Gut 2001;49:795–803 795 Interleukin 16 expression and phenotype of interleukin 16 producing cells in Crohn’s disease Gut: first published as 10.1136/gut.49.6.795 on 1 December 2001. Downloaded from P Middel, K Reich, F Polzien, V Blaschke, B Hemmerlein, J Herms, M Korabiowska, H-J Radzun Abstract inflammatory disorder are still poorly under- Background—The mechanisms involved stood. Various hypothesis have been proposed in the initiation and maintenance of to explain the aetiology and pathogenesis of Crohn’s disease are poorly understood. CD, ranging from exposure to an infective Previous studies have demonstrated an agent to aberrant T cell regulation.12 Chronic increased number of infiltrating CD4+ T inflammatory changes in CD include focal cells within the inflammatory aVected lymphocytic infiltrates within the lamina pro- bowel wall in Crohn’s disease. Novel pria and the submucosa, where granulomas therapy approaches using anti-CD4 anti- with Langhans’ type multinucleated giant cells bodies are thought to be eVective in can also be observed.3 The focal lymphocytic Crohn’s disease. aggregates frequently demonstrate a perivascu- Aims—Interleukin 16 (IL-16) has been lar distribution, predominantly around small characterised as a chemokine with selec- submucosal vessels. These infiltrates consist tive chemoattraction for CD4+ inflamma- mainly of naive CD4+ lymphocytes45express- tory T cells. In this study, cellular ing the activation markers CD25 and HLA-DR expression of IL-16 in Crohn’s disease and admixed with scattered freshly migrated mono- ulcerative colitis was investigated. cytes and/or macrophages.3 The increased Methods—Expression of IL-16 was ana- number of CD4+ lymphocytes in intestinal lysed in tissue samples of Crohn’s disease, lesions suggests that T cells are responding to ulcerative colitis, and normal controls by antigenic stimulation and contribute to the applying reverse transcription-polymerase local inflammatory process.67This assumption chain reaction, non-radioactive in situ is further supported by studies demonstrating Department of hybridisation, and immunohistochemistry. CD4+ T cells as the major cellular source of Pathology, Double staining methods were used to proinflammatory cytokines such as interferon Georg-August characterise cells expressing IL-16. The ã, interleukin (IL)-2, and tumour necrosis fac- University of amount of infiltrating CD4+ cells was tor á in CD, representing a so-called TH-1 http://gut.bmj.com/ Göttingen, Germany immune response.1 In addition, it has been P Middel determined by immunohistochemistry and B Hemmerlein correlated with the corresponding IL-16+ shown that clinical improvement in CD can be M Korabiowska cell number by step sections. achieved by reduction of activated T cells by H-J Radzun Results—An increased number of IL-16+ administration of immunosuppressive agents cells in Crohn’s disease in comparison such as cyclosporin A or systemic anti-CD4 Department of 8 with ulcerative colitis and control probes antibody. Dermatology, Because of the regulatory role of CD4+ T Georg-August was demonstrated. IL-16 was expressed by on September 23, 2021 by guest. Protected copyright. University of CD4 and CD8 positive T cells. In addition, cells in CD, study of the mechanisms responsi- Göttingen, Germany in active Crohn’s disease there was a sub- ble for accumulation of these cells is of primary K Reich stantial number of IL-16 positive mast importance. IL-16, originally described as V Blaschke cells. The increased number of CD4+ lymphocyte chemoattractant factor, serves as 9 lymphocytes correlated positively with the the natural ligand of the CD4 molecule. Thus Department of apart from other cytokines and chemokines, Gastroenterology, increased number of IL-16 positive cells in Georg-August Crohn’s disease. IL-16 can selectively attract CD4+ cells, University of including T cells, monocytes, dendritic cells, Conclusion—Our results demonstrate 10–12 Göttingen, Germany that increased expression of IL-16 in T and neutrophilic granulocytes. In addition F Polzien cells and mast cells in active Crohn’s to its function as a chemokine, IL-16 stimulates disease is associated with increased num- expression of the high aYnity IL-2 receptor Department of (IL-2R; CD25) and MHC class II on resting T Neuropathology, bers of CD4+ lymphocytes. Local expres- 910 Georg-August sion of IL-16 seems to play a significant cells. Previous studies have shown that University of IL-16 is produced by a variety of inflammatory role in the initiation and persistence of the 13 14 Göttingen, Germany inflammatory process in Crohn’s disease, cells, including lymphocytes, mast cells, and J Herms 15 presumably by IL-16 mediated recruit- eosinophilic granulocytes, and epithelial cells such as keratinocytes16 and airway epithelial Correspondence to: ment of CD4+ cells, mostly lymphocytes, 17 Dr P Middel, Centre of into the bowel wall. cells. Pathology, (Gut 2001;49:795–803) Georg-August-University Göttingen, Robert-Koch-Str. Keywords: Crohn’s disease; interleukin 16; 40, 37073 Göttingen, Abbreviations used in this paper: IL, interleukin; inflammation; chemotaxis Germany. CD, Crohn’s disease; UC, ulcerative colitis; NIGD, pmiddel@ med.uni-goettingen.de non-inflammatory gut disorder; RT-PCR,reverse transcription-polymerase chain reaction; mAb, Accepted for publication The immune alterations initiating and main- monoclonal antibody; FITC, fluorescein 5 June 2001 taining Crohn’s disease (CD) as a chronic isothiocyanate. www.gutjnl.com 796 Middel, Reich, Polzien, et al The biological properties of IL-16 prompted seconds at 57°C, 1.5 minutes at 72°C, followed us to hypothesise that IL-16 may be involved in by a final extension step of seven minutes at accumulation of CD4+ lymphocytes within the 72°C; IL-16 (IL-16-fw-primer: 5'- ATG Gut: first published as 10.1136/gut.49.6.795 on 1 December 2001. Downloaded from inflammatory aVected bowel in CD. The main CCCGACCTCAACTCCTCCACT -3'; IL- objective of this study was to characterise and 16-rev-primer: 5'-GCCACCCAGCTGC AA- determine the phenotype of inflammatory cells GATTTC -3'; product size: 261 bp) three expressing IL-16 at the protein and RNA minutes at 95°C, 35 cycles of 40 seconds at levels, as evaluated by immunohistochemistry 95°C, 40 seconds at 62°C, one minute at and non-radioactive in situ hybridisation, 72°C, and final elongation of seven minutes at respectively. Furthermore, the number of cells 72°C. The PCR products were visualised on expressing IL-16 was correlated with the 1% agarose gels by staining with ethidium number of CD4+ lymphocytes in CD. Our bromide. To exclude amplification of genomic results provide evidence that increased expres- sequences, PCR primers were designed to sion of IL-16 by lymphocytes and mast cells is amplify cDNA fragments that span at least one involved in recruitment of CD4+ lymphocytes intron of the corresponding gene. cDNA from in CD. a human lymph node was used as a positive control template for each primer pair. Nega- Methods tive controls with water instead of cDNA were TISSUE SAMPLES always included. A PCR reaction was consid- Surgical specimens derived from involved areas ered to be positive when a single band of cor- of the large intestine of 10 patients with active rect product length could be detected. Ampli- CD were studied. CD was active in all patients, fication of correct PCR products was as confirmed by clinical features, laboratory controlled by asymmetric restriction enzyme parameters, as well as macroscopic and his- digestion and sequencing with an ABI310 topathological alterations. All patients under- automatic sequencer using the rhodamine- went surgical intervention because of failure of dye-terminator kit according to the manufac- medical treatment. As controls, surgical speci- turer’s instructions (Perkin Elmer, Darmstadt- mens from the gut of five patients suVering Weiterstadt, Germany). from therapy resistant ulcerative colitis (UC) (table 1) as well as macroscopic and micro- scopic uninvolved large bowel tissues from five CLONING OF PCR PRODUCTS patients with non-inflammatory gut disorder For generation of the IL-16 riboprobe for (NIGD) were used (three colon carcinoma and quantitative real time RT-PCR or in situ two diverticular disease). For routine morpho- hybridisation, PCR products were cloned into logical analysis, immunohistochemistry, and the blunt end SmaI restriction site of the tran- non-radioactive in situ hybridisation, appropri- scription vector pBluescript II KS plasmid. ate tissue specimens were fixed in formalin and Briefly, blunt end PCR products were gener- http://gut.bmj.com/ embedded in paraYn. Additional representa- ated using Vent polymerase (Pharmacia) ac- tive samples were snap frozen in liquid cording to the PCR cycling conditions, as nitrogen, stored at −80°C, and used for RNA mentioned above. After micro spin column isolation. purification (Pharmacia, Heidelberg, Ger- many), the blunt end PCR products were RNA EXTRACTION AND REVERSE ligated into a SmaI restricted pBluescript II KS TRANSCRIPTION-POLYMERASE CHAIN REACTION plasmid using T4-DNA-ligase at 16°C over- (RT-PCR) on September 23, 2021 by guest. Protected copyright. night and transformed into the CaCl2 compe- RNA was isolated from cryoconserved tissue tent Escherichia coli strain DH5á. After propa- samples using TriReagent according to the gation under standard culture conditions the manufacturer’s instructions (Sigma, Deisen- plasmids were isolated using the alkaline lysis hofen, Germany) and finally obtained in 30 µl procedure. Cloning of IL-16 specific PCR RNase free water. RNA content was deter- fragments was confirmed by cycle sequencing mined spectrophotometrically. RNA (1 µg) was with the rhodamine-dye-terminator kit using used for reverse transcription after a DNase an ABI 310 sequencer according to the manu- (FPLC-pure DNaseI; Pharmacia, Freiburg, facturer’s instructions (Perkin-Elmer). Ribo- Germany) digestion step. cDNA synthesis was probes were generated by in vitro transcription performed in a total volume of 20 µl RNase free using T3 or T7 polymerase (Boehringer, Man- water including 1.5 µM oligo-dT primer, 0.4 nheim, Germany).