DOCSLIB.ORG

Biochemical Characterization and Spatio-Temporal Expression of Myo-Inositol Oxygenase (MIOX) from Wheat (Triticum Aestivum L.)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biochemical Characterization and Spatio-Temporal Expression of Myo-Inositol Oxygenase (MIOX) from Wheat (Triticum Aestivum L.) Plant Gene 4 (2015) 10–19 Contents lists available at ScienceDirect Plant Gene journal homepage: www.elsevier.com/locate/plant-gene Biochemical characterization and spatio-temporal expression of myo-inositol oxygenase (MIOX) from wheat (Triticum aestivum L.) Anshu Alok a,c, Harsimran Kaur a, Kaushal K. Bhati a,JiteshKumara,PankajPandeya, Santosh K. Upadhyay b, Ashutosh Pandey a, Naresh C. Sharma c,AjayK.Pandeya, Siddharth Tiwari a,⁎ a National Agri-Food Biotechnology Institute (NABI), Department of Biotechnology, Government of India, C-127, Industrial Area, Phase VIII, SAS Nagar, Mohali 160071, Punjab, India b Department of Botany, Panjab University, Chandigarh, India c Department of Biochemistry and Genetics, Barkatullah University, Bhopal, India article info abstract Article history: Myo-inositol oxygenase (MIOX) catalyzes the conversion of myo-inositol into D-glucuronic acid. The present Received 3 July 2015 study demonstrates isolation of MIOX cDNA (TaMIOX) from wheat (Triticum aestivum L.) with open reading Received in revised form 11 September 2015 frame of 912 bp encoding 303 amino acid polypeptides with a molecular mass of 35.2 kDa. Phylogenetic analysis Accepted 18 September 2015 of TaMIOX across kingdoms confirmed the close relationship with Triticum urartu and Aegilops tauschii. Available online 25 September 2015 Secondary structure of TaMIOX consists of α-helixes (42.9%), β-turns (7.26%) joined by extended strands (14.85%), and 37 random coils (34.94%). Three-dimensional structure of TaMIOX suggested its close functional Keywords: fi μ L-Ascorbic acid and structural resemblance with known MIOX. Catalytic activity of the puri ed TaMIOX is 3.47 katal at pH 8.0 Cell wall biosynthesis and 35 °C with Michaelis constant 5.6 mM. Differential expression pattern of TaMIOX was observed in leaves, Myo-inositol root, stem, seed and seed developmental stages. Leaves showed a significantly higher transcript accumulation Myo-inositol oxygenase followed by root, stem and seed. Expression of TaMIOX during seed development stages showed higher Phytic acid expression at later stage and suggested that expression of TaMIOX was significantly higher in endosperm as Wheat compared with aleurone. The exogenous application of myo-inositol enhanced the expression of TaMIOX in leaves and roots suggested myo-inositol acts as an inducer for the TaMIOX expression. The present study reports molecular, structural and biochemical characterizations of MIOX in wheat which might play an important role in myo-inositol oxidation pathway. © 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 1. Introduction been of great interest (Lorence et al., 2004; Cruz-Rus et al., 2011; Tóth et al., 2011; Lisko et al., 2013). Myo-inositol oxygenase (MIOX, EC 1.13.99.1) is responsible for oxi- Molecular and functional characterizations of MIOX have been dative conversion of myo-inositol into D-glucuronic acid (Arner et al., reported in Arabidopsis thaliana (Lorence et al., 2004; Endres and 2001; Kanter et al., 2003; Valluru and Van den Ende, 2011). Myo-inositol Tenhaken, 2011; Tóth et al., 2011; Lisko et al., 2013), Oryza sativa is known to be involved in plant development and signaling processes, (Duan et al., 2012; Höller et al., 2015)andGlycine soja (Chen et al., including auxin storage and transport, regulation of cell death and 2015). In A. thaliana,fourMIOX homologs AtMIOX1, AtMIOX2, AtMIOX4 biosynthesis of molecules related to lipid signaling, cell wall and phytic and AtMIOX5 are localized on different chromosomes. Out of these, acid (Eckardt, 2010; Endres and Tenhaken, 2011). Contribution in the AtMIOX4 has been shown to play an important role in the biosynthesis ascorbic acid biosynthesis is one of the most important functions of of ascorbic acid using myo-inositol as an alternative precursor the plant MIOX (Lorence et al., 2004). The alternative pathway for ascor- (Lorence et al., 2004) as well as abiotic stress tolerance reported in over- bic acid biosynthesis directed through oxygenation of myo-inositol has expressing line by elevation in ascorbic acid content (Tóth et al., 2011; Lisko et al., 2013). However, Endres and Tenhaken (2009, 2011) report- ed that MIOX controls the level of myo-inositol without a significant change in ascorbic acid content. Tolerance against drought stress in Abbreviations: MIOX, Myo-inositol oxygenase gene; MIOX, Myo-inositol oxygenase rice OsMIOX overexpressing lines suggested its role in abiotic stress protein; AtMIOX, Arabidopsis thaliana myo-inositol oxygenase; TaMIOX, Triticum aestivum (Duan et al., 2012) but the level of ascorbic acid was not changed before (wheat) myo-inositol oxygenase. ⁎ Corresponding author. and after stress treatment (Höller et al., 2015). Alkaline stress tolerance E-mail addresses: [email protected], [email protected] (S. Tiwari). conferred by GsMIOX1a in Glycine soja was reported by Chen et al. http://dx.doi.org/10.1016/j.plgene.2015.09.004 2352-4073/© 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). A. Alok et al. / Plant Gene 4 (2015) 10–19 11 (2015). These studies in A. thaliana, G. soja and O. sativa clearly suggest Table 1 that alterations in plant MIOX might perturb the flux for its participation Primers used in gene amplification, cloning and quantitative real-time PCR analysis. in multiple pathways. Name of Sequences (5′ to 3′) Amplicon These attributes for MIOX make it an important candidate to be primers size (bp) studied in crop plants like wheat. Wheat is an important crop and a TaMIOX_F ATGACCATCATCATCGAGCAGCCTCAGT 912 major source of energy and micronutrients in the developing world. TaMIOX_R TCACCATCGCAGCTTCCCCGGGAA Thus, study directing towards understanding the role of MIOX in pET(TaMIOX)_F CGGGATCCATGACCATCATCATCGAGCAGCCTCAGT 912 wheat seeds could be of great interest and has potential for any such pET(TaMIOX)_R CCGCTCGAGCCATCGCAGCTTCCCCGGGAAGTA RT (TaMIOX)_F GCCGAGGCCATCCGCAAGGA 165 trait development. RT (TaMIOX)_R GTTGCATTCGTCGAACGCGCAGC In the present study, we report molecular, structural and RT (TaARF)_F TGATAGGGAACGTGTTGTTGAGGC 200 biochemical characterizations of wheat MIOX (TaMIOX). In-silico anal- RT (TaARF)_R AGCCAGTCAAGACCCTCGTACAAC ysis of TaMIOX was carried out to determine secondary and three- RT (TaEF1)_F GCTGTCAAGTTTGCTGAGATCC 150 RT (TaEF1)_R GTACTGAGCGAAGGTCTCCAC dimensional (3D) structures. Spatio-temporal expression analyses of TaMIOX suggested its preferential expression in leaves. Enzyme kinetics of TaMIOX suggested its functional activity towards the substrate that could help in addressing the in-vivo function of the protein. 2. Materials and methods were analyzed by the restriction digestion and confirmed by the 2.1. Plant material, growth conditions and treatment sequencing using a 96 capillary DNA analyzer (3730XL, Applied Biosystems, USA). Bread wheat (Triticum aestivum L.) Indian variety, C306, was grown TaMIOX sequence was analyzed using different bioinformatics tools. at the research farm of the National Agri-Food Biotechnology Institute Theoretical molecular weight (MW) and isoelectronic point (pI) of the (NABI). The individual plant spike of the three biological replicates for TaMIOX protein were computed using ExPASy proteomics server each experiment was tagged at the first day after anthesis (DAA). (http://ca.expasy.org). Signal peptide in the TaMIOX was investigated About 25–30 seeds from each spike were harvested at four different by Signal P 4.1 server (http://www.cbs.dtu.dk/services/SignalP/) and developmental stages i.e. 7, 14, 21, and 28 DAA and were frozen in SOSUI software (Gomi et al., 2000). Multiple sequence alignments liquid nitrogen for RNA extraction. To compare the expression of were performed by the ClustalW program. Domain organization was genes in the aleurone and endosperm, these tissues were separated analyzed by the Scan Prosite (http://prosite.expasy.org/scanprosite) from 14 DAA seeds and were frozen for further processing. For treat- and InterProScan (http://www.ebi.ac.uk/Tools/pfa/iprscan). UniProt ment assays, three week old plants were placed in Hoagland liquid database (http://www.uniprot.org/blast) was used to understand the media (Hoagland and Arnon, 1950) and kept for one week for acclima- function of different motifs present in TaMIOX. An orthologous MIOX tization. Plants were then transferred to fresh Hoagland liquid media sequences of A. thaliana (Uniprot ID: Q8L799)andO. sativa (Uniprot supplemented with 10 mM and 20 mM myo-inositol and then kept for ID: Q5Z8T3) were used as reference for the functional characterization 24 h. The plants were grown in a plant growth chamber (Conviron, of TaMIOX. Conserved amino acid sequences present in MIOX were Canada) at 22 °C under 16/8-h light/dark period with 60 ± 5% relative analyzed across kingdoms using ConSurf server (http://consurf.tau.ac. humidity. Light at 200 μmolphotonm−2 s−1 was supplied by il/overview.html). fluorescent tube lights. 2.4. Gene structure and phylogenetic analysis 2.2. RNA isolation and cDNA synthesis The wheat genome sequence database (http://www.wheatgenome. Total RNA was isolated from different tissues (roots, leaves, stems org/) was used to identify homologs of the TaMIOX.FGENESH+program and seeds) and at different developmental stages of the seed (7, 14, was used for the prediction of exon and intron in the genomic contig 21, and 28 DAA) using Spectrum™ Plant Total RNA kit (Sigma-Aldrich, (www.softberry.com). MIOX protein sequences from bacteria, fungi, USA). On-column DNase I Digest set (Sigma-Aldrich, USA) was plant and animal species were retrieved from the NCBI data bank and used to eliminate DNA contamination. The integrity and size distri- aligned using ClustalW program (www.ebi.ac.uk/Tools/msa/clustalw2). bution of total RNA were fractionated by electrophoresis on 1.2% aga- The phylogenetic tree was constructed using Molecular Evolutionary rose gel and detected by ethidium bromide staining. NanoQuant Genetic Analysis (MEGA) 5.0 software (Tamura et al., 2011).
Load more

Recommended publications
  • Molecular Insights Into DNA Interference by CRISPR-Associated Nuclease-Helicase Cas3
    Molecular insights into DNA interference by CRISPR-associated nuclease-helicase Cas3 Bei Gonga,1, Minsang Shinb,1, Jiali Suna, Che-Hun Junga,b, Edward L. Boltc, John van der Oostd, and Jeong-Sun Kima,b,2 aInterdisciplinary Graduate Program in Molecular Medicine, Chonnam National University, Gwangju 501-746, Korea; bDepartment of Chemistry, Chonnam National University, Gwangju 500-757, Korea; cSchool of Life Sciences, University of Nottingham Medical School, Nottingham NG72UH, United Kingdom; and dLaboratory of Microbiology, Wageningen University, 6703 HB, Wageningen, The Netherlands Edited by Wei Yang, National Institutes of Health, Bethesda, MD, and approved September 26, 2014 (received for review June 10, 2014) Mobile genetic elements in bacteria are neutralized by a system 21), Cascade complex by itself is not a nuclease for degradation based on clustered regularly interspaced short palindromic repeats of invader DNA (13). In Escherichia coli K-12 (type IE), Cascade (CRISPRs) and CRISPR-associated (Cas) proteins. Type I CRISPR-Cas recognizes and binds crRNA to complimentary sequence in systems use a “Cascade” ribonucleoprotein complex to guide RNA target DNA, generating an RNA mediated displacement loop specifically to complementary sequence in invader double-stranded (R-loop) of single-stranded (ss) DNA and RNA-DNA hybrid DNA (dsDNA), a process called “interference.” After target recogni- within double-stranded (ds) target DNA (13). Formation of the tion by Cascade, formation of an R-loop triggers recruitment of R-loop structure induces conformational change in Cascade subunits, triggering recruitment of Cas3 protein that is a nucle- a Cas3 nuclease-helicase, completing the interference process by – destroying the invader dsDNA.
    [Show full text]
  • Molecular Insights Into DNA Interference by CRISPR-Associated Nuclease-Helicase Cas3
    Molecular insights into DNA interference by CRISPR-associated nuclease-helicase Cas3 Bei Gonga,1, Minsang Shinb,1, Jiali Suna, Che-Hun Junga,b, Edward L. Boltc, John van der Oostd, and Jeong-Sun Kima,b,2 aInterdisciplinary Graduate Program in Molecular Medicine, Chonnam National University, Gwangju 501-746, Korea; bDepartment of Chemistry, Chonnam National University, Gwangju 500-757, Korea; cSchool of Life Sciences, University of Nottingham Medical School, Nottingham NG72UH, United Kingdom; and dLaboratory of Microbiology, Wageningen University, 6703 HB, Wageningen, The Netherlands Edited by Wei Yang, National Institutes of Health, Bethesda, MD, and approved September 26, 2014 (received for review June 10, 2014) Mobile genetic elements in bacteria are neutralized by a system 21), Cascade complex by itself is not a nuclease for degradation based on clustered regularly interspaced short palindromic repeats of invader DNA (13). In Escherichia coli K-12 (type IE), Cascade (CRISPRs) and CRISPR-associated (Cas) proteins. Type I CRISPR-Cas recognizes and binds crRNA to complimentary sequence in systems use a “Cascade” ribonucleoprotein complex to guide RNA target DNA, generating an RNA mediated displacement loop specifically to complementary sequence in invader double-stranded (R-loop) of single-stranded (ss) DNA and RNA-DNA hybrid DNA (dsDNA), a process called “interference.” After target recogni- within double-stranded (ds) target DNA (13). Formation of the tion by Cascade, formation of an R-loop triggers recruitment of R-loop structure induces conformational change in Cascade subunits, triggering recruitment of Cas3 protein that is a nucle- a Cas3 nuclease-helicase, completing the interference process by – destroying the invader dsDNA.
    [Show full text]
  • Computational Analysis of Protein Function Within Complete Genomes
    Computational Analysis of Protein Function within Complete Genomes Anton James Enright Wolfson College A dissertation submitted to the University of Cambridge for the degree of Doctor of Philosophy European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, United Kingdom. Email: [email protected] March 7, 2002 To My Parents and Kerstin This thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This thesis does not exceed the specified length limit of 300 pages as de- fined by the Biology Degree Committee. This thesis has been typeset in 12pt font using LATEX2ε accordingtothe specifications defined by the Board of Graduate Studies and the Biology Degree Committee. ii Computational Analysis of Protein Function within Complete Genomes Summary Anton James Enright March 7, 2002 Wolfson College Since the advent of complete genome sequencing, vast amounts of nucleotide and amino acid sequence data have been produced. These data need to be effectively analysed and verified so that they may be used for biologi- cal discovery. A significant proportion of predicted protein sequences from these complete genomes have poorly characterised or unknown functional annotations. This thesis describes a number of approaches which detail the computational analysis of amino acid sequences for the prediction and analy- sis of protein function within complete genomes. The first chapter is a short introduction to computational genome analysis while the second and third chapters describe how groups of related protein sequences (termed protein families) may be characterised using sequence clustering algorithms.
    [Show full text]
  • Cas3 Protein—A Review of a Multi-Tasking Machine
    G C A T T A C G G C A T genes Review Cas3 Protein—A Review of a Multi-Tasking Machine Liu He 1, Michael St. John James 1, Marin Radovcic 2, Ivana Ivancic-Bace 2,* and Edward L. Bolt 1,* 1 School of Life Sciences, University of Nottingham, Nottingham NG7 2UH, UK; [email protected] (L.H.); [email protected] (M.S.J.J.) 2 Department of Biology, Faculty of Science, University of Zagreb, 10 000 Zagreb, Croatia; [email protected] * Correspondence: [email protected] (I.I.-B.); [email protected] (E.L.B.); Tel.: +385-4606273 (I.I.-B.); +44-115-8230194 (E.L.B.) Received: 13 January 2020; Accepted: 16 February 2020; Published: 18 February 2020 Abstract: Cas3 has essential functions in CRISPR immunity but its other activities and roles, in vitro and in cells, are less widely known. We offer a concise review of the latest understanding and questions arising from studies of Cas3 mechanism during CRISPR immunity, and highlight recent attempts at using Cas3 for genetic editing. We then spotlight involvement of Cas3 in other aspects of cell biology, for which understanding is lacking—these focus on CRISPR systems as regulators of cellular processes in addition to defense against mobile genetic elements. Keywords: CRISPR; Cas3; helicase; nuclease; biofilm 1. Introducing Cas3—The Identification of a DNA Helicase-Nuclease Machine In this article, we review original research that describes the structure and function of prokaryotic Cas3. Cas3 is an essential component of CRISPR-Cas adaptive immunity systems that repel invader genetic elements (reviewed recently [1–3]), but it also plays-in to several other aspects of cell biology, highlighted in Figure1.
    [Show full text]
  • Contribution of SAM and HD Domains to Retroviral Restriction Mediated by Human SAMHD1
    Virology 436 (2013) 81–90 Contents lists available at SciVerse ScienceDirect Virology journal homepage: www.elsevier.com/locate/yviro Contribution of SAM and HD domains to retroviral restriction mediated by human SAMHD1 Tommy E. White a,1, Alberto Brandariz-Nun˜ez a,1, Jose Carlos Valle-Casuso a, Sarah Amie b, Laura Nguyen b, Baek Kim b, Jurgen Brojatsch a, Felipe Diaz-Griffero a,n a Department of Microbiology and Immunology, Albert Einstein College of Medicine Bronx, NY 10461, USA b Department of Microbiology & Immunology, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642, USA article info abstract Article history: The human SAMHD1 protein is a novel retroviral restriction factor expressed in myeloid cells. Previous Received 1 September 2012 work has correlated the deoxynucleotide triphosphohydrolase activity of SAMHD1 with its ability to Returned to author for revisions block HIV-1 and SIVmac infection. SAMHD1 is comprised of the sterile alpha motif (SAM) and histidine– 24 September 2012 aspartic (HD) domains; however the contribution of these domains to retroviral restriction is not Accepted 20 October 2012 understood. Mutagenesis and deletion studies revealed that expression of the sole HD domain of Available online 13 November 2012 SAMHD1 is sufficient to achieve potent restriction of HIV-1 and SIVmac. We demonstrated that the HD Keywords: domain of SAMHD1 is essential for the ability of SAMHD1 to oligomerize by using a biochemical assay. SAMHD1 In agreement with previous observations, we mapped the RNA-binding ability of SAMHD1 to the HD HIV-1 domain. We also demonstrated a direct interaction of SAMHD1 with RNA by using enzymatically-active HD domain purified SAMHD1 protein from insect cells.
    [Show full text]
  • PARP Power: a Structural Perspective on PARP1, PARP2, and PARP3 in DNA Damage Repair and Nucleosome Remodelling
    International Journal of Molecular Sciences Review PARP Power: A Structural Perspective on PARP1, PARP2, and PARP3 in DNA Damage Repair and Nucleosome Remodelling Lotte van Beek 1,† , Éilís McClay 2,†, Saleha Patel 3, Marianne Schimpl 1 , Laura Spagnolo 2,* and Taiana Maia de Oliveira 1,* 1 Structure and Biophysics, Discovery Sciences, R&D, AstraZeneca, Cambridge CB4 0WG, UK; [email protected] (L.v.B.); [email protected] (M.S.) 2 Institute of Molecular, Cell and Systems Biology, College of Medical, Veterinary and Life Sciences, Garscube Campus, University of Glasgow, Glasgow G61 1QQ, UK; [email protected] 3 Discovery Biology, Discovery Sciences, R&D, AstraZeneca, Cambridge CB4 0WG, UK; [email protected] * Correspondence: [email protected] (L.S.); [email protected] (T.M.d.O.) † These authors contributed equally to this work. Abstract: Poly (ADP-ribose) polymerases (PARP) 1-3 are well-known multi-domain enzymes, catalysing the covalent modification of proteins, DNA, and themselves. They attach mono- or poly-ADP-ribose to targets using NAD+ as a substrate. Poly-ADP-ribosylation (PARylation) is cen- tral to the important functions of PARP enzymes in the DNA damage response and nucleosome remodelling. Activation of PARP happens through DNA binding via zinc fingers and/or the WGR domain. Modulation of their activity using PARP inhibitors occupying the NAD+ binding site has proven successful in cancer therapies. For decades, studies set out to elucidate their full-length molecular structure and activation mechanism. In the last five years, significant advances have Citation: van Beek, L.; McClay, É.; progressed the structural and functional understanding of PARP1-3, such as understanding allosteric Patel, S.; Schimpl, M.; Spagnolo, L.; activation via inter-domain contacts, how PARP senses damaged DNA in the crowded nucleus, and Maia de Oliveira, T.
    [Show full text]
  • Comparative Analysis of Protein Domain Organization
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Research Comparative Analysis of Protein Domain Organization Yuzhen Ye and Adam Godzik Program in Bioinformatics and Systems Biology, The Burnham Institute, La Jolla, California 92037, USA We have developed a set of graph theory-based tools, which we call Comparative Analysis of Protein Domain Organization (CADO), to survey and compare protein domain organizations of different organisms. In the language of CADO, the organization of protein domains in a given organism is shown as a domain graph in which protein domains are represented as vertices, and domain combinations, defined as instances of two domains found in one protein, are represented as edges. CADO provides a new way to analyze and compare whole proteomes, including identifying the consensus and difference of domain organization between organisms. CADO was used to analyze and compare >50 bacterial, archaeal, and eukaryotic genomes. Examples and overviews presented here include the analysis of the modularity of domain graphs and the functional study of domains based on the graph topology. We also report on the results of comparing domain graphs of two organisms, Pyrococcus horikoshii (an extremophile) and Haemophilus influenzae (a parasite with reduced genome) with other organisms. Our comparison provides new insights into the genome organization of these organisms. Finally, we report on the specific domain combinations characterizing the three kingdoms of life, and the kingdom “signature” domain organizations derived from those specific domain combinations. [Supplemental material is available online at www.genome.org and http://ffas.ljcrf.edu/DomainGraph.] With complete genomes of >100 organisms already known and 1997), and SCOP (Murzin et al.
    [Show full text]
  • Structural Basis for Inhibition of an Archaeal Crispr–Cas Type I-D
    Structural basis for inhibition of an archaeal CRISPR–Cas type I-D large subunit by an anti-CRISPR protein Manav, M. Cemre; Van, Lan B.; Lin, Jinzhong; Fuglsang, Anders; Peng, Xu; Brodersen, Ditlev E. Published in: Nature Communications DOI: 10.1038/s41467-020-19847-x Publication date: 2020 Document version Publisher's PDF, also known as Version of record Document license: CC BY Citation for published version (APA): Manav, M. C., Van, L. B., Lin, J., Fuglsang, A., Peng, X., & Brodersen, D. E. (2020). Structural basis for inhibition of an archaeal CRISPR–Cas type I-D large subunit by an anti-CRISPR protein. Nature Communications, 11, [5993]. https://doi.org/10.1038/s41467-020-19847-x Download date: 25. sep.. 2021 ARTICLE https://doi.org/10.1038/s41467-020-19847-x OPEN Structural basis for inhibition of an archaeal CRISPR–Cas type I-D large subunit by an anti- CRISPR protein ✉ M. Cemre Manav 1,3, Lan B. Van1, Jinzhong Lin 2, Anders Fuglsang 2, Xu Peng 2 & ✉ Ditlev E. Brodersen 1 – 1234567890():,; A hallmark of type I CRISPR Cas systems is the presence of Cas3, which contains both the nuclease and helicase activities required for DNA cleavage during interference. In subtype I-D systems, however, the histidine-aspartate (HD) nuclease domain is encoded as part of a Cas10-like large effector complex subunit and the helicase activity in a separate Cas3’ subunit, but the functional and mechanistic consequences of this organisation are not cur- rently understood. Here we show that the Sulfolobus islandicus type I-D Cas10d large subunit exhibits an unusual domain architecture consisting of a Cas3-like HD nuclease domain fused to a degenerate polymerase fold and a C-terminal domain structurally similar to Cas11.
    [Show full text]
  • An HD Domain Phosphohydrolase Active Site Tailored for Oxetanocin-A Biosynthesis
    An HD domain phosphohydrolase active site tailored for oxetanocin-A biosynthesis Jennifer Bridwell-Rabba,b,c, Gyunghoon Kangb, Aoshu Zhongd,e, Hung-wen Liud,e, and Catherine L. Drennana,b,c,1 aHoward Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, MA 02139; bDepartment of Chemistry, Massachusetts Institute of Technology, Cambridge, MA 02139; cDepartment of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; dDivision of Chemical Biology and Medicinal Chemistry, College of Pharmacy, University of Texas at Austin, Austin, TX 78712; and eDepartment of Chemistry, University of Texas at Austin, Austin, TX 78712 Edited by David W. Christianson, University of Pennsylvania, Philadelphia, PA, and accepted by Editorial Board Member Stephen J. Benkovic October 26, 2016 (received for review August 16, 2016) HD domain phosphohydrolase enzymes are characterized by a triphosphate from deoxyadenosine triphosphate (dATP) (21, 22). conserved set of histidine and aspartate residues that coordinate These enzymes can also cleave the phosphodiester bond of cyclic- an active site metallocenter. Despite the important roles these di-GMP (11, 23). Finally, two HD domain enzymes, myo-inositol enzymes play in nucleotide metabolism and signal transduction, few oxygenase and PhnZ, are not hydrolases at all. They bind mixed- + + have been both biochemically and structurally characterized. Here, valent Fe2 /Fe3 metal centers and operate as oxygenases, we present X-ray crystal structures and biochemical characterization indicating the chemical diversity possible with the HD domain of the Bacillus megaterium HD domain phosphohydrolase OxsA, fold (10, 18, 20, 24–26). involved in the biosynthesis of the antitumor, antiviral, and Here we investigate two plausible mechanistic proposals for the antibacterial compound oxetanocin-A.
    [Show full text]
  • Genes in Deinococcus Radiodurans S Jinhui Wang, Ye Tian, Zhengfu Zhou, Liwen Zhang, Wei Zhang, Min Lin, and Ming Chen*
    J. Microbiol. Biotechnol. (2016), 26(12), 2106–2115 http://dx.doi.org/10.4014/jmb.1601.01017 Research Article Review jmb Identification and Functional Analysis of RelA/SpoT Homolog (RSH) Genes in Deinococcus radiodurans S Jinhui Wang, Ye Tian, Zhengfu Zhou, Liwen Zhang, Wei Zhang, Min Lin, and Ming Chen* Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P.R. China Received: January 11, 2016 Revised: July 20, 2016 To identify the global effects of (p)ppGpp in the gram-positive bacterium Deinococcus Accepted: August 10, 2016 radiodurans, which exhibits remarkable resistance to radiation and other stresses, RelA/SpoT homolog (RSHs) mutants were constructed by direct deletion mutagenesis. The results showed that RelA has both synthesis and hydrolysis domains of (p)ppGpp, whereas RelQ only First published online synthesizes (p)ppGpp in D. radiodurans. The growth assay for mutants and complementation August 24, 2016 analysis revealed that deletion of relA and relQ sensitized the cells to H2O2, heat shock, and *Corresponding author amino acid limitation. Comparative proteomic analysis revealed that the bifunctional RelA is Phone: +86-1082106106; involved in DNA repair, molecular chaperone functions, transcription, the tricarboxylic acid Fax: +86-1082106142; cycle, and metabolism, suggesting that relA maintains the cellular (p)ppGpp levels and plays a E-mail: [email protected] crucial role in oxidative resistance in D. radiodurans. The D. radiodurans relA and relQ genes are responsible for (p)ppGpp synthesis/hydrolysis and (p)ppGpp hydrolysis, respectively. (p)ppGpp integrates a general stress response with a targeted re-programming of gene S upplementary data for this regulation to allow bacteria to respond appropriately towards heat shock, oxidative stress, and paper are available on-line only at starvation.
    [Show full text]
  • CRISPR Immunity and Applications in Archaea with a Comparative Analysis of CRISPR Types in Sulfolobales
    biomolecules Review Heavily Armed Ancestors: CRISPR Immunity and Applications in Archaea with a Comparative Analysis of CRISPR Types in Sulfolobales , Isabelle Anna Zink * y , Erika Wimmer y and Christa Schleper Department of Functional and Evolutionary Ecology, Archaea Biology and Ecogenomics Unit, University of Vienna, 1090 Vienna, Austria; [email protected] (E.W.); [email protected] (C.S.) * Correspondence: [email protected] These authors contributed equally. y Received: 2 October 2020; Accepted: 3 November 2020; Published: 6 November 2020 Abstract: Prokaryotes are constantly coping with attacks by viruses in their natural environments and therefore have evolved an impressive array of defense systems. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is an adaptive immune system found in the majority of archaea and about half of bacteria which stores pieces of infecting viral DNA as spacers in genomic CRISPR arrays to reuse them for specific virus destruction upon a second wave of infection. In detail, small CRISPR RNAs (crRNAs) are transcribed from CRISPR arrays and incorporated into type-specific CRISPR effector complexes which further degrade foreign nucleic acids complementary to the crRNA. This review gives an overview of CRISPR immunity to newcomers in the field and an update on CRISPR literature in archaea by comparing the functional mechanisms and abundances of the diverse CRISPR types. A bigger fraction is dedicated to the versatile and prevalent CRISPR type III systems, as tremendous progress has been made recently using archaeal models in discerning the controlled molecular mechanisms of their unique tripartite mode of action including RNA interference, DNA interference and the unique cyclic-oligoadenylate signaling that induces promiscuous RNA shredding by CARF-domain ribonucleases.
    [Show full text]
  • The HD-Domain Metalloprotein Superfamily: an Apparent Common Protein Scaffold with Diverse Chemistries
    catalysts Review The HD-Domain Metalloprotein Superfamily: An Apparent Common Protein Scaffold with Diverse Chemistries Michelle Langton, Sining Sun , Chie Ueda, Max Markey, Jiahua Chen , Isaac Paddy, Paul Jiang, Natalie Chin, Amy Milne and Maria-Eirini Pandelia * Department of Biochemistry, Brandeis University, 415 South Street, Waltham, MA 02453, USA; [email protected] (M.L.); [email protected] (S.S.); [email protected] (C.U.); [email protected] (M.M.); [email protected] (J.C.); [email protected] (I.P.); [email protected] (P.J.); [email protected] (N.C.); [email protected] (A.M.) * Correspondence: [email protected]; Tel.: +1-781-736-4939 Received: 10 September 2020; Accepted: 9 October 2020; Published: 15 October 2020 Abstract: The histidine–aspartate (HD)-domain protein superfamily contains metalloproteins that share common structural features but catalyze vastly different reactions ranging from oxygenation to hydrolysis. This chemical diversion is afforded by (i) their ability to coordinate most biologically relevant transition metals in mono-, di-, and trinuclear configurations, (ii) sequence insertions or the addition of supernumerary ligands to their active sites, (iii) auxiliary substrate specificity residues vicinal to the catalytic site, (iv) additional protein domains that allosterically regulate their activities or have catalytic and sensory roles, and (v) their ability to work with protein partners. More than 500 structures of HD-domain proteins are available to date that lay out unique structural features which may be indicative of function. In this respect, we describe the three known classes of HD-domain proteins (hydrolases, oxygenases, and lyases) and identify their apparent traits with the aim to portray differences in the molecular details responsible for their functional divergence and reconcile existing notions that will help assign functions to yet-to-be characterized proteins.
    [Show full text]