biparental inheritance resulting in heteroplasmy in one of four offspring.

Figure 7. Evidence for heteroplasmic offspring

Figure 7 shows a chromatogram of a small portion (X bp or give position coordinates) of the cp minisatellite for three individuals involved in a single cross. The top box shows the sequences of the mother, the father, and one offspring, plus a consensus sequence.

Parentheses and asterisks below the consensus sequence demarcate two complete repeat and one partial unit of the minisatellite. The dark blue shading of the offspring sequence indicates poor sequence quality, which could indicate heteroplasmy. Red colons in the father’s sequence indicates a gap for alignment purposes, and corresponds to the father having two fewer repeat units than the mother. The bottom box shows the same individuals, but with the corresponding base-call peaks. The mother and father have only one clear peak at each base position. The offspring is inferred to be heteroplasmic because it shows double peaks at most positions⎯one peak matching the mother, and the other matching the father. Also, the double peaks are half of the height of single base peaks, consistent with a read of two distinct sequences that share bases at some positions.

CHAPTER III

RESULTS

Parental results. A total of 143 parents were sequenced. A full list of parental repeat motifs can be found in Appendix A. I was able to support the preliminary observations of either variable inheritance or heteroplasmy by comparing sequences of parents that were maternal siblings. There were two cases where two parents from the same maternal family had sequences that differed from each other. Each sibling pair was from a different source population (JWS and MAR). The two haplotypes in each case were highly divergent, and could not have resulted from a de novo mutational event. Although the number of plants per population that I sequenced was small, it is interesting to note that these two plants were both hermaphrodites from sire populations.

There were also two cases of known heteroplasmy in the parental generation (MR

F2 23 and YW F4 10). Both of these individuals were used as dams; no sires were found to be heteroplasmic. These two dams were sequenced multiple times, and DNA was extracted from multiple buds. By extracting DNA from the different buds, I was able to repeat evidence of two distinct chloroplast genomes (Appendix A, yellow shading). In both cases, the parent showed evidence of two distinct repeat motifs (a long and short version). The short version, in each case, could have been derived from a deletion of several repeat units from the longer version, as all of the repeat units in the short version were present in the same order in the longer version. In both crosses, only one of the

28 29

maternal repeat motifs was passed on to the offspring (Appendix B). Heteroplasmy in both individuals could have resulted from a deletion of some of the repeat units.

Heteroplasmy in parent YW F4 10 (mother in YW 3.1 and 3.2) is likely to have involved a deletion. The mother was heteroplasmic for a long and short sequence (BBCCCCCBD and BD; see YW F4 10 in Appendix A). Compared to the longer form, seven leading motifs were missing from the shorter form as well as the 94bp-repeat section, which is upstream from the minisatellite locus (see Figure 4). This is unusual since every other individual had at least one of the two 94bp-repeats.

When sequencing individual buds from the parents in question, two YW F4 10 buds were homoplasmic for the shorter (BD) repeat motif, and one bud was heteroplasmic for the long (BBCCCCCBD) and short (BD) motifs. Individual buds from

MR F2 23 were homoplasmic for either the long (BBBBBB) or short (BBB) motifs. Both of these plants were females from dam populations.

Summary of inheritance patterns across all offspring. A total of 353 offspring were sequenced (Appendix B). Across the whole sample, a majority (98%) of the offspring showed maternal inheritance of the chloroplast genome; 1% showed bi-parental inheritance, and 1% showed paternal inheritance (Figure 8). Within maternal inheritance,

13% of individuals exhibited maternal inheritance from a mother with known or cryptic heteroplasmy.

Figure 8. Frequency of inheritance types observed

This figure demonstrates how often a mode of inheritance occurred across all of the offspring analyzed. Refer to Figure 6 for definitions of inheritance types.

Analysis by cross. A vast majority (80%) of the crosses showed strict maternal cp inheritance in all offspring (Figure 9). Furthermore, there was at least one offspring in every cross that inherited its mother's chloroplast type. In 3 of the 4 crosses where a mother was known to be heteroplasmic, all six offspring inherited only one of the mother's two haplotypes (see Appendix B3). In cross YW 3.1, one offspring possibly received both of the mother's haplotypes. This individual was also not included in the summary data because I was unable to obtain clean sequences after several runs.

Cryptic heteroplasmy was found in three crosses, but at least one offspring received the mother's detected repeat motif. Bi-parental inheritance was found in two crosses. Again, a majority (9/13) of the offspring in these crosses showed maternal inheritance, while three showed bi-parental inheritance. Paternal inheritance was found in only one cross, where two out of the six individuals had the father's repeat motif.

Cross YW 7.1 was inconclusive; two individuals received their father's genome, however the other individual's sequence motif can not yet be determined because the sequence quality was low in repeated sequencing reactions. The offspring are heteroplasmic, but it is not yet known if this is due to bi-parental inheritance, or cryptic heteroplasmy. Further investigation will be needed to discern their sequence motif. These individuals were not included in the individual summary data (Figures 8 & 9).

Figure 9. Diversity of inheritance types among crosses

The six rows represent the populations where the mothers were collected (purple circles in Figure 3). The 12 columns represent the populations where the fathers were collected

(green circles in Figure 3). Inheritance types found in the 54 crosses are indicated by the color of the square. A majority of the crosses and populations followed strict maternal inheritance. A full red box indicates a cross in which every offspring in the cross showed maternal inheritance. The other colored squares indicate at least one individual in that cross exhibited an alternative mode of inheritance. For instance, in cross PS x CR, at least one offspring showed evidence of bi-parental inheritance. Boxes split on the diagonal indicate two crosses made between those two populations, each with a different outcome.

CHAPTER IV

CONCLUSION AND DISCUSSION

A majority of Lobelia siphilitica offspring followed strict maternal inheritance of the chloroplast genome with a few individuals showing paternal and bi-parental inheritance. There were no crosses where every individual had non-maternal inheritance or heteroplasmy, and every cross had at least one offspring showing maternal inheritance.

It is unknown why certain populations show differences in inheritance, and others only show strict maternal inheritance. Further investigation is needed to help confirm result, search for mechanisms of cp inheritance and the possible effects on sex ratio.

To test the power (β) of my results, I used Milligan's (1992) power analysis of a binomial distribution equation: β = 1 - (1 - P)N, where P is the probability of paternal transmission (0.006), and N is the sample size (353 offspring). My results returned a power analysis of 0.88. In most cases, the β should be large so one does not falsely accept strict maternal inheritance. The value of my power analysis allows me to accept maternal inheritance, while also indicating paternal inheritance could still be a possible mode of transmission in Lobelia siphilitica.

Possible mechanisms of maternal organellar inheritance. To understand why chloroplast inheritance varies among Lobelia siphilitica populations, the mechanism of organellar inheritance must be found. There are many possibilities for how maternal organelles are passed from generation to generation. Nagata (2010) focuses on two. First, during

33 34

meiosis in male tissues, organelles are excluded from the generative cells of pollen.

Pollen grains contain two types of cells: vegetative (non-reproductive) and generative cells (containing sperm). If the organelles are excluded from the sperm in the generative cell, the fertilized egg will never receive paternal organelles. The second proposed mechanism states that organellar DNA is digested in the mature sperm cells. Like the first method, the organelles never have a chance of entering the egg. However, these are only two possibilities. Birky (1995) states that transmission of the organelle genomes can be stopped at any point in the reproductive cycle. For example, it is shown in mammals, that sperm mitochondria are marked with ubiquitin (a marker for protein degradation). After fertilization, the ubiquitin is amplified and the paternal organelles are destroyed (Burt and

Trivers, 2006). A similar method could be present in plant cells.

However, previous studies have shown that mitochondria and chloroplasts can be inherited from different parents, particularly in gymnosperms (Neale and Sederoff, 1989;

Fauré et al., 1994). Also, because paternal inheritance and bi-parental inheritance are more common than once thought, mechanisms regulating chloroplast and mitochondrial inheritance must be examined independently.

Although heteroplasmy is most likely to arise through bi-parental inheritance, it can be maintained or lost within lineages even under maternal inheritance. In this study, I found one individual that inherited both genomes from a heteroplasmic mother. Yet, the rest of her offspring only received one haplotype. This could result from vegetative sorting. During mitosis and meiosis, daughter cells can inherit different ratios of mitotypes by chance. This process can take place across the entire plant, the flower buds,

or individual ovules, which results in different haplotype distribution in the offspring and the parent. Eventually, one flower bud could have had a majority of ovules with only one haplotype (leading to apparent maternal inheritance) and another flower could have had ovules with both haplotypes. If the eggs with both copies were fertilized, then the offspring would, in turn, be heteroplasmic.

A second way for heteroplasmy to occur without bi-parental inheritance is through mutation. Some copies of a haplotype could undergo a deletion and be passed to further generations along with the non-mutated copy. Two parents in this study (YW F4

10 and MR F2 23) were heteroplasmic for short and long haplotypes. It is unknown if the mutation occurred de novo in the parent, or de novo in a previous generation.

Differences of inheritance patterns among populations. As one can see, modes of inheritance not only vary from cross to cross, but from population to population. Two of the dam populations in this study (BVII and CAR) showed evidence of strict maternal inheritance across all sires. Every offspring received the mother's haplotype, and there was no evidence of heteroplasmy. Interestingly, one of those populations was monomorphic (JGKGKGK for BVII). So, in the natural populations, it would be difficult to track paternal leakage or biparental inheritance with the methods used in this study, since every individual has the same sequence motif. It could be possible that the mechanism used in this species has become very strict in this population, leading to the strict maternal inheritance.

This is not the first study to show differences among populations. In two recent studies (Pearl et al., 2009; Bentley et al., 2010) of Silene vulgaris (Caryophyllaceae), researchers found different levels of heteroplasmy among different populations. Pearl et al. (2009) took seeds from fruits that were open pollinated and found some populations where heteroplasmy was not detected. In contrast to studying open-pollinated flowers,

Bentley et al. (2010) tracked inheritance patterns through controlled crosses. The data collected from the controlled crosses, where the father was known, showed similar patterns to the Pearl et al. (2009) study. Recently, a study on Mimulus guttatus

(Phrymaceae) provided more evidence that mitochondrial heteroplasmy differs populations (Floro, 2011). These population differences give rise to the interesting thought that mechanisms enforcing patterns of inheritance could vary within a species.

Possible variation in the mechanisms regulating inheritance in different populations. It is unknown why certain populations show differences in chloroplast inheritance, and it could be due to populations using different mechanisms of paternal organelle exclusion.

Bentley et al. (2010) had stated these population differences cannot be due to environmental differences or pollinator differences because one was hand-pollinated in a controlled environment, and the other study (Pearl et al., 2009) looked at open-pollinated systems. So, it seems as if the mechanisms of organelle inheritance of these species (M. guttatus, S. vulgaris, and L. siphilitica) is not affected by the environment on short time scales.

It was also stated in Bentley et al. (2010) that genetic differences influence the amount of paternal leakage or biparental inheritance of mitochondria within populations.

This could also be a probable explanation for chloroplast inheritance in L. siphilitica. In this study, the population with the most observed cases of heteroplasmy, paternal, and bi- parental inheritance also had the greatest diversity in chloroplast haplotypes (YW; H.J.

Madson, unpublished data) . Not only does this population have the greatest number of unique haplotypes, it also contains haplotypes from each major haplotype group (B,

BCD, JGK). The possibility of a correlation between haplotype diversity and non- maternal inheritance is intriguing and should be investigated further. I did not have enough maternal populations in my study to rigorously test for such a correlation, but it would be consistent with expectations that non-maternal inheritance, even if rare, could contribute to organellar diversity within populations (Wade and McCauley, 2005).

Importance of organellar inheritance for populations sex ratio. Inheritance patterns are not the only variable characteristics among populations. Sex ratios also vary from population to population. Many species of plants, like L. siphilitica, are gynodioecious

(having females and hermaphrodites). Variation in the population sex ratio (frequency of females and hermaphrodites) can have various causes. If population sex ratios reflect natural selection, females should be more common within populations if they produce more seeds of higher quality than hermaphrodites (Delph et al., 2006; McCauley and

Bailey, 2009). Hermaphrodites require energy to produce pollen as well as seeds, but they have an advantage in finding compatible mates, being able to mate with either

hermaphrodites or females, and able to reproduce with themselves, if necessary.

However, if females use the same amount of extra energy, the seeds produced will be of higher number and quality. Mothers pass on CMS genes to the offspring through seed, while male fertility restorers are inherited through pollen (Delph et al., 2006). It has been shown by theoretical research that non-maternal inheritance of CMS genes can increases the frequency of females in gynodioecious populations, even where nuclear restorers are present (Wade and McCauley, 2005).

This research is important when looking at the populations used in this study. The populations used as mothers were populations with very high frequencies of females. So, the high-female populations could be expected to show more non-maternal inheritance than populations where the ratio is not as skewed (if the mechanism for mitochondria inheritance, and therefore CMS genes, is the same as it is for the chloroplast). This could be an explanation as to why the occurrence of non-maternal inheritance varied more among the maternal populations than the paternal populations. In this study, only plants from high-frequency populations were used as mothers. To test Wade and McCauley's

(2005) predictions, a second study would have to use female and hermaphrodite mothers from a broader range of populations and see how often non-maternal inheritance occurs in these crosses. This would also assess whether mitochondrial inheritance is linked to chloroplast inheritance in this species. If high female populations show an increase in non-maternal inheritance, mechanisms could affect the inheritance of CMS genes as well.

Due to the variation of inheritance among populations of L. siphilitica, cp markers used in phylogenetic and evolutionary studies cannot be assumed to be strictly maternally

inherited. It must be taken into account that not all populations showed maternal inheritance, and that sex ratio may be related to the type of inheritance found. Chloroplast markers can only reliably be used to trace maternal lineages in populations that consistently show strict maternal inheritance, or once a mechanism is found in populations, such as YW, a population with a relatively high incidence of non-maternal inheritance. More studies will have to be done in the future to look for possible cellular mechanisms, as well as additional factors that could possibly influence organelle inheritance.

Future investigation to confirm results. During the course of sequencing the offspring and parents, individuals who showed evidence of heteroplasmy were further tested by another undergraduate student in the lab using a basic vector cloning method. He attempted to separate the two individual haplotypes from heteroplasmic individuals and sequence them individually. Unfortunately, the data collected was not useful to the project due to not having enough colonies. It might be in the best interest to try cloning again with many more samples of the cryptically heteroplasmic mothers, the known heteroplasmic mothers, and the offspring that were where inheritance type was not able to be distinguished. The results from cloning could elucidate the cryptic mother's second motif sequence as well as the unknown offspring.

I am also in the process of maternity and paternity tests to rule out the possibility of contamination or mis-labelling. There is a chance that offspring were labeled incorrectly and came from a different cross, meaning that my inferences of non-maternal

inheritance would not be correct. To help confirm paternity, the process of genotyping will be used. Parents and offspring will be analyzed based on the alleles they carry at three nuclear microsatellite loci. Since nuclear genes are bi-parentally inherited, the offspring should have one allele from the father, and one allele from the mother. With these markers, I may be able to detect mislabeling of an offspring or parent if the offspring an allele that does not match a parent.

Testing could also be done to find the mechanisms of inheritance of this individual, and how vegetative sorting (described below in Possible mechanisms) could allow heteroplasmy to be lost or continued between generations. This would be more involved than collecting a few buds from select individuals, as I did. Grandparents, parents, and offspring would have to be grown to maturity, and multiple leaves and buds from each individual would be sequenced. This would then provide information on which areas of the plant have higher instances of heteroplasmy and homoplasmy, and how vegetative sorting within a plant allows for heteroplasmy to increase or decrease among generations in different populations. It would also be helpful to track the frequency of haplotypes within the different organs of the heteroplasmic individuals. This would add to the information on vegetative sorting, and provide insight into how rare haplotypes are continued throughout the different cells of the plant, and continued from generation to generation.

A final study could be done to see if both chloroplast and mitochondria are inherited together in Lobelia siphilitica. If found to be true, and both organelles are

jointly inherited, assumptions can be made about the inheritance of the mitochondrial genome.

REFERENCES

Avise J., Arnold J., Ball R., Bermingham E., Lamb T., Neigel J., Reeb C., Saunders N. 1987. Intraspecific phylogeography: the bridge between population genetics and systematics. Annual Review of Ecology, Evolution, and Systematics. 18: 489- 522.

Ayala J. 1995. The myth of eve: molecular biology and human origins. Science. 270.5244: 1930-6.

Bailey F., Delph L. 2007. A field guide to models of sex-ratio evolution in gynodioecious species. Oikos. 116: 1609-17.

Baur E. 1909. Das wesen und die rrblichkeitsverhaltnisse der "varietates albo-marginatae hort" von Pelargonium zonale. Z Indukt Abstammungs-Vererbungs1. 1: 330-51.

Behar D., Villems R., Soodyall H., Blue-Smith J., Pereira L., Metspalu E., Scozzari R., Makkan H., Tzur S., Comas D., Bertranpetit J., Quintana-Murci L., Typer-Smith C., Wells R., Rosset S., The Genographic Consortium. 2008. The dawn of human matrilineal diversity. American Journal of Human Genetics. 82.5: 1130-40.

Bentley K., Mandel J., McCauley D. 2010. Paternal leakage and heteroplasmy of mitochondrial genomes in Silene vulgaris: evidence from experimental crosses. Genetics. 185.3: 961-8.

Birky C. 1995. Uniparental inheritance of mitochondrial and chloroplast genes: Mechanisms and evolution. Proceedings of the National Academy of Sciences, USA. 92: 11331-8.

Burt A., Trivers R. 2006. Genes in conflict: the biology of selfish genetic elements. Harvard University Press, Cambridge, Massachusetts. 602 pages.

Caruso C. 2006. Plasticity of inflorescence traits in Lobelia siphilitica (Lobeliaceae) in response to soil water availability. American Journal of Botany. 93.4: 531-8.

Chinnery P., Samuels D., Elson J., Turnbull D. 2002. Accumulation of mitochondrial DNA mutations in ageing, cancer, and mitochondrial disease: is there a common mechanism? The Lancet. 360: 1323-5.

Chinnery P., Turnbull D. 2000. Mitochondrial DNA mutations in the pathogenesis of human disease. Molecular Medicine Today. 6: 425-32.

42 43

Conner J., Hartl D. A Primer of Ecological Genetics. Sinauer Associates, Incorporated, Sunderland, Massachusetts. 304 pages

Correns C. 1909. Verebungsversuche mit blass(gelb)grünen und buntblattrigen sippen bei Mirabilis jalapa, Urtica pilulifera, und Lunaria annnua. Z Indukt Abstammungs-Vererbungs1. 1: 291-329.

Corriveau J., Coleman A. 1988. Rapid screening method to detect potential biparental inheritance of plastid DNA and results for over 200 angiosperm species. American Journal of Botany. 75: 1443-58.

Delph L., Touzet P., Bailey M. 2006. Merging theory and mechanism in studies of gynodioecy. TRENDS in Ecology and Evolution. 22.1: 17-24.

Dumolin S., Demesure B., Petit R. 1995. Inheritance of chloroplast and mitochondrial genomes in pedunculate oak investigated with an efficient PCR method. Theoretical and Applied Genetics. 91: 1253-6.

Ellis J., Bentley K., McCauley D. 2008. Detection of rare paternal chloroplast inheritance in controlled crosses of the endangered sunflower Helianthus verticillatus. Heredity. 100: 574-80.

Fauré S., Noyer J., Carreel F., Horry J., Bakry F., Lanaud C. 1994. Maternal inheritance of chloroplast genome and paternal inheritance of mitochondrial genome in bananas (Musa acuminata). Current Genetics. 25: 265-9.

Floro E. 2011. Mitochondrial heteroplasmy in Mimulus guttatus. Masters Thesis, Kent State University, Kent. 83 pages.

Frey J., Frey B., Forcioli D. 2005. Quantitative assessment of heteroplasmy levels in Senecio vulgaris chloroplast DNA. Genetica. 123: 255-61.

Galtier N., Nabholz B., Glemin S., Hurst G. 2009. Mitochondrial DNA as a marker of molecular diversity: a reappraisal. Molecular Ecology. 18: 4541-50.

Hansen A., Escobar L., Gilbert L., Jansen R. 2007. Paternal, maternal and bi-parental inheritance of the chloroplast genome in Passiflora (Passifloraceae): implications for phylogenetic studies. American Journal of Botany. 94.1: 42-6.

Johnson L., Palmer J. 1989. Heteroplasmy of chloroplast DNA in Medicago. Plant Molecular Biology. 12: 3-11.

Johnston M. 1991a. Natural selection on floral traits in two species of Lobelia with different pollinators. Evolution. 45.6: 1468-79.

Johnston M. 1991b. Pollen limitation of female reproduction in Lobelia cardinalis and Lobelia siphilitica. Ecology. 72.4: 1500-3.

Kuroiwa T., Kawazu T., Uchida H., Ohta T., Kuroiwa H. 1992. Direct evidence of plastid DNA and mitochondrial DNA in sperm cells in relation to biparental inheritance of organelle DNA in Pelargonium zonale by fluorescence electron microscopy. European Journal of Cell Biology. 62: 307-13.

Law R., Hutson V. 1992. Intracellular symbionts and the evolution of uniparental cytoplasmic inheritance. Proceedings in Biological sciences. 248: 69-77.

Milligan B. 1992. Is organelle DNA strictly maternally inherited? Power analysis of a binomial distribution. American Journal of Botany. 79.11: 1325-8.

McCauley D., Bailey M. 2009. Recent advances in the study of gynodioecy: the interface of theory and empiricism. Annals of Botany. 104.4: 611-20.

McCauley D., Olson M. 2008. Do recent findings in plant mitochondrial molecular and population genetics have implications for the study of gynodioecy and cytonuclear conflict. Evolution. 62.5: 1013-25.

Moraes C., DiMauro S., Zeviani M., Lombes A., Shanske S., Miranda A., Nakase H., Bonilla E., Werneck L., Servidei S., Nonaka I., Koga Y., Spiro A., Brownell A., Schmidt B., Schotland D., Zupanc M., DeVivo D., Schon E., Rowland L. 1989. Mitochondrial DNA deletions in progressive external ophthalmoplegia and Kearns–Sayre syndrome. New England Journal of Medicine. 320: 1293-9.

Nagata N. 2010. Mechanisms for independent cytoplasmic inheritance of mitochondria and plastids in angiosperms. Journal of Plant Research. 123: 193-9.

Neale D., Sederoff R. 1989. Paternal inheritance of chloroplast DNA and maternal inheritance of mitochondrial DNA in loblolly pine. Theoretical and Applied Genetics. 77: 212-6.

Pearl S., Welch M., McCauley D. 2009. Mitochondrial heteroplasmy and paternal leakage in natural populations of Silene vulgaris, a gynodioecious plant. Molecular Biology and Evolution. 26.3: 537-45.

Reardon W., Pembrey M., Trembath R., Ross R., Sweeney M. Harding E., Luxon L. 1992. Diabetes mellitus associated with a pathogenic point mutation in mitochondrial DNA. Lancet. 340: 1376-9.

Schwartz M., Vissing J. 2002. Paternal inheritance of mitochondrial DNA. The New England Journal of Medicine. 347.8: 576-80. Sears B. 1980. Elimination of plastids during spermatogenesis and fertilization in the plant kingdom. Plasmid 4: 233-55.

Wade M., McCauley D. 2005. Paternal leakage sustains the cytoplasmic polymorphism underlying gynodioecy but remains invasible by nuclear restorers. The American Naturalist. 166.5: 592-602.

Wege S., Scholz A., Gleissberg S., Becker A. 2007. Highly efficient virus-induced gene silencing (VIGS) in California Poppy (Eschscholzia californica): and evaluation of VIGS as a strategy to obtain functional data from non-model plants. Annals of Botany. 100: 641-9.

Xu J. 2005. The inheritance of organelle genes and genomes: patterns and mechanisms. Genome. 48: 951-8.

Zeviani M., Moraes C., DiMauro S., Nakase H., Bonilla E., Schon E., Rowland L. 1988. Deletions of mitochondrial DNA in Kearns–Sayre syndrome. Neurology. 38: 1339-46.

APPENDIX A. Parental sequence motifs found

Below is a list of all the plants sequenced in the study and used as the parental generation for testing inheritance patterns. POP stands for the population the seeds came from, GIN is the grandparent identification number, and PIN is the parent identification number. These three categories make up the name of the parent. In the GIN column, F stands for female, H stands for hermaphrodite, and U stands for unknown. The F/H column represents what gender the parent is. If there is no letter, the gender is unknown and the individual was not used in any controlled cross in this study.

For example, parent BWB H2 10-H, is the 10th offspring of Hermaphrodite 2 in the BWB population. The individual is a hermaphrodite and was used as a father. The final column indicates the sequence motif (haplotype) of this individual is

JGKKKGKGK. Highlighted yellow parents indicate the individual was observed to be heteroplasmic, and the two identified haplotypes are recorded. Green highlighted individuals are siblings from the same maternal family (indicated by the same GIN), who should have the same haplotypes under strict maternal inheritance, but they do not.

46 47

continued on next page

continued from previous page

APPENDIX B. List of crosses with parent and offspring sequence motifs

Below is a comprehensive list of the crosses analyzed. Each cross is boxed and set up in the following manner: the mother (D) is centered the top of the cross box, below her are the offspring sequenced, and the father (S) is bottom centered individual. Offspring names were given according to the population (POP), the cross number (C#), and the individual of that cross (I#). So, CAR 2.1 2 is the second offspring of the CAR 2.1 cross.

If an offspring was run multiple times and different sequence motifs were found, it is indicated in the identification number. Individual HR 4.1 1.1 and HR 4.1 1.2 are the same individual, 1.1 indicates the first sequencing, and 1.2 indicates the second sequencing.

Offspring in this study did not have genders due to being harvested prior to flower formation. Cross number also indicates how many times a mother was used. For example, in population BVII, cross 1.1 and 1.2 have the same mother, but different fathers. Just as in cross CAR 3.1 and 3.2 have the same mother and different fathers.

Lastly, color indicates which type of inheritance an individual experienced. The colors coincide with Figure 7. Pink indicates maternal inheritance with no heteroplasmy, orange indicates maternal inheritance with known heteroplasmy, yellow indicates maternal inheritance with cryptic heteroplasmy, purple indicates bi-parental inheritance, and blue indicates paternal inheritance. In one cross green is used to indicate the individuals motifs could not be determined; these individuals were not counted in the summary data of Figure 7. In two crosses, the father's sequence motif was not known.

This is due to not receiving the individual for extraction. However, the offspring all received the maternal motif sequence, so the cross information was not discarded.

49 50

continued on next page

continued from previous page

continued on next page

continued from previous page