DOCSLIB.ORG

GOLGA2/GM130 Polyclonal Antibody Catalog Number:11308-1-AP 42 Publications

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
GOLGA2/GM130 Polyclonal Antibody Catalog Number:11308-1-AP 42 Publications For Research Use Only GOLGA2/GM130 Polyclonal antibody www.ptglab.com Catalog Number:11308-1-AP 42 Publications Catalog Number: GenBank Accession Number: Purification Method: Basic Information 11308-1-AP BC014188 Antigen affinity purification Size: GeneID (NCBI): Recommended Dilutions: 150ul , Concentration: 500 μg/ml by 2801 WB 1:2000-1:10000 Nanodrop and 333 μg/ml by Bradford Full Name: IHC 1:50-1:200 method using BSA as the standard; golgi autoantigen, golgin subfamily IF 1:50-1:500 Source: a, 2 Rabbit Calculated MW: Isotype: 111 kDa IgG Observed MW: Immunogen Catalog Number: 130 kDa AG1848 Applications Tested Applications: Positive Controls: FC, IF, IHC, WB, ELISA WB : HEK-293 cells, human spleen tissue, HeLa cells, Cited Applications: MCF-7 cells, MDCK cells IF, IHC, WB IHC : human testis tissue, Species Specificity: IF : HepG2 cells, MDCK cells, HEK-293 cells human, Canine Cited Species: Hamster, human Note-IHC: suggested antigen retrieval with TE buffer pH 9.0; (*) Alternatively, antigen retrieval may be performed with citrate buffer pH 6.0 GOLGA2, also known as GM130, is a 130 kDa cis-Golgi matrix protein which is one component of the detergent and Background Information salt resistant Golgi matrix. It is a peripheral membrane protein highly bound to Golgi membrane and localized mainly at the cytoplasmic face of cis-Golgi membrane. Together with its interacting partner proteins, including p115, giantin, GRASP65, and Rab GTPase, GOLGA2/GM130 is involved in the regulation of ER-to-Golgi transport and also in the maintenance of the Golgi structure. Emerging evidence suggest that the GOLGA2/GM130 has potential roles in the control of glycosylation, cell cycle progression, and higher order cell functions such as cell polarization and directed cell migration. (PMID: 20197635) Notable Publications Author Pubmed ID Journal Application Xue Zou 33002418 Mol Ther WB Zhelong Li 33133429 J Extracell Vesicles WB Xixi Zheng 33193874 J Cancer WB Storage: Storage Store at -20°C. Stable for one year after shipment. Storage Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. Aliquoting is unnecessary for -20ºC storage For technical support and original validation data for this product please contact: This product is exclusively available under Proteintech T: 1 (888) 4PTGLAB (1-888-478-4522) (toll free E: [email protected] Group brand and is not available to purchase from any in USA), or 1(312) 455-8498 (outside USA) W: ptglab.com other manufacturer. Selected Validation Data Various lysates were subjected to SDS PAGE Immunofluorescent analysis of (10% Immunohistochemical analysis of paraffin- followed by western blot with 11308-1-AP Formaldehyde) fixed HepG2 cells using 11308-1- embedded human testis using 11308-1-AP (GOLGA2/GM130 antibody) at dilution of 1:5000 AP (GOLGA2/GM130 antibody) at dilution of 1:50 (GOLGA2,GM130 antibody) at dilution of 1:100 incubated at room temperature for 1.5 hours. and Alexa Fluor 488-conjugated AffiniPure Goat (under 40x lens). Anti-Rabbit IgG(H+L). 1X10^6 HEK-293 cells were intracellularly stained with 0.2 ug Anti-Human GOLGA2/GM130 (11308-1- AP) and CoraLite®488-Conjugated AffiniPure Goat Anti-Rabbit IgG(H+L) at dilution 1:1000 (green), or stained with 0.2 ug rabbit IgG isotype control and CoraLite®488-Conjugated AffiniPure Goat Anti- Rabbit IgG(H+L) at dilution 1:1000 (black). Cells were fixed and permeabilized with Transcription Factor Staining Buffer Kit (PF00011)..
Load more

Recommended publications
  • Viewed Previously [4]
    Barlow et al. BMC Biology (2018) 16:27 https://doi.org/10.1186/s12915-018-0492-9 RESEARCHARTICLE Open Access A sophisticated, differentiated Golgi in the ancestor of eukaryotes Lael D. Barlow1, Eva Nývltová2,3, Maria Aguilar1, Jan Tachezy2 and Joel B. Dacks1,4* Abstract Background: The Golgi apparatus is a central meeting point for the endocytic and exocytic systems in eukaryotic cells, and the organelle’s dysfunction results in human disease. Its characteristic morphology of multiple differentiated compartments organized into stacked flattened cisternae is one of the most recognizable features of modern eukaryotic cells, and yet how this is maintained is not well understood. The Golgi is also an ancient aspect of eukaryotes, but the extent and nature of its complexity in the ancestor of eukaryotes is unclear. Various proteins have roles in organizing the Golgi, chief among them being the golgins. Results: We address Golgi evolution by analyzing genome sequences from organisms which have lost stacked cisternae as a feature of their Golgi and those that have not. Using genomics and immunomicroscopy, we first identify Golgi in the anaerobic amoeba Mastigamoeba balamuthi. We then searched 87 genomes spanning eukaryotic diversity for presence of the most prominent proteins implicated in Golgi structure, focusing on golgins. We show some candidates as animal specific and others as ancestral to eukaryotes. Conclusions: None of the proteins examined show a phyletic distribution that correlates with the morphology of stacked cisternae, suggesting the possibility of stacking as an emergent property. Strikingly, however, the combination of golgins conserved among diverse eukaryotes allows for the most detailed reconstruction of the organelle to date, showing a sophisticated Golgi with differentiated compartments and trafficking pathways in the common eukaryotic ancestor.
    [Show full text]
  • Golgi Matrix Proteins Interact with P24 Cargo Receptors and Aid Their Efficient Retention in the Golgi Apparatus
    Published December 10, 2001 JCBReport Golgi matrix proteins interact with p24 cargo receptors and aid their efficient retention in the Golgi apparatus Francis A. Barr, Christian Preisinger, Robert Kopajtich, and Roman Körner Department of Cell Biology, Max-Planck-Institute of Biochemistry, 82152 Martinsried, Germany he Golgi apparatus is a highly complex organelle in vivo. GRASPs interact directly with the cytoplasmic comprised of a stack of cisternal membranes on the domains of specific p24 cargo receptors depending on T secretory pathway from the ER to the cell surface. their oligomeric state, and mutation of the GRASP binding This structure is maintained by an exoskeleton or Golgi site in the cytoplasmic tail of one of these, p24a, results in it matrix constructed from a family of coiled-coil proteins, being transported to the cell surface. These results suggest the golgins, and other peripheral membrane components that one function of the Golgi matrix is to aid efficient such as GRASP55 and GRASP65. Here we find that TMP21, retention or sequestration of p24 cargo receptors and other Downloaded from p24a, and gp25L, members of the p24 cargo receptor family, membrane proteins in the Golgi apparatus. are present in complexes with GRASP55 and GRASP65 Introduction on April 13, 2017 The Golgi apparatus is an organelle on the secretory pathway required to target it to the Golgi (Barr et al., 1998). GM130 required for the processing of complex sugar structures on in turn is a receptor for p115, required for tethering vesicles many proteins and lipids, and for the sorting of these proteins to their target membrane (Barroso et al., 1995; Nakamura et and lipids to their correct subcellular destinations (Farquhar al., 1997).
    [Show full text]
  • Crystal Structures of the Single PDZ Domains from GRASP65 and Their Interaction with the Golgin GM130
    ORIGINAL SCIENTIFIC PAPER Croat. Chem. Acta 2018, 91(2), 255–264 Published online: July 11, 2018 DOI: 10.5562/cca3341 Crystal Structures of the Single PDZ Domains from GRASP65 and their Interaction with the Golgin GM130 Claudia M. Jurk,1 Yvette Roske,1 Udo Heinemann1,2,* 1 Macromolecular Structure and Interaction Laboratory, Max-Delbrück-Center for Molecular Medicine, Robert-Rössle-Straße 10, 13125 Berlin, Germany 2 Institute of Chemistry and Biochemistry, Freie Universität Berlin, Takustraße 6, 14195 Berlin, Germany * Corresponding author’s e-mail address: [email protected] RECEIVED: April 12, 2018 REVISED: June 19, 2018 ACCEPTED: June 19, 2018 THIS PAPER IS DEDICATED TO DR. BISERKA K -P ON THE OCCASION OF HER 80TH BIRTHDAY OJIĆ RODIĆ Abstract: Among the major components of the Golgi apparatus are the GRASP family proteins, including GRASP65 on the cis-Golgi side. With its GRASP domain, GRASP65 is involved in Golgi stacking and ribbon formation. Interaction of GRASP65 with the Golgi marker protein GM130 is important for the docking of vesicles to the Golgi membrane. We present here structures of the two individual PDZ domains comprising the GRASP domain in human GRASP65. We use isothermal titration calorimetry to probe the interaction between GRASP65 and GM130. Additionally, we present evidence for the limited sequence conservation of the PDZ fold by describing the PDZ domain structure of the GRASP65 homolog Grh1 from Saccharomyces cerevisiae. Keywords: PDZ domain structure, Golgi stacking, GRASP family, Golgins, Golgi apparatus,
    [Show full text]
  • Attenuation of Cgas/STING Activity During Mitosis
    Attenuation of cGAS/STING activity during mitosis Item Type Article Authors Uhlorn, Brittany L; Gamez, Eduardo R; Li, Shuaizhi; Campos, Samuel K Citation Uhlorn, B. L., Gamez, E. R., Li, S., & Campos, S. K. (2020). Attenuation of cGAS/STING activity during mitosis. Life Science Alliance, 3(9). DOI 10.26508/lsa.201900636 Publisher LIFE SCIENCE ALLIANCE LLC Journal LIFE SCIENCE ALLIANCE Rights © 2020 Uhlorn et al. This article is available under a Creative Commons License (Attribution 4.0 International, as described at https://creativecommons.org/licenses/by/4.0/). Download date 23/09/2021 20:58:17 Item License https://creativecommons.org/licenses/by/4.0/ Version Final published version Link to Item http://hdl.handle.net/10150/650682 Published Online: 13 July, 2020 | Supp Info: http://doi.org/10.26508/lsa.201900636 Downloaded from life-science-alliance.org on 8 January, 2021 Research Article Attenuation of cGAS/STING activity during mitosis Brittany L Uhlorn1, Eduardo R Gamez2, Shuaizhi Li3, Samuel K Campos1,3,4,5 The innate immune system recognizes cytosolic DNA associated of STING to the Golgi is regulated by several host factors, including with microbial infections and cellular stress via the cGAS/STING iRHOM2-recruited TRAPβ (18), TMED2 (19), STIM1 (20), TMEM203 (21), pathway, leading to activation of phospho-IRF3 and downstream and ATG9A (22). STING activation at the Golgi requires palmitoylation IFN-I and senescence responses. To prevent hyperactivation, cGAS/ (23) and ubiquitylation (24, 25), allowing for assembly of oligomeric STING is presumed to be nonresponsive to chromosomal self-DNA STING and recruitment of TBK1 and IRF3 (26, 27, 28).
    [Show full text]
  • Loss of the Golgin GM130 Causes Golgi Disruption, Purkinje Neuron Loss, and Ataxia in Mice
    Loss of the golgin GM130 causes Golgi disruption, Purkinje neuron loss, and ataxia in mice Chunyi Liua,b,1, Mei Meia,1, Qiuling Lia,1, Peristera Robotic, Qianqian Panga,b, Zhengzhou Yinga,b, Fei Gaod, Martin Lowec,2, and Shilai Baoa,b,2 aState Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China; bSchool of Life Sciences, University of Chinese Academy of Sciences, Beijing 100049, China; cFaculty of Biology, Medicine and Health, University of Manchester, Manchester M13 9PT, United Kingdom; and dState Key Laboratory of Stem Cell and Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China Edited by Jennifer Lippincott-Schwartz, Howard Hughes Medical Institute, Ashburn, VA, and approved November 28, 2016 (received for review May 27, 2016) The Golgi apparatus lies at the heart of the secretory pathway remains unclear (20). Several studies have shown that polarized where it is required for secretory trafficking and cargo modifica- membrane delivery via the Golgi apparatus is important for tion. Disruption of Golgi architecture and function has been widely neuronal morphogenesis during brain development (8–10, 21), but observed in neurodegenerative disease, but whether Golgi dys- whether impairment of this process can cause neuronal death with function is causal with regard to the neurodegenerative process, consequent neurological impairment in vivo is currently unknown. or is simply a manifestation of neuronal death, remains unclear. Members of the golgin family of coiled-coil proteins are re- Here we report that targeted loss of the golgin GM130 leads to quired for maintenance of Golgi organization and are important a profound neurological phenotype in mice.
    [Show full text]
  • GRASP55, a Second Mammalian GRASP Protein Involved in the Stacking of Golgi Cisternae in a Cell-Free System
    The EMBO Journal Vol.18 No.18 pp.4949–4960, 1999 GRASP55, a second mammalian GRASP protein involved in the stacking of Golgi cisternae in a cell-free system James Shorter, Rose Watson, give rise to cisternae, and in the subsequent stacking of Maria-Eleni Giannakou1, Mairi Clarke1, these cisternae to form stacks. These studies have used Graham Warren2 and Francis A.Barr1,3 in vitro assays in which the Golgi apparatus can be disassembled and reassembled under defined conditions, Cell Biology Laboratory, Imperial Cancer Research Fund, 44 Lincoln’s thus allowing the identification of components important 1 Inn Fields, London WC2A 3PX and IBLS, Division of Biochemistry for different aspects of Golgi structure (Acharya et al., and Molecular Biology, Davidson Building, University of Glasgow, Glasgow G12 8QQ, Scotland, UK 1995; Rabouille et al., 1995a). One cell-free system 2 (Rabouille et al., 1995a) has exploited the disassembly of Present address: Department of Cell Biology, SHM, C441, the Golgi apparatus into many small vesicles and mem- Yale University School of Medicine, 33 Cedar Street, PO Box 208002, New Haven, CT 06520-8002, USA brane fragments during cell division (Lucocq et al., 1987, 1989). In this system, isolated Golgi membranes are 3Corresponding author e-mail: [email protected] treated with mitotic cell cytosol to generate a population of mitotic Golgi fragments (MGFs) that can reassemble We have identified a 55 kDa protein, named GRASP55 into stacked Golgi membranes when incubated under (Golgi reassembly stacking protein of 55 kDa), as a the correct conditions. The N-ethylmaleimide (NEM)- component of the Golgi stacking machinery.
    [Show full text]
  • FUNCTIONAL CHARACTERIZATION of P24δ SUBFAMILY PROTEINS in A. Thaliana”
    UNIVERSITAT DE VALÈNCIA Departamento de Bioquímica y Biología Molecular Programa de doctorado en Biotecnología “FUNCTIONAL CHARACTERIZATION OF p24δ SUBFAMILY PROTEINS IN A. thaliana” Tesis doctoral con Mención Internacional presentada por Noelia Pastor Cantizano Tesis dirigida por: Dr. Fernando Aniento Company Dra. María Jesús Marcote Zaragoza Valencia, Octubre 2016 FERNANDO ANIENTO COMPANY, Catedrático del departamento de Bioquímica y Biología Molecular de la Universidad de Valencia y MARIA JESÚS MARCOTE ZARAGOZA, Profesora titular del departamento de Bioquímica y Biología Molecular de la Universidad de Valencia, CERTIFICAN: Que la presente memoria titulada: “FUNCTIONAL CHARACTERIZATION OF p24δ SUBFAMILY PROTEINS IN A. thaliana” ha sido realizada por la Licenciada en Farmacia Noelia Pastor Cantizano bajo nuestra dirección, y que, habiendo revisado el trabajo, autorizamos su presentación para que sea calificada como tesis doctoral y obtener así el TITULO DE DOCTOR CON MENCIÓN INTERNACIONAL. Y para que conste a los efectos oportunos, se expide la presente certificación en Burjassot, a 19 de octubre de 2016. Fdo: Fernando Aniento Company Fdo: María Jesús Marcote Zaragoza Esta Tesis Doctoral se ha realizado con la financiación de los siguientes proyectos: 1. “Tráfico intracelular de proteínas en células vegetales”. Plan Nacional de I + D. Programa de Biología Fundamental (BFU2009-07039). I.P.: Dr. Fernando Aniento Company. 2. “Tráfico intracelular de proteínas en células vegetales”. Plan Nacional de I + D. Programa de Biología Fundamental
    [Show full text]
  • Characterization of Two G-Protein Coupled Receptors and One Fox Transcription Factor in Drosophila Embryonic Development by Cait
    Characterization of Two G-Protein Coupled Receptors and One Fox Transcription Factor in Drosophila Embryonic Development By Caitlin D. Hanlon A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July 2015 ABSTRACT Cell migration is an exquisitely intricate process common to many higher organisms. Variations in the signals driving cell movement, the distance cells travel, and whether cells migrate as individuals, clusters, or as intact epithelia are all possible. Cell migration can be beneficial, as in development or wound healing, or detrimental, as in cancer metastasis. To begin to unravel the complexities inherent to cell migration, the Andrew lab uses the Drosophila salivary gland as a relatively simple model system for learning the molecular/cellular events underlying cell movement. The salivary gland begins as a placode of polarized columnar epithelial cells on the surface of the embryo that invaginates and move dorsally until a turning point is reached. There, it reorients and begins posterior migration, which continues until the gland reaches its final position along the anterior-posterior axis of the embryo. The broad goal of my work is to identify and characterize other key players in salivary gland migration. I characterized two G-protein coupled receptors (GPCRs) – Tre1 and mthl5 – which are expressed dynamically in the embryo. By creating a null allele of Tre1, I found that Tre1 plays a key role in germ cell migration and affects microtubule organization in the migrating salivary gland. I created a mthl5 mutant allele using the CRISPR/Cas9 system. mthl5 plays a role in the cell shape changes that drive salivary gland invagination.
    [Show full text]
  • The Trans-Membrane Protein P25 Forms Highly Specialized Domains That Regulate Membrane Composition and Dynamics
    Research Article 4821 The trans-membrane protein p25 forms highly specialized domains that regulate membrane composition and dynamics Gregory Emery1,*, Robert G. Parton2, Manuel Rojo1,‡ and Jean Gruenberg1,§ 1Department of Biochemistry, University of Geneva, 30 quai Ernest Ansermet, CH-1211 Geneva 4, Switzerland 2Institute for Molecular Bioscience, Centre for Microscopy & Microanalysis, and School of Biomedical Sciences, University of Queensland, 4072 Brisbane, Australia *Present address: Research Institute of Molecular Pathology (IMP), Dr Bohr-Gasse 7, A-1030 Wien, Austria ‡Present address: INSERM U523, Institut de Myologie, Groupe Hospitalier Pitié-Salpêtrière, 47 boulevard de l’Hôpital, 75651 Paris Cedex 13, France §Author for correspondence (e-mail: [email protected]) Accepted 25 July 2003 Journal of Cell Science 116, 4821-4832 © 2003 The Company of Biologists Ltd doi:10.1242/jcs.00802 Summary Trans-membrane proteins of the p24 family are abundant, confined to well-defined membrane regions visible by oligomeric proteins predominantly found in cis-Golgi electron microscopy. We find that this p25SS accumulation membranes. They are not easily studied in vivo and their causes a concomitant accumulation of cholesterol in late functions are controversial. We found that p25 can be endosomes, and an inhibition of their motility – two targeted to the plasma membrane after inactivation of its processes that are functionally linked. Yet, the p25SS-rich canonical KKXX motif (KK to SS, p25SS), and that p25SS regions themselves seem to exclude not only Lamp1 but also causes the co-transport of other p24 proteins beyond the accumulated cholesterol. One may envision that p25SS Golgi complex, indicating that wild-type p25 plays a crucial accumulation, by excluding cholesterol from oligomers, role in retaining p24 proteins in cis-Golgi membranes.
    [Show full text]
  • Shaping Membranes with Disordered Proteins T ∗ Mohammad A.A
    Archives of Biochemistry and Biophysics 677 (2019) 108163 Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Shaping membranes with disordered proteins T ∗ Mohammad A.A. Fakhree, Christian Blum, Mireille M.A.E. Claessens Nanobiophysics Group, University of Twente, 7522, NB, Enschede, the Netherlands ARTICLE INFO ABSTRACT Keywords: Membrane proteins control and shape membrane trafficking processes. The role of protein structure in shaping Disordered proteins cellular membranes is well established. However, a significant fraction of membrane proteins is disordered or Membranes contains long disordered regions. It becomes more and more clear that these disordered regions contribute to the Membrane curvature function of membrane proteins. While the fold of a structured protein is essential for its function, being dis- Membrane tethering ordered seems to be a crucial feature of membrane bound intrinsically disordered proteins and protein regions. Membrane domains Here we outline the motifs that encode function in disordered proteins and discuss how these functional motifs enable disordered proteins to modulate membrane properties. These changes in membrane properties facilitate and regulate membrane trafficking processes which are highly abundant in eukaryotes. 1. Biological membranes membrane can also be thought of as a matrix and two-dimensional anisotropic solvent for membrane proteins. Membrane proteins are In dilute solutions interactions between molecules are unlikely, yet present in or on the membrane to fulfil their function as enzymes, such interactions are essential to life. To make life possible, specific transporters, electron carriers, messenger/ligands, lipid clamps/mem- molecules have to be accumulated and contained in well-defined but brane anchors, and are involved in membrane remodeling processes responsive and dynamic compartments.
    [Show full text]
  • Intrinsic Disorder at Genomic Scale: Genome-Wide Analysis of Intrinsic Disorder and Its Implication in Specific Protein Functional Classes in Arabidopsis Thaliana
    ! ABSTRACT Protein functional features extracted from primary sequences: a focus on disordered regions. by Natalia Pietrosemoli In! this! thesis! we! implement! an! ensemble! of! sequence! analysis! strategies! aimed!at!identifying!functional!and!structural!protein!features.!The!first!part!of!this! work! was! dedicated! to! two! case! studies! of! specific! proteins! analyzed! to! provide! candidate! functional! positions! for! experimental! validation:! the! protein! alphaP synuclein!(αsyn)!and!the!alanine!racemases!protein!family.!In!the!case!of!αsyn,!the! objective! was! to! predict! its! aggregation! prone! regions.! For! the! alanine! racemase! protein!family,!the!scope!was!to!predict!sites!responsible!for!substrate!specificity.!In! these! two! studies,! computational! predictions! allowed! systematically! exploring! potentially!functionally!relevant!protein!sites!in!an!efficient!manner!that!may!not!be! possible! to! implement! with! traditional! experimental! approaches.! ! Our! strategy! provided!a!powerful!forecasting!tool!for!the!selection!of!candidate!sites!to!be!later! verified!experimentally.! In! the! second! part,! we! analyze! the! role! of! intrinsic! disorder! (ID)! as! a! modulator!of!protein!function!in!different!organisms!and!cellular!processes,!which! is! largely! unexplored.! As! key! components! of! the! diverse! cellular! pathways,! disordered! proteins! are! often! involved! in! many! diseases,! including! cancer! and! ( III!( ! neurodegenerative!diseases.!Thus,!there!is!an!impeding!need!to!unveil!the!general!
    [Show full text]
  • GRASP65 (GORASP1) (NM 031899) Human Tagged ORF Clone – RG210076 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG210076 GRASP65 (GORASP1) (NM_031899) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GRASP65 (GORASP1) (NM_031899) Human Tagged ORF Clone Tag: TurboGFP Symbol: GORASP1 Synonyms: GOLPH5; GRASP65; P65 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG210076 representing NM_031899 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCCTGGGCGTCAGCGCTGAGCAGCCCGCAGGCGGCGCCGAGGGCTTCCACCTCCACGGGGTGCAGG AGAACTCCCCAGCCCAGCAGGCGGGCCTGGAGCCCTACTTTGACTTCATCATCACCATTGGGCACTCGAG GCTGAACAAGGAGAATGACACCCTGAAGGCACTACTGAAAGCCAATGTGGAGAAGCCCGTGAAGCTGGAG GTGTTCAATATGAAGACCATGAGGGTGCGCGAGGTGGAGGTGGTGCCCAGCAACATGTGGGGCGGCCAGG GCCTACTGGGTGCCAGTGTGCGCTTCTGCAGCTTCCGCAGGGCCAGTGAGCAGGTGTGGCATGTGCTGGA TGTGGAACCATCTTCACCTGCTGCCCTTGCCGGCCTGCGCCCCTACACAGACTATGTGGTTGGTTCGGAC CAGATTCTCCAGGAGTCCGAGGACTTCTTTACGCTCATCGAGTCTCATGAGGGGAAGCCCTTGAAGCTGA TGGTGTATAACTCCAAGTCAGACTCCTGCCGGGAGGTGACTGTAACTCCCAACGCAGCCTGGGGTGGAGA GGGCAGTCTGGGATGTGGCATTGGCTATGGGTATCTACACCGGATCCCAACTCAGCCCCCCAGCTACCAC AAGAAGCCACCTGGCACCCCACCACCTTCTGCTCTACCACTTGGTGCCCCACCACCTGATGCTCTACCAC CTGGACCCACCCCCGAGGACTCTCCTTCCCTGGAGACAGGTTCCAGGCAGAGTGACTACATGGAGGCCCT GCTGCAGGCACCTGGCTCCTCCATGGAGGATCCCCTTCCTGGGCCTGGGAGTCCCAGCCACAGTGCTCCA
    [Show full text]