Studies on Morphology and Molecular Characterization of Oriental Cat Flea

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Journal of Entomology and Zoology Studies 2017; 5(4): 301-305 E-ISSN: 2320-7078 P-ISSN: 2349-6800 JEZS 2017; 5(4): 301-305 Studies on morphology and molecular © 2017 JEZS characterization of oriental cat flea infesting Received: 07-05-2017 Accepted: 08-06-2017 small ruminants by barcoding Ashwini MS MVSc Scholar, Department of Veterinary Parasitology, Ashwini MS, Puttalakshmamma GC, Mamatha GS, Rakshith Ojha, Veterinary College Bengaluru, Chandranaik BM, Thimmareddy PM, Placid E D’souza, Jalali SK and India Venkatshan T Puttalakshmamma GC Associate Professor, Department Abstract of Veterinary Parasitology, The study was carried out to identify the flea species infesting small ruminants in Karnataka state, India. Veterinary College Bengaluru, The morphological differentiation of species of genus Ctenocephalides was often confused due to loss of India specific characters. Therefore, DNA barcoding of COX1 mitochondrial gene was carried and PCR product yielded a specific amplicon at 700 bp. The COX1 sequences of Ctenocephalides orientis from Mamatha GS sheep were showing 99-100% homology to C. orientis from goats whereas, C. felis felis from dogs Assistant Professor, Department of Veterinary Parasitology, showed 99% homology to C. felis felis from cat. The accession number of KX467332 and KX467333 for Veterinary College Bengaluru, C. orientis from Sheep and goats, KX467334 and KX467335 for C. felis felis from dog and cats India respectively was allotted by NCBI. In the phylogenetic analysis, C. orientis formed a separate cluster to the subspecies of C. felis and clustered as sister species with C. canis. Thus, supporting C. orientis as Rakshith Ojha separate species as previously suggested by morphological and molecular approaches. Senior Research Fellow, NBAIR, Hebbal, Bengaluru, India, India Keywords: Small ruminants, C. orientis, COX1 gene, Barcoding Chandranaik BM Introduction Scientists, IAH &VB Small ruminants are the major source of income to the farmers through milk, meat, wool and Hebbal, Bengaluru hide production which has positive impact on their socio-economic life. Presently, India has Karnataka, India, 65.07 million sheep (Ovis aries) and 135.17 million goat (Capra hircus) population out of Thimmareddy PM which Karnataka contributes 9.58 and 5.27 million of sheep and goat population respectively. Professor, Department of Fleas of the genus Ctenocephalides are the important group of ectoparasites infesting small Veterinary Parasitology, ruminants in tropical and subtropical countries like India causing dermatitis, severe anaemia Veterinary College Bengaluru, and deaths especially in young animals. Fleas are important since they act as a vector of India zoonotic pathogens such as Rickettsia felis and Bartonella species [1]. However, small [2] Placid E D’souza ruminants like sheep and goats do not have their own species of flea . The cat flea, Professor cum Director Ctenocephalides felis has a wide host range including small ruminants, distributed worldwide CAFT Bengaluru and formerly consisted of four sub species viz., Ctenocephalides felis felis, Ctenocephalides Karnataka, India felis orientis, Ctenocephalides felis strongylus and Ctenocephalides felis damarensis[3]. But, Jalali SK morphological revision of the phallosome (male reproductive organ) proposed for the [4, 5] Principal Scientist, NBAIR, elevation of C. orientis and C. damarensis to full species level . However, the Hebbal, Bengaluru, India morphological differentiation of species of genus Ctenocephalides is often confused due to loss of specific characters like legs, head and minute morphological differences like head Venkatshan T shape, chaetotaxy and manubrium of clasper. Therefore, molecular characterization is a boon Principal Scientist NBAIR, Hebbal, Bengaluru, for exact identification and classification of fleas of the genus Ctenocephalides. DNA India barcoding using COX1 mitochondrial gene as a universal marker is the most reliable method as COX1 mitochondrial gene are in abundance (1000 identical copies per cell), is highly conserved functional domains and variable region [6]. Hence, a barcode of fleas infesting small ruminants, dogs and cats of Karnataka was undertaken. Correspondence Materials and Methods Ashwini MS Study area, sample and identification MVSc Scholar, Department of The study was carried out during January 2015 to June 2016 in private farms, household pens Veterinary Parasitology, 0 0 Veterinary College Ben22galuru, and nomadic flocks of sheep and goats in Karnataka state located between 11.30 and 18.30 0 0 India north latitude and 74 and 78.30 east longitude in India. Fleas were collected from both sheep ~ 301 ~ Journal of Entomology and Zoology Studies and goats and also from dog and cats closely associated with ruminants whereas cat flea, C. felis felis was found on dogs these flocks. Initially, animals were restrained and examined and cats associated with infested small ruminants farms. C. in detail. Later fleas were collected from randomly selected orientis (C. felis orientis) was previously reported on Goats infested animals in a flock using fine toothed metal comb and from Karnataka [13] supporting that C. orientis is the dominant placed in a plastic vial containing absolute ethanol. The flea species found in India. Previously, four subspecies viz., collected fleas were brought to the laboratory and identified Ctenocephalides felis felis, Ctenocephalides felis orientis, based on the standard keys [7]. Ctenocephalides felis strongylus and Ctenocephalides felis damarensis were classified under the species C. felis [14, 15]. DNA extraction, PCR amplification and Sequencing However, C. orientis and C. damarensis as a separate species The genomic DNA of adult Ctenocephalides was extracted based on the revision of the morphological characters of the using Qiagen DNeasy Blood and Tissue Kit (Germany) as per male reproductive organ [4]. The presence of both genal and the manufactures protocol. The COX1 mitochondrial gene of pronotal combs confirmed the identity of the genus Ctenocephalides species viz., C. orientis and C. felis felis Ctenocephalides. In C. orientis flea, the anterior most genal were targeted and subjected for PCR by using Phire animal spine was shorter than subsequent spine. The genal ctenidium direct Kit using the universal primers: forward 5’- consisted of seven to eight pairs of spines and the pronotal GGTCAACAAATCATAAAGATA TTGG-3 and reverse 5’- ctenidium has got totally 15 to16 spines. The length of head TAAACTTCAGGGTGACCAAAAAATCA-3’[8]. Reaction was twice as long as height and the frons were elongate and for the COX1F/COX1R primers were performed in a total broadly rounded at anterior end (Fig. 1). Metepisternum or volume of 50µl consisting 2X PCR buffer 25 µl, 0.5µl lateral metanotal area (LMA) had two bristles. Females had a COX1F (20ppm), 0.5 µl COX1R(20ppm), DNA polymerase row of one to 12 short spiniform bristles behind the antennal 1µl, flea DNA, NFW to make final volume 50µl under the groove (Fig. 2). Dorsal margin of hind tibia had seven notches following cycling conditions: an initial denaturation stage at with stout and single bristles on third and sixth notches. 980 C for 5min, then 40 cycles of denaturation at 980 C for 5 Chaetotaxy formula of metatibial bristles was 2-2-1-2-2-1-3 sec, annealing at 450 C for 10 sec and 720 C for 30 sec (Fig. 3). In males, the manubrium of the clasper was widened followed by a final extension phase at 720 C for 1 min[9]. Once at the apex (Fig. 4). the PCR reaction were carried out, 1µl of DNA release buffer and gel loading dye were subjected for electrophoresis in 1.5% agarose gel and the images were captured using gel documentation system. The amplified products were sent for DNA sequencing to M/s Chromous Bengaluru, India. The sequences obtained were subjected to Basic Local alignment search tool (BLAST) analysis at NCBI-BLAST. The sequences were edited and submitted to National Centre for Biotechnology Information (NCBI) GeneBank. The BoldSystem V3 was used to generate barcode for the two species of Ctenocephalides. The DNA sequences of the both C. orientis and C. felis felis from the study and other DNA sequences of Ctenocephalides species uploaded from GenBank database were assembled and subjected to MEGA 5.0 software for Phylogenetic tree construction. The tree obtained by applying Neighbor-joining (NJ) method with 1000 bootstrap support. The evolutionary history was inferred [10] using the Neighbor-joining method . The optimal tree with Fig 1: C. orientis: a. Elongate and broadly rounded head; b. LMA the sum of branch length = 0.50258811 is shown. The with two bristles and c. 1st comb is shorter than 2nd comb percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches [11]. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Kimura 2- parameter method [12] and are in the units of the number of base substitutions per site. The rate variation among sites was modelled with a gamma distribution (shape parameter = 1). The analysis involved 9 nucleotide sequences. Codon positions included were 1st+2nd+3rd. All positions containing gaps and missing data were eliminated. There were a total of 601 positions in the final dataset. Results and Discussion Morphological identification In the present study, two species of fleas in the genus
Recommended publications
  • Fleas, Hosts and Habitat: What Can We Predict About the Spread of Vector-Borne Zoonotic Diseases?

    Fleas, Hosts and Habitat: What Can We Predict About the Spread of Vector-Borne Zoonotic Diseases?

    2010 Fleas, Hosts and Habitat: What can we predict about the spread of vector-borne zoonotic diseases? Ph.D. Dissertation Megan M. Friggens School of Forestry I I I \, l " FLEAS, HOSTS AND HABITAT: WHAT CAN WE PREDICT ABOUT THE SPREAD OF VECTOR-BORNE ZOONOTIC DISEASES? by Megan M. Friggens A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Forest Science Northern Arizona University May 2010 ?Jii@~-~-u-_- Robert R. Parmenter, Ph. D. ~",l(*~ l.~ Paulette L. Ford, Ph. D. --=z:r-J'l1jU~ David M. Wagner, Ph. D. ABSTRACT FLEAS, HOSTS AND HABITAT: WHAT CAN WE PREDICT ABOUT THE SPREAD OF VECTOR-BORNE ZOONOTIC DISEASES? MEGAN M. FRIGGENS Vector-borne diseases of humans and wildlife are experiencing resurgence across the globe. I examine the dynamics of flea borne diseases through a comparative analysis of flea literature and analyses of field data collected from three sites in New Mexico: The Sevilleta National Wildlife Refuge, the Sandia Mountains and the Valles Caldera National Preserve (VCNP). My objectives were to use these analyses to better predict and manage for the spread of diseases such as plague (Yersinia pestis). To assess the impact of anthropogenic disturbance on flea communities, I compiled and analyzed data from 63 published empirical studies. Anthropogenic disturbance is associated with conditions conducive to increased transmission of flea-borne diseases. Most measures of flea infestation increased with increasing disturbance or peaked at intermediate levels of disturbance. Future trends of habitat and climate change will probably favor the spread of flea-borne disease.
  • Fleas and Flea-Borne Diseases

    Fleas and Flea-Borne Diseases

    International Journal of Infectious Diseases 14 (2010) e667–e676 Contents lists available at ScienceDirect International Journal of Infectious Diseases journal homepage: www.elsevier.com/locate/ijid Review Fleas and flea-borne diseases Idir Bitam a, Katharina Dittmar b, Philippe Parola a, Michael F. Whiting c, Didier Raoult a,* a Unite´ de Recherche en Maladies Infectieuses Tropicales Emergentes, CNRS-IRD UMR 6236, Faculte´ de Me´decine, Universite´ de la Me´diterrane´e, 27 Bd Jean Moulin, 13385 Marseille Cedex 5, France b Department of Biological Sciences, SUNY at Buffalo, Buffalo, NY, USA c Department of Biology, Brigham Young University, Provo, Utah, USA ARTICLE INFO SUMMARY Article history: Flea-borne infections are emerging or re-emerging throughout the world, and their incidence is on the Received 3 February 2009 rise. Furthermore, their distribution and that of their vectors is shifting and expanding. This publication Received in revised form 2 June 2009 reviews general flea biology and the distribution of the flea-borne diseases of public health importance Accepted 4 November 2009 throughout the world, their principal flea vectors, and the extent of their public health burden. Such an Corresponding Editor: William Cameron, overall review is necessary to understand the importance of this group of infections and the resources Ottawa, Canada that must be allocated to their control by public health authorities to ensure their timely diagnosis and treatment. Keywords: ß 2010 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved. Flea Siphonaptera Plague Yersinia pestis Rickettsia Bartonella Introduction to 16 families and 238 genera have been described, but only a minority is synanthropic, that is they live in close association with The past decades have seen a dramatic change in the geographic humans (Table 1).4,5 and host ranges of many vector-borne pathogens, and their diseases.
  • Arthropod Parasites in Domestic Animals

    Arthropod Parasites in Domestic Animals

    ARTHROPOD PARASITES IN DOMESTIC ANIMALS Abbreviations KINGDOM PHYLUM CLASS ORDER CODE Metazoa Arthropoda Insecta Siphonaptera INS:Sip Mallophaga INS:Mal Anoplura INS:Ano Diptera INS:Dip Arachnida Ixodida ARA:Ixo Mesostigmata ARA:Mes Prostigmata ARA:Pro Astigmata ARA:Ast Crustacea Pentastomata CRU:Pen References Ashford, R.W. & Crewe, W. 2003. The parasites of Homo sapiens: an annotated checklist of the protozoa, helminths and arthropods for which we are home. Taylor & Francis. Taylor, M.A., Coop, R.L. & Wall, R.L. 2007. Veterinary Parasitology. 3rd edition, Blackwell Pub. HOST-PARASITE CHECKLIST Class: MAMMALIA [mammals] Subclass: EUTHERIA [placental mammals] Order: PRIMATES [prosimians and simians] Suborder: SIMIAE [monkeys, apes, man] Family: HOMINIDAE [man] Homo sapiens Linnaeus, 1758 [man] ARA:Ast Sarcoptes bovis, ectoparasite (‘milker’s itch’)(mange mite) ARA:Ast Sarcoptes equi, ectoparasite (‘cavalryman’s itch’)(mange mite) ARA:Ast Sarcoptes scabiei, skin (mange mite) ARA:Ixo Ixodes cornuatus, ectoparasite (scrub tick) ARA:Ixo Ixodes holocyclus, ectoparasite (scrub tick, paralysis tick) ARA:Ixo Ornithodoros gurneyi, ectoparasite (kangaroo tick) ARA:Pro Cheyletiella blakei, ectoparasite (mite) ARA:Pro Cheyletiella parasitivorax, ectoparasite (rabbit fur mite) ARA:Pro Demodex brevis, sebacceous glands (mange mite) ARA:Pro Demodex folliculorum, hair follicles (mange mite) ARA:Pro Trombicula sarcina, ectoparasite (black soil itch mite) INS:Ano Pediculus capitis, ectoparasite (head louse) INS:Ano Pediculus humanus, ectoparasite (body
  • Ctenocephalides Felis Infesting Outdoor Dogs in Spain Rosa Gálvez1, Vicenzo Musella2, Miguel A

    Ctenocephalides Felis Infesting Outdoor Dogs in Spain Rosa Gálvez1, Vicenzo Musella2, Miguel A

    Gálvez et al. Parasites & Vectors (2017) 10:428 DOI 10.1186/s13071-017-2357-4 RESEARCH Open Access Modelling the current distribution and predicted spread of the flea species Ctenocephalides felis infesting outdoor dogs in Spain Rosa Gálvez1, Vicenzo Musella2, Miguel A. Descalzo3, Ana Montoya1, Rocío Checa1, Valentina Marino1, Oihane Martín1, Giuseppe Cringoli4, Laura Rinaldi4 and Guadalupe Miró1* Abstract Background: The cat flea, Ctenocephalides felis, is the most prevalent flea species detected on dogs and cats in Europe and other world regions. The status of flea infestation today is an evident public health concern because of their cosmopolitan distribution and the flea-borne diseases transmission. This study determines the spatial distribution of the cat flea C. felis infesting dogs in Spain. Using geospatial tools, models were constructed based on entomological data collected from dogs during the period 2013–2015. Bioclimatic zones, covering broad climate and vegetation ranges, were surveyed in relation to their size. Results: The models builded were obtained by negative binomial regression of several environmental variables to show impacts on C. felis infestation prevalence: land cover, bioclimatic zone, mean summer and autumn temperature, mean summer rainfall, distance to urban settlement and normalized difference vegetation index. In the face of climate change, we also simulated the future distributions of C. felis for the global climate model (GCM) “GFDL-CM3” and for the representative concentration pathway RCP45, which predicts their spread in the country. Conclusions: Predictive models for current climate conditions indicated the widespread distribution of C. felis throughout Spain, mainly across the central northernmost zone of the mainland. Under predicted conditions of climate change, the risk of spread was slightly greater, especially in the north and central peninsula, than for the current situation.
  • The Biology and Ecology of Cat Fleas and Advancements in Their Pest Management: a Review

    The Biology and Ecology of Cat Fleas and Advancements in Their Pest Management: a Review

    insects Review The Biology and Ecology of Cat Fleas and Advancements in Their Pest Management: A Review Michael K. Rust ID Department of Entomology, University of California Riverside, Riverside, CA 92521, USA; [email protected]; Tel.: +1-951-827-5327 Academic Editors: Changlu Wang and Chow-Yang Lee Received: 7 August 2017; Accepted: 18 October 2017; Published: 27 October 2017 Abstract: The cat flea Ctenocephalides felis felis (Bouché) is the most important ectoparasite of domestic cats and dogs worldwide. It has been two decades since the last comprehensive review concerning the biology and ecology of C. f. felis and its management. Since then there have been major advances in our understanding of the diseases associated with C. f. felis and their implications for humans and their pets. Two rickettsial diseases, flea-borne spotted fever and murine typhus, have been identified in domestic animal populations and cat fleas. Cat fleas are the primary vector of Bartonella henselae (cat scratch fever) with the spread of the bacteria when flea feces are scratched in to bites or wounds. Flea allergic dermatitis (FAD) common in dogs and cats has been successfully treated and tapeworm infestations prevented with a number of new products being used to control fleas. There has been a continuous development of new products with novel chemistries that have focused on increased convenience and the control of fleas and other arthropod ectoparasites. The possibility of feral animals serving as potential reservoirs for flea infestations has taken on additional importance because of the lack of effective environmental controls in recent years. Physiological insecticide resistance in C.
  • Holistic Understanding of Contemporary Ecosystems Requires Integration of Data on Domesticated, Captive and Cultivated Organisms

    Holistic Understanding of Contemporary Ecosystems Requires Integration of Data on Domesticated, Captive and Cultivated Organisms

    Biodiversity Data Journal 9: e65371 doi: 10.3897/BDJ.9.e65371 Forum Paper Holistic understanding of contemporary ecosystems requires integration of data on domesticated, captive and cultivated organisms Quentin Groom‡,§, Tim Adriaens |, Sandro Bertolino¶#, Kendra Phelps , Jorrit H Poelen¤, DeeAnn Marie Reeder«, David M Richardson§, Nancy B Simmons»,˄ Nathan Upham ‡ Meise Botanic Garden, Meise, Belgium § Centre for Invasion Biology, Department of Botany and Zoology, Stellenbosch University, Stellenbosch, South Africa | Research Inst. for Nature and Forest (INBO), Brussels, Belgium ¶ Department of Life Sciences and Systems Biology, University of Turin, Torino, Italy # EcoHealth Alliance, New York, United States of America ¤ Ronin Institute for Independent Scholarship, Montclair, United States of America « Bucknell University, Lewisburg, United States of America » Department of Mammalogy, Division of Vertebrate Zoology, American Museum of Natural History, New York, United States of America ˄ Arizona State University, Tempe, United States of America Corresponding author: Quentin Groom ([email protected]) Academic editor: Vincent Smith Received: 02 Mar 2021 | Accepted: 13 May 2021 | Published: 15 Jun 2021 Citation: Groom Q, Adriaens T, Bertolino S, Phelps K, Poelen JH, Reeder DM, Richardson DM, Simmons NB, Upham N (2021) Holistic understanding of contemporary ecosystems requires integration of data on domesticated, captive and cultivated organisms . Biodiversity Data Journal 9: e65371. https://doi.org/10.3897/BDJ.9.e65371 Abstract Domestic and captive animals and cultivated plants should be recognised as integral components in contemporary ecosystems. They interact with wild organisms through such mechanisms as hybridization, predation, herbivory, competition and disease transmission and, in many cases, define ecosystem properties. Nevertheless, it is widespread practice for data on domestic, captive and cultivated organisms to be excluded from biodiversity repositories, such as natural history collections.
  • Molecular Investigations of Cat Fleas (Ctenocephalides Felis) Provide the First Evidence of Rickettsia Felis in Malta and Candidatus Rickettsia Senegalensis in Israel

    Molecular Investigations of Cat Fleas (Ctenocephalides Felis) Provide the First Evidence of Rickettsia Felis in Malta and Candidatus Rickettsia Senegalensis in Israel

    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2018 Molecular investigations of cat fleas (Ctenocephalides felis) provide the first evidence of Rickettsia felis in Malta and Candidatus Rickettsia senegalensis in Israel Hornok, S ; Baneth, G ; Grima, A ; Takács, N ; Kontschán, J ; Meli, Marina L ; Suter, V ; Salant, H ; Farkas, R ; Hofmann-Lehmann, Regina Abstract: Rickettsia felis, the causative agent of flea-borne spotted fever, occurs on all continents except Antarctica, owing to the cosmopolitan distribution of its cat flea vector. In this study, cat fleas were collected in two countries where the occurrence of R. felis was either unknown (Malta) or where accurate prevalence data were lacking (Israel). Altogether 129 fleas were molecularly analysed for the presence of rickettsial DNA. On the basis of three genetic markers, R. felis was identified in 39.5% (15/38) of the cat fleas from Malta. Sequences showed 100% identity to each other and to relevant sequences inGenBank. Among the 91 cat fleas from Israel, two (2.2%) contained the DNA of Candidatus Rickettsia senegalen- sis. Phylogenetically, the R. felis and Candidatus R. senegalensis identified here clustered separately (with high support) but within one clade, which was a sister group to that formed by the typhus group and spotted fever group rickettsiae. This is the first record of R. felis in Malta and of Candidatus R. senegalensis outside its formerly reported geographical range including Africa, Asia and North America. DOI: https://doi.org/10.1016/j.nmni.2018.05.001 Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-158200 Journal Article Published Version The following work is licensed under a Creative Commons: Attribution 4.0 International (CC BY 4.0) License.
  • Development of Ctenocephalides Felis Felis (Siphonaptera: Pulicidae) in Different Substrates for Maintenance Under Laboratory Conditions

    Development of Ctenocephalides Felis Felis (Siphonaptera: Pulicidae) in Different Substrates for Maintenance Under Laboratory Conditions

    Short Communication ISSN 1984-2961 (Electronic) www.cbpv.org.br/rbpv Development of Ctenocephalides felis felis (Siphonaptera: Pulicidae) in different substrates for maintenance under laboratory conditions Desenvolvimento de Ctenocephalides felis felis (Siphonaptera: Pulicidae) em diferentes substratos para manutenção em condições laboratoriais Gabriela Pereira Salça de Almeida1; Diefrey Ribeiro Campos1; Barbara Rauta de Avelar1; Thalita Xavier de Araújo da Silva1; Monique Morais Lambert2; Mariana Silva Revoredo Alves2; Thaís Ribeiro Correia3* 1 Discente do Programa de Pós-graduação em Ciências Veterinárias, Universidade Federal Rural do Rio de Janeiro – UFRRJ, Seropédica, RJ, Brasil 2 Médico Veterinário Autônomo; Universidade Federal Rural do Rio de Janeiro – UFRRJ, Seropédica, RJ, Brasil 3 Departamento de Parasitologia Animal, Universidade Federal Rural do Rio de Janeiro – UFRRJ, Seropédica, RJ, Brasil How to cite: Almeida GPS, Campos DR, Avelar BR, Silva TXA, Lambert MM, Alves MSR, et al. Development of Ctenocephalides felis felis (Siphonaptera: Pulicidae) in different substrates for maintenance under laboratory conditions. Braz J Vet Parasitol 2020; 29(2): e022819. https://doi.org/10.1590/S1984-29612020047 Abstract The aim of this study was to evaluate the efficiency of different substrates for larval development of Ctenocephalides felis felis during its biological cycle. Eight hundred eggs of C. felis felis from a flea maintenance colony were used. Different diets were formulated, in which the main substrates were meat flour, powdered milk, sugar, lyophilized bovine blood, tick metabolites and lyophilized egg. The flea eggs were placed in test tubes (10 per tube) and approximately 2 g of the diet to be tested was added to each tube. There were 10 replicates for each substrate.
  • Ectoparasites Ctenocephalides (Siphonaptera, Pulicidae) in the Composition of Mixed Infestations in Domestic Dogs from Poltava, Ukraine

    Ectoparasites Ctenocephalides (Siphonaptera, Pulicidae) in the Composition of Mixed Infestations in Domestic Dogs from Poltava, Ukraine

    DOI: 10.2478/fv-2020-0026 FOLIA VETERINARIA, 64, 3: 47—53, 2020 ECTOPARASITES CTENOCEPHALIDES (SIPHONAPTERA, PULICIDAE) IN THE COMPOSITION OF MIXED INFESTATIONS IN DOMESTIC DOGS FROM POLTAVA, UKRAINE Yevstafieva, V.1, Horb, К.1, Melnychuk, V.1 Bakhur, T.2, Feshchenko, D.3 1Department of Parasitology and Veterinary-Sanitary Examination, Institute of Veterinary Medicine Poltava State Agrarian Academy, Skovorody Str., 1/3, 36003, Poltava 2Department of Parasitology and Pharmacology, Bila Tserkva National Agrarian University Soborna Sq., 8/1, 09100, Bila Tserkva, Kyiv region 3Department of Parasitology, Veterinary-Sanitary Expertise and Zoohygiene, Polissia National University Staryy Blvd., 7, 10008, Zhytomyr, Ukraine [email protected]; [email protected] ABSTRACT were mostly parasitizing in the form of an associations with: nematoda (Toxocara canis, Trichuris vulpis, Un­ One of the most common ectoparasites on domes- cinaria stenocephala), Cestoda (Dipylidium caninum), tic carnivores are fleas from the genus Ctenocephalides. protozoa (Cystoisospora canis), and another ectoparasite This group of blood sucking insects are one of the most (Trichodectes canis). Overall, 33 types of mixed infesta- important in medical and veterinary terms, as they can tions were detected. Moreover, the number of different serve as carriers of dangerous infectious and may cause parasitic species in each dog ranged from one to seven. other invasive diseases. Research studies have estab- Fleas of the genus Ctenocephalides (in the composition lished a variety of fleas and other contagions parasitiz- of two species of parasites) were registered the most of- ing domestic dogs in Poltava, Ukraine. Certain peculi- ten (14.60 %). The infestation of dogs with other forms arities of these ectoparasitic studies, as a part of mixed of mixed infestations was 0.69—8.01 %.
  • A Chromosome-Level Assembly of the Cat Flea Genome Uncovers Rampant Gene Duplication and Genome Size Plasticity Timothy P

    A Chromosome-Level Assembly of the Cat Flea Genome Uncovers Rampant Gene Duplication and Genome Size Plasticity Timothy P

    Driscoll et al. BMC Biology (2020) 18:70 https://doi.org/10.1186/s12915-020-00802-7 RESEARCH ARTICLE Open Access A chromosome-level assembly of the cat flea genome uncovers rampant gene duplication and genome size plasticity Timothy P. Driscoll1†, Victoria I. Verhoeve2†, Joseph J. Gillespie2*† , J. Spencer Johnston3, Mark L. Guillotte2, Kristen E. Rennoll-Bankert2, M. Sayeedur Rahman2, Darren Hagen4, Christine G. Elsik5,6,7, Kevin R. Macaluso8 and Abdu F. Azad2 Abstract Background: Fleas (Insecta: Siphonaptera) are small flightless parasites of birds and mammals; their blood-feeding can transmit many serious pathogens (i.e., the etiological agents of bubonic plague, endemic and murine typhus). The lack of flea genome assemblies has hindered research, especially comparisons to other disease vectors. Accordingly, we sequenced the genome of the cat flea, Ctenocephalides felis, an insect with substantial human health and veterinary importance across the globe. Results: By combining Illumina and PacBio sequencing of DNA derived from multiple inbred female fleas with Hi-C scaffolding techniques, we generated a chromosome-level genome assembly for C. felis. Unexpectedly, our assembly revealed extensive gene duplication across the entire genome, exemplified by ~ 38% of protein-coding genes with two or more copies and over 4000 tRNA genes. A broad range of genome size determinations (433–551 Mb) for individual fleas sampled across different populations supports the widespread presence of fluctuating copy number variation (CNV) in C. felis. Similarly, broad genome sizes were also calculated for individuals of Xenopsylla cheopis (Oriental rat flea), indicating that this remarkable “genome-in-flux” phenomenon could be a siphonapteran-wide trait.
  • Mammalian Diversity in Nineteen Southeast Coast Network Parks

    Mammalian Diversity in Nineteen Southeast Coast Network Parks

    National Park Service U.S. Department of the Interior Natural Resource Program Center Mammalian Diversity in Nineteen Southeast Coast Network Parks Natural Resource Report NPS/SECN/NRR—2010/263 ON THE COVER Northern raccoon (Procyon lotot) Photograph by: James F. Parnell Mammalian Diversity in Nineteen Southeast Coast Network Parks Natural Resource Report NPS/SECN/NRR—2010/263 William. David Webster Department of Biology and Marine Biology University of North Carolina – Wilmington Wilmington, NC 28403 November 2010 U.S. Department of the Interior National Park Service Natural Resource Program Center Fort Collins, Colorado The National Park Service, Natural Resource Program Center publishes a range of reports that address natural resource topics of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate high-priority, current natural resource management information with managerial application. The series targets a general, diverse audience, and may contain NPS policy considerations or address sensitive issues of management applicability. All manuscripts in the series receive the appropriate level of peer review to ensure that the information is scientifically credible, technically accurate, appropriately written for the intended audience, and designed and published in a professional manner. This report received formal peer review by subject-matter experts who were not directly involved in the collection, analysis, or reporting of the data, and whose background and expertise put them on par technically and scientifically with the authors of the information. Views, statements, findings, conclusions, recommendations, and data in this report do not necessarily reflect views and policies of the National Park Service, U.S.
  • Cat Flea, Ctenocephalides Felis (Bouché)1 D

    Cat Flea, Ctenocephalides Felis (Bouché)1 D

    EENY-011 Cat Flea, Ctenocephalides felis (Bouché)1 D. C. Zentko and D. L. Richman2 Introduction Distribution There are over 2,000 described species of fleas. The most Although it exists worldwide, the cat flea is most commonly common domestic flea is the cat flea, Ctenocephalides found in the United States, in and around homes with pets. felis (Bouché). The adult cat flea, unlike many other fleas, remains on the host. Adults require a fresh blood meal in Description order to reproduce. Adults Adults are stimulated to emerge by vibration or an increase in carbon dioxide. They are about 1 to 3 mm in size, reddish-brown to black in color, wingless, and are laterally compressed. They possess powerful hind legs that allow for running and jumping through hair, fur, and feathers. Adult cat fleas require fresh blood to produce eggs. This is the only stage in the cat flea life cycle when the fleas live on the pet. Adults live 4 to 25 days. Eggs Cat flea eggs are laid at the rate of up to one egg per hour. They are oval, smooth, and about 0.5 mm in size. Due to Figure 1. Adult cat flea, Ctenocephalides felis (Bouché). Credits: UF/IFAS their dry, smooth surface, the eggs easily fall out of the animal’s hair. Though otherwise visible, the white eggs are The dog flea, Ctenocephalides canis (Curtis), appears similar nearly impossible to see against surfaces such as carpet, to the cat flea, but is rarely found in the United States. Cat bedding, and lawn. It is here where the eggs will remain fleas are commonly found on both cats and dogs in North until the larvae emerge.