CELL CYCLE, FATE, STEM CELLS, AND THE PLANARIAN
SCHMIDTEA MEDITERRANEA
by
Hara Kang
A dissertation submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
Department of Neurobiology and Anatomy
The University of Utah
May 2009 Copyright © Hara Kang 2009
All Rights Reserved THE UNIVERSITY OF UTAH GRADUATE SCHOOL
SUPERVISORY COMMITTEE APPROVAL
of a dissertation submittedby
HaraKang
This dissertation has been read by each member of the following supervisory committee and by majority vote has been found to be satisfactory.
- Z / 7 [VjL Cljmi£ Alej andro Sanchez Alvarado �I-Z/() t} I I Monica Vetter
Richard Dorsky U §t24 H Shannon Odelberg
Charles Murtangh THE UNIVERSITY OF UTAH GRADUATE SCHOOL
FINAL READING APPROVAL
To the Graduate COlmcil of the University of Utah:
have read the dissertation of Kang in jts f m aj famI and have found that (1) its fonnat, citations,Ham and bibliographic style are consistent and acceptable; (2) its illustrative materials including figures, tables, and charts are in place; and (3) the manuscript is satisfactory� to the supervisory committee and is � submissionfmal to The Graduate School. re y foci
Date Ak>f£tndroJ"efrcz'A lvarado /\Oiair: Supervisory Committee
Approved for the Major Department
MonicaChairlDean Vetter
Approved for the Graduate Council
David S. 0JapmaA Dean of The Graduate School ABSTRACT
The replacement of differentiated cells is a major challenge for all multicellular organisms throughout their life spans. Humans, for example, must replace an estimated
10 billion cells every day, while some animals replace body parts as a result of continuous tissue homeostasis. Such turnover and body part replacement can be regulated through the maintenance, proliferation, and differentiation of somatic stem cells.
Although it is clear that the fate decision of somatic stem cells to proliferate or differentiate is tightly controlled by regulating the cell cycle machinery, little is known about the cell cycle of somatic stem cells due to difficult experimental accessibility.
We used an excellent in vivo model system, the planarian Schmidtea mediterranea to study the cell cycle of somatic stem cells. S. mediterranea has a relatively large population of stem cells distributed through the entire body except the area in front of photoreceptors and the pharynx. First of all, we developed and optimized methods to characterize the cell cycle of planarian stem cells using flow cytometry and fluorescent- activated cell sorting. Using these methods, we described the cell cycle of planarian total cells or specific populations. Second, for an in-depth understanding of the planarian cell cycle, we identified and characterized planarian homologs of the regulatory molecules controlling the cell cycle in other organisms. Among these molecules, we are highly interested in Smed-cdc73 due to the strong phenotype caused by RNAi and lack of functional studies of Cdc73 in stem cells. Finally, we therefore characterized the function of Smed-cdc73 in the decision for proliferation or differentiation of planarian stem cells using RNAi and molecular markers for stem cells and differentiated progeny of stem cells.
We observed that stem cell proliferation was prevented, while differentiation of stem cells was accelerated in the absence of Smed-cdc73, suggesting that Smed-cdc73 is required for self-renewal of planarian stem cells. Taken together, our studies demonstrate the ability to analyze cell cycle of planarian stem cells in vivo and to identify cell cycle regulators required for stem cell functions. Studies on the cell cycle of planarian stem cells will allow valuable basic understanding of stem cell biology. TABLE OF CONTENTS
ABSTRACT iv
ACKNOWLEDGMENTS viii
Chapter
1. INTRODUCTION 1
Abstract 1 The Planarian Schmidtea mediterranea 1 Neoblasts 2 Neoblasts and the Cell Cycle 6 Research Summary 8 References 9
2. DEVELOPMENT OF METHODOLOGIES FOR THE ANALYSIS OF STEM CELL PROLIFERATION IN PLANARIANS 12
Abstract 12 Introduction 13 Materials and Methods 15 Results 17 Discussion 34 Acknowledgments 36 References 37
3. IDENTIFICATION AND CHARACTERIZATION OF GENES THAT AFFECT THE CELL CYCLE 39
Abstract 39 Introduction 39 Materials and Methods 45 Results 52 Discussion 71 Acknowledgments 74 References 74
4. cdc73 IS REQUIRED FOR SELF-RENEWAL OF PLANARIAN STEM CELLS 78
Abstract 78 Introduction 78 Materials and Methods 81 Results 85 Discussion 115 Acknowledgments 125 References 125
5. DISCUSSION 132
What Was Previously Known About the Cell Cycle in Planarians?.. 132 What We Learned from This Study 133 Future Studies 135 References 137
APPENDIX: CHARACTERIZATION OF ADDITIONAL MOLECULES THAT AFFECT MITOTIC ACTIVITIES OF NEOBLASTS 138
vii ACKNOWLEDGMENTS
I have often heard that people gain three chances of lifetime. It was my second
golden chance to meet with Dr. Alejandro Sanchez Alvarado and to study in his
laboratory. During my Ph.D. studies with him, I came to have my dream of becoming a good scientist after the example of his enthusiasm for science. I sincerely appreciate the chance to be in his laboratory and his care of me.
I would also like to thank all members of the laboratory, especially Dr. Carrie
Adler. I could not have overcome all my various difficulties without her valuable and thoughtful advice. Also, it was my pleasure to be with Dr. George Eisenhoffer and Sofia
Robb who are very delightful persons. I really enjoyed spending time with them in the
laboratory.
I would like to thank my committee members, Drs. Monica Vetter, Richard
Dorsky, Shannon Odelberg, and Charles Murtaugh, for helping me to complete the long course.
I also appreciate the encouragement from all my friends who are in Korea and those I met in Salt Lake City. I especially thank Eonjoo Park and Sanghee Yun for their simple friendship.
Finally, I would like to thank my family who are always at my side for their devoted love with my whole heart. I cannot thank my husband, Sunghwan Kim who gave me my first lucky chance, enough. CHAPTER 1
INTRODUCTION
Abstract
All multicellular organisms depend on stem cells for survival and perpetuation.
The central role of stem cells in reproductive, embryonic, and postembryonic processes, combined with their wide phylogenetic distribution in both the plant and animal kingdoms intimates that the emergence of stem cells may have been a prerequisite in the evolution of multicellular organisms. Somatic stem cells may be ancestral, with germ line stem cells being derived later in the evolution of multicellular organisms. Current studies of stem cell biology are likely to benefit from studying the somatic stem cells of simple metazoans such as the planarian Schmidtea mediterranea. This chapter will provide an overview of the merits of known neoblast functions, and the merits of studying these experimentally accessible cells to dissect the fundamental in vivo biology of stem cells.
The Planarian Schmidtea mediterranea
Planarians are bilaterally symmetric, triploblastic animals that possess abundant somatic stem cells known as neoblasts |1], Planarians belong to the phylum
Platyhelminthes, and are phylogenetically placed in the Lophotrochozoa, a sister group to both the Ecdysozoa (which include D. melanogaster and C. elegans) and the
Deuterostomes (to which vertebrates belong) [2], The Lophotrochozoa comprise animals 2
displaying the largest collection of body plans on the planet (squids, mollusks, annelids,
ribbonworms, etc), yet have remained underrepresented in current molecular and cellular
investigations. There are thousands of different known species [3], but only several dozen
have been characterized in any detail. Of these, the free-living, freshwater hermaphrodite
Schmidtea mediterranea emerged as a good candidate for in depth analyses due to their
robust regenerative properties and their stable diploid state (2n=8) and relatively small
8 1
genome size of -4.8x10 bp (nearly half that of other common planarians) [2].
The ease of maintenance and manipulation of S. mediterranea has allowed us [4]
to develop the requisite molecular tools to dissect the remarkable biology of these
animals. We have established loss-of-function assays [5, 6], large collections of cDNAs
(71, have recently completed a large-scale RNAi-based screen |8|, a sequenced genome,
and a genome browser, SmedGD [9, 10]. These advances have permitted us to commence
systematic cellular and molecular genetic studies on animal regeneration, tissue
homeostasis and the attendant stem cells driving these phenomena.
Neoblasts
Neoblasts are the adult somatic stem cells of planarians and are distributed throughout the planarian body (Figure 1.1) [11]. Morphologically, neoblasts share many
attributes with the stem cells of other organisms, such as large nuclei with extensively
decondensed DNA, and largely undifferentiated, highly basophilic cytosols. Neoblasts
are the only mitotically active somatic cells in planarians [11], and their division progeny
generate the -40 different cell types found in the adult organism [2], In intact planarians,
neoblasts replace cells lost to normal physiological turnover [1 1], while in amputated
animals, they give rise to the blastema, the structure in which missing tissues are 3
FIGURE 1.1. Planarian stem cells. (A) Immunostaining of S. mediterranea using a phosphorylated histone H3 (H3P) antibody that detects mitotic cells. (B) Immunostaining of S. mediterranea using a BrdlJ (Bromodeoxyuridine) antibody. Animals were stained
48 hours after BrdU-injection. At this timepoint, BrdU-positive cells represent cycling stem cells and descendents of stem cells. Arrows and asterisks represent photoreceptors and pharynxes in planarians, respectively. Scale bars indicate 0.2 mm. 4
A
B regenerated [12]. Several lines of evidence support the stem cell properties of neoblasts.
First, electron microscopy studies have uncovered morphological characteristics [13].
Second, bromodeoxyuridine (BrdU) labeling indicated the mitotically active nature of
these cells, with the resulting BrdU labeled cells intercalating, differentiating and
contributing to multiple tissues and organs [11], Third, injection of neoblast-enriched
cell suspensions into irradiated planarians devoid of mitotic activity and thus neoblasts
resulted in the restoration of both regenerative abilities and long-term viability of the
recipient animals [14].
Besides playing central roles in the regenerative and tissue homeostatic capacities of planarians, neoblasts play a key function in the reproductive fitness of these animals.
S. mediterranea can, and does, reproduce by either sexual or asexual means [13]. This is possible because the division progeny of self-renewing neoblasts not only give rise to
somatic tissues, but also to the germ cells. A clear demonstration that adult somatic stem cells can produce a functional germ line and the reproductive structures associated with this cell population was provided by Thomas Hunt Morgan in 1902 [15]. Morgan demonstrated that a planarian head fragment devoid of germ line structures could regenerate functional gonads from the remaining somatic tissue [15]. This is an
important attribute of planarians, i.e., the presence of a multipotent, adult somatic stem cell lineage able to produce functional germ cells. In sexually reproducing planarians, the germ cell lineage does not appear to be segregated during embryogenesis. Instead, the gonads and the copulatory apparatus are formed de novo in the appropriate regions of the worm once the planarian reaches an appropriate size [16]. Neoblasts and the Cell Cycle
We know little about how the cell cycle in adult somatic stem cells may be
regulated [17]. This is in stark contrast to our extensive knowledge of cell cycle
parameters in differentiated cells [18]. Only recently, for example, it has been shown that
self-renewing mammary epithelial stem cells selectively retain their tritiated thymidine-
labeled template DNA strands, and pass newly synthesized BrdU-labeled DNA to their
progeny during asymmetric divisions [19]. Such findings suggest that tight regulatory
mechanisms of cell proliferation have been selected during evolution to promote the
longevity of stem cell populations. Moreover, the ability of stem cells to respond to changes in tissue homeostasis caused by physiological turnover or injury is also poorly
understood. Thus, in order to understand how changes in homeostasis trigger stem cell
proliferation, it is necessary to determine if the cell cycle itself is regulated in response to these changes and if so, which phases of the cell cycle are being affected.
Even less is known about the proliferation dynamics of planarian neoblasts.
Traditionally, neoblast cell cycle activities were measured by counting mitotic figures in histological sections of planarians [12], More recently, the distribution of neoblasts in whole-mount specimens of S. mediterranea has been revealed by BrdU labeling [11], as these cells are the only mitotically active cell population in planarians. In S. mediterranea, neoblasts are distributed throughout the parenchyma of the animal, with the exception of the area in front of the photoreceptor and in the pharynx. Interestingly,
both of these nonmitotic areas were shown by T. H. Morgan to be incapable of regenerating a complete worm [20], Later, BrdU labeling was extended to other
llatworm species in which the S-phase cells are found either throughout the parenchyma (Convolutriloba longifissur ) [11, 21], or along the lateral sides of the body as in the rhabdocoel Macrostomum sp. [22], In all cases, however, the function of the neoblasts appears to be to self-renew and/or differentiate to replace cells lost to aging or wounding.
During the initial 12 hours after amputation or feeding, a mitotic burst in the neoblast population is observed in planarians [23, 24], Because of the rate at which this burst occurs, it was thought that a large population of neoblasts arrested in the G2 phase of the cell cycle existed in planarians [23, 25]. If so, G2 checkpoint mechanisms would become primary targets of stem cell function regulation. However, we have shown that
G2 arrests do not occur in S. mediterranea. This conclusion was reached after examining the results of both fraction of labeled mitoses (FLM) and continuous BrdU labeling experiments [11], Double-labeling neoblasts with BrdU and a mitotic marker (an antibody against the phosphorylated histone H3), allowed us to directly test whether the initial burst of proliferation after feeding or amputation was due to G2-arrested cells. If cells that have already traversed S phase (e.g., G2-arrested cells) were responsible for the initial mitotic peak, then the mitotic cells observed in the initial 12 hours after addition of
BrdU should be devoid of this thymidine analog. We found that 96% of the mitotic cells were labeled with BrdU 12 hours after BrdU feeding, suggesting that in S. mediterranea large populations of G2-arrested stem cells are unlikely to exist.
Continuous BrdU labeling experiments also corroborated the FLM experiments.
Two potential outcomes from the application of this method were possible. First, if a large number of G2-arrested. or slow cycling neoblasts exists, then the maximum percentage of cells with the morphological characteristics of neoblasts that could be labeled with BrdU within a defined period of time will not reach 100%. Second, if all of the neoblasts cycle, close to 100% of the cells would become BrdU labeled. We found that more than 99% of neoblasts incorporated BrdU after 3 days of continuous labeling, suggesting again that a large subpopulation of stem cells did not remain quiescent for more than 3 days [11].
Research Summary
This dissertation describes my efforts to develop methodologies to analyze the cell cycle of planarian stem cells during tissue homeostasis and regeneration. In Chapter
2, I will describe flow cytometry and fluorescent activated cell sorting (FACS) methods I developed for the study of planarian stem cell biology. These methods made possible detailed analyses of cell cycle profiles of both total and specific cell populations from S. mediterranea, allowing us to detect environmental- and experimentally-induced perturbations to the cell cycle. In addition, I extended the utility of these methods by developing protocols to follow a pulse of BrdU in a cycling population of stem cells using both flow cytometry and FACS. This technical improvement allowed us to study the regulatory mechanisms of the cell cycle of planarian stem cells at unprecedented levels of resolution.
In Chapter 3, I identified and characterized potential cell cycle regulators in planarians using the methodologies developed in Chapter 2. First, I carried out an RNAi screen to identify genes that affect neoblasts and focused on those resulting in impairment of regeneration. The screen was followed by the determination of expression patterns of the pertinent genes, and the loss-of-function effects on the cell cycle were characterized by in situ hybridizations and by immunostaining using a mitotic marker and flow cytometry, respectively. I found that Smed-cdk4, Smed-rb, and Smed-cdc73 affect the 9
planarian cell cycle.
In Chapter 4, the functional characterization of Stned-cdc73 is described. RNAi of
Smed-cdc73 resulted in a failure of planarian tissue homeostasis and regeneration. A closer inspection showed a significant reduction of proliferating neoblasts in Smed- cdc73(RNAi) animals. I then extended recently acquired knowledge of the molecular
lineage relationship between neoblasts and their postmitotic progeny and the technology of double labeling by BrdU and in situ were mainly applied [26], I observed that neoblasts differentiate earlier at inappropriate spatial domains in the absence of Smed- cdc73. These results suggest that Smed-cdc73 is required to promote the proliferation and inhibit the differentiation of stem cells in planarians.
References
1. Reddien, P.W., and Sanchez Alvarado, A. (2004). Fundamentals of planarian regeneration. Annual Review of Cell and Developmental Biology 20, 725-757.
2. Sanchez Alvarado, A., and Kang, H. (2005). Multicellularity, stem cells, and the neoblasts of the planarian Schmidtea mediterranea. Experimental Cell Research 306, 299-308.
3. Brusca, R.C., and Brusca, G.J. (1990). Invertebrates (Sunderland, MA: Sinauer Associates).
4. Agata, K. (2003). Regeneration and gene regulation in planarians. Curr Opin Genet Dev 13, 492-496.
5. Newmark, P.A., Reddien, P.W., Cebria, F., and Sanchez Alvarado, A. (2003). Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians. Proc Natl Acad Sci U S A 100 Suppl 7, 11861-11865.
6. Sanchez Alvarado, A., and Newmark, P.A. (1999). Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc Natl Acad Sci U S A 96, 5049-5054.
7. Sanchez Alvarado, A., Newmark, P.A., Robb, S.M., and Juste, R. (2002). The Schmidtea mediterranea database as a molecular resource for studying 10
platyhelminthes, stem cells and regeneration. Development 129, 5659-5665.
8. Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sanchez Alvarado, A. (2005). RNAi screening identifiesregeneration and stem cell regulators in the planarian Schmidtea mediterranea. Developmental Cell 8, 635- 649.
9. Sanchez Alvarado, A., Reddien. P.W., Newmark, P.A., and Nusbaum, C. (2003). Proposal for the Sequencing of a New Target Genome: White Paper for a Planarian Genome Project. http://www.genome.gov/page.cfm?pageID= 10002154.
10. Robb, S.M.C., Ross, E., and Sanchez Alvarado, A. (2008). SmedGD: the Schmidtea mediterranea genome database. Nucleic Acids Research 36, D599- D606.
11. Newmark, P.A., and Sanchez Alvarado, A. (2000). Bromodeoxyuridine specifically labels the regenerative stem cells of planarians. Dev Biol 220, 142- 153.
12. Reddien, P.W., and Sanchez Alvarado, A. (2004). Fundamentals of planarian regeneration. Annu. Rev. Cell Dev. Biol. 20, 725-757.
13. Newmark, P.A., and Sanchez Alvarado, A. (2002). Not your father's planarian: a classic model enters the era of functional genomics. Nature Reviews Genetics 3, 210-219.
14. Baguna, J., Salo, E., and Auladell, C. (1989). Regeneration and pattern formation in planarians. III. Evidence that neoblasts are totipotent stem cells and the source of blastema cells. Development 107, 77- 86.
15. Morgan, T.H. (1902). Growth and regeneration in Planaria lugubris. Arch. Ent. mech. Org. 13, 179-212.
16. Curtis, W.C. (1902). The life history, the normal fission, and the reproductive organs of Planaria maculata. Proc Boston Soc Nat Hist 30, 515-559.
17. D'Urso, G., and Datta, S. (2001). Cell cycle control, checkpoints, and stem cell biology. In Stem Cell Biology, D.R. Marshak, R.L. Gardner and D. Gottleib, eds. (Cold Spring Harbor, New York: Cold Spring Flarbor Laboratory Press), pp. 61-94.
18. Murray, A.W. (2004). Recycling the cell cycle: cyclins revisited. Cell 116, 221- 234.
19. Smith, G.H. (2005). Label-retaining epithelial cells in mouse mammary gland divide asymmetrically and retain their template DNA strands. Development 132, 681-687. 11
20. Morgan, T.H. (1898). Experimental studies of the regeneration of Planaria maculata. Arch. Entw. Mech. Org. 7, 364-397.
21. Gschwentner, R., Ladurner, P., Nimeth, K., and Rieger, R. (2001). Stem cells in a basal bilaterian. S-phase and mitotic cells in Convolutriloba longifissura (Acoela, Platyhelminthes). Cell Tissue Res 304, 401-408.
22. Ladurner, P., Rieger, R., and Baguna, J. (2000). Spatial distribution and differentiation potential of stem cells in hatchlings and adults in the marine platyhelminth macrostomum sp.: a bromodeoxyuridine analysis. Dev Biol 226, 231-241.
23. Baguna, J. (1976). Mitosis in the intact and rgenerating planarian Dugesia mediterranea n.sp. II Mitotic sudies during regeneration and a possible mechanism of blastema formation. J Exp Zool 195, 65-80.
24. Baguna, J. (1974). Dramatic mitotic response in planarians after feeding, and a hypothesis for the control mechanism. J Exp Zool 190, 117-122.
25. Salo, E., and Baguna, J. (1984). Regeneration and pattern formation in planarians. I. The pattern of mitosis in anterior and posterior regeneration in Dugesia (G) tigrina, and a new proposal for blastema formation. J Embryol Exp Morphol 83, 63-80.
26. Eisenhoffer, G.T., Kang, H., and Sanchez Alvarado, A. (2008). Molecular analysis of stem cells and their descendants during cell turnover and regeneration in the planarian Schmidtea mediterranea. Cell Stem Cell 3, 327-339. CHAPTER 2
DEVELOPMENT OF METHODOLOGIES FOR THE ANALYSIS
OF STEM CELL PROLIFERATION IN PLANARIANS
Abstract
Although cell cycle mechanisms among living organisms share deep evolutionary conservation, multicellular organisms have developed important regulatory adaptations associated with the long-term maintenance of cell proliferation. Such adaptations are evident in the regulation of stem cell functions, which are profoundly linked to the regulation of their cell cycle. Remarkably, little is known about how stem cells regulated their entry into and exit from the cell cycle. This is due in great part to the general in vivo inaccessibility of stem cells in the more traditional model systems such as mice, Hies and nematodes. Because planarian stem cells are abundant and experimentally accessible, but little was known about their cell cycle dynamics, we endeavored to develop methodologies with which to measure this process under normal and experimentally perturbed conditions. First, we adapted and optimized flow cytometric methodologies from other systems to define the proliferative profile of cells in planarians, and measure changes in cell cycle dynamics caused by environmental (feeding) or experimental
(RNAi) changes. Secondly, we refined the methods to allow us to follow BrdU-labeled cells specifically, which allowed us to study the cell cycle in stem cells, including modulatory effects caused by environmental stimuli.
Introduction
During the cell cycle, DNA is accurately replicated and distributed as identical
chromosomal copies to the resulting daughter cells allowing for the faithful transmission of genetic material from generation to generation [1J. The cell cycle is generally divided
into four phases: DNA synthesis (S) phase, mitotic segregation (M) and two intervening gap phases (G1 and G2) preceding the S and M phases, respectively. Strict regulation of the cell cycle ensures that the events in each phase are completed before the cell can move on to the next phase [1], Although these phases are generally present in most cell types, exceptions exist. For instance, embryonic stem cells (ES cells) exhibit a very unusual cell cycle structure, characterized by a short G1 phase and a high proportion of cells in S-phase. As ES cells differentiate, the cell cycle structure changes dramatically, with the emergence of a significantly longer G1 phase [2], The unique cell cycle structure and likely mechanisms underpinning cell cycle control in ES cells indicates that the cell cycle machinery plays a role in establishment or maintenance of the stem cell state.
In addition to the unique phase distribution, the cell cycle in stem cells is regulated in response to physiological and/or traumatic changes such as the replacement of cells lost to tissue homeostasis and the regeneration of injured body parts [3|. Such regulatory mechanisms appear to be widespread among distantly related metazoans. For example, the Drosophila germ line and follicle somatic stem cells of the ovary have been shown to adjust their proliferative rates in response to nutritional levels [4], Similarly, mouse ES cells have been shown to respond to environmental insults such as irradiation by regulating the G1-phase checkpoint of the cell cycle to remove damaged cells from the 14
population [5], In addition, classical studies have shown that the planarian stem cells can
respond to both global and local homeostatic changes. For example, starvation leads to an
allometric reduction in size of the entire organism [6]; and locally, amputation leads to a
burst of neoblast proliferation near the amputation plane without significantly affecting
the proliferative rates of neoblasts elsewhere in the animal [7]. These attributes make planarians a good model system for the study of population dynamics of adult somatic
stem cells in vivo. Because the study of various in vitro manipulated stem cells has not produced enough information [8], the systematic study of planarian stem cells in vivo is likely to provide novel insights on the regulatory mechanism of the cell cycle in stem cells.
In order to understand the regulation of the cell cycle in stem cell functions, we needed to define the cell cycle parameters of the planarian stem cells, and how these parameters may be regulated in vivo. We aimed to derive from these studies information that may help us identify phases of the cycle that may respond to both homeostatic and regenerative stimuli. In the past, fraction of labeled mitosis (FLM) has been used to study the planarian cell cycle [9], However, this method is labor intensive as it involves whole- mount preparations, confocal microscopy and quantification on a cell to cell basis.
Presently, flow cytometry has primarily been used to monitor the cell cycle of mammalian cells 110], This method takes advantage of the different DNA concentrations found in cycling cells, which allows measuring the distribution of cycling cells along the various phases of the cell cycle (G0/G1, S, G2 and M). Using flow cytometry, cell cycle distribution can be analyzed rapidly based on DNA content of individual cells. In addition,
subpopulations of each cell cycle phase can be quantified. Therefore, flow cytometry is a more practical method for monitoring the status of the planarian cell cycle and its
regulation than FLM methods. Flow cytometry has been widely used for cultured cells or yeast cells and the dearth of equivalent assays for planarians required the adaptation and
optimization of flow cytometry suitable for in vivo stem cell cycle research.
Materials and Methods
Flow Cytometry
In order to subject planarians to flow cytometry, reproducible tissue dissociation methods needed to be identified. We took advantage of the observation that animals placed in maceration solution (planarian water, glycerol, and acetic acid in a 13:1:1 ratio) result in both fixation and full tissue dissociation. Fixed cells were then washed with calcium-magnesium-free media (CMF) and treated with 5pg/ml of RNaseA, followed by
staining with 5fig/ml of propidium iodide (PI), a DNA binding dye. The cells were then analyzed for flow cytometry. After performing the How cytometry using a Becton
Dickinson FACScan, the data were analyzed using the Modflt LT software (Verity
Software House, Inc.), which is capable of deconvoluting DNA content into frequency
histograms.
Immunostaining
Animals were killed in 2% HC1 for 5 minutes and fixed in Carnoy's (for 2 hours on ice [11], They were dehydrated in 100% methanol for 1 hour at -20°C and bleached in
6% H2O2 in methanol overnight at room temperature (RT). Following rehydration through a methanol dilution series in PBST (PBS + 0.3% Triton X-100), animals were
labeled with the phosphorylated histone H3 antibody (1:300, Upstate) and the goat anti- rabbit conjugated to HRP (1:150, Molecular Probes). Signals were amplified by tyramide conjugated to Alexa 568 (1:100, Molecular Probes), followed by washing with PBST including 0.25% BSA (Bovine Serum Albumin). Animals were mounted in Vectashield.
RNAi
Three RNAi feedings were administrated on days 0, 4, and 13 to wild-type animals starved for 10-14 days as previously described [12], To examine the regeneration phenotype, RNAi animals were amputated 4 hours after RNAi feeding on days 4 and 13.
BrdU Analysis Using FACS
Animals were injected with BrdU (about 100 nl of 5 mg/rnl of BrdU), washed, and dounced in CMF. Dissociated cells were incubated in CMF on a nutator for 15 minutes at RT and filtered through a 50 pm Nitex filter. Cells were fixed in 100% chilled methanol for 30 minutes on ice. Cells were collected, resuspended in 2N HCI in PBST
(PBS + 0.5% Triton X-100) and incubated for 30 minutes at RT to denature DNA. After neutralization by adding 0.1M Borax in PBST, cells were collected and washed in PBST.
Then cells were incubated with a BrdU antibody (1:10, Oxford Ltd) overnight at 4°C following the blocking in PBST including 1% BSA for 1 hour. Cells were washed twice with PBST for 15 minutes each and then incubated with the preabsorbed HRP-conjugated anti-rat antibody (1:200, Upstate) for 1 hour at RT. After several washes with PBST for 2 hours, cells were incubated with Tyramide (1:200, Molecular Probes) for 30 minutes at
RT. Cells were subjected to the last washing step with PBST and incubated in RNaseA
(20 pi of 100 pg/ml) in PBS for 10 minutes at RT. Finally, cells were stained with PI
(5pg/ml) for 2 hours at RT. Analyses were performed using a BD Biosciences FACS Aria. Results
Cell Cycle Analyses Using Flow Cytometry
To analyze the planarian cell cycle using flow cytometry, I have optimized several methods to dissociate and fix cells, stain DNA, and analyze the profile of the cell cycle using the Modfit LT software (Figure 2.1 A). I discovered that maceration solution and absolute methanol were the most efficient reagents for fixation. In flow cytometric cell cycle analyses, the staining method is critical because of cell-to-cell differences, cellular/nuclear concentrations and stoichiometry of nuclear material. By titrating of the concentration and varying the incubation time of propidium iodide staining, the optimum staining method was determined to be 5pg/ml of propidium iodide for 2 hours at RT. For the flow cytometric analyses using the Modfit LT software, I adjusted the gate used for cell sorting during forward scatter measurements in order to avoid overestimating the number of cells in the G2/M phase, thus avoiding counting doublets which are made of groups of cells that are not fully separated from each other.
Once optimized, I analyzed the cell cycle profile of planarian cells (Figure 2. IB).
DNA content distribution of planarian cells consists of two predominant peaks corresponding to G0/G1 and G2/M phase cells, respectively. The intermediate region between both peaks represents cells in the S phase of the cell cycle. G2/M phase cells have twice the amount of DNA of G0/G1 phase cells, and S phase cells possess variable amounts of DNA between G1 and G2 cells. Average percentage of planarian cell populations in G0/G1, S, and G2/M phases are 81.99% (SD=2.4), 5.78% (SD=1.4), and
12.23% (SD=1.4), respectively. The cell distribution obtained in Figure 2.IB is comparable to that observed in mammalian tissue culture preparations, indicating that the FIGURE 2.1. Flow cytometric cell cycle analyses. (A) Diagram of the key steps involved in the experimental procedures for cell cycle analyses using flow cytometry. (B)
The cell cycle profile of planarian whole cells. Cell cycle was determined by measuring
DNA content using flow cytometry. Two peaks from left to right indicate the number of cells in G0/G1 and G2/M. respectively. The intermediate region between both peaks represents cells in S phase. B
o -Q ZS C 00 o "a> o Dissociation 40 80 120 1 I propidium iodide
PI staining 4 Flow Cytometry developed method is applicable to study the cell cycle in whole planarians. Currently, it is possible to obtain such graphs from as few as two average sized planarians (4-6 mm in length).
This method was also used to analyze the cell cycle profdes of the specific cell populations [13]. To determine whether distinct cell populations have different cell cycle profiles, we isolated three different cell populations by FACS: the irradiation-sensitive populations (XI and X2) and the irradiation-insensitive population (Xins). After irradiation, the XI cells disappear within 24 hours, while the X2 cells take longer to disappear (7 days). We determined that the XI cell population contains a large portion of cycling cells, with 19.6±5% in S and 74.7±7.5% in G2/M. In contrast, the X2 and Xins populations are mainly comprised of noncycling (G0/G1) cells (75.2±2.5% and
81.63±7.9%, respectively). This result independently supported prior observations indicating that the XI population is cycling while X2 cells are mostly nondividing, and possibly the early progeny of stem cells.
Regulation of Cell Cycle by Environmental Changes Can Be Detected by Flow Cytometry
A mitotic burst of planarian stem cells has been observed after feeding [7]. Thus, such environmental stimuli should result in changes in flow cytometric profiles. To examine whether mitotic activities of neoblasts are changed in response to feeding, we first carried out immunostaining using the phosphorylated histone H3 (H3P) antibody at different time points after feeding (Figure 2.2). The flatness of the animal and the finite number of mitotic figures in any given animal allow us to easily quantify mitoses, and thus to measure changes in the number of mitotic cells at various time points after FIGURE 2.2. Mitotic activities of planarian stem cells after feeding. (A) Anti- phosphorylated histone H3 (H3P) immunostaining in whole-mount animals at several times after feeding. (B) Quantification of H3P-positive nuclei in animals over time after feeding. For the graph, at least five animals were counted per time point. Scale bars indicate 0.2mm. Error bars indicate standard deviations. control 6h
12h 24 h
48h 72h
control 6h 12h 24h 48h 72h experimental manipulation. As a result, the number of mitotic cells was increased
significantly by 12 hours after feeding of egg yolk and eventually decreased to pre-
leeding levels 72 hours later (Figure 2.2). To determine whether the cell cycle of
planarian stem cells reflects the changes in the mitotic activity induced by feeding, I
dissociated animals at 24 hours after feeding and performed flow cytometry (Figure 2.3A
and B). Cells found in G0/G1 phase are decreased from 84.98% to 80.41%, while cells in
S and G2/M phases are increased from 4.33% and 10.68% to 6.52% and 13.07%, respectively. This result indicates that environmental changes can modulate the cell cycle dynamics of the planarian stem cell population. Since the length of S-phase and mitosis are relatively fixed, changes in cell cycle parameters induced by feeding are likely to be manifested by shortening the length of Gl. Thus, an accelerated transition from G1 to S
phase should result in an increase in the number of mitotic cells. I tested this hypothesis by measuring mitotic changes in fed animals by flow cytometry and observed that the percentage of the cell population in each cell cycle phase changed with time in a general trend toward a decrease in the number of cells in the G0/G1 -phase population and an
increase in the S-phase population through 72 hours after feeding (Figure 2.3C). These results demonstrate the ability of neoblasts to respond to mitogenic stimuli provided by changes in nutritional status (feeding), which is consistent with the results from whole- mount immunostaining with H3P antibody (Figure 2.2). From this study, we concluded that the regulation of planarian cell cycle by environmental changes can be detected and measured using the flow cytometric assays developed. FIGURE 2.3. Changes to the planarian cell cycle after feeding. Cell cycle profiles of planarians under the normal (A) and feeding (24 hours after feeding) conditions (B). (C)
The graphs indicate the percentage of cells in G0/G1, S, or G2/M phase of the cell cycle at multiple times after feeding. The graphs represent three independent biological replicates. In B, cont. is control (1-week-starved animals). Error bars indicate standard deviations. 25
G0/G1 : 84.98% B G0/G1 : 80.41% S : 4.33% S : 6.52% 2000- G2/M : 10.68% 2000 G2/M : 13.07% CD CD -O X! E 1500- 1500 Z3 E C D C — 1000- 1000 i CD a> o O 500 H 500
30 60 90 120 150 30 60 90 120 150 Propidium iodide Propidium iodide
jo 85 Iod 80 C> o CD 75
70 cont. 6h 12h 24h 48h 72h 15 q3 o 10 CO o 5
cont. 6h 12h 24h 48h 72h 20 0) o 15 C\J 10 O M— 5 o 0 cont. 6h 12h 24h 48h 72h Cell Cycle Analyses of Animals Subjected to RNAi Treatments
To test if the RNAi-induced phenotypes can be reproducibly measured by the flow cytometric cell cycle analysis developed above, two known cell cycle-related genes were tested. These are the planarian cell division cycle 23 (Smed-cdc23) and Smed-sec61 genes [12]. We have recently shown that planarians fed double-stranded RNA (dsRNA) of Smed-cdc23 have high mitotic activity and that those fed Smed-sec61 dsRNA have low mitotic activity (Figure 2.4A and B) [12|. Flow cytometry was performed on dissociated cells from RNAi animals (Figure 2.4C). C. elegans unc22 dsRNA was used as a control for RNAi feeding. If the effects of RNAi on the planarian cell cycle can be detected by the DNA analysis using flow cytometry, cdc23(RNAi) animals will have a higher percentage of cells in the G2/M phase than controls. Accordingly, we expect that planarians fed Smed-sec61 dsRNA will have a lower percentage of cells in the G2/M phase than controls. As expected, the percentage of cells in S and G2/M phases in Smed- cdc23(RNAi) animals is increased from 16.46% and 8.81% to 21.42% and 12.93%, respectively. This result probably reflects the fact that cdc23, a component of the anaphase promoting complex (APC), is known to promote the progression from M to G1 phase [14]. Hence, the number of cells entering the G1 phase of the cell cycle is decreased. In contrast, in Smed-sec61 (RNAi) animals, the percentage of cells in G2/M phase is drastically reduced to 4.52%. This results in a marked accumulation of cells in S phase accompanied by a notable decrease in the cells populating G0/G1. Such decrease in
G0/G1 may reflect the fraction of mitotically active cells (i.e.. Gl) found in this region of the How cytometry curve. These results clearly indicate that experimentally induced changes in the cell cycle can be detected using flow cytometry, and that these types of FIGURE 2.4. Changes to the mitotic activities and the cell cycle in RNAi animals.
(A) Immunostaining using 113P antibody was carried out in whole-mount animals 14 days after RNAi feeding. Scale bars indicate 0.2 mm. (B) Quantification of H3P-positive nuclei in RNAi animals. Smed-cdc23(RNAi) animals had more mitotic cells while Smed- sec61 (RNAi) animals barely had mitotic cells. (C) Cell cycle profiles for RNAi animals were analyzed by flow cytometry. 28
unc22(RNAi) Smed-cdc23(RNAi) Smed-sec61(RNAi) B E 800 E -- 600 w g 400
200
unc22 Smed-cdc23 Smed-sec61 unc22(RNAi) Smed-cdc23(RNAi)\ \Smed-sec61 (RNAi) G0/G1:74.74% G0/G1:65.65% G0/G1:58.31% S: 16.46% 1000 S:21.42% 600 S:37.18% o G2/M:8.81% G2/M:12.93% G2/M:4.52% -Q E 400 13 C "a5 200H O
Propidium iodide analyses are likely to provide insight on various regulatory aspects of the planarian cell
cycle at the molecular level.
BrdU Analyses Using FACS
Although we could detect changes in the cell cycle caused by environmental and experimental changes by flow cytometry using PI, the changes are subtle because most cells of the animal are differentiated (GO) and stem cells are not synchronized at specific cell cycle phase. To increase the resolution of cell cycle measurements in planarians, various methods to differentiate stem cells from their postmitotic progeny were tested using Hoechst, TO-PRO, and BrdU. Among these, BrdU is the most effective. BrdU is a thymidine analog that becomes incorporated into newly synthesized DNA during S-phase, and so in planarians a short pulse of BrdU labels the cycling stem cells 115]. Therefore, it should be possible to cytometrically follow the fate of cells labeled with BrdU through multiple rounds of cell division. Staining with BrdU allows us to distinguish the fraction of cells that become postmitotic (GO) from the fraction of cells that will re-enter the cell cycle (Gl). To label cycling stem cells, a single pulse of BrdU was provided to the animals via feeding or injection. The animals were then dissociated into single cells at various time points, and the cells were analyzed for BrdU incorporation along with DNA content using PI. Stained cells were then subjected to flow cytometry. We observed that
BrdU-negative cells made a peak of GO/G1-phase cells while BrdU-positive cells are in
Gl, S, and G2/M at 48 hours after BrdU-injection (Figure 2.5). To follow the fate of the stem cells labeled with BrdU, I analyzed their cell cycle at various time points (Figure
2.6). BrdU-positive cells are most abundant in S or G2/M through 16 hours after BrdU-
injection. By 22 hours after injection, BrdU-positive cells are most predominant in Gl. FIGURE 2.5. BrdU analyses of planarian cells using FACS. After labeling cycling stem cells with BrdU, cell cycle profdes of the entire cell population from dissociated animals, planarian whole cells, or BrdU-positive cells, or BrdU-negative cells were analyzed by FACS. At 48 hours after BrdU-injections, most BrdU-negative cells are in
G0/G1 phase while BrdU-positive cells are traversing Gl, S, and G2/M. 31
Total cells BrdU-negative BrdU-positive
800- I t, 800 800 600- 600 600- 400" 400 400- 2001 1 Jl 200' 200" 0- 0- o- 30 60 90 120 30 60 90 120 30 60 90 120 propidium iodide FIGURE 2.6. Cell cycle analyses using BrdU and PI. BrdU-injected animals were dissociated at various time points after BrdU administration. Their cell cycle was analyzed by FACS after staining with BrdU for DNA replication and PI for DNA contents. The boxes represent BrdU-positive cells. 105- Uninjected 10s4 2h 105' 4h 104- 10" 104- 103- 103 103-
0 102 103 104 106 0 102 103 104 10® 0 102 103 104 10
10H 6h 105- 8h 105- 10h 104- 104- 104' r 3 Z) 10H 10 10 ' "D CD 0 102 103 10" 105 0 102 103 104 105 o 102 103 104 10
105- 12h 105- 14h 105- 16h 104- 104- 104- 103- 1 o3- 103-
0 102 103 104 105 0 102 103 104 10® 0 102 103 104 10
105- 18h 105-22h 105-24h 4 4 4 10 - 10 - — 10 - 103- 103- 103-
0 102 103 104 106 0 102 103 104 105 0 102 103 104 105 Propidium iodide These results allowed us to deduce that the total length of cell cycle in planarian stem cells is about 21 hours because the time required for BrdU to be first detected in neoblast after its introduction is about 1 hour. This result is comparable to the total cell cycle duration of ES cells (about 20 hours) estimated by the BrdU cumulative labeling technique [16].
Using the methods I developed for combining BrdU labeling and FACS, I further characterized the cell cycle features of XI, X2, and Xins cells [13]. Isolated XI, X2, and
Xins cells by FACS were analyzed at different time points after BrdU incorporation by feeding. 49±0.8% of cells in the XI fraction was labeled with BrdU 8 hours after BrdU- feeding. In contrast, only 4±2% of the X2 and 7±3% of the Xins cells were BrdU-positive.
By 18 hours the BrdU-labeled X2 cells increased to 22.5±5.4%, while no increase was detected in the Xins cells. Four days after BrdU-feeding, the number of BrdU-positive XI cells was significantly reduced to 27±4.6% and BrdU-positive X2 cells remained constant
(18.9±3.7%). These results demonstrate that the cycling XI cells can give rise to a portion of the cells found in the X2 population.
Discussion
It is clear that cell cycle regulation is critical for maintaining stem cell functions
[3], Most studies on cell cycle in stem cells have been done in vitro using ES cells. The cell cycle in ES cells is constitutively primed for DNA replication. They, therefore, have a very short G1 phase and newly formed cells also enter a new phase of DNA replication very shortly after exit from mitosis. In contrast, little is known about the cell cycle in embryonic stem cells not undergoing clonal expansion and in adult somatic stem cells
[17], Because the planarian S. mediterranea is a good model system to study adult somatic stem cells [18], we developed optimal methods of flow cytometry to study stem
cell proliferation in this organism. First of all, cell cycle distribution measurements of
planarian cells, allowed us to demonstrate changes in cell cycle dynamics in these
animals in response to environmental stimuli. For example, feeding results in a rapid Gl to S phase progression. What are the mechanisms regulating the rapid transit through the
Gl phase in this adult somatic stem cell? Do similar regulatory events occur in the
somatic stem cells of other organisms? Germline stem cells and ES cells are affected differently by nutritional changes. Drosophila germline stem cells promote their proliferation rate in response to nutrients [4], but ES cells are independent of serum stimulation [19] or mitogenic signals [20], ES cells can efficiently progress through the
Gl to S phase constantly. Generally, in other systems, the rate limiting transition from Gl to S is regulated by cyclin D which itself is under the regulation of the retinoblastoma protein, a target of signaling pathways responding to environmental changes [21],
Therefore, it would be of great importance to study the molecular regulation of Gl
progression in planarian stem cells. In Chapter 3, I describe my efforts to identify key
molecular components of the cell cycle, while in Chapter 4,1 present the characterization of a molecule directly involved in regulating cell cycle re-entry.
We also detected different cell cycle distribution profiles in animals treated with
RNAi of known cell cycle-related genes that cause different mitotic stem cell deficiencies.
Our data clearly indicate that the methodologies described can be deployed to both characterize cell cycle phenotypes of known cell cycle related genes, and as tools to
screen for cell cycle defects in RNAi screens. The number of mitotic cells and the
percentage of cell population in each cell cycle phase will reflect on the function of the identified molecules. For example, if an identified molecule promotes the progression of
cell cycle after environmental change, animals fed dsRNA against this gene will show a
phenotype of low mitotic activity and/or cell cycle arrest. If, as expected, planarians
possess cell autonomous regulators of the neoblast cell cycle, planarian stem cells may
modulate their cell cycle using these molecules in response to environmental changes.
Alternatively, the cell cycle of the neoblasts could be regulated by signals from
differentiated progeny in response to environmental changes.
Finally, BrdU labeling of cycling stem cells provided us with a remarkable
improvement in the resolution of flow cytometric based cell cycle analyses. BrdU
labeling in combination with flow cytometry will be instrumental in characterizing the cell cycle characteristics of the planarian stem cells. Future experiments will aim to
incorporate mitotic measurements to combined BrdU and flow cytometry methods using the H3P antibody. Since Histone H3 is phosphorylated at the G2 to M transition, mitotic cells could be resolved from G2 cells found in the G2/M peaks of flow cytometry profiles
[22], Nevertheless, in its present state, the flow cytometric methods optimized for the study of cell cycle dynamics in planarians provide us with a unique opportunity to investigate this understudied aspect of in vivo stem cell biology.
Acknowledgments
We thank Jim Jenkin. Wayne Green, Nasum-Hawk Oh for technical flow cytometry support. We also thank Dr. Eric Green for discussion on the BrdU labeling experiments. 37
References
1. Elledge, S.J., Bachant, J., Sanchez, Y„ Desany, B., Alcasabas, A., Wang, H., and George, A. (1997). Cell cycle checkpoint pathways in yeast and humans. Faseb Journal 11, A1302-A1302.
2. Smith, A.G. (2001). Embryo-derived stem cells: of mice and men. Annual Review of Cell and Developmental Biology 17, 435-462.
3. Orford, K.W., and Scadden, D.T. (2008). Deconstructing stem cell self-renewal: genetic insights into cell-cycle regulation. Nature Reviews Genetics 9, 115-128.
4. Drummond-Barbosa, D., and Spradling, A.C. (2001). Stem cells and their progeny respond to nutritional changes during Drosophila oogenesis. Developmental Biology 231, 265-278.
5. Hong, Y.L., and Stambrook, RJ. (2004). Restoration of an absent G(l) arrest and protection from apoptosis in embryonic stem cells after ionizing radiation. Proceedings of the National Academy of Sciences of the United States of America 101, 14443-14448.
6. Oviedo, N.J., Newmark, PA., and Sanchez Alvarado, A. (2003). Allometric scaling and proportion regulation in the freshwater planarian Schmidtea mediterranea. Developmental Dynamics 226, 326-333.
7. Baguna, J. (1976). Mitosis in the intact and rgenerating planarian Dugesia mediterranea n.sp. 11 Mitotic sudies during regeneration and a possible mechanism of blastema formation. J Exp Zool 195, 65-80.
8. Fortune], N.O., Otu, H.H., Ng, H.-H., Chen, J., Mu, X., Chevassut, T, Li, X., Joseph, M., Bailey, C., Hatzfeld, J.A., Hatzfeld, A., Usta, F., Vega, V.B., Long, P.M., Libermann, T.A., and Lim, B. (2003). Comment on "'Sternness': Transcriptional Profiling of Embryonic and Adult Stem Cells" and "A Stem Cell Molecular Signature." Science 302, 393.
9. Newmark, P.A., and Sanchez Alvarado, A. (2000). Bromodeoxyuridine specifically labels the regenerative stem cells of planarians. Developmental Biology 220, 142-153.
10. Pozarowski, P., and Darzynkiewicz, Z. (2004). Analysis of cell cycle by flow cytometry. Methods in Molecular Biology 281, 301-311.
11. Sanchez Alvarado, A., and Newmark, P.A. (1999). Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc Natl Acad Sci U S A 96, 5049-5054. 38
12. Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sanchez Alvarado, A. (2005). Identification of genes needed for regeneration, stem cell function, and tissue homeostasis by systematic gene perturbation in planaria. Developmental Cell 8, 635-649.
13. Eisenhoffer, G.T., Kang, H., and Sanchez Alvarado, A. (2008). Molecular analysis of stem cells and their descendants during cell turnover and regeneration in the planarian Schmidtea mediterranea. Cell Stem Cell 3, 327-339.
14. Irniger, S., and Nasmyth, K. (1997). The anaphase-promoting complex is required in G(l) arrested yeast cells to inhibit B-type cyclin accumulation and to prevent uncontrolled entry into S-phase. Journal of Cell Science 110, 1523-1531.
15. Eidinoff, M.L., Cheong, L., and Rich, M.A. (1959). Incorporation of unnatural pyrimidine bases into deowyribonucleic acid of mammalian cells. Science 129, 1550-1551.
16. Fluckiger, A.C., Marcy, G., Marchand, M„ Negre, D., Cosset, F.L., Mitalipov, S., Wolf, D., Savatier, P., and Dehay, C. (2006). Cell cycle features of primate embryonic stem cells. Stem Cells 24, 547-556.
17. D'Urso, G., and Datta, S. (2001). Cell cycle control, checkpoints, and stem cell biology. Stem Cell Biology, Cold Spring Harbor Laboratory Press.
18. Newmark, P.A., and Sanchez Alvarado, A. (2002). Not your father's planarian: a classic model enters the era of functional genomics. Nature Reviews Genetics 3, 210-219.
19. Schratt, G, Weinhold, B., Lundberg, A.S., Schuck, S., Berger, J., Schwarz, H., Weinberg, R.A., Ruther, U., and Nordheim, A. (2001). Serum response factor is required for immediate-early gene activation yet is dispensable for proliferation of embryonic stem cells. Molecular and Cellular Biology 21, 2933-2943.
20. Burdon, T., Smith, A., and Savatier, P. (2002). Signalling, cell cycle and pluripotency in embryonic stem cells. Trends in Cell Biology 12, 432-438.
21. Shen, W.H. (2001). The plant cell cycle: Gl/S regulation. Euphytica 118, 223-232.
22. Juan, G, and Darzynkeiwicz, Z. (2004). Detection of mitotic cells. Current Protocols in Cytometry Chapter 7. CHAPTER 3
IDENTIFICATION AND CHARACTERIZATION OF GENES
THAT AFFECT THE CELL CYCLE
Abstract
The major components of the cell cycle machinery and their regulatory mechanisms in response to extracellular stimuli are evolutionarily conserved from yeast to human. By searching its recently annotated genome, we found that the planarian S. mediterranea possesses a comparatively large number of cell cycle gene homologs such as cdks, cyclins, and cdcs. Planarians also have genes known to regulate the cell cycle under conditions that damage DNA or which sense nutritional changes. Because little was known at the time about the cell cycle of planarian neoblast, we cloned multiple, key cell cycle regulators and characterized their functions using RNAi and flow cytometric analyses. Although the data from RNAi experiment was inconclusive in some respects, a handful of the characterized genes were observed to regulate the planarian cell cycle in robust and reproducible ways. Our studies provide valuable information to dissect the regulatory mechanisms of the cell cycle of stem cells in vivo.
Introduction
The central molecular effectors of cell cycle progression are the cyclin-dependent kinases (CDKs) and their binding partners, cyclins [1], Different cyclins are produced at different cell cycle phases, resulting in the formation of a series of cyclin-Cdk complexes that drive cell cycle events. The regulation of Cdk is involved in controlling cell cycle progression in response to cell cycle checkpoints and extracellular signals that regulate cell proliferation [2], However, the precise signaling pathways and the molecules responding to these signals to effect cell cycle arrest or activation in stem cells remain to be determined.
Multicellular organisms utilize a wide variety of checkpoint controls to maintain genome stability during development [3]. Generally, DNA damage delays cell cycle progression by inhibiting Cdk activation at either the G1 to S or G2 to M phase transition to prevent passing the damaged DNA to daughter cells [4], When the level of damage is severe, cells undergo apoptosis. Although different mechanisms can be used in response to DNA damage depending on the organism or cell type, the checkpoint-involved signaling pathways are highly conserved (Figure 3.1). Checkpoint pathways are characterized by cascades of protein phosphorylation, altering the activity, stability, or localization of the phosphorylated proteins. In response to DNA damage, ataxia- telangiectasia mutated (ATM) and ataxia-telangiectasia and RAD3 related (ATR) proteins trigger the activation of a checkpoint that leads to cell cycle arrest or delay [4],
ATM and ATR kinases induce accumulation and activation of the p53 protein under DNA damage, activating p21 to block Cdk activity at G1 phase. ATM also induces the phosphorylation of the checkpoint kinase 2 (Chk2), which targets the Cdc25A phosphatase for ubiquitin-dependent degradation [5], Consequently, the Cdk2/Cyclin E and Cdk2/Cyclin A complexes remain inactive and thus DNA synthesis is prevented at S phase [6]. Double strand breaks generated by DNA damage, require nucleases and 41
FIGURE 3.1. Evolutionarily conserved signaling pathways regulating cell cycle.
DNA damage activates ATM- and ATR-mediated signaling, resulting in checkpoint controls during cell cycle. Tor- and PI3K-mediated signaling regulates cell cycle progression in response to nutrient status and mitogenic signals. * indicates genes that we cloned in this study. DNA damage
ATM / ATR
. MSH p53 Chk1 / Chk2 ^ I 1 apoptosis Nbs1 / MRE11 */ Rad50* Cdc25C* p21 Cdc25A I i 1 SMC1/FANCD2 Cdk1* CyclinB' Cdk2*^yclinE' I GO G1 Cdc45 G2 M f * t translation & growth Cdk2? CyclinE ^ \ Glucose metabolism T. elF4E \ (GSK3*/Glut4T Rb' S6KT p21 / p27 4EBP1 Cdk4/6*CyclinD T TOR*) TSC1 / 2 | Akt fe-PI3K*-* IRS t T t Nutrients PTEN Growth factors (Insulin) 43 polymerases in S phase because they are unable to be directly ligated. Nijmegen- breakage-syndrome-1 (Nbsl), Meiotic-recombination protein-11 (Mrell), Rad50 and
Fanconi anaemia complementation group D2 (FANCD2) are involved in this processing
[7, 8], In addition, Chkl and Chk2, which are activated by ATM and ATR, phosphorylate
Cdc25C. The phosphorylated Cdc25C is sequestered in the cytoplasm, keeping the
Cdkl/Cyclin B1 complex in an inactive state, thus blocking entry into mitosis [9].
The cell cycle can be regulated in response to extracellular signals generated by changes in nutrient status and mitogenic signals. For example, yeast cells respond to external cues such as starvation by arresting their cell cycle at G1 phase while mitogenic signals initiate cell cycle re-entry, exit quiescence, and progress through G1 phase. Both nutrient status and combinations of growth factors are known to induce the activation of
Cdks. Although it is clear that stem cells respond to environmental factors by undergoing cell cycle arrest or activation, surprisingly little is known about the molecular mechanisms that regulate the cell cycle. The best understood mechanism is the target of rapamycin (Tor)-mediated signaling. Tor has been recognized as an evolutionarily conserved central coordinator to integrate nutrient and mitogenic signals to regulate cell growth and ccll cycle progression (Figure 3.1) [10]. Tor is activated when yeast cells are grown on nitrogen-rich sources like glutamine, and becomes inactive upon depletion of nutrition [11], Mammalian Tor (mTor) promotes GO to S phase cell cycle progression and rescues the inhibition effect of rapamycin blocking G1 phase progression. The best characterized downstream effectors of mTor are the 70kDa ribosomal protein S6 kinase 1
(S6K1) and the eukaryotic translation initiation factor 4E (eIF4E)-binding protein 1
(4EBP1) [12]. These proteins promote ribosome biogenesis and therefore enhance protein 44 biosynthetic capacity for cell growth with cell cycle progression during cell proliferation.
mTor-dependent signals activate S6K1 and inactivate 4EBP1, while the tuberous sclerosis complex proteins (TSC1 and TSC2) negatively regulate mTor. The PI3K/Akt pathway, which coordinates growth factor signaling with mTor signals, has been reported to have direct effects on the cell cycle machinery [13]. Growth factor-activated PI3K activates
Akt. Akt promotes Cdk2 activation and positively regulate Gl to S cell cycle progression
while it inactivates GSK3-beta, leading to increased cyclin Dl, and inhibition of TSC2
[14], Akt also causes mislocalization of the Cdk inhibitors, p21 and p27 that inhibit cyclin
E/Cdk2 activity for cell cycle arrest in Gl phase [15], Retinoblastoma (Rb) also plays a critical role in the regulation of cell cycle proliferation. Previous studies have shown that
Rb activation arrests cells at the Gl phase by repressing transcription of genes required
for the Gl/S transition [16].
Which signaling pathways affect the cell cycle machinery to induce or inhibit cell cycle progression in stem cells? How do changes in the activity of multiple signaling pathways result in coordinated changes in cell cycle activity? Are there specific windows of opportunity during cell cycle progression in which signals must effect these changes?
To address these questions, studies on planarian cell cycle regulation might be
informative. Whether Cdks are involved in the regulation of the neoblast cell cycle, and whether the Gl or G2 checkpoints are under the control of Cdks following amputation and feeding remain to be determined. Given the wide phylogenetic use of Cdks in the regulation of the eukaryotic cell cycle, it is likely that these molecules will play key roles
in regulating neoblasts. Future investigations of neoblast cell cycle regulation will have to define if Cdk functions are conserved and determine whether Cdks are regulated by 45 homeostatic changes defining basic planarian biological functions such as regeneration and tissue homeostasis. The availability of large collections of cDNAs, double-stranded
RNA-mediated interference, and cell cycle analyses using flow cytometry make these problems accessible to experimental manipulation, and should allow for a detailed mechanistic dissection of neoblast cell cycle activities in response to metabolic changes.
Here, we selected a set of evolutionarily conserved molecules known to play pivotal roles in cell cycle regulation, and tried to determine whether these molecules share functional characteristics in the cell cycle of planarian stem cells using RNAi and flow cytometric analyses. This study provides a platform for launching cell cycle research of stem cells using planarians as a model system.
Materials and Methods
Cloning
Candidate genes were cloned into pDONRdT7 or pCR4-TOPO vector. Twenty- one genes were amplified by RT-PCR from C4 asexual cDNA using primers containing attB recombination sequences. PCR products were individually cloned into pDONRdT7 vector using a BP reaction (Invitrogen). The other 7 genes were amplified by RT-PCR from C4 asexual cDNA and directly cloned into pCR4-TOPO vector (Invitrogen). All the clones were transformed into E. coli strain HT115 for RNAi experiments. Primers used for RT-PCR are shown in Table 3.1. For making riboprobes, PCR products were amplified using the ASA1 and 2 or the Ml3 forward and reverse primers.
ASA1 : GCTATGACCATGATTACGCCAAGCGC
ASA2 : GTAATACGACTCACTATAGGGCG TABLE 3.1 Primers used for RT-PCR to clone candidate genes. 47
CDK1 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAATATATTTA TAAATCTC
CDK1 R GGGGACCACTTTGTACAAGAAAGCTGGGTTTATTTATTTGTC TTTATTTTT
CDK2 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGTATTCAAATC AATTTGAA
CDK2 R GGGGACCACTTTGTACAAGAAAGCTGGGTTTAACTTAAAAAT AATTTTTTAG
CDK4 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGGTGAAGGTG CTTT
CDK4 R GGGGACCACTTTGTACAAGAAAGCTGGGTTTATTTTGATTTTT TAATAGAAA
CDK6 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGTGGTGGAATT CCTC
CDK6 R GGGGACCACTTTGTACAAGAAAGCTGGGTTCACTTATTGAAA ACGTAT
CDK 10 F GTACGGATTTCCTATTACAT
CD/C/O R CTCGGTTTTTCTTTCAATTTG
CDK11 F TAGATAATCGTGAATATGCC
CDK1 I R CTCTAAACTGAATCTTCC cyclin A F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGACTACCGAAA CTCTAC cyclin A R GGGGACCACTTTGTACAAGAAAGCTGGGTTTAAACACAGGCC AATAAAC cyclinB F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGCACTTTAAGG ATGACG cyclinB R GGGGACCACTTTGTACAAGAAAGCTGGGTTCATTGATTTGCTT GAATCT 48
TABLE 3.1 continued
cyclinC F GGTGAGAAGTTGGGCCTT
cyclinC R GCTGTTGATTGGCATTGTG
cyclinD F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAAACGTCGTG GCTT
cyclinD R GGGGACCACTTTGTACAAGAAAGCTGGGTTCAACTAATTATT ATCGGTA
cyclinG F GCCAATGGCTCAGAACGT
cyclinG R AGATGTCGGAGATGCTCC
cyclinH F GCCCGATGGATTTTCTCA
cyclinH R CAACGCGACATCATTGGG
cdc7 F GTCGATTTCGGATTGGCT
cdc7 R CAAATTCGGCATGGTTTCC
cdc25C F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGCGTCAAATGA TATCCC
cdc25C R GGGGACCACTTTGTACAAGAAAGCTGGGTTTACATTTCTGGTC CACGA
cdc45 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGTGGTGGAATT CAGTG
cdc45 R GGGGACCACTTTGTACAAGAAAGCTGGGTTTATTCGGACAAA AACCTAC
cdc73 F CACGGCAAAGGATTGTCG
cdc73 R TTTGACCATGTGCCGATC
4EBP1 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAGTTCTTCTA ATTACAT
4EBP1 R GGGGACCACTTTGTACAAGAAAGCTGGGTTCATCTAGAATAA ATTCTCA 49
TABLE 3.1 continued
PI3K F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAAAAGATCTG ATGTACC
PI3K R GGGGACCACTTTGTACAAGAAAGCTGGGTAATGGCTTTAATC CGTTGA
GSK3 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAGCTCTAAAT TTTTAAAT
G.S'AJ R GGGGACCACTTTGTACAAGAAAGCTGGGTTTACCTGGAACTG ATGTA
glut4 F GGGGACAAGTTTGTACAAAAAAGCAGGCTGTAATTATTGGTG CTATTAT
glut4 R GGGGACCACTTTGTACAAGAAAGCTGGGTTACGGCATTGATT CCC
m"/ F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGAAAGAAAA GATTATAG
.S75A7 R GGGGACCACTTTGTACAAGAAAGCTGGGTTTACCTTTCGTCAC ACAA
FANCD2 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGATTAGAGGCA TTGAAAC
FANCD2 R GGGGACCACTTTGTACAAGAAAGCTGGGTTGTTACAGCACCG ATTCC
rad50 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAGTTATCACC AAGTAAA
rac/50 R GGGGACCACTTTGTACAAGAAAGCTGGGTCTAGCATACGCAG GAACA
MRE11 F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAGTGATGAAG ACACT I 1
MRE11 R GGGGACCACTTTGTACAAGAAAGCTGGGTTTAT IXXjTCCCCA AAATGTC 50
TABLE 3.1 continued
MSH F GGGGACAAGT TTGTACAAAAAAGCAGGCTATGAATAGCACCG ACAAGC
MSH R GGGGACCACTTTGTACAAGAAAGCTGGGTACCGACCTTCAGC GTATC
tor F GGGGACAAGTTTG Ty\CAAAAAAGCAGGCTATGACTCAAGAAA 1 1AATAG
tor R GGGGACCACTTTGTACAAGAAAGCTGGGTTATCACGTTTACC AATTTAT
GGGGACAAGT ("TGTACAAAAAAGCAGGCTTTGAGTGTGTGTT TAATCAT
RBR GGGGACCACTTTGTACAAGAAAGCTGGGTCGAACAATACTTG GGGAC
eIF4E F GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAAGAAAGTTA TTGATTTT
eIF4E R GGGGACCACTTTGTACAAGAAAGCTGGGTTTATATTCTAAAA GTGCACT Three RNAi feedings were administrated on days 0, 4, and 13 as previously described [17]. To examine the regeneration phenotype, RNAi animals were amputated 4 hours after RNAi feeding on days 4 and 13. For injection experiments, dsRNA was prepared using T7 RNA polymerase and about lOOnl were delivered per animals for three consecutive days.
In Situ Hybridization
Animals were fixed in Carnoy's (60% EtC>H;30% CHC13;10% acetic acid) and performed whole-mount in situ hybridization with digoxygenin (DIG)-conjugated riboprobes as described previously [18]. For in situ hybridization on FACS-isolated cells, cells were spotted on a slide (Superfrost plus, VWR) for 30 minutes, fixed in 4% formaldehyde in PBS for 20 minutes at RT, treated with 1 pg/ml Proteinase K in PBS for
10 minutes at RT, and then postfixed in 4% formaldehyde in PBS for 15 minutes at RT.
Flybridization was done for 36 hours at 56°C. After washes with 2X SSC and 0.2X SSC, cells were blocked in PBST (PBS + 0.1% triton X-100) including 10% heat-inactivated horse serum, and then labeled with anti-DIG antibody (1:2000, Roche) for 2 hours at RT.
Cells were washed with PBST overnight and signals were developed for about 4 hours.
Immunostaining
Animals were killed in 2% HC1 for 5 minutes and fixed in Carnoy's for 2 hours on ice. They were hydrated in 100% methanol for 1 hour at -20 °C and bleached in 6% H2O2 in methanol overnight at RT. Following rehydration through a methanol dilution series in
PBST (PBS + 0.3% Triton X-100), animals were labeled with the phosphorylated histone 52
H3 antibody (1:300, Upstate) and the goat anti-rabbit conjugated to HRP (1:150,
Molecular Probes). Signals were amplified by tyramide conjugated to Alexa 568 (1:100,
Molecular Probes). Following washes with PBST including 0.25% BSA, animals were mounted in Vectashield.
FACS
Animals were dissociated by a plastic pestle and incubated in calcium, magnesium-free medium (CMF). Cells were filtered through 53 pm and 20 pm Nitex filters and then incubated with Hoechst 33342 (25pg/ml) for 20 minutes and calcein
(0.2pg/ml) for 10 minutes sequentially. Cells were collected, resuspended in CMF + BSA and PI (4pg/ml) was added. Analyses and sorts were performed using a Becton Dickinson
FACS vantage.
Results
Identification of Potential Planarian Cell Cycle Regulators
We searched the planarian genome using BLAST (Basic Local Alignment Search
Tool) for homologs of key cell cycle regulators. Because the assembly and annotation of planarian genome sequence was not completed when we started this research project, we carried out blast search based on the data of the planarian whole genome shotgun sequencing. The tblastn search was done with available protein sequences of key cell cycle genes in other organisms from plant to human and the Phrap program was run for assembling shotgun DNA sequence data. Then, we collected the best matched contig possessing the lowest e-value and longest sequence. We obtained the predicted protein sequence using ORF finder and the homology of this sequence was confirmed by blastp. 53
Using this method, we identified 29 potential cell cycle genes of S. mediterranea (Table
3.2). Among 29 genes, 18 genes are considered to be involved in cell cycle progression, 4 genes are components of the DNA repair machinery known to affect cell cycle, and 7 genes are known to have effects on growth and proliferation by regulating the cell cycle in response to nutrients.
RNAi Phenotypes of Potential Planarian Cell Cycle Regulators
Previous studies demonstrated that Smed-cyclinB and Smed-cdc23, the only known planarian cell cycle regulators, have RNAi phenotypes characterized by an inability to regenerate [17|. In other organisms, absence of cyclinB and cdc23 has been shown to cause cell cycle arrest at G2 and mitosis, respectively. RNAis of Smed-cyclinB and Smed-cdc23 also lead to cell cycle arrest and insufficient proliferation of neoblasts, yielding a regeneration defect. Therefore, to identify clones regulating the cell cycle in planarians, we examined RNAi animals for defects in regeneration similar to those observed in Smed-cyclinB(RNAi) and Smed-cdc23(RNAi) animals. RNAi animals were amputated pre- and post-pharyngeally. Controls, unc22(RNAi) animals, regenerate heads and tails within 7 days after amputation. While Smed-rb(RNAi) and Smed-cdc73(RNAi) animals phenocopied the defect observed in Smed-cdc23 RNAi animals (Figure 3.2A-D).
Smed-rb(RNAi) and Smed-cdc73(RNAi) animals fail to form blastemas, curled ventrally, and lysed. On the other hand, RNAis of Smed-tor and Smed-eif4e resulted in a delay of regeneration: RNAi animals accomplish regeneration, but the process was slower than in control (Figure 3.2E and F). Some of the Smed-eif4E(RNAi) animals fail to develop pigment cups. RNAi animals of Smed-mrell, Smed-msh, or Smed-glutA also regenerate with a normal time schedule, but fused pigment cups were observed with some frequency. 54
TABLE 3.2. List of potential planarian cell cycle regulators. Twenty-nine genes were cloned by RT-PCR using cDNA and characterized by RNAi experiments. These genes are categorized by their known functions in other organisms. 55
Category Gene Accession Known function number Control of cell Smed-cdk1-1 FJ588601 Progression of G2/M transition cycle progression Smed-cdk2-1 FJ588602 Progression of G1/S transition Smed-cdk4-1 FJ588603 Progression of G1/S transition Smed-cdk6-1 FJ588604 Progression of G1/S transition Smed-cdk10-1 FJ588626 Inhibition of the entry into S-phase Smed-cdk11-1 FJ588625 Negative regulation of cell cycle Smed-cyclinA-1 FJ588605 Progression of G1/S and G2/M transition Smed-cyclinB-1 FJ588606 Progression of G2/M transition Smed-cyclinE-1 FJ588607 Progression of G1/S transition Smed-cyclinH FJ588621 Regulation of CDK7 kinase activity Smed-cyclinC FJ588622 Transcriptional regulation Smed-cyclinG FJ588623 G2/M arrest in response to DNA damage Smed-cdc7 FJ588627 Phosphorylation of CDKs Smed-cdc25c-1 FJ588599 Progression of G2/M transition Smed-cdc45 FJ588600 Initiation of chromosomal DNA replication Smed-cdc73 FJ588624 Regulation of cyclin D1 expression Smed-rb FJ588617 Negative regulation of cell cycle Smed-e2f-1 FJ588618 Transcription activator controlling G1/S transition Control of cell Smed-tor FJ588620 Progression ofG1 phase growth and Smed-s6k1-1 FJ588619 Phosphorylation of ribosomal protein proliferation S6 in response to insulin or mitogens Smed-4ebp-1 FJ588608 Negative regulation of translational initiation Smed-eif4E1-1 FJ588609 Protein biogenesis Smed-glut4-1 FJ588611 Glucose transporter Smed-gsk3-1 FJ588612 Regulation of glycogen metabolic process Smed-pi3k-1 FJ588615 Regulation of phosphoinositide- mediated signaling Control of cell Smed-fancd2-1 FJ588610 Activation of S- and G2 phase- cycle checkpoints checkpoint upon DNA damage in response to Smed-mre11-1 FJ588613 Repair of double-strand break DNA damage Smed-msh-1 FJ588614 Component of the post-replicative DNA mismatch repair system Smed-rad50-1 FJ588616 Repair of double-strand break FIGURE 3.2. RNAi phenotypes of potential planarian cell cycle regulators. Animals were amputated 13 days after RNAi feeding and then examined 11 days after amputation.
(A) unc22(RNAi) control. (B-D) Smed-rb(RNAi) and Smed-cdc73(RNAi) animals had regeneration phenotype shown in control, Smed-cdc23(RNAi) animal. (E-F) Smed- tor(RNAi) animal Smed-eif4E(RNAi) animals showed slow regeneration. (G-I) Smed- mrel 1 (RNAi), Smed-msh(RNAi), and Smed-glut4(RNAi) animals formed abnormal photoreceptors. Scale bars indicate 0.2 mm. 57
A — B c —
unc22(RNAi) Smed-cdc23(RNAi) Smed-rb(RNAi) D — E — F —
$ ••
Smed-cdc73(RNAi) Smed-tor(RNAi) Smed-eif4E(RNAi) G — H — 1 —
Smed-mre 11(RNAi) Smed-msh(RNAi) Smed-glut4(RNAi) RNAi of the remaining 22 genes did not result in any obvious phenotypes (Figure 3.2G-I), suggesting that these genes may not be uniquely required for planarian cell cycle during regeneration. Altogether, these results suggest that Smed-rb and Smed-cdc73 may be essential cell cycle regulators like Smed-cyclinB and Smed-cdc23 in planarians. The functional characterization of Smed-cdc73 will be described in Chapter 4.
Characterization of Potential Cell Cycle Machinery Genes
Surprisingly, many known conserved cell cycle machinery genes such as CDKs and cyclins do not appear to have the typical regeneration phenotype after RNAi treatment. To test whether the obtained clones were homologs to this gene family, we carried out in situ hybridizations to determine whether the isolated genes were or were not expressed in dividing cells. Our expectation was to find these genes expressed primarily in purified XI cells (see Chapter 2). As we expected, most cloned cdks and cyclins were expressed in cycling XI cells exclusively (Figure 3.3), ruling out the possibility of having misidentified planarian homologs. Therefore, the cloned genes are likely to play roles in regulating cell cycle and neoblast functions although they do not have morphologically visible RNAi phenotype. Only Smed-cdk6 and Smed-cyclinE are expressed in all XI, X2, and Xins cells ubiquitously, indicating that they are unlikely real functional homologs of cdk6 and cyclinE. We then examined these RNAi animals more carefully using flow cytometry and H3P immunostaining to determine whether they may have any subtle effects on the regulation of neoblast cell cycle. Cell cycle profiles of
RNAi animals were analyzed 20 days after the RNAi feeding by flow cytometry. Smed- rb(RNAi) animals, for example, were found to have more G0/G1 phase cells and fewer
G2/M phase cells (Figure 3.4A). Interestingly, although Smed-cdk4(RNAi) animals have 59
FIGURE 3.3. in situ hybridization of FACS-isoIated cells. Three populations, XI, X2, and Xins cells, were isolated from wild-type animals by FACS. Then in situ hybridizations were performed in these cells using riboprobes for cell cycle genes. Smed- cdkl, 2, and 4 and Smed-cyclinA and B were primarily expressed in XI cells. Scale bar indicates 50 pm. rb ede25e eyelinE eyelinB eye/inA edk6 edk4 edk2 edk1
0 .. ~ .. 0 • • • 0 -. .".- • 0 • • • ~ • • 0 • x • , • ~ • • • o' .' • , • • • • • • • • • • .. • • • II , 0 = 0 0 • ~ :- •
0 '. 0 0 '!- . 0 • • ~ • r ~ • "', ~ .. •'. t, ·• . I • 0 > • X • , '. ~ • 5 ' o. 0 I/) -0 0 -! • r • .. 0 • 0' " 0 • 4 ... • '0
0"\ o no morphological phenotype, they have fewer G0/G1 phase cells and slightly more G2/M phase cells (Figure 3.4A). These results are consistent with those of immunostaining using a mitotic cell marker, H3P (Figure 3.4B and C). There is a decrease and an increase in the number of mitotic cells in Smed-rb(RNAi) animals and in Smed-cdk4(RNAi) animals, respectively. Therefore, it is likely that Smed-cdk4 regulates the planarian cell cycle as well as Smed-rb. Nevertheless, in the rest of RNAi animals, there are no detectable changes in cell cycle profiles and in the number of mitotic cells. We interpret these results as indicating that some of the cloned genes do not function in the regulation of cell cycle or that a large number of cdks and cyclins are functionally redundant.
Additional Studies on Smed-rb
Smed-rb is expressed in differentiated cells that are insensitive to irradiation
(Xins) as well as in cycling cells (XI) unlike most cell cycle machinery genes that are expressed only in cycling cells (XI) (Figure 3.3). Therefore, we hypothesize that Smed-rb may have other functions besides regulating the cell cycle. Smed-rb(RNAi) causes impairment of regeneration instead of tumorigenesis, which is contradictory to the fact that Rb is a tumor suppressor gene in other organisms. Recent studies have shown that the biological functions of RB include apoptosis, differentiation and senescence [19]. To further characterize the functions of Smed-rb, we first carried out TUNEL staining on
RNAi animals to determine whether Smed-rb is involved in apoptosis. Our data indicate that Smed-rb(RNAi) animals have more TUNEL positive nuclei than control 21 days after
RNAi feeding (Figure 3.5). This suggests that Smed-rb can inhibit apoptosis besides its ability to regulate cell proliferation. 62
FIGURE 3.4. Cell cycle analyses of RNAi animals. (A) Cell cycle profiles for RNAi animals were analyzed by flow cytometry. (B) Antiphosphorylated histone H3 (H3P) immunostaining in whole-mount animals 20 days after RNAi feeding. Scale bars indicate
0.2 mm. (C) Quantification of H3P-positive nuclei in RNAi animals. Smed-rb(RNAi) animals had fewer mitotic cells while Smed-cdk4(RNAi) animals had more mitotic cells compared with unc22(RNAi) controls. A - ;:: (9 (9 'if. 0 ~ u '" % of G2/M cells % of S cells 0 80 86 88 82 84 12 8 6 0 2 4 2 4 6 8 o , ~ ~ ~ 1- co con control • • _ ntr tro o l l cdk1 cdk cdk1 - - - - - • • • 1 cdk2 cdk2 cdk2 - • • • • • • • • • • • cdk4 cdk4 cdk4 • • cyclinA cyc cyclinA l inA cy cyc cyclinB - clinB l in B - RB RB RB N -" z ~100 ~150 ~ ~ ~300 u '" => E E QJ C B 200 250 350 50 0 co ntro l RB CDK4 63 FIGURE 3.5. TUNEL assay for Smed-rb(RNAi) animals. (A) RNAi animals were stained by TUNEL assay 20 days after RNAi feeding. Scale bars indicate 0.2 mm. (B)
Quantification of TUNEL-positive nuclei in RNAi animals. Smed-rb(RNAi) animals had more TUNEL-positive nuclei than unc22(RNAi) controls. 65
A
B N E 200 E !!!. a; 150 u Q) .,> 100 'iii a.0 50 -'w z => f- 0 unc22 Smed-RB Characterization of Other Candidate Genes Known to Regulate Cell Cycle
Like the cloned cell cycle genes, RNAi of Tor and PI3K signaling pathway genes did not result in the expected regeneration phenotypes. Thus, we wished to determine whether these genes are expressed in cycling cells (XI) or not. In fact, most of the genes were expressed in Xins cells as well as XI cells or only in Xins cells (Figure 3.6).
However, Smed-mrell and Smed-fancd2 are expressed in cycling XI cells, but not in
Xins cells. This suggests that the cloned molecules involved in DNA repair may affect the cell cycle. To test this idea, we examined RNAi animals by flow cytometry and H3P immunostaining 20 days after RNAi feeding. Unfortunately, there are no significant changes between RNAi animals and controls in the cell cycle profiles and in the number of mitotic cells (Figure 3.7). However, we have yet to perform the cell cycle analyses after DNA damage using sublethal doses of irradiation.
Interestingly, Smed-glut4 and Smed-tor, nutritional status sensors, are expressed specifically in the central nervous system and in a few neurons, respectively (Figure
3.6B-D). To determine whether these genes affect cell cycle in response to nutritional status, we examined their mitotic activities after feeding. Because wild-type animals have significantly increased number of mitotic cells at 6 and 12 hours after feeding, we measured the levels of mitotic cells of the day 14 RNAi animals 6 hours after feeding. If
Smed-glut4 or Smed-tor promotes cell cycle progression in response to nutrients, then
RNAi animals that are unable to response to nutrients will not increase the number of mitotic cells after feeding. However, increases in number of mitotic cells in both RNAi animals and controls in response to feeding were observed. These data suggest that Smed- glut4 and Smed-tor regulation of nutritional sensing may occur in the presence of many FIGURE 3.6. in situ hybridization in FACS-isolatcd cells and in whole-mount animals. (A) in situ hybridizations were carried out in three FACS-isolated cell populations, XI, X2, and Xins, using riboprobes for potential cell cycle regulators. Scale bar indicates 50 pm. (B) Whole-mount in situ hybridization for Smed-glut4. (C) Whole- mount in situ hybridization for Smed-tor. (D) Magnified image of the head region in (B).
Smed-tor is expressed in specific neuronal cells. Scale bars in B and C: 0.2 mm; D: 0.1 FANCD2 MRE11 MSH rad50 GSK3 4EBP elF4E S6K1 PI 3K » • • • • • • • • • .. • • • • • 0- --c • x , ~ • •• ... • , • • • • " o' • ",
" ' X ., N s , s • • , I • • • • .... • • • • • • • s ' ,. x • • 3" !• •• • en s' • • • " • • • • FIGURE 3.7. Cell cycle analyses of RNAi animals. (A) After RNAi feeding with dsRNAs of signaling molecules known to affect cell cycle, cell cycle profiles were analyzed by fow cytometry. (B) Immunostaining using H3P antibody was carried out in whole-mount animals 20 days after RNAi feeding. Scale bars indicate 0.2 mm. 2 C 3D cn Q. o Ol r\J m 3: J\3 HUB Mmk f o flKh ^ s mm » ^ l§
: K* . i. - : • •> • * - V -
o alternative signaling pathways that sense nutrient status to regulate mitotic activities. On the other hand, they may be involved in the formation of blastema or differentiation of photoreceptors, given their abnormal regeneration phenotype after RNAi treatment.
Discussion
The program controlling stem cells is strictly linked to regulation of cell cycle because components of cell cycle machinery play a role in regulation of stem cell self- renewal, proliferation, and differentiation [20], Because only Smed-cdc23 and Smed- cyclinB are known cell cycle-related molecules in planarians [17], we determined whether other components of the cell cycle machinery may be involved. Inspection of the planarian genome helped indentify a group of evolutionarily conserved molecules known to regulate progression of the cell cycle. Smed-cdk4(RNAi) results in an increase of mitotic cells, which are in S or G2/M phase, while Smed-rb(RNAi) and Smed- cdc73(RNAi) results in a decrease of mitotic cells and impairment of regeneration.
Therefore, we concluded that Smed-cdk4, Smed-rb, and Smed-cdc73 may regulate the cell cycle in planarians.
We could not observe detectable changes in other cloned, putative cell cycle machinery genes by RNAi and flow cytometric cell cycle analyses. Why did known conserved cell cycle genes fail to produce phenotypes in planarians when silenced by
RNAi? Because most cdks and cyclins tested are expressed in only cycling stem cells
(XI), they are likely bona fide homologs and play a role in the proliferation of stem cells.
Moreover, most proteins encoding cell cycle genes are not likely to perdure after RNAi since they are known to cycle between destruction and de novo synthesis during the cell cycle. 72
For many years, studies using knockout mice provided information to understand mechanisms of cell cycle control associated with cdks or cyclins [21]. Unexpectedly, knockout mice of key cell cycle regulators are viable. For example, cdk2-null mice are viable and cell proliferation is barely affected [22|. In addition, embryonic cell cycles and proliferation of stem cells are not dependent on a specific cdk/cyclin complex. ES cells seem to be able to fully compensate for the lack of multiple Cdks [23], Taken together, our results suggest the possibility of functional redundancy of cell cycle molecules in planarians. To determine how many cell cycle molecules exist in planarians, we repeated the genomic search for cell cycle related genes with the completely annotated planarian genome. We found out that S. mediterranea has expanded many cell cycle gene families:
37 cdks, 26 cyclins, and 45 cdc genes. This allows us to deduce that cdk/cyclin complexes may functionally substitute for others.
To test RNAi efficiency, we compared the efficiencies between dsRNA-injection and dsRNA-feeding. Animals injected with dsRNA of Smed-mrell showed head regression which is a more severe phenotype than the phenotype generated by feeding dsRNA (the fused pigment cups). Smed-cdk2(RNAi) animals by dsRNA-feeding did not provide any phenotypes while they generated a head regression phenotype by dsRNA- injection. Therefore, although planarian cdks and cyclins are functionally redundant, optimization of RNAi methodologies to study cell cycle genes will be necessary.
We observed that S. mediterranea also possesses known signaling molecules responsible for regulating the cell cycle in response to environmental stimuli such as Tor and Glut4. We could not observe any significant changes in RNAi phenotype and in cell cycle profiles, suggesting that they might not be responsible for regulating cell cycle in planarians. However, this study is inconclusive until RNAi experiments are repeated by using RNAi method like dsRNA-injection. If they do not regulate planarian cell cycle, further characterization could be done using the a-arrestin antibody (VC-1) that recognizes planarian photoreceptor neurons [24], Considering that some RNAi animals gave phenotypes of delayed regeneration or perturbed photoreceptor formation, they might be involved in blastema formation or photoreceptor development. This study would be informative in uncovering mechanisms involved in cephalic blastema formation and differentiation.
There are a number of different mechanisms known to regulate stem cell maintenance and differentiation. Proliferation signals and cell cycle regulators may control cell kinetics or total number of cell divisions [25, 26], Loss of trophic support and cytokine receptor activation may contribute to the induction of cell death at specific stages of development [27, 28j. Signaling from differentiated progeny or asymmetric distribution of specific molecules may alter the self-renewal characteristics of stem cells
[29-31], Thus, it appears as if the final decision of a cell to self-renew, differentiate or remain undifferentiated is dependent on an integration of multiple signaling pathways which in turn depend on cell density, metabolic state, ligand availability, type and levels of receptor expression, and downstream cross-talk between distinct signaling pathways.
Although planarian stem cells respond to environmental factors such as nutrient status by undergoing cell cycle arrest or activation [32], little is known about the molecular mechanisms. Even though several signaling pathways have been shown to operate in various stem cell populations from Drosophila to humans [33-35], it is not clear which signal pathways are involved in planarian stem cells specifically, and how they affect the 74 regulation of the cell cycle. In fact, how multiple signal pathways cooperate or antagonize each other to regulate the functions of metazoan stem cells still remains an open question. In the Appendix, we will describe the characterization of additional molecules that are involved in a variety of biological processes and affect mitotic activities of neoblasts [17].
Acknowledgments
We thank Sofia Robb and Eric Ross for help with the genomic search for genes associated with the cell cycle.
References
1. Johnson, D.G., and Walker, C.L. (1999). Cyclins and cell cycle checkpoints. Annual Review of Pharmacology and Toxicology 39, 295-312.
2. Israels, E.D., and Israels, L.G. (2001). The cell cycle. Stem Cells 19, 88-91.
3. Lindahl, T. (1993). Instability and decay of the primary structure of DNA. Nature 362, 709-715.
4. Bartek, J., and Lukas, J. (2007). DNA damage checkpoints: from initiation to recovery or adaptation. Current Opinion in Cell Biology 19, 238-245.
5. Matsuoka, S., Rotman, G., Ogawa, A., Shiloh, Y., Tamai, K., and Elledge, S.J. (2000). Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in vitro. Proceedings of the National Academy of Sciences of the United States of America 97, 10389-10394.
6. Bartek, J., Falck, J., and Lukas, J. (2001). Chk2 kinase - A busy messenger. Nature Reviews Molecular Cell Biology 2, 877-886.
7. Lee, S.E., Moore, J.K., Holmes, A., Umezu, K., Kolodner, R.D., and Haber. J.E. (1998). Saccharomyces Ku70, Mrell/Rad50, and RPA proteins regulate adaptation to G2/M arrest after DNA damage. Cell 94, 399-409.
8. Petrini, J.H.J. (2000). The Mrell complex and ATM: collaborating to navigate S phase. Current Opinion in Cell Biology 12, 293-296. 75
9. Peng, C.Y., Graves, PR., Thoma, R.S., Wu, Z.Q., Shaw, A.S., and PiwnicaWorms, H. (1997). Mitotic and G(2) checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216. Science 277, 1501-1505.
10. Fingar, D.C., and Blenis, J. (2004). Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene 23, 3151 -3171.
11. Crespo, J.L., and Hall, M.N. (2002). Elucidating TOR signaling and rapamycin action: lessons from Saccharomyces cerevisiae. Microbiol Mol Biol Rev 66, 579- 591, table of contents.
12. Gingras, A.C., Raught, B., and Sonenberg, N. (2001). Regulation of translation initiation by FRAP/mTOR. Genes & Development 15, 807-826.
13. Martin, K.A., and Blenis, J. (2002). Coordinate regulation of translation by the PI 3-kinase and mTOR pathways. Advances in Cancer Research, Vol 86 86, 1-39.
14. Diehl, J.A., Cheng, M.G., Roussel, M.F., and Sherr, C.J. (1998). Glycogen synthase kinase 3 beta regulates cyclin D1 proteolysis and subcellular localization. Genes & Development 12, 3499-3511.
15. Liang, J., and Slingerland, J.M. (2003). Multiple roles of the PI3K/PKB (Akt) pathway in cell cycle progression. Cell Cycle 2, 339-345.
16. Du, W., Vidal, M„ Xie, J.E., and Dyson, N. (1996). RBF, a novel RB-related gene that regulates E2F activity and interacts with cyclin E in Drosophila. Genes Dev 10, 1206-1218.
17. Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sanchez Alvarado, A. (2005). RNAi screening identifiesregeneration and stem cell regulators in the planarian Schmidtea mediterranea. Developmental Cell 8, 635- 649.
18. Reddien, P.W., Oviedo, N.J., Jennings, J.R., Jenkin, J.C., and Sanchez Alvarado, A. (2005). SMEDWI-2 is a PlWI-like protein that regulates planarian stem cells. Science 310, 1327-1330.
19. Du, W., and Pogoriler, J. (2006). Retinoblastoma family genes. Oncogene 25, 5190-5200.
20. Tsai, R.Y.L. (2004). A molecular view of stem cell and cancer cell self-renewal. International Journal of Biochemistry & Cell Biology 36, 684-694.
21. Ciemerych, M.A., and Sicinski, P. (2005). Cell cycle in mouse development. Oncogene 24, 2877-2898. 76
22. Aleem, E., Kiyokawa, H., and Kaldis, P. (2005). Cdc2-cyclin E complexes regulate the Gl/S phase transition. Nature Cell Biology 7, 831-U893.
23. Berthet, C., and Kaldis, P. (2007). Cell-specific responses to loss of cyclin- dependent kinases. Oncogene 26, 4469-4477.
24. Inoue, T., Kumamoto, II., Okamoto, K., Umesono, Y., Sakai, M., Sanchez Alvarado, A., and Agata, K. (2004). Morphological and functional recovery of the planarian photosensing system during head regeneration. Zoological Science 21, 275-283.
25. Shivdasani, A.A., and Ingham, P.W. (2003). Regulation of stem cell maintenance and transit amplifying cell proliferation by tgf-beta signaling in Drosophila spermatogenesis. Curr Biol 13, 2065-2072.
26. Lindsten, T., Golden, J.A., Zong, W.X., Minarcik, J., Harris, M.H., and Thompson, C.B. (2003). The proapoptotic activities of Bax and Bak limit the size of the neural stem cell pool. J Neurosci 23, 11112-11119.
27. Rodriguez, M., Bernad, A., and Aracil, M. (2003). Interleukin-6 deficiency affects bone marrow stromal precursors resulting in defective hematopoietic support. Blood 103, 3349-3354.
28. Pepling, M.E., and Spradling, A.C. (2001). Mouse ovarian germ cell cysts undergo programmed breakdown to form primordial follicles. Dev Biol 234, 339- 351.
29. May, G., and Enver, T. (2001). Lineage Commitment and Self-Renewal of Blood Stem Cells. In Hematopoiesis: A Developmental Approach, L.I. Zon, ed. (New York: Oxford University Press), pp. 61-81.
30. Drummond-Barbosa, D., and Spradling, A.C. (2001). Stem cells and their progeny respond to nutritional changes during Drosophila oogenesis. Dev Biol 231, 265- 278.
31. Chen, D., and McKearin, D. (2003). Dpp signaling silences bam transcription directly to establish asymmetric divisions of germline stem cells. Curr Biol 13, 1786-1791.
32. Nimeth, K.T., Mahlknecht, M., Mezzanato, A., Peter, R., Rieger, R., and Ladurner, P. (2004). Stem cell dynamics during growth, feeding, and starvation in the basal flatworm Macrostomum sp. (Platyhelminthes). Dev Dyn 230, 91-99.
33. Bhardwaj, G, Murdoch, B., Wu, D„ Baker, D.P, Williams, K.P, Chadwick, K., Ling, L.E., Karanu, EN., and Bhatia, M. (2001). Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via BMP regulation. Nat 77
Immunol 2, 172-180.
34. Duncan, A.W., Rattis, F.M., Dimascio, L.N., Congdon, K.L., Pazianos, G., Zhao, C., Yoon, K„ Cook, J.M., Willert, K., Gaiano, N., and Reya, T. (2005). Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol.
35. Kleber, M., and Sommer, L. (2004). Wnt signaling and the regulation of stem cell function. Curr Opin Cell Biol 16, 681-687. CHAPTER 4
cdc73 IS REQUIRED FOR SELF-RENEWAL OF
PLANARIAN STEM CELLS
Abstract
The self-renewal of stem cells involves the coordination of proliferation and cell fate. Little is known, however, about the mechanisms underpinning cell cycle-mediated regulation of stem cell fate in vivo. We report that the planarian orthologue of the yeast protein cdc73 plays an essential, unpredicted role in the ability of planarian stem cells
(neoblasts) to re-enter the cell cycle. RNAi of Smed-cdc73 results in a blockade of regeneration and normal tissue homeostasis caused by the specific disappearance of neoblasts. We demonstrate that the loss of neoblasts is not due to arrest in the S, G2, or
M phases of the cell cycle, or to abnormal changes in cell death. Instead, we show that
Smed-cdc73(RNAi) hastens the differentiation of neoblasts. We propose that Smed-cdc73 functions to support stem cell self-renewal by inhibiting differentiation and promoting cell cycle re-entry of neoblasts during the G1 phase of the cell cycle.
Introduction
The coordination of self-renewal with cell cycle progression and cell-fate determination is an essential feature of stem cells that is critical for both embryonic development and the lifelong maintenance of adult tissues in multicellular organisms [ 1, 2], The ability of stem cells to re-enter the cell cycle, for example, drives the clonal expansion of mammalian embryonic stem cells (ESCs) in vitro [3, 4|. In vivo, modulating cell cycle re-entry and exit is indispensable for the maintenance and dynamics of differentiation of adult stem cells in the hematopoietic [5], digestive [6, 7], and central nervous system |8, 9], Although we have gained important new understanding of the molecular circuitry regulating the differentiation potential of stem cells in vitro [10-12], we know comparably little about how re-entry and exit from the cell cycle is regulated in both embryonic and adult stem cells in vivo.
In many biological contexts, cell cycle regulation has been implicated in determining the fate of the resulting daughter cells. After division, cells can follow one of at least five different fates: cell cycle re-entry [13], differentiation [14], quiescence [15,
16], senescence [15, 17] or apoptosis [18. 19], Which fate is favored depends both on developmentally and/or physiologically regulated intrinsic and extrinsic factors [20]. In stem cells, proliferation signals and cell cycle regulators may control cell kinetics or total number of cell divisions [21, 22]. Loss of trophic support and cytokine receptor activation may contribute to the induction of cell death at specific stages of development
[23, 24], Thus, whether stem cells self-renew, differentiate, remain undifferentiated, senesce, or die is dependent on a complex integration of multiple cell autonomous and cell non-autonomous events.
Interestingly, the vast majority of proliferation-mediated fate decisions have been documented to occur during the Gl phase of the cell cycle [25-281. Gl represents the interval between the completion of mitosis and the beginning of DNA synthesis, and it is generally subdivided into early (mitogen-dependent) and late (mitogen-independent) phases separated by a defined transition known as the restriction point (R) [29, 30], Self- renewal, for instance, is associated with shortening Gl. In ESCs, the G1 phase is characterized by an absence of the early phase and the R point [13, 31]; while in ASC self-renewal, the shortening of Gl is accomplished by bypassing the early phase via activation of the Wnt [32], Notch [33], and Hedgehog [34] pathways. Other cellular fates such as apoptosis, differentiation and senescence are also launched during Gl progression
[20], While it is true that many of the molecular events guiding Gl progression are well defined, we still possess a very limited understanding of how and what cell cycle factors may be directly associated with specific stem cell functions.
Because adult planarians maintain an active, experimentally accessible, and relatively large population of stem cells known as neoblasts [35], these organisms provide us with a unique opportunity to discover and characterize factors regulating in vivo stem cell functions [2], Neoblasts are the only known mitotically active somatic cells in planarians [36], and their proliferation generates a constant supply of cells to sustain the high rate of physiological turnover observed in these animals [37], Planarians also display remarkable developmental plasticity, as small fragments removed from almost anywhere in their bodies can regenerate entire animals [38], indicating that neoblasts can produce all the cell types found in the adult flatworm, including themselves and the germline [39]. Thus, appropriate regulation of the neoblast cell cycle is essential not only for maintaining homeostasis, but also for mounting a regenerative response [40],
The recent observation that transition from cycling neoblast to nondividing progeny is accompanied by specific changes in gene expression that are causally related by lineage
[41], combined with the characterization of neoblast [42] and division-progeny specific markers [41], provides molecular tools for the in vivo investigation of cell cycle-mediated regulation of stem cell fate in planarians.
In this study, we report that the planarian ortholog of the yeast protein cdc73
(.Smed-cdc73) regulates neoblast self-renewal. CDC73 is a component of the
Polymerase-Associated Factor 1 (PAF1) complex that interacts with RNA polymerase II, and is known to function in transcriptional initiation and elongation, posttranscriptional processing, and histone modification [43-46]. Our studies reveal that Smed-cdc73 has an unexpected role in the regulation of stem cell function in the planarian S. mediterranea.
RNAi of Smed-cdc73 results in a significant and specific reduction of neoblasts, resulting in tissue homeostasis failure and a blockade of regeneration. Additionally, in the absence of Smed-cdc73, neoblasts differentiate prematurely and in inappropriate spatial domains.
We propose that Smed-cdc73 is an important component of the machinery regulating the ability of stem cells to remain undifferentiated and self-renew in vivo.
Materials and Methods
Planarian Culture and Irradiation
The asexual clonal line C4 of S. mediterranea was maintained and used as described [40], For irradiation experiments, animals were exposed to 100 Gray (Gy) of gamma-irradiation using a J.L. Shepherd and Associates model 30, 6,000 Ci Cs137 instrument at approximately 5.90 Gy/min for 17 minutes [41 ].
Cloning of Smed-cdc73
Two versions of Smed-cdc73 were cloned by RT-PCR from CIW4 asexual
cDNA: a full-length version using cdc73-F2 and cdc73-Rl and a 633bp clone using cdc73-Fl and cdc73-Rl. Both were cloned into the pCR4-TOPO vector (Invitrogen).
The full-length clone was used for generating riboprobes, and the 633bp clone was used
for RNAi. For RNAi experiments, the insert was transferred into pDONRdT7 as
described [40], The following primers were used: cdc73-¥\\ 5'CACGGCAAAGGATTGTCG cdc73-F2: 5'ATGGCAGACTTATTAGCA cdc73-R1: 5'TTTGACCATGTGCCGATC
RNAi
All RNAi-experiments were carried out by the soft serve method as described
[47], Animals were fed 3 times with RNAi food on day 0, 4 and 7. in situ Hybridization
For in situ hybridization with PCNA and smedwi-1, animals were killed in 10%
N-Acetyl Cysteine in PBS for 3 minutes and fixed in 4% formaldehyde in PBST (PBS +
0.5% Triton X-100) for 20 minutes at RT. They were permeabilized in 1 % SDS in PBST for 20 minutes and bleached in 6% H202 in PBST overnight at RT. After a PBST rinse, in situ hybridizations with DIG-labeled riboprobes were performed as previously described [42], For double fluorescent in situ hybridization, fixed animals were permeabilized in 1% SDS in PBST for 3 minutes, placed in methanol for at least 2 hours, and then bleached in 6% H2O2 in methanol overnight. The remainder of the protocol was as described |41 ]. Animals were imaged using either a Zeiss StereoLumar.V12 equipped with an AxiocamHRc, an Olympus FY 1000, or a Zeiss LSM-5 Live confocal microscope. 83
BrdU Labeling
Approximately 100-150nl of BrdU (5mg/mL) (BD Pharmigen™) was injected
into RNAi animals on day 9 post-RNAi feeding [36], Animals were fixed as for double
fluorescent in situ hybridization above, and then processed for in situ hybridization using
fluorescein tyramide as described [41], For BrdU staining, samples were treated with 2N
HC1 in 0.5% Triton X-100 for 40 minutes, rinsed with 0.1M Borax in PBST (PBS + 0.5%
Triton X-100), and then incubated in PBSTB (PBS + 0.3% Triton X-100 + 0.25% BSA)
for at least 1 hour. Animals were incubated with BrdU antibody (Oxford Biotechnology) overnight at 4°C, washed with PBSTB for 4-6 hours at RT, and then incubated with anti-
Rat-URP (abeam) overnight at 4°C. The next day, animals were washed with PBSTB for
2-4 hours at RT, and then developed using Cy3 tyramide as described [411. After washes with PBST, samples were mounted in Vectashield and imaged using an Olympus
FV1000 confocal microscope.
Immunohistochemistry
Animals were killed in 2% HC1 for 5 minutes and fixed in Carnoy's (60%
EtOH;30% CHC13;10% acetic acid) for 2 hours on ice. They were then placed in 100% methanol for 1 hour at -20°C and bleached in 6% H2O2 in methanol overnight at RT.
Following rehydration through a methanol dilution series in PBST (PBS + 0.3% Triton
X-100), animals were labeled with the phosphorylated histone H3 antibody (Upstate) as described previously [40], Fluorescence Associated Cell Sorting (FACS)
Animals were macerated and incubated in calcium, magnesium-free medium
(CMF) containing Trypsin (2 units/mL) for 30 minutes at RT, and then filtered through
53 pm and 20 pm Nitex filters, sequentially. Cells were collected by centrifugation (280 g for 5 minutes), resuspended in CMF containing Hoechst 33342 (12 pg/mL) and Calcein
(0.5 pg/mL), and incubated for 30 minutes at RT. Samples were then centrifuged and resuspended in fresh CMF. Analyses and sorts were performed using a BD Biosciences
FACS Aria as previously described [41].
TUNEL Staining
Animals were killed in 10% N-Acetyl Cysteine in PBS for 35 minutes and fixed in 4% formaldehyde in PBST (PBS + 0.3% Triton X-100) for 20 minutes at RT. They were permeabilized in 1% SDS in PBS for 20 minutes and bleached in 6% H2O2 in PBST overnight at RT. Then, TUNEL staining was carried out using ApopTag® Red In Situ
Apoptosis Detection Kit (Chemicon). Animals were washed with PBS and incubated in equilibration buffer at RT for 5 minutes. Terminal deoxynucleotidyl transferase (TdT) enzyme reaction was followed at 37°C for 4 hours, which was stopped by stop/wash buffer at RT for 5 minutes. Animals were rinsed with PBSTB (PBST + 0.25% BSA) and incubated with rhodamine antibody solution at RT for 4 hours. After extensive washes with PBSTB, animals were mounted in Vectashield and imaged using a Zeiss
StereoLumar.V12 equipped with an AxiocamHRc. Quantitative RT-PCR
Total RNA was extracted from five 7-day starved CIW4-asexual planarians or ten
thousand FACS-purified cells for each population using Trizol reagent (Invitrogen), and
further purified with the RNeasy Mini Kit (Qiagen). cDNA synthesis and PCR reactions
were performed using SuperScript III Two-Step qPCR Kit with SYBR Green
(Invitrogen) as previously described [41]. PCR reactions were analyzed using the ABI
Prism 7900HT. Data were analyzed using SDS 2.1 software and relative expression
levels were determined by comparison with Smed-GAPDH (H.S.lOb) controls. Smed- cdc73 and Smed-GAPDH were amplified using the following primers. cdc73-F3: 5'CTGCTGCCAATGGGATATTT cdc 73-R2: 5' TATCAACGGGCACAGAATGA
GAPDH-F: 5' AGCTCCATTGGCGAAAGTTA
GAPDH-R: 5'CTTTTGCTGCACCAGTTGAA
Results
Smed-cdc73 Is Required for Tissue Homeostasis and Regeneration
Because planarian neoblasts have to interpret changes in their environment to maintain appropriate rates of proliferation and differentiation [48], we hypothesized that
specific components of the cell cycle machinery may exist that are capable of mediating the self-renewal and proliferation of neoblasts in response to both physiological and
injury-associated demands. In order to identify such molecules, we first searched the S. mediterranea genome [49, 50] for homologs of cell cycle regulators, including CDKs,
cyclins, and other known cdc molecules. We then cloned the identified genes from each class, targeted their expression via RNAi, and examined the resulting amputated and
unamputated animals for defects as previously described [40].
Of all the genes analyzed, we were particularly intrigued by the results obtained after silencing the single-copy planarian homolog of cdc73 (Smed-cdc73) (Figure 4.1). In wild-type animals, amputation results in blastema formation at both wound sites,
followed by the regeneration of heads and tails within 7 days (Figure 4.2A). Smed- cdc73(RNAi) animals were unable to form blastemas, and ultimately failed to regenerate
(Figure 4.2B-D). Amputations performed at later times produced increasingly severe and rapid onset of the phenotype. Following administration of Smed-cdc73(RNAi), planarians were amputated on days 9, 11 or 14 after RNAi feeding. On both day 9 and 11 amputations, the formation of small blastemas that later regressed was observed. In addition, animals curled ventrally within 11 days after amputation and lysed 18-20 days after amputation. When Smed-cdc73(RNAi) animals were amputated on day 14 after
RNAi feeding, the onset of the phenotype was accelerated: animals failed to form blastemas, and curled ventrally within 4 days after amputation. This phenotype resembles animals in which irradiation has been used to specifically kill the neoblasts
[51], i.e., a regeneration blockade, ventral curling in 7 days and lysis 14 days after amputation (Figure 4.2E). These results indicate that Smed-cdc73 is required for planarian regeneration and may be causing defects in neoblast function.
To determine whether Smed-cdc73 is also required for tissue homeostasis, we examined the phenotype of intact Smed-cdc73(RNAi) animals. Planarian tissues are maintained by replacing the cells lost during physiological cellular turnover with either neoblasts or their differentiated progeny. If neoblasts do not proliferate or differentiate FIGURE 4.1. Sequence alignment of Smed-cdc7S with Drosophila melanogaster (D.m.) and Homo sapiens (H.s.) homologs. Genbank accession numbers for sequences of H.s.
Parafibromin and D.m Hyrax are NP 078805 and ABD58935, respectively. The Smed- cdc73 protein sequence was deduced from the cDNA sequence. Boxed sequences represent conserved residues. 88
H.s. Parafibromin M A D V Ls]y|L RQVNI Q K K E I vjv K[G~D]E V|T F G E F S WP K[NJV K T N Y 40 D.m. Hyrax M A D P L S L L RQYNN|I K K E I VERDSQI F G E F S WP K S V K T N Y 40 SMED-Cdc73 M A D L L[A]I_ L R|D F T|I H NRLE I [K1E|D[G~D|D 40 I I FID N Y A|VJN1K SISIK T N Y H.s. Parafibromin G Q P REYYT L|D|S I LLF[MNFNTV L S H P V Y V R R 80 D.m. Hyrax G A. P RE YYTL E|C LL Y L L K N V L0 H S.V Y V R Q[CJA A 80 SMED-Cdc73 H G L IKIE Y Y[F1L E S I L S H AQ~F1 V R Q A A A 80 V]Y[F1L K N[TN H.s. Parafibromin 81 V V J? RPDRK G Y L N G E A 5 TjsjA S I D R S A P L E Il[Q 3 120 D.m. Hyrax 81 A V NRPDRK A Y L N G E T P T C A SD I K S A P L E It|q[ v 120 SMED-Cdc73 81 GQJFF G I L]P D R[Q K D|Y L[Q]G|K I T|T C|¥~A|I D|H|SMP[VD1I Q R[RJ 120
H.s. Parafibromin 121 5 - - - TQVKRAADE A|E A K K E1D[E]ECVRL[D]KER L[A]A R L 157 D.m. Hyrax 121 K R A A E G E[P]S S V A A K K EJETQVQKVREQLA[A|RWD 157 SMED-Cdc73 121 LVI LQNNDK D[PJN D A T G[? P S S CL[E]DGNSI[D]MANEGHST 160
H.s. Parafibromin 158 E G H|KT G I IVIQT E@- 172 D.m. Hyrax 158 v NIQK E T A[VJ0N MD N - 172 SMED-Cdc73 161 D Q[Q[N1E I N L K E S0R LAAKLQLPPGGKMTSDLYQNDPSKAST 200
H.s. Parafibromin 173 L S E A MS V E K I A A I KAK I IV A - T A L K Q 210 D.m. Hyrax 173 L S E T|MS V E K I A A I K A K aLKJFR A - - IV(G]T D[T 210 A N K R SMED-Cdc73 201 IlJTIeJH I P|V[D|K I |Q ML R|A K D V V P D K G K P 240 H.s. Parafibromin 211 R1]F V DA E| V D V T|RJDT S R ER V WR T R T 235 D.m. Hyrax 211 R_ A I L D|y D V D S K D I S R E QR W . R T R T 235 SMED-Cdc73 241 kHJA ID AE]E P I KPFVSKI QLGVTKN F V!KJE|I_ M A[R_EJY T WR T R T 280 H.s. Parafibromin 236 EJ L Q 5 T G K S K N I A I LQSVKAREEG RA P EJQ 268 D.m. Hyrax 236 SLL L QSTGK A K N I A ML Q|G I |K A R E E G RN R P Q|V 268 SMED-Cdc73 281 0Wk FDSVVLGT L|K|S V K|L K|E E[N L Q H H T QlR I G P|H T 320
H.s. Parafibromin 269 N A A[P|V D P T L R T KJQ P|I 0A A Y N R Y D Q E R F K G K E E T E G F 307 D.m. Hyrax 269 N P I K 4P]E P A R I A K[P OPJQ L S Q YN R Y 0 Q E R F N R Q|K E E T E G F 308 SMED-Cdc73 321 AS NGHAGNVQ Q[PJA Q A0T H Y[S1R YDQE R T G A G Q D!T[A]G F 360
H.s. Parafibromin 308 KL DT MGTYHGI K S V T E G[A S A R K0Q T 334 D.m. Hyrax 309 K I D T0G T Y H G I K S V T E G S|L AQRKAQANNLPGAPGVIA 347 SMED-Cdc73 361 K I DTMGT H G[I< G1L|T|S|MMT|D1G S|Q|A|N L0S R D P R 391
H.s. Parafibromin 335 A A Q P|V P V S Q A R P[P PN Q K G S R T P I I I 363 p D.m. Hyrax 348 G|A A|A G R P|A~A|Q A R Q L A N G P R T R T P I I 382 SMED-Cdc73 392 A N R QT]A P V sP G A IF? V D T GKGVTKANRAK s rMp I I 431 H.s. Parafibromin 364 I P A ALTJT 5 L I T ML N A K D[LJL Q D L|KJ7 QG C QR E N E T 403 D.m. Hyrax 383 I P0A NTSLI TMLNAKDI L Q[E]L R F QGC QR E[C]E. V 422 SMED-Cdc73 432 I P A A|P|T SLIT IVTYIN A K[E]I L Q D L R F A~N]G C[R1R1D|N|D L 471
H.s. Parafibromin 404 L I QR R0D QMQPGGTAI S V T V P Y R v[vjD LQ K PL Q D WD R V V 443 D.m. Hyrax 423 L0QR KRNNQ T V0Y R V I D0P T K L Q[QHW@R V V 453 SMED-Cdc73 472 L I Q R L0S D G R TVPYRVI DQP N K L E D WD R VV 503
H.s. Parafibromin P D G S D.m. Hyrax G N SMED-Cdc73 G S D
H.s. Parafibromin Y|h K R H L D R[pjv F|LW E T L D R Y M V 523 D.m. Hyrax Q^NIK R H0_ D R A V[L S WE T L D[K I A 530 SMED-Cdc73 H MVl 579 QIUB"D[HT~|R H L D[K1A[NTF1 Q QT1V\TDT|L D R H.s. Parafibromin D.m. Hyrax SMED-Cdc73 FIGURE 4.2. Smed-cdc73(RNAi) causes defects in planarian tissue homeostasis and regeneration. (A) Wild-type animals formed blastemas (arrows) and regenerated heads and tails within 7 days after amputation. (B-D) Smed-cdc73(RNAi) animals amputated on day 9 (B) or 11 (C) after RNAi feeding. They formed small blastemas that regressed within 1 1 days and curled ventrally. (D) Smed-cdc73(RNAi) animals were amputated on day 14 after RNAi feeding; animals formed no blastemas and curled ventrally. (E)
Animals amputated 24 hours after irradiation did not form blastemas or regenerate, and curled within 7 days after amputation. (F) Wild-type, irradiated and RNAi animals.
Irradiated and RNAi animals both curled ventrally. Asterisks represent pharynxes of planarians. Scale bars indicate 0.2 mm. 90
Days after amputation A 11
WT
B d9
C d11 * ft* - D d14 E 10K F WT 10K (d14) RNAi (d21) properly due to irradiation or RNAi of genes required for neoblast function, head tissue regresses [42, 52]. Intact Smed-cdc73(RNAi) animals developed head regression (day 19- 20), ventral curling (day 21-22), and lysis (day 23), which phenocopies irradiated animals (Figure 4.2F). The inability of Smed-cdc73(RNAi) animals to replenish tissue suggests that Smed-cdc73 is necessary not only during regeneration, but also for the regulation of tissue homeostasis in intact planarians. Smed-cdc73 Is Expressed in Neoblasts The Smed-cdc73(RNAi) phenotypes suggested a defective neoblast function. Therefore, we wished to determine whether this gene was expressed in neoblasts. We carried out whole-mount in situ hybridization (WISH) with a riboprobe specific to Smed- cdc73. We found that this gene was expressed in cells between the gut branches where neoblasts normally reside [41], as well as in cells of the nervous system (Figure 4.3 A). Because the expression pattern obtained did not recapitulate the canonical signal distribution of other stem cell markers such as smedwi-1 [42], bruli [52], or Smed-Cbx-1 [41], we subjected animals to lethal doses of irradiation (lOOGy) and examined the expression of Smed-cdc73 1 day and 7 days later. Irradiation has deleterious effects on mitotic neoblasts within 1 day and on postmitotic neoblast progeny within 7 days [41]. The expression of Smed-cdc73 in cells between the gut branches disappeared 1 day after irradiation (Figure 4.3B) and Smed-cdc73 transcripts were undetectable throughout most of the animal within 7 days (Figure 4.3C), demonstrating the expression of Smed-cdc73 in neoblasts and in their progeny. Nevertheless, some transcript persisted in the cephalic ganglia (Figure 4.3C), suggesting that this gene may be expressed at qualitatively lower levels in differentiated cells that are insensitive to irradiation. Furthermore, we 92 FIGURE 4.3. Snted-cdc73 is expressed primarily in dividing neoblasts. (A-D) Whole- mount in situ hybridizations for Smed-cdc73. (A) Wild-type animals. (B-C) Irradiated animals (1 day (B) and 7 days (C) after irradiation). (D) Smed-cdc73(RNAi) animal (14 days after RNAi feeding). (E-F) Quantitative RT-PCR for Smed-cdc73. (E) Smed-cdc73 expression levels in Smed-cdc73(RNAi) animals were reduced as compared to controls, unc-22(RNAi) animals. (F) Comparison of relative expression levels in FACS-isolated XI, X2, and Xins cells. Smed-cdc73 is expressed strongly in XI cells and weakly in X2 cells. In both (E) and (F), the graphs represent three independent biological replicates. Error bars represent standard errors. Scale bars for panels A, B, C, and D indicate 0.2 mm. 93 WT B 1 day after 10K rad 4 ,Sf \ C 7 days after 10K rad D 14 days after RNAi I unc22(RNAi) Smed-cdc73(RNAi) d3 d9 d11 d16 X1 X2 Xins confirmed the specificity of the observed expression pattern by examining Smed- cdc73(RNAi) animals, in which transcripts were reduced to undetectable levels by both WISH (Figure 4.3D) and quantitative RT-PCR (Figure 4.3E). In order to better define the cellular localization of Smed-cdc73 expression, we then carried out quantitative RT-PCR analyses in FACS-purified cells. In planarians, fluorescence activated cell sorting (FACS) separates 3 distinct populations of cells: proliferating neoblasts (XI), postmitotic neoblast progeny (X2) and irradiation- insensitive differentiated cells (Xins) [42, 53, 54], We isolated these three cell populations and determined the relative expression level of Smed-cdc73 in each by quantitative RT-PCR. Smed-cdc73 is highly expressed in the XI population, but at lower levels in the X2, and barely detectable in the Xins populations (Figure 4.3F), supporting our initial conclusions from the WISH analyses. Altogether, we conclude from these data that Smed-cdc73 is largely expressed in both neoblasts and their division progeny, but preferentially in actively dividing neoblasts. Smed-cdc73 Is Necessary for Neoblast Proliferation Based on its RNAi phenotype and its expression in neoblasts, we hypothesized that Smed-cdc73 regulates neoblast function. To further characterize the specific defects caused by RNAi, we monitored neoblast proliferation by immunostaining for the G2/M marker, phosphorylated histone H3 (H3P). At 9 days after RNAi feeding, the numbers of H3P-positive cells were comparable in Smed-cdc73(RNAi) animals and control unc- 22(RNAi) animals (Figure 4.4A and B). However, we observed a dramatic decrease in H3P-positive cells in Smed-cdc73(RNAi) animals on day 11 after RNAi feeding. From this point onward, there was a continual decrease in H3P-positive cells. Smed- cdc73(RNAi) animals had remarkably fewer mitotic cells than controls did at days 11 through 18 (Figure 4.4B, P < 0.0001, t test). To test the validity of these results, we carried out WISH with another mitotic cell marker, PCNA [55]. By 9 days after RNAi feeding, expression levels were similar in Smed-cdc73(RNAi) animals as compared to unc-22(RNAi) animals (Figure 4.4C and Figure 4.5). Similar to the H3P results, by day 11 the number of PCNA-positive cells was significantly reduced. Therefore, approximately 11 days after RNAi feeding of Smed-cdc73, mitotic activity decreased sharply, indicating that Smed-cdc73 is necessary for neoblast proliferation. If Smed-cdc73(RNAi) impedes proliferation of neoblasts, the neoblast population will be lost over time. To monitor the neoblast population, we performed WISH with smedwi-1, a planarian homolog of the PI WI/Argonaute proteins, which is expressed primarily in the XI population, and in a small fraction of X2 cells j42, 52], By 9 days after RNAi feeding, the expression pattern of smedwi-l in Smed-cdc73(RNAi) animals was indistinguishable from that in controls (Figure 4.4D and Figure 4.6). As expected, the number of smedwi-1 -expressed cells was significantly reduced on day 11 after RNAi feeding, indicating that the neoblast population is depleted in Smed-cdc73(RNAi) animals. Altogether, the observation of Smed-cdc73(RNAi) phenotype: an interruption of neoblast proliferation, a failure of replenishment neoblast progeny, and an eventual depletion of stem cell population suggests that neoblasts cannot accomplish their cell cycle progression or self-renewal without Smed-cdc73. Smed-cdc73(RNAi) Does Not Cause Cell Cycle Arrest in S, G2 and M How might Smed-cdc73 regulate the proliferation and maintenance of planarian neoblasts? One possible explanation is that under normal circumstances, Smed-cdc73 FIGURE 4.4. Smed-cdc73 is required for neoblast proliferation and maintenance. (A) Antiphosphorylated histone H3 (H3P) immunostaining in whole-mount animals at certain times after RNAi feeding. (B) Quantification of H3P-positive cells. H3P-positive cells are significantly reduced between days 9 and 11 after Smed-cdc73 RNAi feeding. Twelve to fifteen animals were counted for each condition. Error bars represent standard errors. * - P < 0.0001, t test (C) Whole-mount in situ hybridizations for Smed-PCNA show a decrease in mitotic cells in Smed-cdc7 3 (RNAi) animals. (D) Whole-mount in situ hybridizations for smedwi-1 -expressing cells. Scale bars for panel A, C, and D indicate 0.2 mm. 97 A H3P B unc22(RNAi) Smed-cdc73(RNAi) unc22(RNAi) Smed-cdc73(RNAi) d6 d9 d11 d14 d16 d18 C Smed-PCNA 3 smedwi-1 unc22(RNAi) Smed-cdc73(RNAi) unc22(RNAi) Smed-cdc73(RNAi) FIGURE 4.5. Whole-mount in situ hybridizations for Smed-PCNA from day 6 to day 18 after RNAi feeding. Smed-PCNA-expressmg cells decreased in Smed-cdc73(RNAi) animals. Scale bars indicate 0.2 mm. 99 unc22(RNAi) Smed-cdc 73(RNAi) - d6 .,' .' '. .. -'-, d9 d11 d14 d16 d18 FIGURE 4.6. Whole-mount in situ hybridizations for smedwi-1 from day 6 to day 18 after RNAi feeding, smedwi-1-expressing cells were reduced in Smed-cdc73(RNAi) animals. Scale bars indicate 0.2 mm. 101 unc22(RNAi) Smed-cdc73(RNAi) d6 d9 d11 d14 d16 '" •• J ...... : • • I " . .." .... • d18 " . .' 102 may prevent neoblasts from undergoing apoptosis. Because tissue homeostasis is balanced by both cell proliferation and apoptosis [37], Smed-cdc73 knockdown may promote excessive cell death, causing loss of the neoblast population, and an inability to maintain tissues necessary for survival. To determine whether Smed-cdc73 knockdown altered normal rates of apoptosis, we carried out whole-mount TUNEL staining. However, we did not observe an increase in TUNEL-positive nuclei in Smed- cdc73(RNAi) animals as compared to controls on days 9 through 11 after RNAi feeding (Figure 4.7). Therefore, we conclude from these data that Smed-cdc73 is unlikely to be involved in regulating apoptosis. Next, we hypothesized that Smed-cdc73 may play a role in regulating the neoblast cell cycle. If neoblasts arrest during specific phases of the cell cycle, the cell cycle will halt, eventually causing a reduction in the number of mitotically active cells. To determine whether cell cycle defects exist in Smed-cdc73(RNAi) animals, we utilized FACS analyses to obtain higher resolution measurements of cell cycle position of the population of dividing neoblasts. Approximately 95% of the irradiation-sensitive XI population from FACS plots consists of cycling cells in either S or G2/M [41], If cycling neoblasts are arrested in S or G2/M in Smed-cdc73(RNAi) animals, the XI population will persist. However, we observed a significant reduction in the XI population of Smed- cdc73(RNAi) animals beginning on day 11 after RNAi feeding (Figure 4.8A and B; 14.8 ± 1.2 to 2.8 ± 0.6 % of total, P = 0.0001, t test). By 18 days after RNAi feeding, the XI population was essentially eliminated in Smed-cdc73(RNAi) animals (0.4 ± 0.1 %). These results confirm our earlier analyses with Smed-PCNA and H3P and suggest that the defects observed in Smed-cdc73(RNAi) animals are not caused by cell cycle arrest in S, FIGURE 4.7. Smed-cdc73(RNAi) does not promote apoptosis. (A) RNAi animals were stained with the TUNEL assay. (B) Quantification of TUNEL-positive nuclei over time. TUNEL-positive cells were counted from three animals for each condition. Error bars represent standard errors. 104 A d9 d10 d11 B N E E 120 "Qi 100 -u :::J c 80 Q) • unc22(RNAi) > :;:; 60 "iii • Smed-cdc73(RNAi) 0 a., 40 -lw 20 z ::::> 0 I- d9 d10 FIGURE 4.8. Smed-cdc73(RNAi) causes reduction of cycling neoblasts. (A) Cells from unc22(RNAi) controls and Smed-cdc73(RNAi) animals were FACS-sorted and analyzed with Hoechst and calcein. Numbers of cycling neoblasts (red boxes) diminished after day 11 after RNAi feeding. Ten thousand cells were analyzed for each graph. (B) Relative percentage of XI population compared to the total number of cells in Smed- cdc73(RNAi) animals and controls. Dashed and solid lines represent Smed-cdc73(RNAi) animals and controls. The graph represents three independent biological replicates. Error bars represent standard errors. 106 B — unc22(RNAi) o0) 181 • - • Smed-cdc73(RNAi) s 16- 14' o c 12' o 10- J9 Z3 8- OQ. 6' Q. 4- >< 2 ••I. o ol d6 d9 d11 d14 d16 d18 Time after RNAi G2 or M. Taken together, we conclude that the number of dividing neoblasts in Smed- cdc73(RNAi) animals diminished, but this was not due to apoptosis, nor to an arrest in S, G2 or M. Smed-cdc73(RNAi) Causes Premature Differentiation of Neoblasts Our data indicated that Smed-cdc73 does not appear to regulate either apoptosis or the S, G2 or M phases of the neoblast cell cycle, yet its abrogation results in the eventual cessation of proliferation. Thus, we hypothesized that this molecule may play a role in regulating re-entry of the stem cells into the cell cycle (self-renewal) during G1 phase progression. If neoblasts fail to undergo self-renewal, and instead only produce postmitotic progeny by exiting the G1 phase, ultimately there will be a reduction in the neoblast population. To test this hypothesis, we examined the lineage of neoblasts in Smed-cdc73(RNAi) animals. Normally, smedwi-1-expressing neoblasts transiently express transcripts for Smed-NB.21.1 le and Smed-AGAT-1 sequentially as they transit from dividing neoblasts into postmitotic progeny [41]. These genes mark a subset of postmitotic progeny of neoblasts located in the periphery of the animal and are not expressed simultaneously with the neoblast marker smedwi-1 [41]. At day 11 after RNAi feeding, the number of smedwi-1-expressing cells was reduced in Smed-cdc73(RNAi) animals (Figure 4.9A). We observed that the number of Smed-NB.21.1 le- and Smed- AGAT-1 -expressing cells also decreased by 11 and 13 days after RNAi feeding, respectively (Figure 4.9B and C). The temporal order of downregulation of smedwi-1, Smed-NB.21.1 le and Smed-AGAT-1 in Smed-cdc73(RNAi) animals is consistent with the order of gene expression during neoblast differentiation [41], suggesting that the lineage relationships of these three molecules are not affected by RNAi of Smed-cdc73. FIGURE 4.9. Smed-cdc73 is necessary for neoblast self-renewal. Whole-mount fluorescent in situ hybridizations. Smed-sialin (red) was used as a gut marker. (A) In Smed-cdc73(RNAi) animals, the number of .vme£/w/-/-expressing cells is noticeably reduced when compared to controls. Cells expressing Smed-NB.21. lie- and Smed- AGAT-1 on days 11 and 13 after RNAi feeding, respectively, are also markedly diminished in numbers. (B-C) Spatial localization of neoblast and progeny markers. (B) smedwi-1 is expressed around gut branches in both controls and Smed-cdc73(RNAi) animals. Smed-cdc73(RNAi) animals expressed Smed-NB.21.1 le inappropriately around gut branches. Images in (B) are single confocal slices from comparable positions along the dorso-ventral axis. (C) Dorso-ventral rotation of the confocal projection along the cross section indicated by the dashed line in (B) showing the distribution of Smed- NB.21.1 le in relation to the gut. The dotted lines represent the dorsal (D) and ventral (V) surfaces, respectively. Scale bars are in A: 0.2 mm; B and C: 0.05 mm. 109 unc22(RNAi) Smed-cdc73(RNAi) Smed-sialin d11 smedwi-1 '' W ' --.^V^'T-flPP" B y \ - .*' •' • ti.. Smed-sialin d1l Smed- NB.21.11e • _ Smed-sialin • m d13 Smed- AGAT-1 unc22(RNAi) Smed-cdc 73(RNA i) Smed-sialin smedwi-1 Smed-sialin Smed- NB.21.11e 110 In addition to the temporal order, the expression patterns of Smed-NB.21.1 le and Smed-AGAT-1 are spatially distinct. Neoblast progeny migrate peripherally as they differentiate, and express Smed-NB.21.1 le and Smed-AGAT-1 in increasingly peripheral domains. Interestingly, RNAi of Smed-cdc73 results in not only the reduction of the number of Smed-NB.21.1 le-pos'\Uve cells, but also in an abnormal spatial distribution of Smed-NB.21.lie-positive cells (Figure 4.9E and F). In Smed-cdc73(RNAi) animals, Smed-NB.21.1 le is expressed inappropriately around the gut branches (Figure 4.9E), where smedwi-1-positive neoblasts normally reside (Figure 4.9D). We also observed that the dorsal-ventral expression of Smed-NB.21.1 le to the gut was switched to lateral expression (Figure 4.9F). These results suggest that Smed-cdc73 is necessary for proper differentiation and development of neoblast progeny. Based on the improper spatial distribution of early neoblast progeny in Smed- cdc73(RNAi) animals, we investigated the differentiation of neoblasts using BrdU incorporation together with fluorescent in situ hybridization. Under normal conditions, cells that incorporate BrdU express Smed-NB.21.1 le and Smed-AGAT-1 at 48 and 96 hours, respectively, as they migrate and differentiate [41]. Surprisingly, in Smed- cdc73(RNAi) animals, we observed double-labeled cells of BrdU and Smed-NB.21.1 le as early as 8 hours after BrdU administration (Figure 4.1 OA and Figure 4.11), indicating an acceleration in differentiation of neoblasts. These double-labeled cells persist for 24 hours after the BrdU pulse (Figure 4.1 OB), but vanish by 48 hours (Figure 4.10C), while they remain in controls (Figure 4.10D). Consistent with a more rapid differentiation of progeny, expression of Smed-AGAT-1 in Smed-cdc73(RNAi) animals diminishes earlier than in controls (Figure 4.10E). Our results suggest that neoblast progeny may be FIGURE 4.10. RNAi of Smed-cdc73 results in premature differentiation of neoblasts. (A-C) Animals injected with BrdU were fixed and stained at 8 hr (A), 24 hr (B), and 48 hr (C). Left column: BrdU signal in magenta. Middle column: Smed-NB.21.1 le in green. Right pane: merge of left and tright columns of both unc22(RNAi) controls and Smed- cdc73(RNAi) animals. Images are projections of 3 confocal slices (4 pm apart) showing comparable regions of the gut. Asterisks show position of pharynx. (D) Representative signal distribution of Smed-NB.21.1 le 48 hours after BrdU injection utilized to quantitate double labeled cells. (E) Quantitation of cells double-labeled with BrdU and Smed- NB.21. lie. Double-labeled cells were counted in the tail regions (0.06 mm2) of entire confocal stacks in three independent animals for each condition. Error bars represent standard errors. (F) BrdU and Smed-AGAT-1 staining at 72 and 96 hours after BrdU injection. Scale bars for A and C: 0.1 mm. 112 BrdU Smed-NB.21.11e BrdU I Smed-NB.21.11e unc22(RNAi) Smed-cdc73(RNAi) unc22(RNAi) Smed-cdc73(RNAi) unc22(RNAi) Smed-cdc73(RNAi) \ * J \ * j unc22(RNAi) Smed-cdc73(RNAi, F unc22(RNAi) Smed-cdc73(RNAi) •>?/: 'I-:,-"::4- 48h 72h BrdU I Smed-NB.21.11e E « 40! • unc22(RNAi) Scale bars indicate 50 pm. 114 unc22(RNAi) Smed-cdc73(RNAi) V^T * v •A % * • i V . i % f -» m e * * f ' . tv / v ft •V; f - v* fr • ^ * T ** + ' • I ,» > • .v * * • . * ¥ * * ft ^p utfk* • $ \ • . * • # J- tP ^ • ' • ^ # 4 VP ^ ^ % BrdU I Smed-NB.21.11e 115 preferentially produced as neoblasts exit the cell cycle at G1 phase, due to a failure of a self-renewal program regulated by Smed-cdc73. Discussion Planarians Provide a Unique In Vivo Model to Study Stem Cell Proliferation Dynamics The relative abundance of proliferating stem cells in planarians, combined with recent lineage characterization studies [41] have allowed us to initiate a systematic interrogation of cell cycle-mediated regulation of stem cell fate in planarians. We focused on the planarian ortholog of cdc73 because: 1) the pronounced inability of Smed- cdc73(RNAi) animals to sustain tissue homeostasis or launch a regenerative response after amputation is characteristic of a class of previously described neoblast malfunction phenotypes [40]; and 2) a role for this molecule in regulating stem cell cycle was unknown. By analyzing the effects of silencing Smed-cdc73 on a defined stem cell lineage in planarians, we were able to ascertain changes in the proliferation dynamics of a stem cell population in toto. In the absence of Smed-cdc73, proliferation of neoblasts decreased sharply between days 9 and 11 after the initial RNAi feeding and descendants of neoblasts expressing Smed-NB.21 Ale and Smed-AGAT-1 were concomitantly reduced, indicating a depletion of proliferating neoblasts (Figure 4.4 and 4.9). These data suggested that Smed-cdc73 is necessary for both the proliferation and the maintenance of planarian stem cells (Figure 4.12A, t0 and t|). We tested whether the apparent depletion of neoblasts was due to an arrest of the cell cycle or to cell death, but did not uncover evidence supporting either of these possibilities (Figures 4.8 and 4.5). Instead, we observed that neoblasts began to express the differentiation marker Smed-NB.21.lie FIGURE 4.12. Effects of Smed-cdc73 loss on the regulation of cell fate and cell cycle on the planarian stem cells. (A) RNAi of cdc73 prevents self-renewal (to) which precipitates the initiation of differentiation and results in the abnormal detection of Smed-NB.21.1 le BrdU double positive cells in between the branches of the gastrovascular system. BrdU positive cells, however, do not express late postmitotic markers until they migrate at wild type rates (ti and t2) into the appropriate spatial domain of expression. Once there BrdU positive cells expressing the late postmitotic marker Smed-AGATl can be detected. In the control images, the BrdU negative nucleus (t3) represents the depletion of this thymidine analog in neoblasts, which are constantly dividing and do not allow for long- term retention of this DNA marker. (B) Integration of the observed phenotype with what is known about the G1 phase progression of the cell cycle. Our model proposes a role for cdc73 in responding to cell-nonautonomous signals to support stem cell self-renewal by inhibiting differentiation and promoting cell cycle re-entry of neoblasts during the G1 phase of the cell cycle. The expression of cdc73 in the division progeny may, for example, regulate the expression of telomere lengthening molecules (Mozdy et al., 2008), or the activation of genes required for G1 progression. Expression Domains O BrdU OSmed-NB21.11e O Smedwi-1 Q Smed-AGAT1 mitogens morphogens cdc73 RNAi Differentiation cdc73i cdc73i miRNAs? earlier than in controls and in a region of the animal in which cells expressing this gene are not normally found (Figure 4.9 and 4.10). Taken together, the data support a model in which the absence of Smed-cdc73 causes neoblasts to stop dividing (Figure 4.12A, to), resulting in a failure of maintenance of their undifferentiated state that leads to their temporally premature and spatially inappropriate differentiation (Figure 4.12A, ti). Smed-cdc73 Plays a Central Role in Reflating Neoblast Self-renewal The observation that silencing Smed-cdc73 results in a depletion of neoblasts and their premature differentiation suggested a role for this molecule in promoting cell cycle re-entry and inhibition of differentiation. The specificity of the role of Smed-cdc73 in self-renewal is supported by the fact that only one postmitotic domain expanded at the expense of the neoblast-proliferation domain (Figures 4.9, 4.10 and 4.12A, ti-tj). While we observed cells expressing Smed-NB.21.1 le in the normally neoblast proliferating domain (Figure 4.9), we never detected the expression of more terminal lineage markers such as Smed-AGAT-1 in this region (Figure 4.13). In fact, lineage tracing studies with BrdU demonstrated that the rate of double labeled BrdU and Smed-AGAT-1 cells in Smed-cdc73(RNAi) animals was undistinguishable from wild type (Figure 4.10) |41]. These results indicate that cdc73 is not required in the progeny to drive later differentiation programs since the spatial and temporal characteristics of downstream lineage events remain unaffected. Furthermore, the most likely alternative explanation that neoblasts in Smed- cdc73(RNAi) animals may be entering a quiescent state rather than exiting the cell cycle to differentiate is also not supported by the BrdU lineage experiments. It is possible that quiescent stem cells may not express smedwi-1. If so, we would fail to detect this FIGURE 4.13. Double fluorescent in situ hybridization of gastrovascular, stem cell and division progeny markers in unc22(RNAi) controls and Smed-cdc73(RNAi) animals. Smed-sialin (red) was used as a gut marker. Smed-AGATl (green) labels the late post- mitotice progeny of neoblasts. (A) In control and Smed-cdc73(RNAi) animals, no Smed- AGATl expressing cells are detected associated with the gut. Images in (A) are single confocal slices from comparable positions along the dorso-ventral axis. (B) Dorso-ventral rotation of the confocal projection along the cross section indicated by the dashed line in (A) showing the distribution of Smed-AGATl-positive cells in relation to the gut. The dotted lines represent the dorsal (D) and ventral (V) surfaces, respectively. Scale bars are in A: 0.2 mm; B and C: 0.08 mm. 120 A B Smed-sialin / Smed-AGAT-1 potential cell population in our experiments. However, even though we see a decline in proliferation as measured by PCNA expression, mitotic markers and flow cytometry (Figures 4.4 and 4.8), we do not see a prolonged accumulation of BrdU positive cells in the expression domain normally occupied by smedwi-1 expressing cells. In fact, the apparent accumulation of BrdU-positive cells in this domain observed 24 hrs after the introduction of BrdU in Smed-cdc73(RNAi) is accompanied by a dramatic co-localization of Smed-NB.21 A le expression in these cells (Figure 4.10B). Thus, it appears more likely that a quiescent state is not a prominent aspect of neoblast cell cycle regulation, supporting the findings of prior fraction of labeled mitoses experiments [36], Taken together, our data demonstrate that the tools developed to assay and perturb lineage events in planarians provide us with unprecedented resolution to visualize changes in the proliferation dynamics of an entire, collectively totipotent stem cell population in an adult organism. Equally important, these methodologies and the unique biology of planarians uncovered a potentially novel role for Smed-cdc73 as a regulator of adult stem cell self- renewal in planarians. cdc73 and Self-Renewal Striking a balance between cell-cycle re-entry and exit is integral not only to the regulation of embryonic and postembryonic stem cell populations in vivo, but also to the controlled production of cells needed during embryonic development and for replacing differentiated cells lost to either physiological turnover or damage. Our findings indicate that Smed-cdc73 promotes self-renewal during G1 progression (Figure 4.8) while inhibiting differentiation (Figures 4.9 and 4.10). Whether or not orthologs of this molecule may play similar roles in the regulation of stem cells in other organisms has yet to be formally tested. We know, however, that cdc73 can regulate gene transcription (including cell cycle-specific genes) through its association with RNA polymerase II as part of the Pafl complex in yeast [45, 56], A recent study has shown that a yeast strain harboring a deletion for cdc73 shows a greater than two-fold decrease in TLC1 RNA as well as shortened telomere lengths [57], TLC1 is known to be essential for the maintenance of telomere length [581 and required for the self-renewal enhancing activity of telomerase in embryonic [59] and hematopoietic stem cells [60], In addition, Hyrax, the Drosophila homolog of cdc73 has recently been shown to activate the transcription of target genes of the Wnt signaling pathway [61], Therefore, it is distinctly possible that Smed-cdc73 may be involved in activating genes required for stem cell self-renewal and/or repressing genes necessary for differentiation. cdc73 and Stem Cell Cycle Regulation A model for the participation of Smed-cdc73 in regulating self-renewal is shown in Figure 4.12B. Our model makes three key predictions that are vulnerable to experimental interrogation. First, because cdc73 is expected to operate during the Gl phase of the cell cycle, stem cells in which the Gl phase or the R point are not prominently manifested should express low levels of cdc73. This type of cell is best represented by mammalian ESCs, which exhibit remarkably rapid generation times (~10 hours) due to a notably short length (2 hours) of the Gl phase [62, 63]. A second and related prediction is that as ESCs exit clonal expansion and the length of the Gl phase increases once cells begin committing to differentiated states [63], upregulation of cdc73 expression should occur followed by its downregulation as cells become differentiated. Interestingly, both of these predictions are supported by two recent, comprehensive 123 studies of gene expression profiles of murine ESCs [64, 65], Inspection of the microarray data deposited in the Gene Expression Omnibus [66 j by the Stanford laboratory (GEO accession number GSE7506) indicates that under conditions in which ESCs are maintained undifferentiated, levels of the mouse cdc73 ortholog are relatively low, but that a nearly 2-fold increase in expression of this gene is detected within 24 hours after differentiation is promoted by either removal of leukemia inhibitory factor (LIF) or addition of retinoic acid (RA) [65], Likewise, when the expression profile of cdc73 is extracted from the GEO deposited dataset for the differentiation of ESCs into endothelial cells (GEO accession number GSE10210), a 2-5-fold downregulation is observed from 2.5 to 6.5 days after the initiation of the differentiation protocol [64], The third and final prediction of the model is that proliferating cells with well- defined G1 phases, but which are not undergoing differentiation should express cdc73, and when their differentiation is induced a significant drop in cdc73 expression should be observed. Examples of these types of cells are progenitor and cancer cell lines, both of which can be kept indefinitely in culture but induced to differentiate under defined conditions [67, 68], This prediction is also borne out by publicly available genome-wide microarray expression data of human C2C12 myoblasts, and breast carcinoma cells. When the expression profiles of C2C12 cells are compared to 4-day differentiated myotubes, a 5-fold reduction in cdc73 expression levels is observed (GEO accession number GSE3243). Moreover, when the breast cell mitogen parathyroid hormone-related protein is abrogated via siRNA in MDA-MB-231 breast cancer cells [67], an almost 6- lold decrease in cdc73 expression is detected (GEO accession number GSE4292). 124 Clearly, a definitive test of the model proposed in Figure 4.12B will require carrying out functional studies of cdc73 in other in vitro and in vivo models of stem cell biology. Conclusions Together with the findings reported here, the independent lines of evidence described above for other organisms lend support to a potential involvement of the PAF-1 component cdc73 in regulating the cell-cycle machinery of stem cells. The nature of the factors that may be modulated by cdc73 in stem cells, however, remains unknown, particularly in vivo, as the large majority of studies of stem cell cycle driven fate decisions have been carried out primarily in vitro. There is little doubt, however, that mechanisms regulating stem cell entry and exit from the cell cycle in vivo are likely to play a role in determining the fate of the resulting division progeny. This is intimated, for example, by the recent demonstration that the internal cell mass of the mouse embryo is composed of a heterogeneous population of cells that have already become lineage restricted prior to the blastocyst stage of mouse embryogenesis, i.e., during blastomere proliferation [69], Recent evidence indicates that a combination of both cytokines and microRNAs may be involved in mediating entry and exit from Gl [70J, as well as self- renewal activities in both embryonic [71] and adult stem cells [5] as illustrated in Figure 4.12B. Whether cdc73 is or is not involved in the modulation of these and other factors (such as those associated with the maintenance of telomere length) by regulating the specificity of RNA pol II, or whether it may be acting through a yet undiscovered self- renewal mechanism remains to be determined. Our findings in the planarian S. mediterranea support a test of universality of function of cdc73 in the regulation of stem cell cycle dynamics in other organisms. Moreover, the complete penetrance of the 125 phenotype observed in Smed-cdc73(RNAi) animals provides us with a unique opportunity to attempt an identification and characterization of the genes targeted by this molecule, which may ultimately help reveal the precise role of cdc73 in the regulatory machinery controlling stem cell self-renewal. Acknowledgments We thank Dr. Carrie Adler and members of the Sanchez Alvarado Laboratory for scientific discussions, suggestions, and comments. References 1. Birnbaum, K.D., and Sanchez Alvarado, A. (2008). Slicing across kingdoms: regeneration in plants and animals. Cell 132, 697-710. 2. Sanchez Alvarado, A. (2006). Planarian regeneration: its end is its beginning. Cell 124, 241-245. 3. Silva, J., and Smith, A. (2008). Capturing pluripotency. Cell 132, 532-536. 4. Ying, Q.L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and Smith, A. (2008). The ground state of embryonic stem cell self- renewal. Nature 453, 519-U515. 5. Wilson, A., Osee, G., van der Wath, R., Blanco-Bose, W., Laurenti, E., Dunant, C., Lio, P., MacDonald, H.R., and Trumpp, A. (2008). Haematopoietic stem cells reversibly switch from dormancy to self-renewal during homeostasis and repair. Swiss Medical Weekly 138, 46s-46s. 6. Barker, N., van Es, J.H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen, M., Haegebarth, A., Korving, J., Begthel, H., Peters, P.J., and Clevers, H. (2007). Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449, 1003-U1001. 7. Sangiorgi, E., and Capecchi, M.R. (2008). Bmil is expressed in vivo in intestinal stem cells. Nature Genetics 40, 915-920. 8. Mirzadeh, Z., Merkle, F.T., Soriano-Navarro, M., Garcia-Verdugo, J.M., and Alvarez-Buy 11a, A. (2008). Neural stem cells confer unique pinwheel architecture to the ventricular surface in neurogenic regions of the adult brain. Cell Stem Cell 126 3,265-278. 9. Morrison, S.J., and Spradling, A.C. (2008). Stem cells and niches: mechanisms that promote stem cell maintenance throughout life. Cell 132, 598-611. 10. Jaenisch, R., and Young, R. (2008). Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132, 567-582. 11. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663- 676. 12. Yu, J.Y., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., Slukvin, 1.1., and Thomson, J.A. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917-1920. 13. Savatier, R, Huang, S., Szekely, L., Wiman, K.G., and Samarut, J. (1994). Contrasting patterns of retinoblastoma protein expression in mouse embryonic stem cells and embryonic fibroblasts. Oncogene 9, 809-818. 14. Durand, B., Fero, M.L., Roberts, J.M., and Raff, M.C. (1998). p27(Kipl) alters the response of cells to mitogen and is part of a cell-intrinsic timer that arrests the cell cycle and initiates differentiation. Current Biology 8, 431-440. 15. Smith, J.R., and Pereira-Smith, O.M. (1996). Replicative senescence: implications for in vivo aging and tumor suppression. Science 273, 63-67. 16. Vidal, A., and Koff, A. (2000). Cell-cycle inhibitors: three families united by a common cause. Gene 247, 1-15. 17. Beausejour, C.M., Krtolica, A., Galimi, F., Narita, M., Lowe, S.W., Yaswen, P., and Campisi, J. (2003). Reversal of human cellular senescence: roles of the p53 and p 16 pathways. Embo Journal 22, 4212-4222. 18. Barres, B.A., Hart, I.K., Coles, H.S., Burne, J.F., Voyvodic, J.T., Richardson, W.D., and Raff, M.C. (1992). Cell death and control of cell survival in the oligodendrocyte lineage. Cell 70, 31-46. 19. Thomaidou, D., Mione, M.C., Cavanagh, J.F.R., and Parnavelas, J.G. (1997). Apoptosis and its relation to the cell cycle in the developing cerebral cortex. Journal of Neuroscience 17, 1075-1085. 20. Blomen, V.A., and Boonstra, J. (2007). Cell fate determination during Gl phase progression. Cell Mol Life Sci 64, 3084-3104. 127 21. Lindsten, T., Golden, J.A., Zong, W.X., Minarcik, J., Harris, M.H., and Thompson, C.B. (2003). The proapoptotic activities of Bax and Bak limit the size of the neural stem cell pool. Journal of Neuroscience 23, 11112-11119. 22. Shivdasani, A.A., and Ingham, P.W. (2003). Regulation of stem cell maintenance and transit amplifying cell proliferation by TGF-beta signaling in Drosophila spermatogenesis. Current Biology 13, 2065-2072. 23. Pepling, M.E., and Spradling, A.C. (2001). Mouse ovarian germ cell cysts undergo programmed breakdown to form primordial follicles. Developmental Biology 234, 339-351. 24. Rodriguez, M.D.C., Bernad, A., and Aracil, M. (2004). Interleukin-6 deficiency affects bone marrow stromal precursors, resulting in defective hematopoietic support. Blood 103, 3349-3354. 25. Calegari, F., and Huttner, W.B. (2003). An inhibition of cyclin-dependent kinases that lengthens, but does not arrest, neuroepithelial cell cycle induces premature neurogenesis. Journal of Cell Science 116, 4947-4955. 26. Massague, J. (2004). G1 cell-cycle control and cancer. Nature 432, 298-306. 27. Sherr, C.J. (2000). The Pezcoller Lecture: cancer cell cycles revisited. Cancer Research 60, 3689-3695. 28. Vaudry, D., Stork, P.J.S., Lazarovici, P., and Eiden, L.E. (2002). Signaling pathways for PC 12 cell differentiation: making the right connections. Science 296, 1648-1649. 29. Hullemann, E., Bijvelt, J.J.M., Verkleij, A.J., Verrips, C.T., and Boonstra, J. (2004). Identification of a restriction point at the M/Gl transition in CHO cells. Cellular and Molecular Life Sciences 61, 600-609. 30. Zetterberg, A., Larsson, O., and Wiman, K.G. (1995). What is the restriction point? Current Opinion in Cell Biology 7, 835-842. 31. White, J., Stead, E., Faast, R., Conn, S., Cartwright, P., and Dalton, S. (2005). Developmental activation of the Rb-E2F pathway and establishment of cell cyclc- regulated cyclin-dependent kinase activity during embryonic stem cell differentiation. Molecular Biology of the Cell 16, 2018-2027. 32. Reya, T., Duncan, A.W., Ailles, L., Domen, J., Scherer, D.C., Willert, K., Hintz, L., Nusse, R., and Weissman, I.L. (2003). A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 423, 409-414. 33. Carlesso, N., Aster, J.C., Sklar, J., and Scadden, D.T. (1999). Notch 1-induced 128 delay of human hematopoietic progenitor cell differentiation is associated with altered cell cycle kinetics. Blood 93, 838-848. 34. Palma, V., Lim, D.A., Dahmane, N., Sanchez, P., Brlonne, T.C., Herzberg, C.D., Gitton, Y„ Carleton, A., Alvarez-Buylla, A., and Altaba, A.R.I. (2005). Sonic hedgehog controls stem cell behavior in the postnatal and adult brain. Development 132, 335-344. 35. Randolph, H. (1892). The regeneration of the tail in lumbriculus. J Morphol 7, 317-344. 36. Newmark, P.A., and Sanchez Alvarado, A. (2000). Bromodeoxyuridine specifically labels the regenerative stem cells of planarians. Developmental Biology 220, 142-153. 37. Pellettieri, J., and Sanchez Alvarado, A. (2007). Cell turnover and adult tissue homeostasis: from humans to planarians. Annual Review of Genetics 41, 83-105. 38. Morgan, T.H. (1898). Experimental studies of the regeneration of Planaria maculata. Arch Entw Mech Org 7, 364-397. 39. Newmark, PA., and Sanchez Alvarado, A. (2008). Germ cell specification and regeneration in planarians. Cold Spring Harbor Symposia on Quantitative Biology. 40. Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sanchez Alvarado, A. (2005). Identification of genes needed for regeneration, stem cell function, and tissue homeostasis by systematic gene perturbation in planaria. Developmental Cell 8, 635-649. 41. Eisenhoffer, G.T., Kang, H., and Sanchez Alvarado, A. (2008). Molecular analysis of stem cells and their descendants during cell turnover and regeneration in the planarian Schmidtea mediterranea. Cell Stem Cell 3, 327-339. 42. Reddien, P.W., Oviedo, N.J., Jennings, J.R., Jenkin, J.C., and Sanchez Alvarado, A. (2005). SMEDWI-2 is a PlWI-like protein that regulates planarian stem cells. Science 310, 1327-1330. 43. Hampsey, M., and Reinberg, D. (2003). Tails of intrigue: phosphorylation of RNA polymerase II mediates histone methylation. Cell 113, 429-432. 44. Krogan, N.J., Kim, M., Ahn, S.H., Zhong, G.Q., Kobor, M.S., Cagney, G., Emili, A., Shilatifard, A., Buratowski, S., and Greenblatt, J.R (2002). RNA polymerase II elongation factors of Saccharomyces cerevisiae: a targeted proteomnics approach. Molecular and Cellular Biology 22, 6979-6992. 45. Mueller, C.L., and Jaehning, J.A. (2002). Ctr9, Rtfl, and Leol are components of 129 the Pafl/RNA polymerase II complex. Molecular and Cellular Biology 22, 1971- 1980. 46. Penheiter, K.L., Washburn, T.M., Porter, S.E., Hoffman, M.G., and Jaehning, J.A. (2005). A posttranscriptional role for the yeast Pafl-RNA polymerase II complex is revealed by identification of primary targets. Molecular Cell 20, 213-223. 47. Gurley, K.A., Rink, J.C., and Sanchez Alvarado, A. (2008). beta-catenin defines head versus tail identity during planarian regeneration and homeostasis. Science 319, 323-327. 48. Oviedo, N.J., Pearson, B.J., Levin, M., and Sanchez Alvarado, A. (2008). Planarian PTEN homologs regulate stem cells and regeneration through TOR signaling. Disease Models & Mechanisms 1, 131-143. 49. Cantarel, B.L., Korf, I., Robb, S.M.C., Parra, G, Ross, E., Moore, B., Holt. C,, Alvarado, A.S., and Yandell, M. (2008). MAKER: an easy-to-use annotation pipeline designed for emerging model organism genomes. Genome Research 18, 188-196. 50. Robb, S.M.C., Ross, E., and Sanchez Alvarado, A. (2008). SmedGD: the Schmidtea mediterranea genome database. Nucleic Acids Research 36, D599- D606. 51. Bardeen, C.R., and Baetjer, F.H. (1904). The inhibitive action of the Roentgen rays on regeneration in planarians. J Exp Zool 1, 191-195. 52. Guo, T.X., Peters, A.H.F.M., and Newmark, P.A. (2006). A Bruno-like gene is required for stem cell maintenance in planarians. Developmental Cell 11, 159-169. 53. Asami, M., Nakatsuka, T., Hayashi, T., Kou, K., Kagawa, H., and Agata, K. (2002). Cultivation and characterization of planarian neuronal cells isolated by fluorescence activated cell sorting (FACS). Zoological Science 19, 1257-1265. 54. Ogawa, K., Kobayashi, C., Hayashi, T., Orii, H., Watanabe, K., and Agata, K. (2002). Planarian fibroblast growth factor receptor homologs expressed in stem cells and cephalic ganglions. Development Growth & Differentiation 44, 191-204. 55. Celis, J.E., and Celis, A. (1985). Cell cycle-dependent variations in the distribution of the nuclear-protein cyclin proliferating cell nuclear antigen in cultured-cells-subdivision of S-phase. Proceedings of the National Academy of Sciences of the United States of America 82, 3262-3266. 56. Shi, X.M., Chang, M.P., Wolf, A.J., Chang, C.H., FrazerAbel, A.A., Wade, P.A., Burton, Z.F., and Jaehning, J.A. (1997). Cdc73p and Paflp are found in a novel RNA polymerase Il-containing complex distinct from the Srbp-containing 130 holoenzyme. Molecular and Cellular Biology 17, 1160-1169. 57. Mozdy, A.D., Podell, E.R., and Cech, T.R. (2008). Multiple yeast genes, including Pafl complex genes, affect telomere length via telomerase RNA abundance. Molecular and Cellular Biology 28, 4152-4161. 58. Hiyama, E., and Hiyama, K. (2007). Telomere and telomerase in stem cells. British Journal of Cancer 96, 1020-1024. 59. Armstrong, L., Saretzki, G, Peters, II., Wappler, I., Evans, J., Hole, N., von Zglinicki, T., and Lako, M. (2005). Overexpression of telomerase confers growth advantage, stress resistance, and enhanced differentiation of ESCs toward the hematopoietic lineage. Stem Cells 23, 516-529. 60. Calado, R.T., and Young, N.S. (2008). Telomere maintenance and human bone marrow failure. Blood 111, 4446-4455. 61. Mosimann, C., Hausmann, G., and Basler, K. (2006). Parafibromin/hyrax activates Wnt/Wg target gene transcription by direct association with beta- catenin/armadillo. Cell 125, 327-341. 62. Burdon, T., Smith, A., and Savatier, P. (2002). Signalling, cell cycle and pluripotency in embryonic stem cells. Trends in Cell Biology 12, 432-438. 63. Stead, E., White, J., Faast, R., Conn, S., Goldstone, S., Rathjen, J., Dhingra, U., Rathjen, P., Walker, D., and Dalton, S. (2002). Pluripotent cell division cycles are driven by ectopic Cdk2, cyclin A/E and E2F activities. Oncogene 21, 8320-8333. 64. Nikolova-Krstevski, V., Bhasin, M., Otu, H.H., Eibermann, T., and Oettgen, P. (2008). Gene expression analysis of embryonic stem cells expressing VE-cadherin (CD 144) during endothelial differentiation. Bmc Genomics 9, 240. 65. Walker, E., Ohishi, M., Davey, R.E., Zhang, W., Cassar, P.A., Tanaka, T.S., Der, S.D., Morris, Q., Hughes, T.R., Zandstra, P.W., and Stanford, W.L. (2007). Prediction and testing of novel transcriptional networks regulating embryonic stem cell self-renewal and commitment. Cell Stem Cell 1, 71-86. 66. Barrett, T., Troup, D.B., Wilhite, S.E., Ledoux, P., Rudnev, D., Evangelista, C., Kim, I.F., Soboleva, A., Tomashevsky, M., and Edgar, R. (2007). NCBI GEO: mining tens of millions of expression profiles - database and tools update. Nucleic Acids Research 35, D760-D765. 67. Dittmer, A., Vetter, M., Schunke, D„ Span, P.N., Sweep, F., Thomssen, C., and Dittmer, J. (2006). Parathyroid hormone-related protein regulates tumor-relevant genes in breast cancer cells. Journal of Biological Chemistry 281, 14563-14572. 131 68. Hlaing, M., Shen, X., Dazin, P., and Bernstein, H.S. (2002). The hypertrophic response in C2C12 myoblasts recruits the G(l) cell cycle machinery. Journal of Biological Chemistry 277, 23794-23799. 69. Chazaud, C., Yamanaka, Y., Pawson, T., and Rossant, J. (2006). Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway. Developmental Cell 10, 615-624. 70. Vasudevan, S., Tong, Y.C., and Steitz, J.A. (2007). Switching from repression to activation: microRNAs can up-regulate translation. Science 318, 1931-1934. 71. Wang, Y.M., Medvid, R., Melton, C., Jaenisch, R., and Blelloch, R. (2007). DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self-renewal. Nature Genetics 39, 380-385. CHAPTER 5 DISCUSSION What Was Previously Known About the Cell Cycle in Planarians? In planarians, the proliferation of neoblasts is essential for survival and regeneration. Neoblasts divide to produce cells for the replacement of cells lost to normal physiological turnover and to injury. However, only a small body of literature has been written describing in any detail the mechanisms underlying this proliferation in planarians. First, Newmark and Sanchez Alvarado demonstrated that neoblasts are constantly cycling [1], In continuous BrdU labeling and fraction of labeled mitoses (FLM) experiments, more than 99% of neoblasts incorporated BrdU after 3 days of continuous labeling, suggesting that neoblasts do not remain quiescent for more than 3 days. In addition, they measured that the median length of G2 phase is 6 hours by characterizing planarian cell cycle parameters using FLM. Second, a mitotic burst in the neoblast population was observed in planarians during the initial 12 hours after feeding or amputation [2]. This suggests that the cell cycle of neoblasts is modulated by changes in the extracellular environment. Third, at the molecular level, two planarian cell cycle regulators, Smed-cyclinB and Smed-cdc23, were identified [3]. Smed-cyclinB(RNAi) animals had a low number of mitotic cells, while Smed-cdc23(RNAi) animals had a high number of mitotic cells. This result is consistent with findings in other organisms, in which absence of cyclinB has been shown to cause cell cycle arrest at G2 and loss of cdc23 results in anaphase arrest during mitosis [4, 5], Because Histone H3 phosphorylation was being used as a readout for mitosis using an antibody specific to this posttranslational modification, we concluded that RNAi of Smed-cyclinB prevented progression through G2 resulting in low counts of H3P positive cells, while Smed-cdc23 caused cycling cells to accumulate in mitosis accounting for the high number of H3P positive cells [3]. Altogether, both RNAi treatments yield insufficient proliferation of neoblasts, resulting in drastic tissue homeostasis and regeneration defects. To understand the cell cycle in planarians, many important questions remain. Do neoblasts have a unique cell cycle structure? What is the total length of the neoblast cell cycle? How is the cell cycle regulated in response to environmental changes such as feeding or amputation? Do the evolutionarily conserved cell cycle regulators such as cdks, cyclins, and cdc genes exist in planarians? If so, do they share evolutionarily conserved functions with their orthologs in other organisms and can they modulate the planarian cell cycle in similar ways? What We Learned from This Study In order to address the many unresolved questions associated with the regulation of the cell cycle in planarians, we first had to adapt and optimize flow cytometric methodologies suitable for use in vivo to study planarian stem cells. Once this was achieved (Chapter 2), we were able to carry out the first detailed characterization of the planarian cell cycle. First of all, the phase distribution of planarian total cells was defined. The average percentage of the cell population in planarians in G0/G1, S, and G2/M phases are 81.99±2.4%, 5.78±1.4%, and 12.23±1.4%, respectively. Second, we also determined the cell cycle profile of the irradiation sensitive neoblast populations (XI and X2) and irradiation insensitive differentiated cells (Xins). About 95% of the cells in the XI population are cycling with distinct flow cytometric peaks in S and G2/M, while the X2 and Xins populations are mainly comprised of non-cycling (G0/G1) cells (75.2±2.5% and 81.63±7.9, respectively). Third, by simultaneously combining BrdU incorporation and measurements of DNA content, we calculated the total length of the cell cycle of the planarian stem cells to be about 21 hours (Chapter 2). This measurement is likely the first of its kind for any member of the Phylum Platyhelminthes. Once baseline measurements of cell cycle parameters were obtained, we then wished to better understand how the cell cycle responds to mitogenic stimuli and to characterize the key molecular events underpinning such modulation. In order to accomplish these goals, we first analyzed and defined cell cycle parameters in animals after feeding, which is known to trigger an increase of mitotic figures in planarians [2], We performed immunohistological and flow cytometric timecourses independently. In both cases our findings supported a rapid stimulation of mitoses. The flow cytometry studies provided us with great insight on the phase of the cell cycle most likely being modulated to affect an increase in mitotic activity. We observed a general trend toward a decrease in the number of cells in the G0/G1 phase and a concomitant increase in the S phase population. This result suggests that transition from Gl to S phase of the cell cycle is modulated in response to mitogenic stimuli, providing us with the intriguing possibility that unlike other known toti/pluripotent stem cells, the planarian neoblasts may have a well defined Gl phase with a mitogenic-sensitive phase. In order to begin a molecular dissection of the neoblast cell cycle, we set out to 135 clone and characterize key molecules associated with the cell cycle in other organisms (Chapter 3). We mined both the trace reads and the recently assembled and annotated genome of S. mediterranea in search of conserved cell cycle genes. We uncovered 37 cdks, 26 cyclins, and 45 cdc genes. After targeting some of these genes for loss-of- function using RNAi, we observed that most of them failed to produce detectable phenotypes at the gross morphological level. We determined the effect of RNAi on these molecules and found them to be quite efficient, suggesting the possibility of great functional redundancy for this cohort of proteins. Nevertheless, we uncovered pronounced and fully penetrant phenotypes for Smed-cdk4, Smed-rb, and Smed-cdc73 characteristic to deficiencies in neoblast functions. Smed-cdk4(RNAi) animals were found to have fewer G0/G1 phase cells and slightly more G2/M phase cells than in controls, while Smed-rb(RNAi) animals have more G0/G1 phase cells and fewer G2/M phase cells than in controls. In Chapter 4, we described that Smed-cdc73 is required for the regulation of G1 phase to self-renew and to inhibit differentiation. In the absence of Smed-cdc73, neoblasts stop dividing, fail to maintain their undifferentiated state, and differentiate prematurely. This novel finding indicates that this understudied molecule may play a key role in the self-renewal mechanisms of stem cells. Altogether, our studies provide valuable information that will serve as a robust platform from which to initiate a systematic dissection of the regulatory mechanisms controlling the cell cycle of planarian stem cells. Future Studies The findings reported in this dissertation open new important avenues for future studies of planarian stem cell biology. For example, we observed that feeding results in a rapid Gl to S phase progression. In other organisms, Cyclin D1 is a key molecule that regulates Gl/S phase transition [6], However, we could not find cyclin D homologs after exhaustive searches of the planarian genome using a variety of methods (BLAST, PSI- BLAST, HMMR). Therefore, it would be important to understand what molecular mechanisms regulate the rapid Gl/S phase transition in planarian stem cells. We identified Smed-cdc73 as an essential regulator for planarian stem cell self- renewal, but the molecular mechanisms remain to be elucidated. Since the known function of Cdc73 is to regulate transcription of genes [7], [8], it is possible that Smed- cdc73 activates genes required for stem cell self-renewal and/or represses genes necessary for differentiation. Therefore, it will be of great interest to find the target genes of Smed-cdc73 in order to characterize the regulatory mechanism of neoblast self-renewal more precisely. In addition, it was recently found that Cdc73 affects telomere length in yeast [9] and it is also known that the maintenance of telomere length is critical for stem cell self-renewal [10]. Studies to determine whether Smed-cdc73 regulates telomere length in planarians and whether such activity plays a role in the perpetuation of neoblasts will be both exciting and instructive. Finally, some of our candidate genes such as Smed-tor and Smed-glut4 are unlikely to regulate the cell cycle, but their specific expression patterns and RNAi phenotypes, delayed regeneration and abnormal development of photoreceptors, are interesting. How do the specific neurons expressing Smed-tor control the process for replacing missing cells in a number of tissues? Are Smed-glut4-expressing cells in the central nervous system required for the development of photoreceptors? Thus, further 137 characterization will be informative and will help to decipher how these signaling molecules are involved in the generation of new tissue and organs from neoblasts. References 1. Newmark, P.A., and Sanchez Alvarado, A. (2000). Bromodeoxyuridine specifically labels the regenerative stem cells of planarians. Developmental Biology 220, 142-153. 2. Baguna, J. (1976). Mitosis in the intact and rgenerating planarian Dugesia mediterranea n.sp. II Mitotic sudies during regeneration and a possible mechanism of blastema formation. J Exp Zool 195, 65-80. 3. Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sanchez Alvarado, A. (2005). RNAi screening identifies regeneration and stem cell regulators in the planarian Schmidtea mediterranea. Developmental Cell 8, 635- 649. 4. Peters, J.M. (2002). The anaphase-promoting complex: proteolysis in mitosis and beyond. Molecular Cell 9, 931-943. 5. Doree, M., and Galas, S. (1994). The cyclin-dependent protein kinases and the control of cell division. FASEB J. 5, 1114-1121. 6. Shen, W.H. (2001). The plant cell cycle: Gl/S regulation. Euphytica 118, 223-232. 7. Hampsey, M., and Reinberg, D. (2003). Tails of intrigue: phosphorylation of RNA polymerase II mediates histone methylation. Cell 113, 429-432. 8. Mosimann, C., Hausmann, G., and Basler, K. (2006). Parafibromin/hyrax activates Wnt/Wg target gene transcription by direct association with beta- catenin/armadillo. Cell 125, 327-341. 9. Mozdy, A.D., Podell, E.R., and Cech, T.R. (2008). Multiple yeast genes, including Pafl complex genes, affect telomere length via telomerase RNA abundance. Molecular and Cellular Biology 28, 4152-4161. 10. Hiyama, E., and Hiyama, K. (2007). Telomere and telomerase in stem cells. British Journal of Cancer 96, 1020-1024. APPENDIX CHARACTERIZATION OF ADDITIONAL MOLECULES THAT AFFECT MITOTIC ACTIVITIES OF NEOBLASTS My research has focused on the identification of cell cycle-related genes. As described in Chapter 3, we took a candidate gene approach to identify cell cycle- associated molecules in planarians. Although we identified genes capable of disrupting cell cycle regulation in planarians, these were in the minority, with the larger collection causing little to no effect in cell cycle dynamics after their RNAi abrogation. Therefore, we attempted to characterize molecules with no known prior role in cell cycle regulation but shown to affect mitotic numbers in a previous RNAi screen performed in our laboratory [1 ]. Reddien et al. discovered 87 genes that had mitotic defects after RNAi feeding by H3P-immunostaining (Table A.l). We reasoned that if they are cell autonomous regulators of the neoblasts cell cycle, then they must be expressed in neoblasts. To determine the expression patterns of these genes, we performed whole- mount in situ hybridizations. Most genes were found expressed ubiquitously, suggesting that they may be required for general metabolic mechanisms rather than be specific to cell cycle regulatory activities. However, 5 genes displayed a typical neoblast expression pattern similar to that observed for smedwi-1 and 3 genes were expressed in mesenchymal cells, while others were expressed exclusively in specific organ systems (5 in the central nervous system and 4 in the gastric system) (Figure A.l). These unexpected expression patterns suggested the possibility that the cell cycle of the neoblasts could be regulated by signals from differentiated cells. In order to test the reproducibility of the previously reported phenotypes, I retested 18 of the genes described above and confirmed the occurrence of the mitotic defects (Figure A.2). Among them, RNAis of 5 genes led to significant changes in the number of mitotic cells. RNAis of Smed-chromobox, Smed- HDAC, Smed-SSRP, and Smed-PITP cause a reduction of mitotic cells, while RNAi of TABLE A.l. List of genes that have mitotic defects after RNAi. In the past, Reddien at al. identified 87 genes that had mitotic defects after RNAi treatment. These genes were characterized in detail in the text. 141 Clones Gene Names Clones Gene Names H. I6.9f 60S ribosomal protein L7a NB.38.10e 60S ribosomal protein L7a H. 18.1b ribosomal protein L21 NB.9.9c MAK16-like protein NB.5.1 la ribosomal protein LI5 NB.13.5f Ezrin NB.3.6g signal recognition particle receptor, NB.31.1 Id heterogeneous nuclear B subunit ribonucleoprotein L NB.9.9e ribosomal protein L3 NB.10.8a heat shock protein 10 NB.23.4d similar to Tubulin gamma-1 chain NB.47.7h proteasome (prosome, macropain) subunit, alpha type 1 NB.33.8h ribosomal protein L22 NB.51.9a transposase protein NB.15.1 Id ribosomal protein LI7 NB.35.5a ribosomal protein SI8 NB.20.5a putative peptidyl prolyl cis-trans NB.8.8b glycine amidinotransferase (L- isomerase with RNA binding region arginine:glycine amidinotransferase) NB.38.12c ribosomal protein S13 NB.28.8d BCSl-like variant NB.51.3h 40S ribosomal protein S27 NB.29.5d homologous to synapsin 1 NB.52.2b ribosomal protein L26 NB.46.8f ribosomal protein S15 NB.23.4f ribosomal protein L14 NB.43.2h zinc finger protein NB.34.1 h similar to ribosomal protein S8 NB.6.2f ribosomal protein LIO NB.48.7c 60S ribosomal protein-like NB.5.12d glutaminyl-tRNA synthetase NB.47.6f spliceosome-associated-protein 114 NB.6.7g similar to SEC24 related gene family, member C NB.28.10b ribosomal protein S4 NB.20.1 lh proteasome subunit beta 7 NB.24.3g ribosomal protein L35 H. 14.4a tolloid-BMP-1 like protein 1 NB.21.1 lg ubiquinol-cytochrome c H.15.12a Actin related protein 2/3 complex, oxidoreductase subunit 9 subunit 1B H.24.7d 34/67 kD laminin binding protein H.6.6f actin NB.32.6e phosphatidylinositol transfer NB.52.1 If Sialin (Solute carrier family 17 protein alpha member 5) H.8.1 Id THO complex 4 NB.15.8h Lysyl (k) trna synthetase protein 1 H.9.10d ubiquitin activating enzyme El H.24.5a H.9.4h similar to RPD3 protein NB.8.5b NB.24.2b Rho2 GTPase NB.25.6h NB.32.8d Prohibitin NB.53.9f NB.44.7c eIF4AIII NB.9.10a NB.45.12f Retinoblastoma binding protein 4 H.24.4R NB.45.2d seryl-tRNA synthetase NB.36.llc NB.52.1 le replication protein A 70kd subunit NB.32.2c NB.29.4f elongation factor-2 NB. 15.9a NB.30.8b peptidase NB.2.3f NB.37.3d ATP synthase beta chain NB.34.6h H.6.5d HSP70 NB.50.4a NB.4.6h HSP70 NB.7.5b NB.50.6d cyclinB NB.9.6c NB.6.8f Gnl3l protein NB.14.12c NB.15.9e S19e ribosomal protein NB.21.4g NB. 15.8c similar to chromobox homolog 3 NB.22.7b NB.30.12e G protein beta subunit H.24.3f H.23.3e membrane import protein H.24.2e H.22.10b sec61 homolog H.9.12e H.16.2b importin alpha 3 NB.33.12c NB.27.12c ribosomal protein LI3a FIGURE A.l. Whole-mount in situ hybridizations. (A) 5 genes: H.9.4h, NB.50.6d, NB.15.8c, NB.45.12f, and H.8.1 Id are expressed in neoblasts. (B) 3 genes: NB.8.5b, NB.32.2c, NB.8.8b are expressed specifically in mesenchymal cells. (C) 5 genes: NB.29.5d, NB43.2h, H.9.12e, H.24.2e, and H.24.3f are expressed in the central nervous system. (D) 4 genes: NB.52.1 If, NB.7.5b, NB.32.6e, and NB.30.12e are expressed in the 143 A |H.9.4h (HDAC1) H.9.4h (HDAC1) NB.50.6d (cyclinB) NB.15.8c (chromobox) B^^jJfET NB.45.12f (RB-binding protein) ^^^ H.8.11d (THO complex4) B NB.8.5b (no match) NB.8.5b (no match) NB.32.2c (no match) NB.8.8b (GATM1) ^ 7WMC*<"' >«> f-i* y W^ C NB.29.5d (synapsin) NB.29.5d (synapsin) NB.43.2h (zinc finger protein) H.9.12e (no match) H.24.2e (no match) H.24.3f (no match) D NB.52.11f (sialin) NB.52.11f (sialin) NB.7.5b (no match) NB.32.6e (PITP) * NB.30.12e (SSRP) FIGURE A.2. Characterization of RNAi animals. (A) H3P immunostaining. Mitotic cells of RNAi animals were measured by H3P immunostaining 20 days after RNAi feeding. (B) Stem cell population of RNAi animals was examined by whole-mount in situ hybridization using smedwi-1 20 days after RNAi feeding. (C) RNAi animals were amputated 13 days after RNAi feeding. Stem cell population in regenerating trunk fragments was examined by whole-mount in situ hybridization using smedwi-1 4 days after amputation. (D) Cycling cells in regenerating trunk fragments from RNAi animals were measured by whole-mount in situ hybridization using smed-PCNA 4 days after amputation. 145 A H3P unc22(RNAi) Smed-chromobox(RNAi) Smed-HDAC(RNAi) ' ' . . * * V « ' » Smed-SSRP(RNAi) Smed-PI TP( RNAi) Smed-Sialin(RNAi) B smedwi-1 unc22(RNAi) Smed-chromobox(RNAi) Smed-HDAC(RNAi) Smed-SSRP(RNAi) Smed-PITP(RNAil Smed-Sialin(RNAi) V ^m ">•• ^K'+.V'J- , .« C smedwi-1 D Smed-PCNA Smed-sialin results in an increase of mitotic cells. If RNAis for these genes affect mitotic cells by arresting or promoting cell cycle, the numbers and distribution of the stem cell population would be expected to change. We observed that the maintenance of stem cell populations was disrupted in both intact and regenerating RNAi animals using whole- mount in situ hybridization for smedwi-1. Considering previous studies on chromobox and HDAC, Smed-chromobox and Smed-HDAC may be cell autonomous regulators of planarian stem cells. Chromobox and HDAC are chromatin remodeling factors known to be expressed in human ES cells [2], Moreover, HDAC was reported to form unique transcriptional complexes to control ES cell fate [3], PITP and SSRP, however, have not been reported to function in regulation of stem cells yet. Inability to maintain stem cells in Smed-SSRP(RNAi) and Smed-PlTP(RNAi) animals is possibly due to a loss of signaling between the stem cells and the gut. We hypothesize that planarian stem cells could be regulated by signals from differentiated cells in the gut. Because planarian stem cells are distributed in the mesenchymal space between the branches of the gut, we suspect that this organ system likely plays an important role in modulating the surrounding microenvironment of stem cells, effectively providing a niche for these cells. Therefore, it is expected that experiments to characterize the functions of Smed-SSRP and Smed-PITP on stem cell regulation in planarians will be a vigorous line of investigation for others in the laboratory in the months to come. References 1. Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sanchez Alvarado, A. (2005). RNAi screening identifies regeneration and stem cell 147 regulators in the planarian Schmidtea mediterranea. Developmental Cell 8, 635- 649. 2. Ramalho-Santos, M., Yoon, S., Matsuzaki, Y., Mulligan, R.C., and Melton, D.A. (2002). "Sternness": transcriptional profiling of embryonic and adult stem cells. Science 298, 597-600. 3. Liang, J., Wan, M., Zhang, Y., Gu, P.L., Xin, H.W., Jung, S.Y., Qin, J., Wong, J.M., Cooney, A.J., Liu, D., and Zhou, S.Y. (2008). Nanog and Oct4 associate with unique transcriptional repression complexes in embryonic stem cells. Nature Cell Biology 10, 731-739.