DOCSLIB.ORG

Interleukin 16 Expression and Phenotype of Interleukin 16 Producing Cells in Crohn’S Disease Gut: First Published As 10.1136/Gut.49.6.795 on 1 December 2001

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Interleukin 16 Expression and Phenotype of Interleukin 16 Producing Cells in Crohn’S Disease Gut: First Published As 10.1136/Gut.49.6.795 on 1 December 2001 Gut 2001;49:795–803 795 Interleukin 16 expression and phenotype of interleukin 16 producing cells in Crohn’s disease Gut: first published as 10.1136/gut.49.6.795 on 1 December 2001. Downloaded from P Middel, K Reich, F Polzien, V Blaschke, B Hemmerlein, J Herms, M Korabiowska, H-J Radzun Abstract inflammatory disorder are still poorly under- Background—The mechanisms involved stood. Various hypothesis have been proposed in the initiation and maintenance of to explain the aetiology and pathogenesis of Crohn’s disease are poorly understood. CD, ranging from exposure to an infective Previous studies have demonstrated an agent to aberrant T cell regulation.12 Chronic increased number of infiltrating CD4+ T inflammatory changes in CD include focal cells within the inflammatory aVected lymphocytic infiltrates within the lamina pro- bowel wall in Crohn’s disease. Novel pria and the submucosa, where granulomas therapy approaches using anti-CD4 anti- with Langhans’ type multinucleated giant cells bodies are thought to be eVective in can also be observed.3 The focal lymphocytic Crohn’s disease. aggregates frequently demonstrate a perivascu- Aims—Interleukin 16 (IL-16) has been lar distribution, predominantly around small characterised as a chemokine with selec- submucosal vessels. These infiltrates consist tive chemoattraction for CD4+ inflamma- mainly of naive CD4+ lymphocytes45express- tory T cells. In this study, cellular ing the activation markers CD25 and HLA-DR expression of IL-16 in Crohn’s disease and admixed with scattered freshly migrated mono- ulcerative colitis was investigated. cytes and/or macrophages.3 The increased Methods—Expression of IL-16 was ana- number of CD4+ lymphocytes in intestinal lysed in tissue samples of Crohn’s disease, lesions suggests that T cells are responding to ulcerative colitis, and normal controls by antigenic stimulation and contribute to the applying reverse transcription-polymerase local inflammatory process.67This assumption chain reaction, non-radioactive in situ is further supported by studies demonstrating Department of hybridisation, and immunohistochemistry. CD4+ T cells as the major cellular source of Pathology, Double staining methods were used to proinflammatory cytokines such as interferon Georg-August characterise cells expressing IL-16. The ã, interleukin (IL)-2, and tumour necrosis fac- University of amount of infiltrating CD4+ cells was tor á in CD, representing a so-called TH-1 http://gut.bmj.com/ Göttingen, Germany immune response.1 In addition, it has been P Middel determined by immunohistochemistry and B Hemmerlein correlated with the corresponding IL-16+ shown that clinical improvement in CD can be M Korabiowska cell number by step sections. achieved by reduction of activated T cells by H-J Radzun Results—An increased number of IL-16+ administration of immunosuppressive agents cells in Crohn’s disease in comparison such as cyclosporin A or systemic anti-CD4 Department of 8 with ulcerative colitis and control probes antibody. Dermatology, Because of the regulatory role of CD4+ T Georg-August was demonstrated. IL-16 was expressed by on September 23, 2021 by guest. Protected copyright. University of CD4 and CD8 positive T cells. In addition, cells in CD, study of the mechanisms responsi- Göttingen, Germany in active Crohn’s disease there was a sub- ble for accumulation of these cells is of primary K Reich stantial number of IL-16 positive mast importance. IL-16, originally described as V Blaschke cells. The increased number of CD4+ lymphocyte chemoattractant factor, serves as 9 lymphocytes correlated positively with the the natural ligand of the CD4 molecule. Thus Department of apart from other cytokines and chemokines, Gastroenterology, increased number of IL-16 positive cells in Georg-August Crohn’s disease. IL-16 can selectively attract CD4+ cells, University of including T cells, monocytes, dendritic cells, Conclusion—Our results demonstrate 10–12 Göttingen, Germany that increased expression of IL-16 in T and neutrophilic granulocytes. In addition F Polzien cells and mast cells in active Crohn’s to its function as a chemokine, IL-16 stimulates disease is associated with increased num- expression of the high aYnity IL-2 receptor Department of (IL-2R; CD25) and MHC class II on resting T Neuropathology, bers of CD4+ lymphocytes. Local expres- 910 Georg-August sion of IL-16 seems to play a significant cells. Previous studies have shown that University of IL-16 is produced by a variety of inflammatory role in the initiation and persistence of the 13 14 Göttingen, Germany inflammatory process in Crohn’s disease, cells, including lymphocytes, mast cells, and J Herms 15 presumably by IL-16 mediated recruit- eosinophilic granulocytes, and epithelial cells such as keratinocytes16 and airway epithelial Correspondence to: ment of CD4+ cells, mostly lymphocytes, 17 Dr P Middel, Centre of into the bowel wall. cells. Pathology, (Gut 2001;49:795–803) Georg-August-University Göttingen, Robert-Koch-Str. Keywords: Crohn’s disease; interleukin 16; 40, 37073 Göttingen, Abbreviations used in this paper: IL, interleukin; inflammation; chemotaxis Germany. CD, Crohn’s disease; UC, ulcerative colitis; NIGD, pmiddel@ med.uni-goettingen.de non-inflammatory gut disorder; RT-PCR,reverse transcription-polymerase chain reaction; mAb, Accepted for publication The immune alterations initiating and main- monoclonal antibody; FITC, fluorescein 5 June 2001 taining Crohn’s disease (CD) as a chronic isothiocyanate. www.gutjnl.com 796 Middel, Reich, Polzien, et al The biological properties of IL-16 prompted seconds at 57°C, 1.5 minutes at 72°C, followed us to hypothesise that IL-16 may be involved in by a final extension step of seven minutes at accumulation of CD4+ lymphocytes within the 72°C; IL-16 (IL-16-fw-primer: 5'- ATG Gut: first published as 10.1136/gut.49.6.795 on 1 December 2001. Downloaded from inflammatory aVected bowel in CD. The main CCCGACCTCAACTCCTCCACT -3'; IL- objective of this study was to characterise and 16-rev-primer: 5'-GCCACCCAGCTGC AA- determine the phenotype of inflammatory cells GATTTC -3'; product size: 261 bp) three expressing IL-16 at the protein and RNA minutes at 95°C, 35 cycles of 40 seconds at levels, as evaluated by immunohistochemistry 95°C, 40 seconds at 62°C, one minute at and non-radioactive in situ hybridisation, 72°C, and final elongation of seven minutes at respectively. Furthermore, the number of cells 72°C. The PCR products were visualised on expressing IL-16 was correlated with the 1% agarose gels by staining with ethidium number of CD4+ lymphocytes in CD. Our bromide. To exclude amplification of genomic results provide evidence that increased expres- sequences, PCR primers were designed to sion of IL-16 by lymphocytes and mast cells is amplify cDNA fragments that span at least one involved in recruitment of CD4+ lymphocytes intron of the corresponding gene. cDNA from in CD. a human lymph node was used as a positive control template for each primer pair. Nega- Methods tive controls with water instead of cDNA were TISSUE SAMPLES always included. A PCR reaction was consid- Surgical specimens derived from involved areas ered to be positive when a single band of cor- of the large intestine of 10 patients with active rect product length could be detected. Ampli- CD were studied. CD was active in all patients, fication of correct PCR products was as confirmed by clinical features, laboratory controlled by asymmetric restriction enzyme parameters, as well as macroscopic and his- digestion and sequencing with an ABI310 topathological alterations. All patients under- automatic sequencer using the rhodamine- went surgical intervention because of failure of dye-terminator kit according to the manufac- medical treatment. As controls, surgical speci- turer’s instructions (Perkin Elmer, Darmstadt- mens from the gut of five patients suVering Weiterstadt, Germany). from therapy resistant ulcerative colitis (UC) (table 1) as well as macroscopic and micro- scopic uninvolved large bowel tissues from five CLONING OF PCR PRODUCTS patients with non-inflammatory gut disorder For generation of the IL-16 riboprobe for (NIGD) were used (three colon carcinoma and quantitative real time RT-PCR or in situ two diverticular disease). For routine morpho- hybridisation, PCR products were cloned into logical analysis, immunohistochemistry, and the blunt end SmaI restriction site of the tran- non-radioactive in situ hybridisation, appropri- scription vector pBluescript II KS plasmid. ate tissue specimens were fixed in formalin and Briefly, blunt end PCR products were gener- http://gut.bmj.com/ embedded in paraYn. Additional representa- ated using Vent polymerase (Pharmacia) ac- tive samples were snap frozen in liquid cording to the PCR cycling conditions, as nitrogen, stored at −80°C, and used for RNA mentioned above. After micro spin column isolation. purification (Pharmacia, Heidelberg, Ger- many), the blunt end PCR products were RNA EXTRACTION AND REVERSE ligated into a SmaI restricted pBluescript II KS TRANSCRIPTION-POLYMERASE CHAIN REACTION plasmid using T4-DNA-ligase at 16°C over- (RT-PCR) on September 23, 2021 by guest. Protected copyright. night and transformed into the CaCl2 compe- RNA was isolated from cryoconserved tissue tent Escherichia coli strain DH5á. After propa- samples using TriReagent according to the gation under standard culture conditions the manufacturer’s instructions (Sigma, Deisen- plasmids were isolated using the alkaline lysis hofen, Germany) and finally obtained in 30 µl procedure. Cloning of IL-16 specific PCR RNase free water. RNA content was deter- fragments was confirmed by cycle sequencing mined spectrophotometrically. RNA (1 µg) was with the rhodamine-dye-terminator kit using used for reverse transcription after a DNase an ABI 310 sequencer according to the manu- (FPLC-pure DNaseI; Pharmacia, Freiburg, facturer’s instructions (Perkin-Elmer). Ribo- Germany) digestion step. cDNA synthesis was probes were generated by in vitro transcription performed in a total volume of 20 µl RNase free using T3 or T7 polymerase (Boehringer, Man- water including 1.5 µM oligo-dT primer, 0.4 nheim, Germany).
Load more

Recommended publications
  • United States Patent (19) 11 Patent Number: 5,766,866 Center Et Al
    USOO5766866A United States Patent (19) 11 Patent Number: 5,766,866 Center et al. 45) Date of Patent: Jun. 16, 1998 54 LYMPHOCYTE CHEMOATTRACTANT Center, et al. The Journal of Immunology. 128:2563-2568 FACTOR AND USES THEREOF (1982). 75 Inventors: David M. Center. Wellesley Hills; Cruikshank, et al. The Journal of Immunology, William W. Cruikshank. Westford; 138:3817-3823 (1987). Hardy Kornfeld, Brighton, all of Mass. Cruikshank, et al., The Journal of Immunology, 73) Assignee: Research Corporation Technologies, 146:2928-2934 (1991). Inc., Tucson, Ariz. Cruikshank, et al., EMBL Database. Accession No. M90301 (21) Appl. No.: 580,680 (1992). 22 Filed: Dec. 29, 1995 Cruikshank. et al. The Journal of Immunology, 128:2569-2574 (1982). Related U.S. Application Data Rand, et al., J. Exp. Med., 173:1521-1528 (1991). 60 Division of Ser. No. 480,156, Jun. 7, 1995, which is a continuation-in-part of Ser. No. 354,961, Dec. 13, 1994, Harlow (1988) Antibodies, a laboratory manual. Cold Spring which is a continuation of Ser. No. 68,949, May 21, 1993, Harbor Laboratory, 285, 287. abandoned. Waldman (1991) Science. vol. 252, 1657-1662. (51) Int. Cl. ....................... G01N 33/53; CO7K 1700; CO7K 16/00: A61K 45/05 Hams et al. (1993) TIBTECH Feb. 1993 vol. 111, 42-44. 52 U.S. Cl. ......................... 424/7.24; 435/7.1; 435/7.92: 435/975; 530/350:530/351; 530/387.1: Center, et al. (Feb. 1995) "The Lymphocyte Chemoattractant 530/388.23: 530/389.2: 424/85.1: 424/130.1 Factor”. J. Lab. Clin. Med. 125(2):167-172.
    [Show full text]
  • Evolutionary Divergence and Functions of the Human Interleukin (IL) Gene Family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W
    UPDATE ON GENE COMPLETIONS AND ANNOTATIONS Evolutionary divergence and functions of the human interleukin (IL) gene family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W. Nebert3* and Vasilis Vasiliou1 1Molecular Toxicology and Environmental Health Sciences Program, Department of Pharmaceutical Sciences, University of Colorado Denver, Aurora, CO 80045, USA 2Department of Clinical Pharmacy, University of Colorado Denver, Aurora, CO 80045, USA 3Department of Environmental Health and Center for Environmental Genetics (CEG), University of Cincinnati Medical Center, Cincinnati, OH 45267–0056, USA *Correspondence to: Tel: þ1 513 821 4664; Fax: þ1 513 558 0925; E-mail: [email protected]; [email protected] Date received (in revised form): 22nd September 2010 Abstract Cytokines play a very important role in nearly all aspects of inflammation and immunity. The term ‘interleukin’ (IL) has been used to describe a group of cytokines with complex immunomodulatory functions — including cell proliferation, maturation, migration and adhesion. These cytokines also play an important role in immune cell differentiation and activation. Determining the exact function of a particular cytokine is complicated by the influence of the producing cell type, the responding cell type and the phase of the immune response. ILs can also have pro- and anti-inflammatory effects, further complicating their characterisation. These molecules are under constant pressure to evolve due to continual competition between the host’s immune system and infecting organisms; as such, ILs have undergone significant evolution. This has resulted in little amino acid conservation between orthologous proteins, which further complicates the gene family organisation. Within the literature there are a number of overlapping nomenclature and classification systems derived from biological function, receptor-binding properties and originating cell type.
    [Show full text]
  • 330, 329, 357 Acquired/Secondary
    j689 Index a acute/chronic pulmonary Acanthamoeba castellanii 152 histoplasmosis 567 acid-fast staining 327 ACV trafficking 248 acquired immune deficiency syndrome adaptive immune system 217 (AIDS) 330, 329, 357 – antigen processing 225–230 acquired/secondary mutualistic – B cells, antibodies and immunity endosymbionts 553–554 224–225 þ actin-associated proteins 131 – CD4 TH1 217–220 actin-based motility system 440, 435 – cells of 217–225 þ – process 435 – cytotoxic CD8 T lymphocytes 221–222 actin-binding proteins (ABPs) 126, 127 – natural killer T lymphocytes 222–223 – coronin 337 – regulatory T cells 223–224 – filamin 130 – T cell receptors 225 – SipA 379 – ab T cells 217 actin cytoskeleton 126, 135 – gd TCRT lymphocytes 222 – background 126 – TH2 lymphocytes 217–220 – – – disruption 135 TH17 lymphocytes 220 221 actin-dependent process 132 adaptive virulence mechanisms 27 – phagocytosis 289 adenylate kinase 133 actin depolymerization factor (ADF) 127 ADP-actin 129 actin filament 129 ADP-Pi-bound monomers 126 actin interactions 128 ADP-ribosylation factor 1(Arf1) 71 – binding 128 ADP transporter 133 – nucleation 128 Aerobacter aerogenes 21 actin monomers 127 Afipia felis 237, 239, 240, 242, 248, see also cat actin nucleation assay, schematic scratch disease presentation 130 – containing phagosome 240, 241, 242, 249, actin polymerization process 116, 129, 243, 251 247 – immunology 251–252 – inhibitor 399 – intracellular bacterium 239 – machinery, lipophosphoglycan (LPG)- – intracellular fate determination 246–248 mediated retention 590 – low-efficiency uptake pathway 242–243 actin-recruiting protein 277 – macrophages 246 actin-remodeling proteins 118 – uptake/intracellular compartmentation actin-rich bacteria-containing membrane, model 240, 248 formation 402 Agrobacterium tumefaciens 311, 575 actin system 126 – Cre recombinase reporter assay 311 Intracellular Niches of Microbes.
    [Show full text]
  • Human and Murine IL-16 Conservation of Structure And
    Conservation of Structure and Function Between Human and Murine IL-16 Joseph Keane, John Nicoll, Sue Kim, David M. H. Wu, William W. Cruikshank, William Brazer, Barbara Natke, Yujun Zhang, This information is current as David M. Center and Hardy Kornfeld of September 30, 2021. J Immunol 1998; 160:5945-5954; ; http://www.jimmunol.org/content/160/12/5945 Downloaded from References This article cites 42 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/160/12/5945.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 30, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1998 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Conservation of Structure and Function Between Human and Murine IL-161,2 Joseph Keane,3 John Nicoll,3 Sue Kim, David M. H. Wu, William W. Cruikshank,4 William Brazer, Barbara Natke, Yujun Zhang, David M. Center, and Hardy Kornfeld5 IL-16 is a proinflammatory cytokine that signals via CD4, inducing chemotactic and immunomodulatory responses of CD41 lymphocytes, monocytes, and eosinophils.
    [Show full text]
  • Chicken IL-17F: Identification and Comparative Expression Analysis In
    Developmental and Comparative Immunology 38 (2012) 401–409 Contents lists available at SciVerse ScienceDirect Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci Chicken IL-17F: Identification and comparative expression analysis in Eimeria-infected chickens Woo H. Kim a, Jipseol Jeong a, Ae R. Park a, Dongjean Yim a, Yong-Hwan Kim a, Kwang D. Kim b, ⇑ Hong H. Chang c, Hyun S. Lillehoj d, Byung-Hyung Lee e, Wongi Min a, a College of Veterinary Medicine & Research Institute of Life Science, Gyeongsang National University, Jinju 660-701, Republic of Korea b Division of Applied Life Science (BK21), PMBBRC, Gyeongsang National University, Jinju 660-701, Republic of Korea c Department of Animal Science, College of Agriculture, Gyeongsang National University, Jinju 660-701, Republic of Korea d Animal Parasitic Diseases Laboratory, Animal and Natural Resources Institute, Agricultural Research Service, US Department of Agriculture, Beltsville, MD 20705, USA e Daesung Microbiological Laboratory, Samdong, Uiwangsi, Gyeonggido 437-815, Republic of Korea article info abstract Article history: Interleukin-17F (IL-17F) is a proinflammatory cytokine, which plays an important role in gut homeosta- Received 10 July 2012 sis. A full-length chicken IL-17F (chIL-17F) cDNA with a 510-bp coding region was identified from ConA- Revised 8 August 2012 activated chicken splenic lymphocytes. ChIL-17F shares 53% amino acid sequence identity with the pre- Accepted 8 August 2012 viously described chicken IL-17 (chIL-17A) and 38–43% with mammalian homologues. The locus harbor- Available online 24 August 2012 ing chIL-17 and chIL-17F displayed inverted order compared to those of mammals.
    [Show full text]
  • Human Cytokine Response Profiles
    Comprehensive Understanding of the Human Cytokine Response Profiles A. Background The current project aims to collect datasets profiling gene expression patterns of human cytokine treatment response from the NCBI GEO and EBI ArrayExpress databases. The Framework for Data Curation already hosted a list of candidate datasets. You will read the study design and sample annotations to select the relevant datasets and label the sample conditions to enable automatic analysis. If you want to build a new data collection project for your topic of interest instead of working on our existing cytokine project, please read section D. We will explain the cytokine project’s configurations to give you an example on creating your curation task. A.1. Cytokine Cytokines are a broad category of small proteins mediating cell signaling. Many cell types can release cytokines and receive cytokines from other producers through receptors on the cell surface. Despite some overlap in the literature terminology, we exclude chemokines, hormones, or growth factors, which are also essential cell signaling molecules. Meanwhile, we count two cytokines in the same family as the same if they share the same receptors. In this project, we will focus on the following families and use the member symbols as standard names (Table 1). Family Members (use these symbols as standard cytokine names) Colony-stimulating factor GCSF, GMCSF, MCSF Interferon IFNA, IFNB, IFNG Interleukin IL1, IL1RA, IL2, IL3, IL4, IL5, IL6, IL7, IL9, IL10, IL11, IL12, IL13, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL34, IL35, IL36, IL36RA, IL37, TSLP, LIF, OSM Tumor necrosis factor TNFA, LTA, LTB, CD40L, FASL, CD27L, CD30L, 41BBL, TRAIL, OPGL, APRIL, LIGHT, TWEAK, BAFF Unassigned TGFB, MIF Table 1.
    [Show full text]
  • Toxicity and Inflammatory Response of Melamine Cyanurate
    Journal of Hong Kong Institute of Medical Laboratory Sciences 2017-2018 Volume 15 No 1 & 2 Lessons Learnt from the Melamine Incident of Paediatric Stones: Toxicity and Inflammatory Response of Melamine Cyanurate Mayur Danny I. Gohel1, John Wai-Man Yuen2, Kam-Lun Hon3, Chi-Fai Ng4 1School of Medical & Health Sciences, Tung Wah College, Homantin, Kowloon, Hong Kong – SAR CHINA. 2School of Nursing, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong –SAR CHINA. 3Department of Paediatrics and 4Department of Surgery, Prince of Wales Hospital, The Chinese University of Hong Kong, Sha Tin, New Territories, Hong Kong – SAR CHINA. #Corresponding author: Prof. Mayur Danny I. Gohel, School of Medical & Health Sciences, Tung Wah College, Homantin, Kowloon, Hong Kong. Phone: (852) 3190 6680. E-mail: [email protected] ABSTRACT News regarding drinking milk products contaminated with melamine had gained considerable coverage. The most affected victims had been infants and children with kidney being the most affected organ. There were challenges in detecting and diagnosing renal stones in infants. Paediatric stone disease differs considerably in many aspects from that in adults, with a prevalence of 0.5 cases per 1000 (compared to 70 per 1000 in adults). We attempted to investigate the early cellular events of kidney cells in response to melamine and related lithogenic ions. A two-compartment transwell culture with human kidney cortical WT 9-12 cell line allowed us to investigate the melamine crystals interacting with the apical surface. In response to the clinically relevant ratio of melamine and cyanurate, i.e. 99:1 (v/v), 25% of the cells were destroyed to demonstrate significant disturbance to the tight junction monolayer of cortical epithelium.
    [Show full text]
  • Tumor Necrosis Factor-A, Interleukin-16, and Interleukind Plasma Levels in Neonatal Sepsis
    003 I-3998/93/3304-0380a03.00/0 PEDIATRIC RESEARCH Vol. 23. No. 4. 1993 Copyright O 1993 International Pediatric Research Foundation. Inc. Prrnrc~drn C'. S..4. Tumor Necrosis Factor-a, Interleukin-16, and Interleukind Plasma Levels in Neonatal Sepsis E. S. J. M. DE B0NT.A. MARTENS. J. VAN RAAN. G. SAMSON. W. P. F. FETTER. A. OKKEN. AND L. H. F. M. DE LEIJ Department of pediatric.^, Divi.sion of Neonatolog~,[E.S.J.hf.d. B.. U: P. F. F.], and Department c?f Clinical Chemi.stry /..1. I\{.. J. I '. R.. G. S.1. Sophia Ho.spita1. Zu,olle: and Department c?f Pediatrics. Division r?/' Neonatologj. /.4.0./, and Department c?fClinical Itnm~cnolo~~~[LH.F.h4.d. L.]. C:niversitj,Ho.spita1 Groningen. Groningen. The Netherlands ARSTRAn. Tumor necrosis factor-a, IL-18, and IL-6 induce severe hypotension and fever in animals and humans are thought to be involved in the pathogenesis of sepsis ( 16- 19). Similar effects have been observed when TNFa is given with gram-negative bacteria. We studied these cytokines (6. 20-23). It is suggested in the literature that IL-1P potentiates during neonatal sepsis with mainly gram-positive bacteria. the effects of TNFa several-fold (24, 25). Ten newborns with clinical sepsis and 22 healthy controls Neonatal sepsis is a disease with a high morbidity and mortality were enrolled in the study. TNFa plasma levels proved to and is mainly caused by gram-positive bacteria (26). Because be increased in the newborns with sepsis up to 560 f 234 these microbial species are infrequently associated with infections pg/mL (ng/L) versus 36 f 4 pg/mL (ng/L) in the control in adults.
    [Show full text]
  • RT² Profiler PCR Array (384-Well Format) Human Inflammatory Response & Autoimmunity
    RT² Profiler PCR Array (384-Well Format) Human Inflammatory Response & Autoimmunity Cat. no. 330231 PAHS-3803ZE For pathway expression analysis Format For use with the following real-time cyclers RT² Profiler PCR Array, Applied Biosystems® models 7900HT (384-well block), Format E ViiA™ 7 (384-well block); Bio-Rad CFX384™ RT² Profiler PCR Array, Roche® LightCycler® 480 (384-well block) Format G Description The Human Inflammatory Response & Autoimmunity RT² Profiler PCR Array profiles the expression of 370 key genes involved in immune response during autoimmunity and inflammation. It represents the expression of inflammatory cytokines, chemokines, and their receptors. It also contains genes related to the production and metabolism of cytokines. Genes involved in cytokine-cytokine receptor interactions are as well as thoroughly researched panels of genes involved in the acute-phase, inflammatory, and humoral immune responses. Using real-time PCR, you can easily and reliably analyze the expression of a focused panel of genes related to autoimmunity and inflammation with this array. For further details, consult the RT² Profiler PCR Array Handbook. Sample & Assay Technologies Shipping and storage RT² Profiler PCR Arrays in formats E and G are shipped at ambient temperature, on dry ice, or blue ice packs depending on destination and accompanying products. For long term storage, keep plates at –20°C. Note: Ensure that you have the correct RT² Profiler PCR Array format for your real-time cycler (see table above). Note: Open the package and store
    [Show full text]
  • IL-16 Regulates Macrophage Polarization As a Target Gene of Mir
    Molecular Immunology 107 (2019) 1–9 Contents lists available at ScienceDirect Molecular Immunology journal homepage: www.elsevier.com/locate/molimm IL-16 regulates macrophage polarization as a target gene of mir-145-3p T Ying Huang1, Kai Li Du1, Pei Yu Guo, Run Min Zhao, Bing Wang, Xue Lin Zhao, ⁎ Chun Qiang Zhang Department of hematology,department of orthopedics,the First Affiliated Hospital of Kunming Medical University, China. ARTICLE INFO ABSTRACT Keywords: Background: Interleukin 16 is an immunomodulatory chemokine that signals through CD4 + T cells, monocytes, IL-16 macrophages and dendritic cells. Its expression in immune-related cells enhances the antimicrobial effect and mir-145-3p inhibits HIV replication in macrophages. However, the role of IL-16 in macrophage polarization is uncertain. Macrophage Mir-145 was reported to regulate IL-10 expression by targeting histone deacetylase 11 and promotes alter- Polarization natively activated macrophage (M2) polarization. Mir-145 was also predicted to target IL-16 mRNA. We aimed M1/M2 to explore the roles of IL-16 and mir-145 in macrophage polarization and antimicrobial functions. Methods: THP1 monocytes were employed in this study, and their cell activity when incubated with different concentrations of IL-16 was evaluated using the CCK-8 cell counting kit. To obtain polarized macrophages, THP- 1 cells were induced by IL-4 and IL-13 following PMA incubation (M2 polarized macrophages) or induced by IFN-gamma and LPS (M1 classical macrophage activation). The influence of IL-16 on macrophage phagocytosis was quantified by the amount of chicken red blood cell phagocytized. IL-16, IL-10 and miR-145 expression in THP1 monocytes and induced macrophages was quantified by quantitative PCR.
    [Show full text]
  • Identification of Cytokine Profiles Associated with Endometrial Chlamydia Infection
    IDENTIFICATION OF CYTOKINE PROFILES ASSOCIATED WITH ENDOMETRIAL CHLAMYDIA INFECTION De’Ashia Elizabeth Lee A thesis submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Master of Science in the Department of Microbiology and Immunology in the School of Medicine. Chapel Hill 2018 Approved by: Toni Darville Nilu Goonetilleke Jason Whitmire Barbara Salvodo © 2018 De’Ashia Elizabeth Lee ALL RIGHTS RESERVED ii ABSTRACT De’Ashia Elizabeth Lee: Identification of Cytokine Profiles Associated with Endometrial Chlamydia Infection (Under the direction of Toni Darville and Nilu Goonetilleke) Chlamydia trachomatis (CT) infection can lead to reproductive tract morbidities when it ascends to the upper genital tract of women, and repeated infections worsen disease. Cervical cytokines associated with disease or infection susceptibility in women are unknown. Forty-eight cytokines were measured in cervical secretions of 160 women with CT infection, 68 who had endometrial infection, and 92 with cervical infection only. Participants were monitored for repeat CT infections over the following year. Multivariable stepwise regression examined whether cytokines were associated with endometrial infection at the enrollment visit or reinfection. IL-16, was associated with decreased risk of endometrial infection while CXCL10, CXCL13, and TNFα, were associated with increased risk of endometrial infection. Although we did not identify cytokines significantly associated with an altered risk of repeat infection, VEGF, a T cell chemokine, and IL-14, a B cell chemokine, were associated with decreased and increased risk of reinfection by univariable analysis, respectively. iii ACKNOWLEDGEMENTS To my family and friends, thank you for all the unconditional love and support throughout my life.
    [Show full text]
  • Uniprot Nr. Proseek Panel 2,4-Dienoyl-Coa Reductase, Mitochondrial
    Protein Name (Short Name) Uniprot Nr. Proseek Panel 2,4-dienoyl-CoA reductase, mitochondrial (DECR1) Q16698 CVD II 5'-nucleotidase (5'-NT) P21589 ONC II A disintegrin and metalloproteinase with thrombospondin motifs 13 (ADAM-TS13) Q76LX8 CVD II A disintegrin and metalloproteinase with thrombospondin motifs 15 (ADAM-TS 15) Q8TE58 ONC II Adenosine Deaminase (ADA) P00813 INF I ADM (ADM) P35318 CVD II ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1 (CD38) P28907 NEU I Agouti-related protein (AGRP) O00253 CVD II Alpha-2-macroglobulin receptor-associated protein (Alpha-2-MRAP) P30533 NEU I Alpha-L-iduronidase (IDUA) P35475 CVD II Alpha-taxilin (TXLNA) P40222 ONC II Aminopeptidase N (AP-N) P15144 CVD III Amphiregulin (AR) P15514 ONC II Angiopoietin-1 (ANG-1) Q15389 CVD II Angiopoietin-1 receptor (TIE2) Q02763 CVD II Angiotensin-converting enzyme 2 (ACE2) Q9BYF1 CVD II Annexin A1 (ANXA1) P04083 ONC II Artemin (ARTN) Q5T4W7 INF I Axin-1 (AXIN1) O15169 INF I Azurocidin (AZU1 P20160 CVD III BDNF/NT-3 growth factors receptor (NTRK2) Q16620 NEU I Beta-nerve growth factor (Beta-NGF) P01138 NEU I, INF I Bleomycin hydrolase (BLM hydrolase) Q13867 CVD III Bone morphogenetic protein 4 (BMP-4) P12644 NEU I Bone morphogenetic protein 6 (BMP-6) P22004 CVD II Brain-derived neurotrophic factor (BDNF) P23560 NEU I, INF I Brevican core protein (BCAN) Q96GW7 NEU I Brorin (VWC2) Q2TAL6 NEU I Brother of CDO (Protein BOC) Q9BWV1 CVD II Cadherin-3 (CDH3) P22223 NEU I Cadherin-5 (CDH5) P33151 CVD III Cadherin-6 (CDH6) P55285 NEU I Carbonic anhydrase 5A, mitochondrial
    [Show full text]