Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE Received; September 26, 2012 Published online; January 29, 2013 Accepted; December 28, 2012 doi; 10.2133/dmpk.DMPK-12-SC-110
Single Nucleotide Polymorphisms in SULT1A1 and SULT1A2 in a Korean population
Su-Jun Lee1, Woo-Young Kim1, Yazun B. Jarrar1, Yang-Weon Kim1,2, Sang Seop
Lee1, Jae-Gook Shin1,3
1Department of Pharmacology and Pharmacogenomics Research Center,
2Department of Emergency Medicine, 3Department of Clinical Pharmacology, Inje
University Busan Paik Hospital, Inje University College of Medicine, Inje University,
Gaegum2-dong, Busanjin-gu, Busan, South Korea.
This work was supported by a grant from the Korea Science and Engineering
Foundation (KOSEF), funded by the Ministry of Education, Science, and Engineering
(MOEST) (No. R13-2007-023-00000-0) and by a grant from the National Project for
Personalized Genomic Medicine (A111218-11-PG02), Korea Health 21 R&D Project,
Ministry for Health & Welfare, Republic of Korea.
Copyright C 2013 by the Japanese Society for the Study of Xenobiotics (JSSX) Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Running Title Page: a) Running title: SNPs of SULT1A1 and SULT1A2 in Koreans. b) Correspondence:
Jae-Gook Shin, PhD, MD.
Department of Pharmacology and Pharmacogenomics Research Center,
Department of Clinical Pharmacology, Inje University College of Medicine, Inje
University,633-165, Gaegum2-dong, Busanjin-gu, Busan, 614-714, South Korea.
Tel: 82-51-890-6709 Fax: 82-51-893-1232 E-mail: [email protected]
C) The number of:
Text pages: 14 Tables: 3 Figures: 1
Supplementary Figure: 1
Supplementary Table: 1
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Summary
SULT1A1 and SULT1A2 are encoded on the same chromatid, and exhibit a 96% amino acid similarity. To screen for genetic variants in these two closely related genes, SULT1A1 and SULT1A2 were directly sequenced in 50 healthy Koreans. A total of 30 variations were identified in SULT1A1: eight in exons, thirteen in introns, and nine in the 5’-untranslated region. With regard to SULT1A2, 21 variants were identified, comprising seven in exons, five in introns, and nine in the 5’-untranslated region. Among these 51 variations, one in SULT1A1 and eight in SULT1A2 were previously unidentified, which include three coding variants (SULT1A2 R37Q,
110G>A; SULT1A2 G50S, 148G>A; SULT1A2 F286L, 3819C>A) and one null allele
(SULT1A2 E217Stop, 3542G>T). Two LD blocks, major haplotype structures, and 7 haplotype-tagging SNPs were determined together for SULT1A1 and SULT1A2 as a single set. Frequencies of common functional variants were compared among ethnic groups. Since these two SULT enzymes are on the same chromatid in a parallel direction with overlapping substrate specificities, a combined analysis using LD and haplotype-tagging single-nucleotide polymorphisms (SNPs) will facilitate understanding of the variations in the sulfation reactions of a wide range of substrates, as compared with analysis of individual genes.
Keywords: SULT1A1 / SULT1A2 / Linkage Disequilibrium / SNPs / Tag SNPs.
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Introduction
Sulfotransferase (SULT) catalyzes transfer of a sulfate group from 3’- phosphoadenosine-5’-phosphosulfate (PAPS) to the nucleophilic moieties of a wide variety of human drugs.1 In addition to xenobiotic metabolism, SULT has an important role in the regulation of endogenous compounds, such as steroids, hormones, and catecholamines.2 Sulfation is also involved in the detoxification of environmental pollutants and inactivation of active drug metabolites, such as those of tamoxifen, 4-OH-tamoxifen and endoxifen.3 Although sulfated compounds usually exhibit increased water solubility and decreased cell-membrane penetrance, sulfation of some chemicals leads to generation of carcinogenic metabolites.4
Based on their sequence similarities, a total of 13 human cytosolic SULT genes are classified into four families: SULT1, SULT2, SULT4, and SULT6.5 The SULT1 family is further divided into two subfamilies, SULT1A and SULT1E, which include
SULT1A1, SULT1A2, SULT1A3, and SULT1E1. In the SULT1A subfamily, each gene has a preference in terms of its substrates and has a different inheritance pattern.
For example, SULT1A1 and SULT1A2 exhibit a high amino-acid homology (96%) and preferentially catalyze the sulfation of small planar phenols, which include endogenous or exogenous estrogens and tamoxifen metabolites.1,6,7 However,
SULT1A3 preferentially catalyzes sulfate conjugation with monoamines, such as dopamine and other neurotransmitters, and exhibits relatively lower amino-acid sequence homologies with SULT1A1 (93%) and SULT1A2 (91%).8,9 Results from the
Human Genome Project show that SULT1A3 is duplicated into two SULT1A3 genes
(e.g., SULT1A3 and SULT1A4) on chromosome 16.10 Therefore, it appears that
SULT1A1 and SULT1A2 share substrates, similar structures and functions, while Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
SULT1A3 has a different substrate affinity and recombination events than SULT1A1 and SULT1A2.
SULT1A1 and SULT1A2 are important genes, as they are involved in regulating estrogen levels and drug clearance in humans.2,11,12 Although SULT1A1 and
SULT1A2 genetic polymorphisms have been reported in whites, blacks, and other ethnic populations,13-18 there is a lack of data regarding these genes in Koreans and
Asians. Therefore, we resequenced the SULT1A1 and SULT1A2 genes, which are located 8 kb apart, identified new variants, and analyzed them together in terms of allele frequencies, haplotype structures, linkage-disequilibrium (LD) blocks, and haplotype-tagging single-nucleotide polymorphisms (SNPs).
Materials and Methods
Subjects
Genomic DNA samples were obtained from 50 unrelated, healthy Koreans from the
DNA repository bank at the INJE Pharmacogenomics Research Center (Inje
University College of Medicine, Busan, Korea).19,20 All subjects provided written informed consent before participating in the present study. The research protocol for the use of human DNA from blood samples was approved by the Institutional Review
Board (IRB) of Busan Paik Hospital, Inje University College of Medicine, Inje
University, Busan, Korea.
Variant identification
Genomic DNA was prepared from peripheral whole blood using a QIAamp blood kit
(Valencia, CA, USA). All exons, intron–exon junctions, 5’-untranslated regions (5’-
UTRs), and 3’UTRs were amplified using SULT1A1- and SULT1A2-specific primers, Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
and the amplified fragments were directly sequenced to identify DNA variations.
Polymerase chain reaction (PCR) primers were initiated approximately 50–100 bp from each intron–exon boundary, and spanned the intron/exon splice site. All primers used are described in supplementary Table A. Since SULT1A1 and SULT1A2 exhibit a high sequence homology, these were amplified first, followed by individual fragments, for direct DNA sequencing. PCR was performed using primers (0.2 mmol l-1 each), genomic DNA (100 ng), 2 U of r-Taq polymerase (Takara Bio, Shiga,
Japan), and each dNTP at 0.2 mmol l-1 per reaction. Amplification products were purified using a PCR purification kit (NucleoGen, Ansan, Korea) and directly sequenced according to the manufacturer’s instructions (ABI Prism 3700XL Genetic
Analyzer, Applied Biosystems, Carlsbad, CA, USA). All variants identified were confirmed by sequencing in both directions. Particularly, the rare variants identified from a single individual were PCR amplified again and confirmed the mutation by re- sequencing in both directions to avoid artificial errors. A software package, PC Gene
(Oxford Molecular, Campbell, CA, USA), was used to identify variants with single- nucleotide substitutions in heterozygous or homozygous individuals. A software program available at http://www.fruitfly.org/seq_tools/splice.html was used to predict possible new splice sites introduced by mutations. Another software program
(http://www.cbrc.jp/research/db/TFSEARCH.html) was used to detect changes in transcription factor-binding elements introduced by mutations.
LD, haplotype analysis, and haplotype-tagging SNPs
Hardy–Weinberg equilibrium (HWE) and haplotype inference were analyzed using the SNPAlyze software (version 4.1; Dynacom, Yokohama, Japan). LD block and Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
haplotype structure were constructed using the Haploview software version 4.1
(http://www.broadinstitute.org/scientific-community/science/programs/medical-and- population-genetics/haploview/downloads). |D’| and rho square (r2) values were used to determine pairwise LD between SNPs, as described previously.21,22 Thirty-seven
SNPs with frequencies of >5% were used to select haplotype-tagging SNPs
(htSNPs). A tagger program that combined the simplicity of pairwise methods with the potential efficiency of multimarker approaches was used to select representative htSNPs on the basis of the exclusion of redundant SNPs displaying high levels of LD
(http://www.broad.mit.edu/mpg/tagger/). Detailed methods for htSNP selection were described previously.22
Results and Discussion
SULTs are important contributors to the conjugation of numerous xenobiotics and endogenous compounds. In general, conjugated compounds with a sulfate anion
- (SO3 ) from PAPS are more water soluble than the acceptor molecule itself, resulting in the increased elimination of substrates or increased toxicity of some chemicals.23,
31 Genetic polymorphisms in SULTs can cause functional changes through various mutations in a number of genomic regions (e.g., expression level variation via mutations in regulatory regions and protein function alterations due to amino acid changes or insertions/deletions). Since SULTs are involved in the conjugation of steroidal hormones, drugs, and environmental compounds, their genetic polymorphism-induced altered functions may be associated with hormonal imbalance, adverse drug reactions, and/or an increased risk of chemical toxicity.
Genetic polymorphisms in SULT1A1 and SULT1A2 in Caucasians have been Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
evaluated.24,25 However, such information regarding Asian populations is limited compared to those regarding other ethnicities. Although a few studies of SULT variant frequencies have been published,13,15,26 no resequencing to comprehensively analyze SULT1A1 and SULT1A2 in Asians has been conducted. Therefore, the goals of our study were to identify further genetic variants and to analyze the LD and haplotype structures of the closely-related SULT1A1 and SULT1A2 genes.
Direct DNA sequencing of SULT1A1 and SULT1A2 revealed a total of 51 variations in 50 Korean individuals. A summary of the identified frequencies is listed in Tables 1 and 2. All of genotype frequencies were in line with HWE, with the exception of rs3743963 in SULT1A2 gene. Genotype error might be a potential source for this departure from HWE. However, further validation of sequencing data confirmed the genotype calling. Therefore, the deviation from HWE of this SNP was unlikely to be due to the sequencing error. For SULT1A1, eight SNPs were found within exons, including three that produced amino acid changes. Of these, SULT1A1 R213H, designated SULT1A1*2, was found at a frequency of 12%. Nine SNPs in the 5’- untranslated region (sequenced up to -1200 bp) and 13 SNPs in introns were detected. None of these variations were implicated in the creation or disruption of splice sites or transcription factor binding sites. Among SULT1A1 variants,
SULT1A1*2 and SULT1A1*3 have been extensively investigated due to their enzymatic changes that occur at relatively high frequencies. SULT1A1*2 has a lower stability than the wild-type.15, 27 SULT1A1*2 exhibited decreased activity in platelets
28-30 and in a recombinant protein system 15, 29 when compared to the wild-type enzyme. The influence of SULT1A1*3 on enzyme activity appears to be less than that of SULT1A1*2, conferring activity similar to the wild-type.27,31 Frequencies of Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
SUL1A1*2 and SULT1A1*3 differed among ethnic populations (Table 3). The frequency of SULT1A1*2 is higher in Caucasians (average 35%) and African-
Americans (28%) than in Asians (12%).22, 30, 32, 33, 33, 35 With regard to SULT1A1*3,
African–Americans exhibited higher frequencies compared to other ethnicities. For
SULT1A2, a total of 21 SNPs were detected in the present study. Eight of the 21 were newly identified. Seven SNPs were found in exons, comprised of three synonymous and five nonsynonymous mutations, including SULT1A2 I7T, R37Q,
G50S, E217Stop, and F268L. All coding variants identified in the present study were heterozygous mutations in a single individual, with the exception of SULT1A2*2.
Although the understanding of in vivo effects is limited due to the low frequency, the current study provides additional information on variants that may be helpful in understanding their influence in vivo by means of future global collaborations. For example, an individual with the E217Stop variant would have an impaired sulfation reaction, which may affect physiological changes or drug responses. Potential effects of amino acid substitutions on the SULT1A2 protein were assessed by an in silico method, polymorphism phenotyping (PolyPhen: http://genetics.bwh.harvard.edu/pph). PolyPhen algorithm prediction scores indicated that these variants were likely damaging for SULT1A2 G50S (Polyphen score 1.0) and F268L (Polyphen score 1.0), and benign for R37Q (Polyphen score 0.0).
Functional studies using experimental approaches may provide greater clarity regarding functional changes than did in silico analysis. However, bioinformatic prediction analysis would facilitate prioritization of candidate variants according to the likely impact on protein function in vivo. Particularly, the change from phenylalanine, which is an aromatic amino acid with strong hydrophobic nature, to Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
the aliphatic amino acid leucine, could cause structural change in its protein folding and this may cause the altered activity of SULT1A2. Decreased SULT1A2*2 and
SULT1A2*3 activities have been reported.1,16,32 However, the relative contribution of these variants to the protein quantity in liver tissue remains to be determined. The frequencies of SUL1A2*2 and SULT1A2*3 differed according to ethnicity (Table 3).
Briefly, the SULT1A2*2 frequency was higher in Caucasians than in Asians (38% vs.
10%).14,26,33 SULT1A2*3 was not detected in Asians, whereas African–Americans and whites exhibited average frequencies of 10–11%.14
After identification of SNPs in both SULT1A1 and SULT1A2, pairwise LD was calculated using the Haploview software, version 4.1 (supplementary Figure A and
Figure 1A) and seven haplotype-tagging SNPs were determined using the program
Tagger (Figure 1B). These selected tagging SNPs comprehensively represented sequence variations in all exon regions and the 5’-UTR regions of SULT1A1 and
SULT1A2, which are thought to be the main functional regions. Thirty-seven variants with a frequency >5% were included in the Haploview analysis for clear separation of an LD block. After the genotypes of all 37 SNPs were combined, seven haplotype alleles exhibited an allele frequency of >1%. Two LD blocks were found within the genomic DNA region containing SULT1A1 and SULT1A2. The locus containing
SULT1A1 and SULT1A2 could be divided into two blocks between 3917A>G in
SULT1A2 and 257T>C in SULT1A1. The distance between these two LD blocks are approximately 15 kb apart. Since limited inter-block recombination may occur in short-interval LD, recombination between these two blocks might be limited.
Therefore, we analyzed the distribution of haplotype patterns within the entire
SULT1A1 and SULT1A2 locus (Figure 1B). The most frequent haplotype, designated Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
H1, occurred at a rate of 33.6% in the present study. Among them, three haplotypes were inferred to occur at >70%. LD block patterns varied according to ethnicity when those with the same SNPs were analyzed in Caucasians and African–Americans in the HapMap database (data not shown). These results suggest that the haplotype structures of the various ethnic groups differ, resulting in the requirement for different haplotype-tagging SNPs. A set of seven tagging SNPs determined for Korean populations could be useful for future association-mapping studies (e.g., hormone- related diseases, such as breast and prostate cancers). These haplotype-tagging
SNPs would enable tracking of >85% of the haplotype structures in the SULT1A1 and SULT1A2 gene locus in the Korean population. The distribution of haplotypes containing SULT1A1*2 was analyzed carefully. One haplotype was found to have a
SULT1A1*2 allele, which comprised 4% of the total haplotype frequency in the combined analysis. The LD between SULT1A1*2 and SULT1A2*2 had D’ and r2 values of 0.89 and 0.73, respectively, suggesting these two variants to be in positive
LD in Koreans.
In summary, we resequenced the SULT1A1 and SULT1A2 genes and identified 51 variations, including nine that were previously unknown. Allele frequencies, haplotype structures, LD blocks, and haplotype-tagging SNPs were determined. A linkage analysis of common alleles was performed. These results may contribute towards development of personalized therapies and enhance understanding of genetic inheritance of the SULT1A1 and SULT1A2 variants. Since SULT1A1 and
SULT1A2 are closely related, being on the same chromatid, and their substrates overlap, these data will facilitate combined genetic analyses to gain an understanding of inter-individual differences in the sulfation reactions of their Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
substrates. Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
References
1) Ginsberg, G., Guyton, K., Johns, D., Schimek, J., Angle, K. and Sonawane,
B.: Genetic polymorphism in metabolism and host defense enzymes:
implications for human health risk assessment. Crit Rev Toxicol, 40: 575-619
(2010).
2) Harris, R.M., Waring, R.H., Kirk, C.J. and Hughes, P.J.: Sulfation of
"estrogenic" alkylphenols and 17beta-estradiol by human platelet phenol
sulfotransferases. J Biol Chem, 275: 159-166 (2000).
3) Gjerde, J., Hauglid, M., Breilid, H., Lundgren, S., Varhaug, J.E., Kisanga, E.R.,
Mellgren, G., Steen, V.M. and Lien, E.A.: Effects of CYP2D6 and SULT1A1
genotypes including SULT1A1 gene copy number on tamoxifen metabolism.
Ann Oncol, 19: 56-61 (2008).
4) Wilborn, T.W., Lang, N.P., Smith, M., Meleth, S. and Falany, C.N.:
Association of SULT2A1 allelic variants with plasma adrenal androgens and
prostate cancer in African American men. J Steroid Biochem Mol Biol, 99:
209-214 (2006).
5) Lindsay, J., Wang, L.L., Li, Y. and Zhou, S.F.: Structure, function and
polymorphism of human cytosolic sulfotransferases. Curr Drug Metab, 9: 99-
105 (2008).
6) Ozawa, S., Nagata, K., Shimada, M., Ueda, M., Tsuzuki, T., Yamazoe, Y. and
Kato, R.: Primary structures and properties of two related forms of aryl Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
sulfotransferases in human liver. Pharmacogenetics, 5: S135-140 (1995).
7) Zhu, X., Veronese, M.E., Sansom, L.N. and McManus, M.E.: Molecular
characterisation of a human aryl sulfotransferase cDNA. Biochem Biophys
Res Commun, 192: 671-676 (1993).
8) Yasuda, S., Liu, M.Y., Suiko, M., Sakakibara, Y. and Liu, M.C.: Hydroxylated
serotonin and dopamine as substrates and inhibitors for human cytosolic
SULT1A3. J Neurochem, 103: 2679-2689 (2007).
9) Kester, M.H., Kaptein, E., Roest, T.J., van Dijk, C.H., Tibboel, D., Meinl, W.,
Glatt, H., Coughtrie, M.W. and Visser, T.J.: Characterization of human
iodothyronine sulfotransferases. J Clin Endocrinol Metab, 84: 1357-1364
(1999).
10) Hildebrandt, M.A., Salavaggione, O.E., Martin, Y.N., Flynn, H.C., Jalal, S.,
Wieben, E.D. and Weinshilboum, R.M.: Human SULT1A3 pharmacogenetics:
gene duplication and functional genomic studies. Biochem Biophys Res
Commun, 321: 870-878 (2004).
11) Thomas, N.L. and Coughtrie, M.W.: Sulfation of apomorphine by human
sulfotransferases: evidence of a major role for the polymorphic phenol
sulfotransferase, SULT1A1. Xenobiotica, 33: 1139-1148 (2003).
12) Miksits, M., Wlcek, K., Svoboda, M., Thalhammer, T., Ellinger, I., Stefanzl, G.,
Falany, C.N., Szekeres, T. and Jaeger, W.: Expression of sulfotransferases
and sulfatases in human breast cancer: impact on resveratrol metabolism.
Cancer Lett, 289: 237-245 (2010).
13) Peng, C.T., Chen, J.C., Yeh, K.T., Wang, Y.F., Hou, M.F., Lee, T.P., Shih, Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
M.C., Chang, J.Y. and Chang, J.G.: The relationship among the
polymorphisms of SULT1A1, 1A2 and different types of cancers in Taiwanese.
Int J Mol Med, 11: 85-89 (2003).
14) Carlini, E.J., Raftogianis, R.B., Wood, T.C., Jin, F., Zheng, W., Rebbeck, T.R.
and Weinshilboum, R.M.: Sulfation pharmacogenetics: SULT1A1 and
SULT1A2 allele frequencies in Caucasian, Chinese and African-American
subjects. Pharmacogenetics, 11: 57-68 (2001).
15) Ozawa, S., Shimizu, M., Katoh, T., Miyajima, A., Ohno, Y., Matsumoto, Y.,
Fukuoka, M., Tang, Y.M., Lang, N.P. and Kadlubar, F.F.: Sulfating-activity and
stability of cDNA-expressed allozymes of human phenol sulfotransferase,
ST1A3*1 ((213)Arg) and ST1A3*2 ((213)His), both of which exist in Japanese
as well as Caucasians. J Biochem, 126: 271-277 (1999).
16) Engelke, C.E., Meinl, W., Boeing, H. and Glatt, H.: Association between
functional genetic polymorphisms of human sulfotransferases 1A1 and 1A2.
Pharmacogenetics, 10: 163-169 (2000).
17) Arslan, S.: Genetic polymorphisms of sulfotransferases (SULT1A1 and
SULT1A2) in a Turkish population. Biochem Genet, 48: 987-994 (2010).
18) Dandara, C., Li, D.P., Walther, G. and Parker, M.I.: Gene-environment
interaction: the role of SULT1A1 and CYP3A5 polymorphisms as risk
modifiers for squamous cell carcinoma of the oesophagus. Carcinogenesis,
27: 791-797 (2006).
19) Lee, S.J., Jang, Y.J., Cha, E.Y., Kim, H.S., Lee, S.S. and Shin, J.G.: A
haplotype of CYP2C9 associated with warfarin sensitivity in mechanical heart
valve replacement patients. Br J Clin Pharmacol, 70: 213-221 (2010). Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
20) Lee, S.J., Kim, W.Y., Kim, H., Shon, J.H., Lee, S.S. and Shin, J.G.:
Identification of new CYP2C19 variants exhibiting decreased enzyme activity
in the metabolism of S-mephenytoin and omeprazole. Drug Metab Dispos, 37:
2262-2269 (2009).
21) Lee, S.J., Jung, I.S., Jung, E.J., Choi, J.Y., Yeo, C.W., Cho, D.Y., Kim, Y.W.,
Lee, S.S. and Shin, J.G.: Identification of P2Y12 single-nucleotide
polymorphisms and their influences on the variation in ADP-induced platelet
aggregation. Thromb Res, 127: 220-227.
22) Lee, S.J., Kim, W.Y., Choi, J.Y., Lee, S.S. and Shin, J.G.: Identification of
CYP19A1 single-nucleotide polymorphisms and their haplotype distributions
in a Korean population. J Hum Genet, 55: 189-193 (2010).
23) Pang, K.S., Schwab, A.J., Goresky, C.A. and Chiba, M.: Transport, binding,
and metabolism of sulfate conjugates in the liver. Chem Biol Interact, 92: 179-
207 (1994).
24) Coughtrie, M.W., Gilissen, R.A., Shek, B., Strange, R.C., Fryer, A.A., Jones,
P.W. and Bamber, D.E.: Phenol sulphotransferase SULT1A1 polymorphism:
molecular diagnosis and allele frequencies in Caucasian and African
populations. Biochem J, 337: 45-49 (1999).
25) Nowell, S., Ratnasinghe, D.L., Ambrosone, C.B., Williams, S., Teague-Ross,
T., Trimble, L., Runnels, G., Carrol, A., Green, B., Stone, A., Johnson, D.,
Greene, G., Kadlubar, F.F. and Lang, N.P.: Association of SULT1A1
phenotype and genotype with prostate cancer risk in African-Americans and
Caucasians. Cancer Epidemiol Biomarkers Prev, 13: 270-276 (2004).
26) Kim, K.A., Lee, S.Y., Park, P.W., Ha, J.M. and Park, J.Y.: Genetic Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
polymorphisms and linkage disequilibrium of sulfotransferase SULT1A1 and
SULT1A2 in a Korean population: comparison of other ethnic groups. Eur J
Clin Pharmacol, 61: 743-747 (2005).
27) Hildebrandt, M.A., Carrington, D.P., Thomae, B.A., Eckloff, B.W., Schaid, D.J.,
Yee, V.C., Weinshilboum, R.M. and Wieben, E.D.: Genetic diversity and
function in the human cytosolic sulfotransferases. Pharmacogenomics J, 7:
133-143 (2007).
28) Ohtake, E., Kakihara, F., Matsumoto, N., Ozawa, S., Ohno, Y., Hasegawa, S.,
Suzuki, H. and Kubota, T.: Frequency distribution of phenol sulfotransferase
1A1 activity in platelet cells from healthy Japanese subjects. Eur J Pharm Sci,
28: 272-277 (2006).
29) Nowell, S., Ambrosone, C.B., Ozawa, S., MacLeod, S.L., Mrackova, G.,
Williams, S., Plaxco, J., Kadlubar, F.F. and Lang, N.P.: Relationship of phenol
sulfotransferase activity (SULT1A1) genotype to sulfotransferase phenotype
in platelet cytosol. Pharmacogenetics, 10: 789-797 (2000).
30) Raftogianis, R.B., Wood, T.C., Otterness, D.M., Van Loon, J.A. and
Weinshilboum, R.M.: Phenol sulfotransferase pharmacogenetics in humans:
association of common SULT1A1 alleles with TS PST phenotype. Biochem
Biophys Res Commun, 239: 298-304 (1997).
31) Nagar, S., Walther, S. and Blanchard, R.L.: Sulfotransferase (SULT) 1A1
polymorphic variants *1, *2, and *3 are associated with altered enzymatic
activity, cellular phenotype, and protein degradation. Mol Pharmacol, 69:
2084-2092 (2006).
32) Lu, J., Li, H., Zhang, J., Li, M., Liu, M.Y., An, X., Liu, M.C. and Chang, W.: Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Crystal structures of SULT1A2 and SULT1A1 *3: insights into the substrate
inhibition and the role of Tyr149 in SULT1A2. Biochem Biophys Res Commun,
396: 429-434 (2010).
33) Glatt, H., Boeing, H., Engelke, C.E., Ma, L., Kuhlow, A., Pabel, U., Pomplun,
D., Teubner, W. and Meinl, W.: Human cytosolic sulphotransferases: genetics,
characteristics, toxicological aspects. Mutat Res, 482: 27-40 (2001).
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Figure legends
Figure 1. Linkage disequilibrium (LD) map of SULT1A1 and SULT1A2 single nucleotide polymorphisms (SNPs) obtained from normal, healthy subjects (n =
50). A. SULT SNPs and their common occurrences in the LD blocks. Frequency of each haplotype is shown at the edge. The blue square indicates the most common allele, and pink the variant allele. B. Haplotype structures inferred from a combined analysis of SULT1A1 and SULT1A2. Frequency of each haplotype is shown at the edge. Seven haplotype-tag SNPs are marked by asterisks. The locations of
SULT1A1*2 and SULT1A2*2 were underlined.
Supplemental Figure A. Linkage disequilibrium (LD) map of SULT1A1 and
SULT1A2 single nucleotide polymorphisms (SNPs) obtained from normal healthy subjects (n = 50). Variants with a frequency of >5% were included in the LD analysis using |D’| and r2 values. Haploview exhibits LD map of SULT1A1 and
SULT1A2 SNPs along with their locations. Red represents significant linkage between a pair of SNPs. Numbers inside the squares are D’ values ×100.
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Table 1. Summary of SULT1A1 variations identified in a Korean population (n = 50).
Amino acid Subject number (n) Positiona Accession No. Nucleotide change Frequency substitution wt/wt wt/mt mt/mt HWp-value
-1135 G>A rs2077412 ccccacacaG/Acacccacaa 19 20 11 0.42 0.29
-904Tdelb tgtttgttttttT/delccccgggg 49 1 0 0.01 1.0
-624G>C rs376009 1 tgcctaggcctG/Ctgcttttgctgagt 27 20 3 0.26 1.0
-396A>G rs750155 cagcaggaaA/Gtggtgagac 14 19 17 0.53 0.14
-358A>C ggagacagcA/Ccaggaaggtcc 26 21 3 0.27 1.0
-341C>G rs2925634 tcctagagC/Gttcctcagtgc 47 3 0 0.03 1.0
-294T>C rs4149382 acaccctgaT/Catctgggcct 7 27 16 0.59 0.65
-66 T>C gcaagaatT/Cccactttcttgc 47 3 0 0.03 1.0
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
-30G>A rs4149385 taagggaacG/Aggcctggctct 32 14 4 0.22 0.33
57G>A P19P gggggtcccG/Actcatcaa 47 3 0 0.03 1.0
257T>C T51T rs1126446 caggcacT/Cacctgggt 39 11 0 0.11 1.0
266A>G V54V rs1126447 acctgggtA/Gagccaga 38 12 0 0.12 0.95
1940A>G rs9282862 gtggagctA/Gaggggtggt 39 10 1 0.12 1.0
2106G>C agaccacG/Ctgcgatgcttc 36 13 1 0.15 1.0
2109C>T accacgtgC/Tgatgcttc 36 13 1 0.15 1.0
2112T>A rs3020806 acgtgcgaT/Agcttccctc 36 13 1 0.15 1.0
2130T>A rs4149388 ctccatgtgacT/Acctggggg 36 13 1 0.15 1.0
2140A>C cctgggggcA/Cggcacctc 36 13 1 0.15 1.0
2159G>A agggacccG/Accaagg 36 13 1 0.15 1.0
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
2166C>T ccaaggC/Tcacccag 36 13 1 0.15 1.0
2582T>C rs4149393 tgaatcagT/Caatccgagcctc 31 19 0 0.19 0.24
2603G>A cactgagggG/Accctctgct 30 20 0 0.20 0.18
2605C>T tgaggggC/Tcctctgct 48 2 0 0.02 1.0
2625G>C P200P rs3176926 agaacccG/Caaaagggag 31 19 0 0.19 0.24
2663G>A R213H (*2) rs9282861 ttgtggggcG/Actccctgc 48 12 0 0.12 0.95
2670G>A L215L gcgctccctG/Accagaggag 43 7 0 0.07 1.0
2816C>T gctggccagC/Tacgggggt 48 12 0 0.12 0.95
2869T>C cataggcactT/Cggggcctcc 43 17 0 0.17 0.39
3049A>G gggctcctggA/Ggtcactgcag 39 11 0 0.11 1.0
3120C>T ttgagggccC/Tgggacggta 33 17 0 0.17 0.39
The reference sequence used was GenBank accession no. NC_000016. Nucleotide changes are indicated in bold. Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
a Position in relation to the ATG start codon of the SULT1A1 gene; the A in ATG is +1. b New variant allele indentified.
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Table 2. Summary of SULT1A2 variations identified in a Korean population (n=50)
Amino acid Subject number (n)
Positiona Accession No. Nucleotide change Frequency HWp- substitution wt/wt wt/mt mt/mt value
-1090A>G rs762633 ggagggcacA/Gaggccaggt 39 11 0 0.11 1.0
-981T>Gb gcctctgctaT/Gccctgccctctc 49 1 0 0.01 1.0
-979C>T rs743590 gcctctgctatcC/Tctgccctctc 38 12 0 0.12 0.95
-366A>G rs193652 gctggcaggA/Gagacagca 21 21 8 0.37 0.63
-341G>C rs1690403 tcctagagG/Cttcctcag 48 2 0 0.02 1.0
-283C>Tb tgggcccC/Tgcgccacga 49 1 0 0.01 1.0
-281C>T rs4115668 tgggccccgC/Tgccacga 38 12 0 0.12 0.95
-119G>A rs4149403 tgtgagtgcG/Aggcaagtca 44 6 0 0.06 1.0
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
-80C>Tb tgacttccC/Ttgaaagca 49 1 0 0.01 1.0
20T>C I7T (*2) rs1136703 caggacaT/Cctctcgcc 39 11 0 0.11 1.0
24T>C S8S rs16940475 ggacatctcT/Ccgcccgcc 39 11 0 0.11 1.0
110G>Ab R37Q caggcccG/Agcctgatg 49 1 0 0.01 1.0
148G>Ab G50S ccaagtccG/Agtaggtg 49 1 0 0.01 1.0
182T>C rs4149406 tctcccaggT/Cggcagtccc 39 11 0 0.11 1.0
2566T>C rs3743963 gtgtcggcacT/Cccctgcc 27 13 10 0.33 0.01
3424G>Ab agagaagtG/Agaccccttt 49 1 0 0.01 1.0
3542G>Tb E217Stop ctccctgccaG/Taggagact 49 1 0 0.01 1.0
3597A>C N235T (*2) rs1059491 tgaagaagaA/Cccctatgac 37 13 0 0.14 0.82
3819C>Ab F268L accaccttC/Aaccgtggc 49 1 0 0.01 1.0
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
3910T>C gaggggT/Ctcctggagtc 37 13 0 0.14 0.82
3917A>G gttcctggA/Ggtcactgcaga 37 13 0 0.14 0.82
The reference sequence used was GenBank accession NC_000016. Nucleotide change is indicated by bold. a Position is indicated in relation to the start codon ATG of the SULT1A2 gene; the A in ATG is +1. b New variant alleles indentified.
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Table 3. Allele frequencies of SULT1A1 and SULT1A2 in various ethnic populations
Frequency of SULT1A1 Frequency of SULT1A2 Population Subject (n) Reference *2 *3 *2 *3
Asian
Korean 50 0.120 0.000 0.110 0.000 Present study
234 0.124 0.000 0.114 ND Kim et al 26
Japanese 143 0.168 0.000 ND ND Ozawa et al 15
Chinese 290 0.080 0.006 0.076 ND Carlini et al 14
168 0.110 0.000 0.110 ND Glatt et al 31
total 885 0.12 0.03 0.001 0.002 0.103 0.018 0.000
White
Germany 300 0.365 0.000 0.374 ND Engelke et al 16
USA 245 0.332 0.012 0.389 0.104 Carlini et al 14
Turkey 303 0.238 0 0.184 0.125 Arsalan 17 Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
total 848 0.312 0.054 0.004 0.006 0.316 0.093 0.115 0.011
Black
African-American 70 0.294 0.229 0.249 0.114 Carlini et al 14
Nigerians 52 0.269 ND ND ND Coughtrie et al 24
Black South 172 0.369 ND ND ND Dandara et al 18 African
total 294 0.311 0.042 - - -
Frequency results from normal populations of differing ethnicities. ND, not determine
Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Supplemental Table A. Sequences of primers used to perform polymerase chain reaction (PCR) amplifications for DNA sequencing
Products Location Primer sequence Tm (°C) (bp)
Primers for whole SULT1A1
Forward 5’- CTTGTCTGTTGGCTGCCTGGCAG -3’ 66 4799 Reverse 5’- CCACTCTGCCTGGCCCACAATCATA-3’
Primers for 5’-UTR of SULT1A1
Forward 5’- CTTGTCTGTTGGCTGCCTGGCAG -3’ 68 1330 Reverse 5’- CTCTAATGCGGTGGTTCCCCAGC –3’
Primers for exon 2-exon 4 of SULT1A1
Forward 5’- GCTGGGGAACCACCGCATTAGAG –3’ 55 841
Reverse 5’- CAGATCACCTGAGGTTGGGAGTT–3’
Primers for exon 5-exon 6 of SULT1A1
Forward 5’-CCTCAGGTTCCTCCTTTGCCAAT–3’ 51 503
Reverse 5’- TGCCCAGGGAGGGGGCTGGGTG –3’ Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Primers for exon 7-exon 8 of SULT1A1
Forward 5’- GTTGAGGAGTTGGCTCTGCAGGGTC –3’ 48 811
Reverse 5’- CCACTCTGCCTGGCCCACAATCATA –3’
Primers for whole SULT1A2
Forward 5’-TAGAGAAAGCTTGTCTTTTGGAGTTCAGGGGCAGG -3’ 66 6047
Reverse 5’- TGACCCCACTAGGAAGGGAGTCAGCACCCCTACT -3’
Primers for 5’-UTR-exon 4 of SULT1A2
Forward 5’- GGAACCACCACATTAGAGCC –3’ 63 838
Reverse 5’- TGGAACTTCTGGCTTCAAGGGATCT –3’
Primers for exon 5-exon 6 of SULT1A2
Forward 5’- CCTCAGCTTCCTCCTTTGCCAAA –3’ 48 491
Reverse 5’- TGGCTGGGTGGCCTTGGC –3’
Primers for exon 7-exon 8 of SULT1A2
Forward 5’- GCTGGCTCTATGGGTTTTGAAGT –3’ 51 712
Reverse 5’- CTGGAGCGGGGAGGTGGCCGTATT –3’
The reference sequences used for SULT1A1 and SULT1A2 were GenBank accession NC_000016 and NC_000016, respectively.
5’-UTR, 5’-untranslated region. Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE
Fig. 1
SULT1A2 SULT1A1
0.336 0.780 0.264 0.020 A 0.176 0.030 0.090 0.050 0.060 0.020 0.034
0.020
B Drug Metabolism and Pharmacokinetics (DMPK) Advance Publication by J-STAGE