Natural Products for the Treatment of Obesity, Metabolic Syndrome, and Type 2 Diabetes 2014

Evidence-Based Complementary and Alternative Medicine

Guest Editors: Menaka C. Thounaojam, Srinivas Nammi, and Ravirajsinh N. Jadeja Natural Products for the Treatment of Obesity, Metabolic Syndrome, and Type 2 Diabetes 2014 Evidence-Based Complementary and Alternative Medicine

Natural Products for the Treatment of Obesity, Metabolic Syndrome, and Type 2 Diabetes 2014

This is a special issue published in “Evidence-Based Complementary and Alternative Medicine.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board

Mona Abdel-Tawab, Germany Chun T. Che, USA Brett Froeliger, USA Jon Adams, Australia Kevin Chen, USA Joel J. Gagnier, Canada GabrielA.Agbor,Cameroon Evan P. Cherniack, USA Siew Hua Gan, Malaysia Ulysses P. Albuquerque, Brazil Salvatore Chirumbolo, Italy Mary K. Garcia, USA Ather Ali, USA W. Chi-shing Cho, Hong Kong Susana Garcia de Arriba, Germany Gianni Allais, Italy Jae Youl Cho, Korea Dolores Garc´ıa Gimenez,´ Spain Terje Alraek, Norway K. B. Christensen, Denmark Gabino Garrido, Chile Shrikant Anant, USA Shuang-En Chuang, Taiwan Michael Goldstein, USA Isabel Andujar,´ Spain Paolo Coghi, Italy Yuewen Gong, Canada Letizia Angiolella, Italy Marisa Colone, Italy Settimio Grimaldi, Italy Virginia A. Aparicio, Spain Lisa A. Conboy, USA Gloria Gronowicz, USA Makoto Arai, Japan Kieran Cooley, Canada Maruti Ram Gudavalli, USA Manuel Arroyo-Morales, Spain Edwin L. Cooper, USA Alessandra Guerrini, Italy Hyunsu Bae, Republic of Korea Olivia Corcoran, UK Narcis Gusi, Spain Winfried Banzer, Germany Muriel Cuendet, Switzerland Svein Haavik, Norway Panos Barlas, UK RobertoK.N.Cuman,Brazil Solomon Habtemariam, UK Vernon A. Barnes, USA Vincenzo De Feo, Italy Abid Hamid, India Samra Bashir, Pakistan Roc´ıo De la Puerta, Spain Michael G. Hammes, Germany Purusotam Basnet, Norway Laura De Martino, Italy Kuzhuvelil B. Harikumar, India Jairo Kennup Bastos, Brazil Nunziatina De Tommasi, Italy Cory S. Harris, Canada Sujit Basu, USA Martin Descarreaux, USA Jan Hartvigsen, Denmark Arpita Basu, USA Alexandra Deters, Germany Thierry Hennebelle, France G. David Baxter, New Zealand Farzad Deyhim, USA Lise Hestbaek, Denmark A.-Michael Beer, Germany Manuela Di Franco, Italy Eleanor Holroyd, Australia Alvin J. Beitz, USA Claudia Di Giacomo, Italy Markus Horneber, Germany Louise Bennett, Australia Antonella Di Sotto, Italy Ching-Liang Hsieh, Taiwan Maria Camilla Bergonzi, Italy M.-G. Dijoux-Franca, France BennyT.K.Huat,Singapore Anna R. Bilia, Italy Luciana Dini, Italy Roman Huber, Germany Yong C. Boo, Republic of Korea Tieraona L. Dog, USA Helmut Hugel, Australia Monica Borgatti, Italy Caigan Du, Canada Ciara Hughes, UK Francesca Borrelli, Italy Jeng-Ren Duann, Taiwan Attila Hunyadi, Hungary Geoffrey Bove, USA Nativ Dudai, Israel Sumiko Hyuga, Japan Gloria Brusotti, Italy Thomas Efferth, Germany H. Stephen Injeyan, Canada Arndt Bussing,¨ Germany Abir El-Alfy, USA Angelo A. Izzo, Italy Rainer W. Bussmann, USA Tobias Esch, USA Chris J. Branford-White, UK Andrew J. Butler, USA Giuseppe Esposito, Italy Suresh Jadhav, India Gioacchino Calapai, Italy Keturah R. Faurot, USA G. K. Jayaprakasha, USA Giuseppe Caminiti, Italy Yibin Feng, Hong Kong Gao jianli, China Raffaele Capasso, Italy Nianping Feng, China Stefanie Joos, Germany Francesco Cardini, Italy Patricia D. Fernandes, Brazil ZeevLKain,USA Opher Caspi, Israel Josue Fernandez-Carnero, Spain Osamu Kanauchi, Japan Subrata Chakrabarti, Canada Antonella Fioravanti, Italy Wenyi Kang, China Pierre Champy, France Fabio Firenzuoli, Italy Shao-Hsuan Kao, Taiwan Shun-Wan Chan, Hong Kong Peter Fisher, UK Juntra Karbwang, USA Il-Moo Chang, Republic of Korea Filippo Fratini, Italy Kenji Kawakita, Japan DeborahA.Kennedy,Canada David Mischoulon, USA JoseL.R´ ´ıos, Spain Youn C. Kim, Republic of Korea Francesca Mondello, Italy Paolo Roberti di Sarsina, Italy Cheorl-Ho Kim, Republic of Korea Albert Moraska, USA Felix J. Rogers, USA Yoshiyuki Kimura, Japan Giuseppe Morgia, Italy Mariangela Rondanelli, Italy Toshiaki Kogure, Japan Mark Moss, UK Omar Said, Israel Jian Kong, USA Yoshiharu Motoo, Japan Avni Sali, Australia Tetsuya Konishi, Japan KamalD.Moudgil,USA Mohd Z. Salleh, Malaysia Karin Kraft, Germany Yoshiki Mukudai, Japan Andreas Sandner-Kiesling, Austria Omer Kucuk, USA Frauke Musial, Germany Manel Santafe, Spain Victor Kuete, Cameroon MinKyun Na, Republic of Korea Tadaaki Satou, Japan Yiu W. Kwan, Hong Kong Hajime Nakae, Japan Claudia Scherr, Switzerland Kuang C. Lai, Taiwan Srinivas Nammi, Australia Guillermo Schmeda-Hirschmann, Chile Ilaria Lampronti, Italy Krishnadas Nandakumar, India Andrew Scholey, Australia Lixing Lao, Hong Kong Vitaly Napadow, USA Roland Schoop, Switzerland Christian Lehmann, Canada Michele Navarra, Italy Sven Schroder,¨ Germany Marco Leonti, Italy Isabella Neri, Italy Herbert Schwabl, Switzerland Lawrence Leung, Canada Pratibha V. Nerurkar, USA Veronique Seidel, UK Shahar Lev-ari, Israel Karen Nieber, Germany Senthamil R. Selvan, USA Min Li, China Menachem Oberbaum, Israel Felice Senatore, Italy Xiu-Min Li, USA Martin Offenbaecher, Germany Hongcai Shang, China ChunGuang Li, Australia Junetsu Ogasawara, Japan Karen J. Sherman, USA Bi-Fong Lin, Taiwan Ki-Wan Oh, Republic of Korea Ronald Sherman, USA Ho Lin, Taiwan Yoshiji Ohta, Japan Kuniyoshi Shimizu, Japan Christopher G. Lis, USA Olumayokun A. Olajide, UK Kan Shimpo, Japan Gerhard Litscher, Austria Thomas Ostermann, Germany Yukihiro Shoyama, Japan I-Min Liu, Taiwan Stacey A. Page, Canada Morry Silberstein, Australia Yijun Liu, USA Siyaram Pandey, Canada Kuttulebbai N. S. Sirajudeen, Malaysia V´ıctor Lopez,´ Spain Bhushan Patwardhan, India Graeme Smith, UK Thomas Lundeberg, Sweden BeritS.Paulsen,Norway Chang-Gue Son, Korea Filippo Maggi, Italy Philip Peplow, New Zealand Rachid Soulimani, France Valentina Maggini, Italy Florian Pfab, Germany Didier Stien, France Gail B. Mahady, USA Sonia Piacente, Italy Con Stough, Australia Jamal Mahajna, Israel Andrea Pieroni, Italy Annarita Stringaro, Italy Juraj Majtan, Slovakia Richard Pietras, USA Shan-Yu Su, Taiwan Francesca Mancianti, Italy Andrew Pipingas, Australia Barbara Swanson, USA Carmen Mannucci, Italy Jose M. Prieto, UK Giuseppe Tagarelli, Italy Marta Marzotto, Italy Haifa Qiao, USA Orazio Taglialatela-Scafati, Italy James H. McAuley, Australia Waris Qidwai, Pakistan Takashi Takeda, Japan Kristine McGrath, Australia Xianqin Qu, Australia Ghee T. Tan, USA James S. McLay, UK CassandraL.Quave,USA Hirofumi Tanaka, USA Lewis Mehl-Madrona, USA Roja Rahimi, Iran Lay Kek Teh, Malaysia Peter Meiser, Germany Khalid Rahman, UK Norman Temple, Canada Karin Meissner, Germany Cheppail Ramachandran, USA Mayank Thakur, Germany Albert S Mellick, Australia Elia Ranzato, Italy Menaka C. Thounaojam, USA Andreas Michalsen, Germany Ke Ren, USA Evelin Tiralongo, Australia Oliver Micke, Germany Man H. Rhee, Republic of Korea Stephanie Tjen-A-Looi, USA Roberto Miniero, Italy Luigi Ricciardiello, Italy Michał Tomczyk, Poland Giovanni Mirabella, Italy Daniela Rigano, Italy Loren Toussaint, USA Yew-Min Tzeng, Taiwan Yong Wang, USA Haruki Yamada, Japan Dawn M. Upchurch, USA Chong-Zhi Wang, USA Nobuo Yamaguchi, Japan Takuhiro Uto, Japan Jonathan L. Wardle, Australia Junqing Yang, China Sandy van Vuuren, South Africa Kenji Watanabe, Japan Ling Yang, China Alfredo Vannacci, Italy J. Wattanathorn, Thailand Eun J. Yang, Republic of Korea Subramanyam Vemulpad, Australia Michael Weber, Germany Ken Yasukawa, Japan Carlo Ventura, Italy Silvia Wein, Germany Albert S. Yeung, USA Pradeep Visen, Canada Janelle Wheat, Australia Chris Zaslawski, Australia Aristo Vojdani, USA Jenny M. Wilkinson, Australia Ruixin Zhang, USA Dawn Wallerstedt, USA D. R. Williams, Republic of Korea M. S. A.-Shtayeh, Palestinian Authority Shu-Ming Wang, USA C. Worsnop, Australia Y. N. Clement, Trinidad And Tobago Contents

Natural Products for the Treatment of Obesity, Metabolic Syndrome, and Type 2 Diabetes 2014, Menaka C. Thounaojam, Srinivas Nammi, and Ravirajsinh Jadeja Volume 2015, Article ID 392681, 2 pages

Tinospora crispa Ameliorates Insulin Resistance Induced by High Fat Diet in Wistar Rats, Mohd Nazri Abu, Suhana Samat, Norathirah Kamarapani, Fuzina Nor Hussein, Wan Iryani Wan Ismail, and Hamzah Fansuri Hassan Volume 2015, Article ID 985042, 6 pages

Ancient Records and Modern Research on the Mechanisms of Chinese Herbal Medicines in the Treatment of Diabetes Mellitus, Hai-ming Zhang, Feng-xia Liang, and Rui Chen Volume 2015, Article ID 747982, 14 pages

Screening for Bioactive Metabolites in Plant Extracts Modulating Glucose Uptake and Fat Accumulation, Rime B. El-Houri, Dorota Kotowska, Louise C. B. Olsen, Sumangala Bhattacharya, Lars P. Christensen, Kai Grevsen, Niels Oksbjerg, Nils Færgeman, Karsten Kristiansen, and Kathrine B. Christensen Volume 2014, Article ID 156398, 8 pages

AReviewoftheEfficacyandSafetyofLitramineIQP-G-002AS,anOpuntia ficus-indica Derived Fiber for Weight Management, Pee-Win Chong, Kai-Zhia Lau, Joerg Gruenwald, and Ralf Uebelhack Volume 2014, Article ID 943713, 6 pages

Lingonberry (Vaccinium vitis-idaea L.) Exhibits Antidiabetic Activities in a Mouse Model of Diet-Induced Obesity, Hoda M. Eid, Meriem Ouchfoun, Antoine Brault, Diane Vallerand, Lina Musallam, John T. Arnason, and Pierre S. Haddad Volume2014,ArticleID645812,10pages

Ethanol Extract of Alismatis rhizome Inhibits Adipocyte Differentiation of OP9 Cells,Yeon-JuPark, Mi-Seong Kim, Ha-Rim Kim, Jeong-Mi Kim, Jin-Ki Hwang, Sei-Hoon Yang, Hye-Jung Kim, Dong-Sung Lee, Hyuncheol Oh, Youn-Chul Kim, Do-Gon Ryu, Young-Rae Lee, and Kang-Beom Kwon Volume 2014, Article ID 415097, 9 pages

Herbal Medicines for the Treatment of Nonalcoholic Steatohepatitis: Current Scenario and Future Prospects, Ravirajsinh Jadeja, Ranjitsinh V. Devkar, and Srinivas Nammi Volume2014,ArticleID648308,18pages

Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice,SuJinSong,SenaChoi,andTaesunPark Volume2014,ArticleID718379,14pages

The Active Role of Leguminous Plant Components in Type 2 Diabetes,MonikaGe¸tek, Natalia Czech, Małgorzata Muc-Wierzgon,´ Elzbieta˙ Grochowska-Niedworok, Teresa Kokot, and Ewa Nowakowska-Zajdel Volume2014,ArticleID293961,12pages Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2015, Article ID 392681, 2 pages http://dx.doi.org/10.1155/2015/392681

Editorial Natural Products for the Treatment of Obesity, Metabolic Syndrome, and Type 2 Diabetes 2014

Menaka C. Thounaojam,1 Srinivas Nammi,2,3 and Ravirajsinh Jadeja4

1 Department of Biochemistry and Cancer Biology, Meharry Medical College School of Medicine, Nashville, TN 37208, USA 2School of Science and Health, University of Western Sydney, NSW 2751, Australia 3National Institute for Complementary Medicine (NICM), University of Western Sydney, NSW 2751, Australia 4Division of Gastroenterology/Hepatology, Department of Medicine, Medical College of Georgia, Georgia Regents University, Augusta, GA 30912, USA

Correspondence should be addressed to Menaka C. Thounaojam; [email protected]

Received 8 October 2014; Accepted 8 October 2014

Copyright © 2015 Menaka C. Thounaojam et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

In the modern and contemporary world, the incidence of (Vaccinium vitis-idaea L.) intake improves blood glucose in obesity, metabolic syndrome, and type II diabetes is rising a mouse model of diet-induced obesity without significantly continuously due to modernization in life style and dietary affecting food intake or body weight. The proposed potential habits. Herbal medicines have been shown to be beneficial mechanism is via enhanced expression of GLUT4 in skeletal against coexistence of these ailments. In 2013, we published muscle and reduced hepatic steatosis. Collectively the authors a special issue on “Natural products for the treatment of put forward the potential of Lingonberry in treating insulin obesity, metabolic syndrome, and type 2 diabetes” in Evidence- resistanceandobesity.Similarly,M.N.Abuetal.suggested Based Complementary and Alternative Medicine (eCAM). that oral administration of Tinospora crispa crude extract to After receiving an overwhelming number of submissions and high fat diet-fed insulin resistant rats exhibits antidiabetic, successful compilation of research/review articles in the first antihypercholesterolemic, and hepatoprotective effects and season, the decision to publish annual special issue on this thus could be useful in treating obesity in patients with subject has been made by eCAM. Herein we present the 2014 insulin resistance and type II diabetes. issue in this series. This special issue consists of 5 original A study by T. Park et al. reported antiadipogenic potential research papers and 4 review articles. of Alismatis rhizome. It was shown that AOE suppresses A study by S. J. Song et al. evaluated the potential of adipocyte differentiation in OP9 cells by downregulating decaffeinated green coffee bean extract (DGCBE) in regu- the expression of C/EBP and consequently decreasing PPAR lating diet-induced obesity and insulin resistance using a and C/EBP levels. In another study, El-Houri and col- mouse model. The authors showed that 0.3% supplemen- leagues performed screening of bioactive metabolites in plant tation of DGCBE significantly reduces visceral adiposity extracts that modulate glucose uptake and fat accumulation. and improved insulin resistance that can be attributed to The authors used various aerial and underground parts of 5-caffeoylquinic acid (CQA) and other polyphenols. The seven different plants to screen their efficacy in reducing benefits of DGCBE are further attributed to a possible glucose uptake and fat accumulation using different in vitro downregulation of the genes associated with adipogenesis experimental models. This screening study provides an ideal and inflammation in the adipose tissue. This study suggested platform for further in-depth evaluation of these herbs in that decaffeinated green coffee beans can be used asa regulating insulin resistance and obesity. therapeutic agent against obesity and metabolic syndrome. The review articles in this special issue focus on the Another study by H. M. Eid et al. reported that Lingonberry efficacy of herbal medicines in regulating diabetes, obesity, 2 Evidence-Based Complementary and Alternative Medicine and nonalcoholic steatohepatitis. An extensive review article by L. Zhang et al. summarized the use of Chinese herbal medicines mentioned in 54 famous ancient materia medica monographs. The authors further discussed the available experimental studies on these herbs with their mechanisms of action and limitations. In another review, M. Getek and colleagues discussed the antidiabetic potential of leguminous plant components focusing on both preclinical and clinical research conducted from 2004 to 2014 and highlighted key benefits with limitations. We sincerely hope that this type of extensive review will provide a future direction to the ongoing research in the field of herbal medicines and type 2 diabetes. P.-W.Chong et al. have meticulously reviewed the efficacy and safety of Litramine (IQP-G-002AS, an Opuntia ficus-indica derived fiber) for weight management. This review article mentioned positive results for fecal fat excretion and weight loss and also discussed the safety aspects. In the last decade, the potential of herbal medicines in regulating nonalcoholic steatohepatitis (NASH) has received much attention. In this context, the review by Jadeja et al. extensively discussed the beneficial role of various herbal extracts, phytocompounds, and polyherbal formulations in the management of NASH. Collectively this special issue provides meticulous compilation of our current knowledge on the role of herbal medicines in regulating obesity, metabolic syndrome, and type 2 diabetes and possible future avenues that needs to be filled. We sincerely hope that this kind of annual issue series will have a long-term impact and can gather a community around it in a short time in much the same way as a successful annual conference does.

Acknowledgments Firstly we express our sincere thanks and gratitude to the Editorial Board of eCAM for including our special issue as an annual issue. We would also like to thank contributors of this special issue for their scientifically sound research/review articles. With great pleasure and respect we extend our thanks to the reviewers for critical assessment of each paper, their constructive criticisms, and timely response that made this special issue possible. Menaka C. Thounaojam Srinivas Nammi Ravirajsinh Jadeja Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2015, Article ID 985042, 6 pages http://dx.doi.org/10.1155/2015/985042

Research Article Tinospora crispa Ameliorates Insulin Resistance Induced by High Fat Diet in Wistar Rats

Mohd Nazri Abu,1 Suhana Samat,2,3 Norathirah Kamarapani,2 Fuzina Nor Hussein,4 Wan Iryani Wan Ismail,2,3 and Hamzah Fansuri Hassan1

1 Faculty of Health Sciences, Universiti Teknologi MARA, Puncak Alam Campus, 42300 Bandar Puncak Alam, Selangor, Malaysia 2 Faculty of Pharmacy, Universiti Teknologi MARA, Puncak Alam Campus, 42300 Bandar Puncak Alam, Selangor, Malaysia 3 Clinical BioPharmaceutics Research Group (CBRG), Brain and Neuroscience Core, Universiti Teknologi MARA, 40450 Shah Alam, Selangor Darul Ehsan, Malaysia 4 Faculty of Veterinary Medicine, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia

Correspondence should be addressed to Wan Iryani Wan Ismail; [email protected]

Received 14 February 2014; Revised 17 July 2014; Accepted 17 July 2014

Academic Editor: Ravirajsinh Jadeja

Copyright © 2015 Mohd Nazri Abu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The antidiabetic properties of Tinospora crispa,alocalherbthathasbeenusedintraditional Malay medicine and rich in antioxidant, were explored based on obesity-linked insulin resistance condition. Male Wistar rats were randomly divided into four groups, namely, the normal control (NC) which received standard rodent diet, the high fat diet (HFD) which received high fat diet only, the high fat diet treated with T. crispa (HFDTC), and the high fat diet treated with orlistat (HFDO). After sixteen weeks of treatment, blood and organs were harvested for analyses. Results showed that T. crispa significantlyp ( < 0.05) reduced the body weight (41.14 ± 1.40%), adiposity index serum levels (4.910 ± 0.80%), aspartate aminotransferase (AST: 161 ± 4.71 U/L), alanine aminotransferase (ALT: 100.95 ± 3.10 U/L), total cholesterol (TC: 18.55 ± 0.26 mmol/L), triglycerides (TG: 3.70 ± 0.11 mmol/L), blood glucose (8.50 ± 0.30 mmo/L), resistin (0.74 ± 0.20 ng/mL), and leptin (17.428 ± 1.50 ng/mL) hormones in HFDTC group. The insulin (1.65 ± 0.07 pg/mL) and C-peptide (136.48 pmol/L) hormones were slightly decreased but within normal range. The histological results showed unharmed and intact liver tissues in HFDTC group. As a conclusion, T. crispa ameliorates insulin resistance-associated with obesity in Wistar rats fed with high fat diet.

1. Introduction leading to hyperinsulinemia. Prolong hyperinsulinemia condition promotes oxidative stress due to increased production Obesity is a leading contributor to global metabolic diseases. of reactive oxygen species (ROS). Increment in ROS and Around 3.4 million adults became overweight or obese each oxidative stress is a key in triggering the progression of year and more than 40 million children under age of five metabolic complications such as diabetic nephropathy [2]. were overweight in 2012 worldwide [1]. Consumption of high The uncontrolled phenomenon can lead to metabolic diseases amount of fat and calories in a diet leads to obesity. The ability such as hypertension, heart disease, and cancer [3]. Insulin of obesity to engender insulin resistance is linked to a wide resistance also enhances the accumulation and infiltration of array of pathophysiologic sequels particularly hyperinsuline- adipose tissue by inflammatory cells, subsequently causing mia and type 2 diabetes mellitus. The insulin resistance condi- inflammation, and exacerbates the complications. Losing tion interferes with glucose utilization in the liver and skeletal weight through drug therapy requires follow-up diagnosis muscles thus reducing glycogen storage and affects glucose duetopossibleadverseeffectsofsyntheticchemicaldrugs. homeostasis. Interference in glucose homeostasis interrupts Therefore, it is important to find alternative treatments for extracellular and intracellular glucose concentrations, con- metabolic diseases related to obesity and insulin resistance, sequentlyamplifyinginsulinproductionbythepancreas, especially from nature-based products. Tinospora crispa, 2 Evidence-Based Complementary and Alternative Medicine a herbal plant which is found rich in antioxidants and in plain SST tubes for serum biochemical assay. The blood ∘ possesses antidiabetic properties, has attracted researchers to samples were centrifuged at 3000 rpm at 4 Cfor15minutes. investigate its possible ameliorative effects on induced insulin The clear serum obtained was separated and labeled for resistance in obese subjects [4, 5]. Therefore, this study aims liver function tests (LFT), namely, aspartate aminotransferase to observe the effects of T. crispa in ameliorating insulin (AST) and alanine aminotransaminase (ALT), renal function resistance induced in obese Wistar rats. test (RFT), namely, urea and creatinine, fasting blood sugar (FBS) and serum lipid profile (LP), namely, triglycerides (TG) 2. Methods and total cholesterol. Biochemical tests were performed using ILAB 300 Plus Clinical Chemistry Analyzer, Milano, Italy. 2.1. Sample Collection. T. crispa sample was purchased in Serum leptin, resistin, insulin hormone (USCN Life Sci- powdered form from the Brotocafe Manufacturing Sdn ence and Technology, Wuhan, China), C-peptide (Mercodia Bhd, Malaysia (962191-W). The powders were dissolved in AB, Uppsala, Sweden), and serum levels were determined ∘ 1:1g/mLwarmdistilledwater(60–70 C) prior to use [6]. through ELISA method by referring to the respective manufacturer’s instructions. 2.2. Animal Care. Male Wistar rats, aged seven weeks old, were obtained from Laboratory Animal Facility and Man- 2.6. Anthropometrical and Adiposity Index Determinations. agement, (LAFAM), Universiti Teknologi MARA (UiTM), The body weight and body length were determined by Puncak Alam, Malaysia. All animal-related experiments were anthropometrical parameters: carried out according to the protocol approved by the body weight (g) Research Committee on the Ethical Use of Animals (UiTM Body mass index (BMI) = , Care), reference number: 18/2013. Animals were housed as 2 ( 2) ∘ length cm one rat per cage at the ambient temperature of 25 ± 2 C (1) and 40–65% relative humidity, with 12-hour light/dark cycle cube root of body weight (g) Lee’s index = . [7]. The rats were given standard rodent diet (11.8 kcal% fat), nose to anus length (cm) from Rodent Diet Speciality Feeds, Glen Forrest, Australia and distilled water was provided ad libitum for 1 week. Adiposity index was determined by the sum of epididymal, visceral, and retroperitoneal fat weights divided by body × 2.3. Induction of Insulin Resistance. After acclimatization for weight 100 and expressed as adiposity percentage (% AI). one week, animals were randomly divided into four different groups namely, the normal control (NC) which received 2.7. Histological Evaluation. A comprehensive gross observa- standard rodent diet, the high fat diet (HFD) which received tion was carried out and histological examination of liver tox- high fat diet only, the high fat diet treated with T. crispa icity was performed. Any signs of abnormality or presence of (HFDTC), and the high fat diet treated with orlistat (HFDO). lesions on the organ was observed following administration For the first eight weeks, three groups (HFD, HFDTC and of T. crispa and high fat diet intake [8, 9]. The organs were HFDO) were fed with purified high fat diet daily to increase then carefully dissected, cleaned of any fats, and weighed. rapid weight gain and obesity thus inducing insulin resis- The relative organ weight (ROW) of each organ was then tance. For the subsequent eight weeks, HFDTC and HFDO calculated according to the following equation: were given oral administration of T. crispa and orlistat at 100 mg/kg body weight/day, respectively. Meanwhile, NC and (absolute organ weight (g) × 100) ROW = . (2) HFD groups were continued with their previous diets. At the body weight of rat on sacrifice day (g) end of the treatment period, all of the rats were fasted for 16 hours and sacrificed by decapitation. Blood samples were Each organ was then preserved in 10% buffered formalin collected through cardiac puncture and left to clot without for subsequent histopathological examination. The tissues anticoagulants in plain serum separating tube (SST). were embedded in paraffin, sectioned in 4-5 𝜇mthickusing the rotary microtome, stained with hematoxylin and eosin, 2.4. Body Weight and Meal Pattern Analysis. The body weight and examined microscopically [8, 9]. (BW) of each rat was recorded once per week and the differences in BW were noted. In the meal pattern analysis, 2.8. Statistical Analysis. Results were expressed as mean ± theamountoffoodandwaterconsumedwasmeasured standard error mean (SEM). Statistical significance was deter- weekly by subtracting from the quantity of food and water mined by one-way analysis of variance (ANOVA). Values supplied initially. The food efficiency was calculated once, at with a confidence level of 𝑝 < 0.05 were considered the end of the study. The total number of kilocalories that significant. wasconsumedbyeachratwasdeterminedbymultiplyingthe caloric content of 1 gram of each diet by the total quantity of 3. Results food eaten. 3.1. Body Weight and Meal Pattern. Total food intake and 2.5. Biochemical Analysis. Blood samples were freshly col- energy efficiency for HFDTC group were higher compared to lected through cardiac puncture, and the samples were stored the HFD group (Table 1). However, percentage of body weight Evidence-Based Complementary and Alternative Medicine 3

Table 1: Effect of T. crispa on body weight (BW), calories (kJ), and energy efficiency.

Parameter groups Percent body weight (%, BW) Total food intake (g) Calories (kJ) Energy efficiency Normalcontrol(NC) 35.63 ± 1.79 2082.30 ± 18.60 27.81 ± 4.21 0.029 ± 0.0004 High fat diet (HFD) 47.57 ± 1.28 2202.21 ± 23.30 27.17 ± 7.47 0.023 ± 0.0010 ∗ ∗ High fat diet + T. crispa (HFDTC) 41.14 ± 1.40 2211.82 ± 16.51 27.59 ± 8.72 0.028 ± 0.0005 ∗ High fat diet + orlistat (HFDO) 40.26 ± 1.06 2103.00 ± 19.24 26.90 ± 3.62 0.024 ± 0.0003 Means ± SEM with “∗” in the same column are significant at 𝑝 < 0.05 compared to HFD group using one-way ANOVA test. 𝑛 = 5 rats/group.

Table 2: Effect of T. crispa on levels of aspartate aminotransferase Table 3: Effect of T. crispa on total protein, creatinine, and urea. (AST) and alanine aminotransferase (ALT) liver enzymes in rats. Parameter Total protein Creatinine Urea Parameter groups AST (U/L) ALT (U/L) groups (mmol/L) (mmol/L) (mmol/L) Normal control (NC) 154.51 ± 2.10 92.73 ± 1.06 Control (NC) 84.25 ± 1.58 76.51 ± 1.26 12.11 ± 1.10 High fat diet (HFD) 218.10 ± 2.94 136.00 ± 2.44 High fat diet (HFD) 196.75 ± 2.36 92.00 ± 2.71 18.35 ± 0.50 ± ∗ ± ∗ High fat diet + T. crispa (HFDTC) 161.25 4.71 100.95 3.10 High fat diet + T. ∗ ∗ ∗ ∗ ∗ 99.43 ± 1.33 77.75 ± 3.28 14.75 ± 1.03 High fat diet + orlistat (HFDO) 187.50 ± 3.00 115.00 ± 4.35 crispa (HFDTC) ± ∗ 𝑝 < 0.05 High fat diet + ∗ ∗ Means SEM with “ ” in the same column are significant at 130.75 ± 1.48 105.01 ± 3.00 15.25 ± 1.03 compared to HFD group using one-way ANOVA test. 𝑛 = 5 rats/group. orlistat (HFDO) Means ± SEM with “∗” in the same column are significant at 𝑝 < 0.05 compared to HFD group using one-way ANOVA test. 𝑛 = 5 rats/group. in HFDTC group showed a significantly decreased (41.14%) compared to HFD (47.57%) group. No significant differences Table 4: Effect of T. crispa (TC) on glucose, cholesterol, and in calorie consumptions and value of energy efficiency were triglycerides (TG). observed in HFDO compared to NC group. Parameter Glucose Cholesterol Triglycerides groups (mmol/L) (mmol/L) (mmol/L) 3.2. Serum Level of Liver and Renal Enzymes. Hepatic serum ± ± ± (AST and ALT) and renal serum levels (total protein, crea- Control (NC) 7.25 0.48 14.03 0.50 2.58 0.10 tinine, and urea) were significantly reduced in the HFDTC High fat diet (HFD) 13.75 ± 0.25 23.38 ± 0.23 4.65 ± 0.10 High fat diet + T. ∗ ∗ ∗ compared to HFD group (Table 2). However, total protein 8.50 ± 0.30 18.55 ± 0.26 3.70 ± 0.11 and creatinine levels (130.75 mmol/L and 105.01 mmol/L) crispa (HFDTC) High fat diet + ∗ ∗ ∗ in HFDO group showed significant increases compared to 11.50 ± 0.30 13.00 ± 0.41 3.58 ± 0.03 NC (84.25 mmol/L and 76.51 mmol/L) group, respectively orlistat (HFDO) (Table 3). Means ± SEM with “∗” in the same column are significant at 𝑝 < 0.05 compared to HFD group using one-way ANOVA test. 𝑛 = 5 rats/group. 3.3. Serum Level of Glucose, Cholesterol, and Triglycerides. Levels of glucose, cholesterol, and triglycerides were shown 3.6. Relative Organ Weight and Histopathology Evaluation. in Table 4. Serum glucose, cholesterol, and triglycerides levels Theabsoluteandrelativeorganweights(ROW)oftheisolated were significantly reduced in HFDTC compared to HFD hearts,spleens,kidneys,lungs,andliversfromthegroups groups. HFDTC exhibited a comparable result to NC group. were recorded and calculated (Table 7). Gross necropsy findings did not reveal changes in any of the organs examined 3.4. Level of Adipocytokines (Resistin and Leptin), Insulin, and (Figure 1). The relative organ weights for liver, heart, and lung C-Peptide. Resistin, leptin, insulin, and C-peptide concen- recorded at the end of the study showed a significant decrease trations were markedly increased in HFD group compared for rats in HFDTC group compared to the rats in HFD group. to the others (Table 5). However, it was the direct opposite in HFDTC, where significant decreases were observed in all tests compared to HFD group. Resistin and insulin levels in 4. Discussions HFDO group remained low. Our study showed that rats fed with high fat diet demonstrated pathophysiology of the insulin resistance condition. 3.5. Anthropometrical and Adiposity Index. The rats fed with The development of glucose intolerance with hyperglycemia, high fat diet (HFD) gave significantly higher BMI and Lee’s hyperinsulinemia, and markedly increased body weight was index compared to NC group (Table 6). However, treatment observed in long-term consumptions of high fat diet. The with TC (HFDTC) showed significant reductions (25.00 g) rats fed with high caloric food were prone to develop weight in adipose tissue weight compared to HFD (32.28 g) groups. gain and causing excessive deposition of fats in the body as Moreover, HFDTC group showed significantly decreased seen in the results from the HFD group (Table 1). For that BMI, Lee’s index, and adiposity index compared to HFD reason,intakeofhighfatandhighcaloricfoodscouldbecome group. major factors that contribute to obesity [9]. To render in vivo 4 Evidence-Based Complementary and Alternative Medicine

Table 5: Effect of T. crispa on resistin, leptin, insulin, and C-peptide.

Parameter groups Resistin (ng/mL) Leptin (ng/mL) Insulin (pg/mL) C-peptide (pmol/L) Control (NC) 0.99 ± 0.10 18.721 ± 2.14 1.59 ± 0.07 161.50 ± 5.42 High fat diet (HFD) 1.13 ± 0.20 14.725 ± 1.11 2.27 ± 0.08 301.66 ± 6.8 ∗ ∗ ∗ High fat diet + T. crispa (HFDTC) 0.74 ± 0.20 17.428 ± 1.50 1.65 ± 0.07 136.48 ± 4.1 ∗ High fat diet + orlistat (HFDO) 0.84 ± 0.20 22.620 ± 1.74 1.98 ± 0.07 173.92 ± 5.11 Means ± SEM with “∗” in the same column are significant at 𝑝 < 0.05 compared to HFD group using one-way ANOVA test. 𝑛 = 5 rats/group.

Table 6: Effect of T. crispa on body mass index (BMI), Lee’s Index, adiposity Index (AI), and total fat pads.

Parameter groups Body mass index (BMI) Lee’s index Total fat pads Adiposity index, AI (%) Normal control (NC) 0.641 ± 0.01 0.293 ± 0.002 18.378 ± 2.92 3.312 ± 0.40 High fat diet (HFD) 0.836 ± 0.02 0.322 ± 0.005 32.278 ± 4.17 6.204 ± 0.30 ∗ ∗ ∗ ∗ High fat diet + T. crispa (HFDTC) 0.760 ± 0.02 0.309 ± 0.001 25.002 ± 4.40 4.910 ± 0.80 ∗ ∗ ∗ ∗ High fat diet + orlistat (HFDO) 0.783 ± 0.02 0.308 ± 0.003 29.216 ± 2.87 5.120 ± 0.41 Means ± SEM with “∗” in the same column are significant at 𝑝 < 0.05 compared to HFD group using one-way ANOVA test. 𝑛 = 5 rats/group.

Table 7: Effect of T. crispa on relative organ weight (ROW) of liver, kidney, lung, spleen, and heart.

Parameter groups Liver Kidney Lung Spleen Heart Normalcontrol(NC) 2.404 ± 0.05 0.546 ± 0.03 0.305 ± 0.01 0.173 ± 0.02 0.242 ± 0.03 High fat diet (HFD) 3.101 ± 0.14 0.520 ± 0.06 0.377 ± 0.02 0.161 ± 0.02 0.319 ± 0.02 ∗ ∗ ∗ High fat diet + T. crispa (HFDTC) 2.510 ± 0.08 0.520 ± 0.03 0.317 ± 0.04 0.167 ± 0.01 0.292 ± 0.02 ∗ ∗ ∗ ∗ ∗ High fat diet + orlistat (HFDO) 2.325 ± 0.02 0.4361 ± 0.03 0.296 ± 2.87 0.172 ± 0.02 0.303 ± 0.01 Means ± SEM with “∗” in the same column are significant at 𝑝 < 0.05 compared to HFD group using one-way ANOVA test. 𝑛 = 5 rats/group.

(a) Normal control (NC) (b) High fat diet (HFD)

Figure 1: Pictomicrographs of the liver of NC (a) rats and insulin resistant male Wistar rats induced with high fat diet before (b) and after being treated with T. crispa (c) and orlistat (d) (H&E staining ×20). The HFD group (b) showed severe degrees of micro- and macrovesicular steatosis and severe hepatocellular ballooning while the rest ((a), (b), and (c)) showed normal hepatocytes with intact morphologies. Evidence-Based Complementary and Alternative Medicine 5 insulin resistant obese condition, the male Wistar rats were the fatty acid oxidation through activation of AMPK in subjected to a high fat diet regime for eight weeks. The muscle cells and thus improving lipid metabolism in the body insulin resistant obese condition was developed in week 4, which was frequently related to hyperlipidemia and fatty liver along with hyperglycemia, hyperinsulinemia, and increased in obese patients [5]. Furthermore, the effect of T. crispa C-peptide, together with increased body weight, fat weight, on diabetic mice revealed activation of insulin receptor- and adiposity index [10]. AKT-GLUT2 expression and insulin sensitivity enhancement On the contrary, the results showed that energy efficiency by borapetosides A, B, and C which contributed to the was higher in the high fat diet rats treated with T. crispa hypoglycemic effect in vivo [15–17]. (HFDTC) compared to HFD group (Table 1). There was a Findings in an earlier study [18]supportedthatleptin significant correlation between energy efficiency andthe was a factor that could be responsible for energy homeostasis decrease in body weight detected in HFDTC group. Together, in the body involving body fat mass and total amounts these results indicate the synergistic effect of T. crispa on the of food consumed [14]. Increase secretion of leptin from lipid metabolism of the rats. Previous studies reported that adipose tissues in obese state should suppress the appetite concentration used in this study (100 mg/kg/day continuously and consequently food intake. Leptin aids in improving the for 28 days) did not cause any dose-related changes that can energy expenditure and prevents the accumulation of fat lead to the breakdown of bodily functions [6, 8]. Interestingly, in the body especially subcutaneous tissues and abdominal the concentration of T. crispa used in this experiment resulted adipose tissues [19]. In the present study, however, increased in significant decrease in body weight compared to the HFD level of leptin (Table 5)asfoundinHFDgroupwasproposed group. to develop leptin resistance rather than insufficiency of The hepatoprotective potential of T. crispa is demon- leptin, which result in the increment in their appetite and strated by the significantly lower levels of AST and ALT in food intake [16]. In contrast, the HFDTC showed markedly the HFDTC group (Table 2) compared to their levels in the decreased leptin level (Table 5), similar to orlistat treated HFD and HFDO groups. These results are consistent with rats (HFDO). In general, the mechanism of action of orlistat other studies [10, 11]. Furthermore, these results are supported is by facilitating the decrease in the absorption of fat in by the findings of intact liver tissues in HFDTC group’s gastrointestinal tract, thus preventing excessive fat deposition histological study (Figure 1(c)). Collectively, these findings inthebody.Orlistathasbeeneffectivelyusedclinicallyfor strongly suggest the potential of T. crispa in controlling liver overweight treatment even though there are various adverse damage caused by high fat diets. However, the underlying effects for long-term consumption20 [ , 21]. mechanism of action for these effects is still unclear. The The results of T. crispa administration on rats in HFDTC presence of antioxidants like flavonoids and phenolics in T. group showed promises in countering the effect of insulin crispa may help to reduce inflammation in the body due to resistance and as an antiobesity agent. This is evidenced by their cytoprotective and anti-inflammatory actions [9, 11–13]. the markedly reduced levels of resistin-leptin, thus ampli- Kidneyandspleenshowednosignificantchangesinrelative fying insulin and C-peptide hormones (Table 5). T. crispa organ weight (ROW) in the HFDTC group (Table 7). Fur- treatment has lowered the secretion of insulin hormones in thermore, histological investigation showed no pathological HFDTC rats compared to rats in NC group, countering the changes in the livers of HFDTC rats (Figure 1(c)). Histologi- hyperinsulinemia effects which is the main characteristic of cal sections of livers from the HFDTC groups showed intact insulinresistance[4, 5, 16]. liver parenchyma with the central vein clearly seen along The administration of T. crispa in HFDTC group has with bile ducts and hepatic arteries. The hepatocytes were significantly lowered glucose levelTable ( 4)comparedto also neatly arranged with the sinusoids radiating from the HFD group. This elucidates the effectiveness of this herb in central vein (Figure 1(c)). Conversely, rats fed with HFD for reducing the glucose level in obese rat with high fat intake. It sixteen weeks showed incidences of hepatocytes hypertrophy, is proposed that the hyperglycemia condition due to the high fat deposition, and infiltration of a mixed population of caloric diet intake in HFD has altered the pancreatic-𝛽 cells inflammatory cell as well as ballooning degeneration of hepa- secretion, resulting in insulin resistance development [15]. tocytes characterized by cell swelling with empty intracellular Perhaps, the presence of borapetosides A, B, and C in T. crispa content (Figure 1(b)), indicating cell necrosis in their liver. which regulates glucose uptake in the cells and peripheral Normal kidney function observed in HFDTC group tissues utilization [16] could counter this effect. In addition, (Table 3)suggeststhatT. crispa is safe for consumption at other studies have demonstrated the consistent hypoglycemic the experimental dose. The decrease in HFDTC lipid profile effect of T. crispa in diabetic-induced rats [4, 5]. (Table 4) demonstrated the hypolipidemic effect of T. crispa, probably through inhibition of the intestinal absorption of cholesterol and triglycerides, thus reducing the accumulation 5. Conclusion of fats in the body. There were no other specific mechanisms of action of In conclusion, through oral administration of Tinospora T. crispa’s antioxidants properties in reducing the body crispa crude extract to insulin resistant obese Wistar rats weight on treated rats [14]butcommonalkaloid;berberine induced by high-fat diet conducted in this study has compound was suggested as an antiobesity agent due to the shown that the herb exhibited antidiabetic, antihypercholes- activity of AMP-activated protein kinase (AMPK) in the terolemic, and hepatoprotective effects. These results suggest peripheral tissues [13]. Berberine was proposed to elevate that long-term consumption of T. crispa may be useful 6 Evidence-Based Complementary and Alternative Medicine

in treating obesity in patients with insulin resistance and [12] U. E. Umana, J. A. Timbuak, S. A. Musa, S. Asala, J. Hambolu, diabetes mellitus conditions. and A. J. Anuka, “Acute and chronic hepatotoxicity and nephrotoxicity: study of orally administered chloroform extract of Carica papaya seeds in adult Wistar rats,” International Journal Conflict of Interests of Scientific and Research Publications,vol.3,no.4,pp.1–8,2013. The authors declare that there is no conflict of interests [13]Z.Amom,K.F.Azman,N.A.Ismail,Z.M.Shah,and M. S. M. Arshad, “An aqueous extract of Tinospora crispa regarding the publication of this paper. possesses antioxidative properties and reduces atherosclerosis in hypercholesterolemic-induced rabbits,” Journal of Food Bio- Acknowledgments chemistry,vol.35,no.4,pp.1083–1098,2011. [14] S. Firdausa, M. M. Cho, M. M. Khin, N. Aung, and N. Ku This research was funded by the Research Entity Initiative Zaifah, “The effect of Tinospora crispa on elevated blood glucose (REI) Grant 600-RMI/ST/REI 5/3 Fst (9/2013), from the in streptozotocin induced diabetic rats,” in Proceedings of the Research Management Institute (RMI) and Faculty of Health 26th Scientific Meeting of Malaysian Society of Pharmacology & Sciences, Universiti Teknologi MARA, Malaysia. Physiology,May2012. [15] C. Ruan, S. Lam, T. Chi, S. Lee, and M. Su, “Borapetoside C from Tinospora crispa improves insulin sensitivity in diabetic mice,” References Phytomedicine,vol.19,no.8-9,pp.719–724,2012. [1] W. H. Organization, “Obesity and overweight,” 2014, http:// [16] S.-H. Lam, C.-T. Ruan, P.-H. Hsieh, M.-J. Su, and S.-S. Lee, www.who.int/mediacentre/factsheets/fs311/en/. “Hypoglycemic diterpenoids from Tinospora crispa,” Journal of Natural Products,vol.75,no.2,pp.153–159,2012. [2] S. Abhijit, R. Bhaskaran, A. Narayanasamy et al., “Hyperinsu- linemia-induced vascular smooth muscle cell (VSMC) migra- [17]F.E.Lokman,H.F.Gu,W.N.W.Mohamud,M.M.Yusoff,K.L. ¨ tion and proliferation is mediated by converging mechanisms Chia, and C.-G. Ostenson, “Antidiabetic effect of oral borapetol of mitochondrial dysfunction and oxidative stress,” Molecular B compound, isolated from the plant Tinospora crispa,by and Cellular Biochemistry, vol. 373, no. 1-2, pp. 95–105, 2013. stimulating insulin release,” Evidence-Based Complementary and Alternative Medicine, vol. 2013, Article ID 727602, 7 pages, [3] H. Xin and W. Jianan, “Up regulation of endogenous leptin 2013. improves human mesenchymal stem cell survival ability in vitro and this cells protect fatal cardial mycocytes from apoptosis,” [18] I. Sadaf Farooqi and S. O’Rahilly, “Leptin: a pivotal regulator of Cardiovascular Disease Clinical Research, vol. 98, 2012. human energy homeostasis,” The American Journal of Clinical Nutrition,vol.89,no.3,pp.980s–984s,2009. [4] H. Noor and S. J. H. Ashcroft, “Pharmacological characterisa- tion of the antihyperglycaemic properties of Tinospora crispa [19] M. N. Norazmir and M. Y. Ayub, “Beneficial lipid-lowering extract,” Journal of Ethnopharmacology,vol.62,no.1,pp.7–13, effects of pink guava puree in high fat diet induced-obese rats,” 1998. Malaysian Journal of Nutrition,vol.16,no.1,pp.171–185,2010. [5]M.Hamid,S.P.M.Bohari,M.S.Bastami,A.M.Ali,N.M. [20]T.D.Filippatos,C.S.Derdemezis,I.F.Gazi,E.S.Nakou,D.P. Mustapha, and K. Shari, “Evaluation of the insulinotrophic Mikhailidis, and M. S. Elisaf, “Orlistat-associated adverse effects activity of Malaysian traditional plants extract,” Journal of and drug interactions: a critical review,” Drug Safety,vol.31,no. Biological Sciences,vol.8,no.1,pp.201–204,2008. 1,pp.53–65,2008. [6] M.N.Abu,M.A.M.Salleh,Z.Eshak,M.H.Hasan,H.F.Hassan, [21] R. H. Mahmoud and W. A. Elnour, “Comparative evaluation andW.I.W.Ismail,“Anti-proliferativeeffectofTinaspora crispa of the efficacy of ginger and orlistat on obesity management, (L.)Hook.F.&ThompsonandGelam(Melaleuca sp.) honey on pancreatic lipase and liver peroxisomal catalase enzyme in male several cancer cell lines,” in Proceedings of the IEEE Symposium albino rats,” European Review for Medical and Pharmacological on Business, Engineering and Industrial Applications (ISBEIA Sciences,vol.17,no.1,pp.75–83,2013. ’11), pp. 545–548, September 2011. [7]S.Samat,N.A.M.Nor,F.N.Hussein,andW.I.W.Ismail, “Effects of Gelam and Acacia honey acute administration on some biochemical parameters of Sprague Dawley rats,” BMC Complementary and Alternative Medicine,vol.14,pp.1–8,2014. [8]M.S.A.Kamal,A.R.Ghazali,N.A.Yahya,M.I.Wasiman, and Z. Ismail, “Acute toxicity study of standardized Mitragyna speciosa korth aqueous extract in Sprague Dawley rats,” Journal of Plant Studies,vol.1,no.2,2012. [9]A.Afzan,N.R.Abdullah,S.Z.Halimetal.,“Repeateddose 28-days oral toxicity study of Carica papaya L. Leaf extract in Sprague Dawley rats,” Molecules,vol.17,no.4,pp.4326–4342, 2012. [10] R. A. DeFronzo, “Insulin resistance, lipotoxicity, type 2 diabetes and atherosclerosis: the missing links. The Claude Bernard Lecture 2009,” Diabetologia,vol.53,no.7,pp.1270–1287,2010. [11] S. Pradeep, S. Anindh, and C. Tanushree, “Natural products with potent hypoglycemic activity,” Research Journal of Phar- macy and Technology,vol.3,no.3,pp.650–656,2010. Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2015, Article ID 747982, 14 pages http://dx.doi.org/10.1155/2015/747982

Review Article Ancient Records and Modern Research on the Mechanisms of Chinese Herbal Medicines in the Treatment of Diabetes Mellitus

Hai-ming Zhang,1 Feng-xia Liang,2 and Rui Chen1

1 Department of Traditional Chinese Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, No. 1277 Jiefang Street, Wuhan, Hubei 430022, China 2 Department of Acupuncture and Moxibustion, Hubei University of Traditional Chinese Medicine, No.1TanhualinStreet,Wuhan,Hubei430060,China

Correspondence should be addressed to Feng-xia Liang; [email protected] and Rui Chen; [email protected]

Received 15 March 2014; Accepted 25 June 2014

Academic Editor: Srinivas Nammi

Copyright © 2015 Hai-ming Zhang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Over the past decades, Chinese herbal medicines (CHM) have been extensively and intensively studied through from both clinical and experimental perspectives and CHM have been proved to be effective in the treatment of diabetes mellitus (DM). This study, by searching ancient records and modern research papers, reviewed CHM in terms of their clinical application and principal mechanism in the treatment of DM. We summarized the use of CHM mentioned in 54 famous ancient materia medica monographs and searched papers on the hypoglycemic effect of several representative CHM. Main mechanisms and limitations of CHM and further research direction for DM were discussed. On the basis of the study, we were led to conclude that TCM, as a main form of complementary and alternative medicine (CAM), was well recorded in ancient literatures and has less adverse effects as shown by modern studies. The mechanisms of CHM treatment of DM are complex, multilink, and multitarget, so we should find main hypoglycemic mechanism through doing research on CHM monomer active constituents. Many CHM monomer constituents possess noteworthy hypoglycemic effects. Therefore, developing a novel natural product for DM and its complications is of much significance. It is strongly significant to pay close attention to CHM for treatment of DM and its complications.

1. Introduction Complementary and alternative medicine (CAM) have been extensively used in modern times. TCM, as a main form Diabetes mellitus (DM), including type 1 and type 2, has ofCAM,hasbeenprovedtobeeffectiveforthetreatment become epidemic worldwide [1–3], and its incidence has been of DM with relatively less side effects in China and beyond on rise year by year [4]. Previous reports have demonstrated [10, 11]. Some hypoglycemic drugs of plant origin have been that overweight, especially obesity at younger ages, substan- approved for clinical use by the regulatory authorities in tially increases the risk for DM [1, 5–8]. The finding is consis- China, such as Yusanxiao, Yijin,andKelening,amongothers tent with the description in the “Medical Classic of the Yellow [12]. Emperor,” the earliest monumental work on the traditional The mechanisms of Chinese herbal medicines (CHM) in Chinese medicine (TCM) dating back to the Warring States the treatment of DM have been extensively and intensively Period (about 446 B.C.−221 B.C.). DM increases the risk studied from biological, immunological, and phytochemical for micro- and macrovascular complications and premature perspectives and great advances have been made in the death and poses tremendous socioeconomic burden [2, 4, 9]. past decades. This paper reviewed records or descriptions In spite of the introduction of insulin and other hypoglycemic concerning the use of CHM for treatment of DM in ancient agents,sofar,notreatmentprotocolscanachieveacomplete Chinese literatures (before 1920 A.D.) and the modern papers cure. Moreover, the side effects of these drugs, which are on the mechanisms of CHM treating DM. We also compared substantial and inevitable, present another challenge. the CHM used in ancient and modern times, examined the 2 Evidence-Based Complementary and Alternative Medicine

Table 1: A similar comparison of the symptoms of “Xiao Ke”andDM.

Symptoms of “Xiao Ke”inZhuBingYuanHouLuna Symptoms of DM in Textbook of Internal Medicine [22] Polydipsia; dry mouth and lips; polyphagia; hunger; emptiness of the stomach; frequent urination; polyuria; Polydipsia; thirst; polyphagia; hunger; polyuria; General glucosuria; emaciation; adiposity; fatigue of limbs; marasmus; obesity; sweet taste of urine; itchy skin; symptoms mental fatigue; feverish dysphoria; itchy skin; vulva pruritus; fatigue; lightheadedness. hyperhidrosis; dizziness; sweet feeling in the mouth. Carbuncle and soreness; night blindness; internal Carbuncle and furuncle; diabetic retinopathy; oculopathy; lung tuberculosis; edema; precordial pain; pulmonary tuberculosis; diabetic cardiomyopathy; pectoral stuffiness pain; apoplexy; coma; impotence; diabetic ketoacidosis; diabetic impotence; glaucoma; foot carbuncle-abscess; unsmooth defecation; diarrhea; Complications diabetic nephropathy; atherosclerosis; cerebral anorexia; short breath; waist soreness; dizziness and ischemic stroke; diabetic foot; constipation; diarrhea; tinnitus; pachylosis; whitish and turbid urine; muscle myophagism; paralysis; oliguria; hyperhidrosis; atrophy of the lower extremities; oliguria; nightly hypohidrosis or anhidrosis; diabetic gastroparesis. sweating; coolness of extremities. aThe “Zhu Bing Yuan Hou Lun”: a book describing causes and manifestations of diseases by Yuanfang Chao, a famous TCM doctor born about AD 550and died in 630 A.D. in the Sui Dynasty. limitations of CHM for treating DM, and discussed the future ancient people believe to be able to make them achieve research trend. longevity.

2. Ancient Records on Treatment of 2.1.3. Symptoms. Thesymptomscanbecategorizedintotwo groups: general symptoms and complications. The general DM with TCM symptoms include polydipsia, polyphagia, polyuria, glucosuria, emaciation, dry mouth, hunger, emptiness of the Our search of literatures of TCM (before 1920 A.D. or earlier) stomach, and frequent urination. And complications include failed to find the term “DM.” We found a plenty of records diabetic foot, diabetic retinopathy, lung tuberculosis, dia- or descriptions about “Xiao Ke,” which, in terms of epi- betic impotence, and diabetic nephropathy. Obviously, those demiology, symptoms, etiology, pathogenesis, and treatment, symptoms and complications are extremely similar to DM, as mimicked those of DM. And it is generally accepted that shown in Table 1. “Xiao Ke” mentioned in ancient Chinese literature is similar to DM of modern medicine [13]. On basis of this assumption, in this paper, we used DM interchangeably with “Xiao Ke” 2.1.4. Etiology and Pathogenesis. According to the theory for the convenience of discussion though they are not strictly of TCM, the symptoms are essentially caused by “Yin Xu” equivalents in a number of ways. (Yin deficiency) and “Zao Re” (dryness heat). In TCM there is a belief that Yin deficiency is the “Ben” (origin or root cause)anddrynessheatisthe“Biao” (symptoms or external 2.1. Terminology, Epidemiology, Symptoms, Etiology, and manifestations). The Ben or root causes involve the invasion Pathogenesis of “Xiao Ke” of exogenous pathogens, innate deficiency, intemperance in eating, abnormal emotional states (anger, anxiety, depression, 2.1.1. Name. In TCM, “Xiao Ke” refers to a cluster of clinical distress, panic, and fear), excessive physical strains (mental or symptoms, including polydipsia, polyphagia, polyuria, ema- physical exertion and sexual intercourse), or propensity for ciation, glucosuria, and fatigue. As aforementioned, “Xiao abusing Dan medicines [11]. Yin and Yang are two opposing Ke” is a general term for a condition that resembles DM in aspects of things. For instance, cold, moist, night, structure, terms of symptoms. DM classically was divided into three and downward mobility belong to Yin while heat, dryness, types: upper, middle, and lower “Xiao Ke.” Th e upp e r t y p e day, function, and upward mobility belong to Yang [14]. (Shang Xiao) is characterized by excessive thirst, the middle type (Zhong Xiao) by excessive hunger, and the lower type 2.2. Treatment. We searched for the term “Xiao Ke”in (Xia Xiao)byexcessiveurination[13]. By searching “Xiao Ke,” more than 1,000 TCM ebooks included in Encyclopedia of weretrievedalargenumberofrecordsconcerning“Xiao Ke” TCM (Compact Disk, ISBN: 7-900377-49-2/R⋅8), published in ancient TCM literatures. by Hunan Electronic and Audiovisual Publishing House. The database contained, among others, “Bencao Gangmu 2.1.2. Epidemiology. The earliest mention of “Xiao Ke”was (Compendium of Materia Medica)”, Puji fang, and so forth. in the “Medical Classic of the Yellow Emperor.” The book described that the “Xiao Ke”wasmostlyfoundinwealthy, 2.2.1. CHM. Wealso searched the database for Chinese crude obese individuals who liked food rich in oil or fat and in drugs for treating “Xiao Ke.” The database contained only influential officials who were on pillsDan, or“ ”asitwas 54 monographs on Chinese materia medica. Most CHM termed in the book, a mineral-based synthetic drug, which treated “Xiao Ke”by“Qing Re”(clearingheat)(Figure 1), Evidence-Based Complementary and Alternative Medicine 3

30 30 25 25 20 20 15 15 10 10 Frequency Frequency 5 5 0 0 abcdef ghi jklmnopqrs t abcdef ghi jklmnopqrs t

CHM CHM

Figure 1: Frequency of heat-clearing (Qing Re)drugsfor“Xiao Ke” Figure 2: Frequency of Yin-nourishing (Yang Yin) and energy- mentioned in 54 monographs on Chinese materia medica. Heat- replenishing (Yi Qi)drugsfor“Xiao Ke” mentioned in 54 mono- clearing drugs are of Liang (cold or cool) or bitter taste. a: Pueraria graphs on Chinese materia medica. Yin-nourishing and energy- lobata (Willd.) Ohwi; b: Trichosanthes kirilowii Maxim.; c: Fructus et replenishing drugsare of sweetish taste and are of cold (Liang) semen trichosanthis kirilowii;d:Lemna minor L.; e: Gypsum fibrosum; nature. a: Lycium barbarum L.; b: Tussilago farfara L.; c: Poria f: Alisma orientale (Sam.) Juz.; g: Coptis chinensis Franch.; h: cocos (Schw.) Wolf; d: Panax ginseng C. A. Mey.; e: Eleocharis Anemarrhena asphodeloides Bunge; i: Lophatherum gracile Brongn.; dulcis (Burm.f.) Trin. ex Hensch.; f: Morus alba L.; g: Adenophora j: Succus bambusae (Recens); k: Arctium lappa L.; l: Phragmites trachelioides Maxim.; h: Cannabis sativa L.; i: Ophiopogon japon- australis (Cav.) Trin. ex Steud.; m: Benincasa hispida (Thunb.) Cogn.; icus (Thunb.) Ker Gawl.; j: Armeniaca mume Siebold; k: Aspara- n: Phaseolus calcaratus Roxb.; o: Scutellaria baicalensis Georgi; p: gus cochinchinensis (Lour.) Merr.; l: Cuscuta chinensis Lam.; m: Solanum lyratum Thunb.; q: Vitex negundo var. cannabifolia (Siebold Achyranthes bidentata Blume; n: Coix lacryma-jobi L.;o:Astragalus and Zucc.) Hand.-Mazz.; r: Phellodendron chinense C. K. Schneid.; membranaceus (Fisch.) Bunge; p: Polygonatum odoratum (Mill.) s: Gardenia jasminoides J. Ellis; t: Lycium chinense Mill. Druce; q: Rhus chinensis Mill.; r: Schisandra chinensis (Turcz.) Baill.; s: Lilium lancifolium Thunb.; t: Rehmannia glutinosa Steud.

“Yang Yin”(nourishingYin), and “Yi Qi”(replenishingvital 20 energy) (Figure 2).TheLatinnamesofCHMusedinthe paper were from the website http://www.theplantlist.org/ or 15 http://www.wikipedia.org/. 10

2.2.2. Foods. Besides, the monographs also mentioned some Frequency 5 foods that help treat “Xiao Ke”inFigure 3. 0 abcdef ghi jklmnopqrs t

3. Mechanisms by Which CHM Work on DM Food and Its Complications Figure 3: Frequency of meat, grains, fishes, and other food that help We searched the databases of PubMed, Web of Science, treat “Xiao Ke” mentioned in 54 monographs on Chinese materia MEDLINE, and CNKI and found that less research attention medica. a: chicken; b: millet; c: barley; d: bamboo shoot; e: cony was paid to Chinese herbal compounds while most studies meat; f: Benincasa hispida; g: watershield leaf; h: mud eel; i: radish; focusedonasingleherbalmedicine. j:foxtailmilletseed;k:snail;l:cow’smilk;m:goosemeat;n:Charr; The mechanisms of CHM in the treatment of DM have o: long surf clam; p: wheat; q: mung bean; r: Gallus black-bone silky been extensively and intensively studied from biological, fowl;s:hairychestnutseed;t:giantgecko. immunological, and phytochemical perspectives (Tables 2, 3, and 4). become drugs for the treatment of DM by further exploring 4. Results their hypoglycemic effects. We also found that some foods were used for treatment of DM in ancient times, and their We found more than 40 CHM with hypoglycemic effect hypoglycemic effects have been confirmed nowadays [15, 16]. in ancient works and reviewed the mechanism of CHM The mechanisms by which CHM treat diabetes include lowering blood sugar. We were led to conclude that a number the following: (1) CHM increase insulin sensitivity and of CHM, including Panax ginseng C. A. Mey., Astragalus ameliorate insulin resistance; (2) CHM promote insulin membranaceus (Fisch.) Bunge, and Lonicera japonica Thunb., secretion and elevate serum insulin levels; (3) CHM inhibit were used in ancient times and also nowadays. In addition, 𝛼-glucosidase activity; (4) CHM protect islet 𝛽 cells and pro- some CHM used for treating DM in ancient works have not mote their regeneration; (5) CHM increase hepatic glycogen been studied for hypoglycemic effect in modern times, such content and suppress gluconeogenesis; (6) CHM inhibit the as Lemna minor L., Gardenia jasminoides J. Ellis, Eleocharis secretion of glucagon; (7) CHM promote the glucose uptake dulcis (Burm.f.) Trin. ex Hensch., and Achyranthes bidentata by adipose and muscular tissues (Figure 4). Mechanisms of Blume (Figures 1 and 2). These CHM may have potential to CHM treating diabetic complications include the following: 4 Evidence-Based Complementary and Alternative Medicine ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 31 41 33 32 35 23 25 39 27 38 24 29 30 36 26 34 42 37 28 40 [ [ [ g/mL 𝜇 ND 200 < ). YES, Yi Qi IIAI NO [ IIAI ND [ IIAI ND [ IIAI ND [ IIAI ND IIAIIIAI ND ND [ [ PIEI ND [ PIEI ND [ PIEI ND [ PIPR ND [ PIPR ND [ BLIR ND [ BLIR ND [ BLIR ND [ IHSG COSR ND [ RAAR ND [ Mechanisms Toxic effect References PIEI, PIPR, PRGU ND [ IIAI, IHSG, PRGU ND ) and benefiting vital energy ( mol g/mL 𝜇 𝜇 range 0.01 50 mg/Kg 700 mg/Kg 700 mg/Kg 200 mg/Kg 0.5, 5 Yang Yin 1, 5, 10 mg/Kg 75, 300 mg/Kg ( Effective doses/doses Yin Human umbilical vein endothelial cells Sprague-Dawley (SD) rats C2C12 cells 0.05–0.2 mg/mL SD rats 1, 5 mg/Kg Models BABL/c mice 100, 200 mg/Kg Goto-Kakizaki rats, Wistar rats 3T3-L1 adipocytes, Min6 cells, human embryo kidney 293 cells, C57BL/KsJ-db/db mice, C57BL/6J mice Wistar ratsKun Ming miceSD rats 4.5 g/Kg 4 mg/Kg 200 mg/Kg KKAy mice, C57BL/6J mice KKAy mice, C57BL/6J mice Ob/ob miceC57BL/6J mice 300 mg/Kg 100, 400 mg/Kg SD rats islet 0.1–1 mg/mL KK/HIJ mice 300 mg/Kg WistarratsWistar ratsSD rats 50,100mg/Kg 1 mg/Kg 20 mg/Kg BALB/c mice, SD rats 200, 400 mg/Kg Wistarrats 100,200mg/Kg In vivo In vitro In vitro In vivo In vivo/ in vitro In vivo In vitro In vivo In vivo In vivo In vivo In vivo In vivo In vivo In vitro In vivo In vivo In vivo In vivo In vivo In vivo In vivo In vivo Astragaloside IV Calycosin Polysaccharide Aqueous extract Polysaccharose Dehydrotumulosic acid, dehydrotrametenolic acid, pachymic acid, triterpenes Crude polysaccharide, water extract Decocted water Extracts or monomers Malonyl ginsenosides Ginsenoside Rh2 Polysaccharide Polysaccharide Ginsenoside Ginsenoside Re Polysaccharide Polysaccharide Polysaccharide Crude extract solid-state fermented mycelium Schisandraceae Lignan Liliaceae Leguminosae Clavicipitaceae Table 2: Main mechanisms of CHM treating DM and its complications by nourishing L. Dioscoreaceae Wall. Araliaceae Panax notoginoside (Turcz.) Lour. Liliaceae C. A. Mey. Araliaceae (Schw.) Wolf Polyporaceae Latin nameLiriope spicata Ophiopogon japonicus (Thunb.) KerGawl. Family Astragalus membranaceus (Fisch.) Bunge Panax ginseng Panax pseudoginseng Poria cocos Dioscorea oppositifolia Schisandra chinensis Ophiocordyceps sinensis (Berk.) G. H. Sung, J. M.Hywel-Jones, Sung, and Spatafora Baill. Evidence-Based Complementary and Alternative Medicine 5 ] ] ] ] ] ] ] ] ] ] ] ] 51 52 39 39 43 45 47 50 49 48 46 44 [ [ [ -glucosidase activity; PIPR: CHM protect 𝛼 PIEI ND [ IHSG ND [ INGA ND COSR ND RAARRAAR ND ND [ [ glucagon; PRGU: CHM promote the glucose uptake PIPR, PIEI ND [ Mechanisms Toxic effect References PIPR, COSR NO COSR, BLIR NO [ COSR, INGA NO [ PIEI, PIPR, IHSG YES, cytotoxicity [ INSG, IHSG, PIEI ND [ r inhibiting nitric oxide synthesis; RAAR: CHM regulate the GA: CHM inhibit L 𝜇 mol 𝜇 g/ 𝜇 g/mL g/mL g/mL g/mL 𝜇 𝜇 𝜇 𝜇 range 1000 mg/Kg 0–25 125, 250, 500, 0–200 5, 125, 250 50, 100, 200 mg/Kg Effective doses/doses cell 𝛽 -Glucosidase 1.2–2.1 Wistarratislets 25–100 𝛼 Mouse splenocytes, Jurkat cell, MCF-7 cells THP-1 cells 100, 300, 500 Models Kun Ming miceKun Ming mice 1.8 g/Kg 4.5 g/Kg BALB/c mice,Albino Swiss mice 200, 500 mg/Kg 50, 100, 200 mg/Kg BRIN-BD11 cells, H4IIE cells Kun Ming mice, SD rats Wistar rats 20 mg/Kg Rat pancreatic Wistar rats 0.1 mg/Kg SD rats 500 mg/Kg derived cell line, INS-1 NIH mice, SD rats Table 2: Continued. In vitro In vitro In vitro In vitro In vivo/ in vitro In vivo In vivo In vivo In vivo In vivo In vivo In vitro In vivo In vivo In vivo In vitro Catalpol Flavonoid, saponin Catalpol Extracts or monomers Methanol extract Total flavonoids Atractylenolide, amino acid Saccharides, amino acid Proanthocyanidins Cornaceae Liliaceae Compositae Campanulaceae PunicaceaePunicaceae Water extract Polyporaceae Polysaccharide Polysaccharides Scrophulariaceae L. Araliaceae Ginsenoside Siebold cells and promote their regeneration; IHSG: CHM increase hepatic glycogen content and suppress gluconeogenesis; INSG: CHM inhibit the secretion of 𝛽 and Zucc Latin nameCornus Officinalis Polygonatum odoratum Family (Mill.) Druce Atractylodes macrocephala Koidz. Codonopsis pilosula (Franch.) Nannf. Panax quinquefolius Rehmannia glutinosa Steud. Dendrobium moniliforme (L.) Sw. Dendrobium chrysotoxum Lindl. Ganoderma lucidum (Leyss. ex Fr.) Karst IIAI: CHM increase insulin sensitivity and ameliorate insulin resistance; PIEI: CHM promote insulin secretion and elevate serum insulin levels; IN islet by adipose and muscular tissues.activity COSR: of CHM aldose control reductase; oxidative BLIR: stress CHM response, block such inflammatory as response. NO scavenging means oxygennot radicals, toxic. preventing lipid ND means peroxidation, o data no available. meansYES toxic. 6 Evidence-Based Complementary and Alternative Medicine ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 61 55 57 39 59 63 65 62 56 67 54 60 66 64 53 58 [ [ PIEI, PRGU ND PRGU, INGA ND ). Qing Re g/mL PIEI NO [ 𝜇 mol IHSG NO [ mol PIPR, COSR ND [ g/mL 𝜇 𝜇 𝜇 2g/Kg IIAI ND [ 2.3 g/Kg INGA, RAAR ND [ 100 60 mg/Kg IIAI ND [ 40 mg/Kg COSR ND [ 1–20 150 mg/Kg IHSG, PIPR ND [ 150 mg/Kg COSR ND [ 150 mg/Kg IIAI ND [ 0.01 5, 10 mg/Kg 0.01–1 mg/mL, 150, 300 mg/Kg PIPR, IHSG, PRGU ND [ 100, 200 mg/Kg IIAI ND [ 200, 400 mg/Kg 200, 400 mg/Kg IHSG ND [ 0.01–0.125 Powder 5% in rat food BLIR ND [ Effective doses/doses range Mechanisms Toxic effect References cells 𝛽 Albino rats Human HepG2 cells, HUVECs Wistar rats Intestinal brush border membrane vesicles, rat hepatoma cell line H4IIE, humanskinfibroblastscell line Hs68, mouse adipocytes 3T3-L1 ICR mice C57BL/6J mice 3T3-L1 adipocytes, C2C12 cells MIN6 Models Newborn Wistar rats Wistar rats Db/db mice Wistar rats Albino Wistar rats Albino Wistar rats SD rats C57BL/6J mice Kun Ming mice Wistar rats islets In vivo In vitro In vivo In vitro In vitro In vivo In vivo In vitro In vivo/ in vitro In vivo In vivo In vivo In vitro In vivo In vivo In vivo In vivo In vivo In vivo Table 3: Main mechanisms of CHM treating DM and its complications by clearing heat ( Fenugreek seeds powder Trigonelline Paeonoside, apiopaeonoside, 6- methoxypaeoniflori- genone Polysaccharide-2b Aqueous extract Ethanolic extract Saponins, momordicine II, kuguaglycoside 1-Deoxynojirimycin, polysaccharide Puerarin Hydroalcoholic extract Geniposide Extracts or monomers Paeonol Saponin fraction, lipid fraction Puerarin Daidzein Protein extract Moraceae Leguminosae Rubiaceae Family Paeoniaceae Cucurbitaceae Leguminosae J. L. L. (Willd.) L. Ellis Latin name Paeonia x suffruticosa Andrews Morus alba Momordica charantia Pueraria lobata Ohwi Trigonella foenum-graecum Gardenia jasminoides Evidence-Based Complementary and Alternative Medicine 7 ] ] ] ] ] ] ] ] ] ] ] ] 75 74 72 39 39 77 68 71 73 76 70 69 [ [ [ [ [ [ IIAI ND PIEI ND IIAI ND INGA ND PRGU ND PIEI, INGA ND g/mL mol/L COSR ND [ 𝜇 g/mL 𝜇 g/mL 𝜇 mol/L 𝜇 𝜇 1.8 g/Kg INGA ND [ 2.3 g/Kg RAAR ND [ 5 5mg/Kg 3 80 mg/Kg 108 mg/Kg 100 mg/Kg 380 mg/Kg 200 mg/Kg BLIR ND [ 0.41 0.032 mg/mL 25, 50 mg/Kg 12.5, 25 0.1–100 369, 501 mg/Kg PIPR, COSR ND [ 100, 200 mg/Kg PIPR, COSR ND [ 2.5, 10, 40 mg/L 400, 800 mg/Kg 125, 500, 250 mg/Kg, Effective doses/doses range Mechanisms Toxic effect References db mice /Lepr ob db /Lep ob B6. V- Lep Homozygous C57BL/Ks db/db mice mice, Rat insulinoma cell line, INS-1 cells SD rats ventricular myocytes Models Wistar rats, Beagle dogs Kun Ming mice Kun Ming mice 3T3-L1 adipocytes Wistar rats L6 rat skeletal muscle cells Wister rats Caco-2 cells Wistar rats 3T3-L1 cells, L6 cells C57BLKS/J-Lepr ICR mice Wistar rats SD rats HIT-T15 cell line Table 3: Continued. In vivo In vivo In vivo In vivo In vitro In vitro In vitro In vivo/ in vitro In vivo In vivo In vitro In vivo In vitro In vivo In vitro In vivo In vivo In vitro In vivo Crude ethanol extract Timosaponin, anemaran Chlorogenic acid, ginnol Extracts or monomers Cinchonain-Ib Total saponins Berberine chloride form Flavonoids, triterpenoids Ethyl acetate fraction Berberine Berberine Berberine Araceae Liliaceae Caprifoliaceae Family Rosaceae Ranunculaceae Rosaceae L. Emodin Bunge Thunb. Franch. L. Bunge Latin name Rheum palmatum Acorus calamus Eriobotrya japonica (Thunb.) Lindl. Anemarrhena asphodeloides Lonicera japonica Coptis chinensis Potentilla discolor 8 Evidence-Based Complementary and Alternative Medicine ] ] ] ] 78 79 81 80 [ [ -glucosidase activity; PIPR: CHM protect 𝛼 INGA ND IHSG, PRGU ND glucagon; PRGU: CHM promote the glucose uptake r inhibiting nitric oxide synthesis; RAAR: CHM regulate the GA: CHM inhibit g/mL g/mL 𝜇 𝜇 0.1–3 0.5–32 60, 120 mg/Kg COSR, BLIR ND [ 200, 25 mg/Kg 100–500 mg/Kg 0.3%, 0.9%, 2.7% gum IIAI, IHSG ND [ Effective doses/doses range Mechanisms Toxic effect References mice ob /Lep ob -glucosidase Table 3: Continued. Models SD rats Zucker diabetic fatty rats, Zucker lean rats C57BL/6J mice, B6. V-Lep 𝛼 L6 myotubes Wistar rats In vivo In vivo/ in vitro In vivo In vitro In vivo In vitro In vivo Artemisia sphaerocephala Krasch. gum Extracts or monomers Oxymatrine Methanolic extract Arctigenin Compositae Family Leguminosae Punicaceae Compositae Aiton L. Krasch. L. cells and promote their regeneration; IHSG: CHM increase hepatic glycogen content and suppress gluconeogenesis; INSG: CHM inhibit the secretion of 𝛽 Latin name Artemisia sphaerocephala Sophora flavescens Punica granatum Arctium lappa IIAI: CHM increase insulin sensitivity and ameliorate insulin resistance; PIEI: CHM promote insulin secretion and elevate serum insulin levels; IN islet by adipose and muscular tissues.activity COSR: of CHM aldose control reductase; oxidative BLIR: stress CHM response, block such inflammatory as response. NO scavenging means oxygennot radicals, toxic. preventing lipid ND means peroxidation, o data no available. meansYES toxic. Evidence-Based Complementary and Alternative Medicine 9 ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 93 39 82 39 39 92 88 89 86 84 90 91 83 85 87 [ [ [ [ g/mL 𝜇 NO 200 < -glucosidase activity; PIPR: CHM protect 𝛼 PIEI ND PIEI ND PIPR ND [ IHSG ND [ INGA ND COSR ND [ COSR ND [ COSR ND [ COSRCOSR ND ND [ [ COSR ND [ PRGU NO [ PRGU, IIAI ND [ Mechanisms Toxic effect References PIPR, COSR glucagon; PRGU: CHM promote the glucose uptake PIPR, COSR, IHSG ND [ r inhibiting nitric oxide synthesis; RAAR: CHM regulate the GA: CHM inhibit (activating blood circulation and easing congestion). g/mL g/mL g/mL 𝜇 𝜇 𝜇 g/mL 𝜇 1.87 g/Kg 10 300 mg/Kg 300 mg/Kg 50–150 Long term study, Huo Xue Hua Yu Short term study, 100, 200, )or Yang (tonifying C57BL/KsJ-db/db mice Caco-2 cells 0.03–4 mg/mL Models Effective doses/doses range HMEC-1 cells, human microvascular endothelial cells HIT-T15 cells, human pancreatic islets 3T3-L1 adipocytesICR mice, 0.02–0.5 mg/mL Kun Ming miceKun Ming mice 10,Kun 30 Ming mg/Kg mice 1.4 g/Kg ICR mice 700 mg/Kg 1.4Db/db g/Kg mice 1.2 g/Kg 500 mg/Kg SD rats 80 mg/Kg RIN-m5F cells 10–100 Wistar rats 200 mg/Kg L6 rat myoblastBALB/c miceWistar rats 5–40 SD rats 0.0125 mg/mL, 0.75, 1.5 g/100 mL, Wen Yang / In vitro In vivo in vitro In vitro In vivo In vivo In vivo In vivo In vivo In vivo In vivo In vitro In vitro In vivo In vivo In vitro In vivo In vivo In vivo In vitro Water extract Polysaccharide Extracts or monomers Aqueous ethanolic extract Methanolic extract Cinnamaldehyde, benzyl benzoate Cinnamaldehyde, cinnamyl acetate, cassioside Lignans Ethanol extract Phenolic gingerol Hot water extract L-Ephedrine, alkaloid Aqueous extract Chloroform extract Icariin Hydrophilic extract Family Zingiberaceae Umbelliferae Lauraceae Lauraceae Eucommiaceae Arecaceae Zingiberaceae Araliaceae Ephedraceae Caricaceae Combretaceae Berberidaceae Lamiaceae Stapf L. Maxim. (Rupr. and Table 4: Main mechanisms of CHM treating DM and its complications by cells and promote their regeneration; IHSG: CHM increase hepatic glycogen content and suppress gluconeogenesis; INSG: CHM inhibit the secretion of 𝛽 Maxim.) Harms Latin name Amomum xanthioides Wall. ex BakerAngelica hirsutiflora Tang S. Liu,andT.I.Chuang C. Y. Chao, Ramulus cinnamomi Cinnamomum cassia (Nees and T. Nees) J. Presl Eucommia ulmoides Oliv. Daemonorops draco (Willd.) Blume Zingiber officinale Roscoe Acanthopanax senticosus Ephedra sinica Carica papaya Terminalia chebulaRetz. Epimedium brevicornum Salvia miltiorrhiza Bunge IIAI: CHM increase insulin sensitivity and ameliorate insulin resistance; PIEI: CHM promote insulin secretion and elevate serum insulin levels; IN islet by adipose and muscular tissues.activity COSR: of CHM aldose control reductase; oxidative BLIR: stress CHM response, block such inflammatory as response. NO scavenging means oxygennot radicals, toxic. preventing lipid ND means peroxidation, o data no available. meansYES toxic. 10 Evidence-Based Complementary and Alternative Medicine

𝛽 cells 𝛼 cells PIPR

PIEI Polygonatum odoratum Panax ginseng C. A. Mey. Pancreas (Mill.) Druce

Glucagon Insulin

Dendrobium moniliforme INSG IIAI Schisandra chinensis (L.) Sw. (Turcz.) Baill.

Blood glucose PRGU

Liver Muscle and IHSG adipose tissue

INGA

Astragalus membranaceus Paeonia x suffruticosa More (Fisch.) Bunge Andrews CHM

Coptis chinensis Franch. Small intestine

Figure 4: Main mechanisms of CHM working on DM. IIAI: CHM increase insulin sensitivity and ameliorate insulin resistance; PIEI: CHM promote insulin secretion and elevate serum insulin levels; INGA: CHM inhibit 𝛼-glucosidase activity; PIPR: CHM protect islet 𝛽 cells and promote their regeneration; IHSG: CHM increase hepatic glycogen content and suppress gluconeogenesis; INSG: CHM inhibit the secretion of glucagon; PRGU: CHM promote the glucose uptake by adipose and muscular tissues. In the figure, seven CHM examples were given. CHM may involve a variety of hypoglycemic mechanisms, and only the main mechanism is mentioned in this figure. Dotted line means the possible ways in which CHM exert hypoglycemic effects. Solid lines show potential hypoglycemic mechanisms.

(1) CHM control oxidative stress response, such as scavenging In addition, many modern clinical researches tended oxygen radicals, preventing lipid peroxidation, or inhibiting to focus on curative effects rather than underlying mecha- nitric oxide synthesis; (2) CHM regulate the activity of nisms. Although molecular biological, immunological, and aldose reductase; (3) CHM block inflammatory response. phytochemical techniques have been widely applied to study Furthermore, CHM hypoglycemic effects are mainly based the mechanism of CHM treating DM, the nature of many on IIAI, PIEI, INGA, PIPR, PRGU, and IHSG and fewer components or extracts was still not very clear. CHM are based on INSG. 5.2. Advantages of CHM in the Treatment of DM. Although CHM have many limitations, as aforementioned, the hypo- 5. Discussion glycemic effects of some CHM were well documented, and 5.1. Limitations of Ancient Records and Modern Studies. First, some can effectively ameliorate certain clinical symptoms of someCHMcanalleviatesomesymptomsofDMsuchas DM, such as polydipsia, polyuria, and polyphagia. A number polydipsia, polyuria, and polyphagia. However, this does not of studies have shown that CHM or their extracts used in necessarily mean that they are able to lower blood sugar. combination with western medicines work even better for the These drugs include Phragmites australis (Cav.) Trin. ex treatment of DM [19, 20]. For example, Trigonella foenum- Steud., Alisma orientale (Sam.) Juz., and Gypsum fibrosum. graecum L. Saponin given together with sulphonylureas could Second, toxicological studies on CHM were rarely conducted effectively control the serum glucose, with few side effects, in or no information was available on the toxicity of CHM. DM patients whose serum glucose was not well controlled by Fourth, many modern clinical and experimental studies on oral administration of sulphonylureas [21]. CHM were methodologically defective, which reduces their reliability and validity. Chen et al. and Li et al.’s results also 5.3. Recommendations for Further Study of CHM for the Treat- stated this limitation [17, 18]. ment of DM. CHM are increasingly used for the treatment Evidence-Based Complementary and Alternative Medicine 11 of DM primarily because of increased awareness, on the [4]S.Wild,G.Roglic,A.Green,R.Sicree,andH.King,“Global part of patients and doctors, of their advantages, such as prevalence of diabetes: estimates for the year 2000 and projec- effectiveness, natural origin, and safety. However, in order tions for 2030,” Diabetes Care,vol.27,no.5,pp.1047–1053,2004. to further extend their scope of application, the limitations [5]K.M.V.Narayan,J.P.Boyle,T.J.Thompson,E.W.Gregg,and of CHM should be avoided. More evidence-based clinical D. F. Williamson, “Effect of BMI on lifetime risk for diabetes in trials should be performed to substantiate the efficacy of the U.S.,” Diabetes Care, vol. 30, no. 6, pp. 1562–1566, 2007. CTM prescriptions and crude CHM for the treatment of [6] P.Zimmet,K.G.M.M.Alberti,andJ.Shaw,“Globalandsocietal DM. To confirm the effect of CHM on DM, larger-scale, implications of the diabetes epidemic,” Nature,vol.414,no. multicentered, randomized, and controlled clinical trials 6865, pp. 782–787, 2001. areneededandstatisticalmethodsshouldbeusedinall [7] K. M. Flegal, M. D. Carroll, C. L. Ogden, and L. R. Curtin, clinical trials. Besides, the mechanisms of CHM and pre- “Prevalence and trends in obesity among US adults, 1999–2008,” the Journal of the American Medical Association,vol.303,no.3, scriptions should be examined at the molecular and cellular pp.235–241,2010. levelsbyfullytakingadvantageofthelatesttechniques, [8] P.Hossain, B. Kawar, and M. El Nahas, “Obesity and diabetes in such as biochemical, biological, molecular biological, and the developing world—a growing challenge,” The New England immunological methods. Since adverse side effects associated Journal of Medicine,vol.356,no.3,pp.213–215,2007. with use of CHM, such as hepatotoxicity, nephrotoxicity [9]T.K.Schramm,G.H.Gislason,L.Køberetal.,“Diabetes and genotoxicity, were reported frequently, it is urgent to patients requiring glucose-lowering therapy and nondiabetics conduct toxicological studies on CHM. In order to achieve with a prior myocardial infarction carry the same cardiovascu- higher accuracy and better reproducibility, all studies on lar risk: a population study of 3.3 million people,” Circulation, CHM should be conducted by following well-established and vol.117,no.15,pp.1945–1954,2008. standardized procedures. [10] T.-T. Zhang and J.-G. Jiang, “Active ingredients of traditional Chinese medicine in the treatment of diabetes and diabetic complications,” Expert Opinion on Investigational Drugs,vol.21, 6. Conclusion no. 11, pp. 1625–1642, 2012. [11] W. L. Li, H. C. Zheng, J. Bukuru, and N. De Kimpe, “Natural CHM used to and still play an important role in the medicines used in the traditional Chinese medical system for treatment of DM in China and great progresses have been therapy of diabetes mellitus,” Journal of Ethnopharmacology,vol. made over the last decades. A great many CHM monomer 92, no. 1, pp. 1–21, 2004. components possess antidiabetes actions. Therefore, it is of [12] W. Jia, W. Y. Gaoz, and L. D. Tang, “Antidiabetic herbal drugs great significance to develop novel CHM for the treatment officially approved in China,” Phytotherapy Research,vol.17,no. of DM and its complications. The underlying mechanism by 10, pp. 1127–1134, 2003. which CHM treat DM are complicated and multifactorial [13] M. B. Covington, “Traditional Chinese medicine in the treat- and involve multiple organs; studying the effect of active ment of diabetes,” Diabetes Spectrum,vol.14,no.3,pp.154–159, monomer components of CHM might be a good starting 2001. point. It is strongly significant to pay close attention to CHM [14] D. Ehling, “Oriental medicine: an introduction,” Alternative for treatment of DM and its complications. Therapies in Health and Medicine,vol.7,no.4,pp.71–82,2001. [15]R.Padiya,T.N.Khatua,P.K.Bagul,M.Kuncha,andS. K. Banerjee, “Garlic improves insulin sensitivity and associ- Conflict of Interests ated metabolic syndromes in fructose fed rats,” Nutrition and Metabolism,vol.8,article53,2011. The authors declare that there is no conflict of interests [16] M. Thomson, H. Drobiova, K. Al-Qattan, R. Peltonen-Shalaby, regarding the publication of this paper. Z. Al-Amin, and M. Ali, “Garlic increases antioxidant levels in diabetic and hypertensive rats determined by a modified perox- Acknowledgment idase method,” Evidence-Based Complementary and Alternative Medicine, vol. 2011, Article ID 703049, 8 pages, 2011. This review was supported by the 42th China Postdoctoral [17]B.Chen,X.Zhao,Y.Guoetal.,“Assessingthequalityofreports Science Foundation (20070420179). about randomized controlled trials of acupuncture treatment on diabetic peripheral neuropathy,” PLoS ONE,vol.7,no.7, Article ID e38461, 2012. References [18] W. W. Li, H. Guo, H. H. Li, L. L. Wang, H. Fu, and X. M. Wang, “Integration of traditional Chinese medicines and [1] W.Yang, J. Lu, J. Weng et al., “Prevalence of diabetes among men western medicines for treating diabetes mellitus with coronary and women in China,” The New England Journal of Medicine, heart disease: a systematic review,” Journal of Alternative and vol.362,no.12,pp.1090–1101,2010. Complementary Medicine,vol.19,no.6,pp.492–500,2013. [2] M. M. Engelgau, L. S. Geiss, J. B. Saaddine et al., “The evolving [19] S. A. Ziai, B. Larijani, S. Akhoondzadeh et al., “Psyllium diabetes burden in the United States,” Annals of Internal decreased serum glucose and glycosylated hemoglobin signif- Medicine, vol. 140, no. 11, pp. 945–950, 2004. icantly in diabetic outpatients,” Journal of Ethnopharmacology, [3]V.Hall,R.Thomsen,O.Henriksen,andN.Lohse,“Diabetesin vol. 102, no. 2, pp. 202–207, 2005. Sub Saharan Africa 1999–2011: epidemiology and public health [20] L. Zhu and H. L. Li, “Therapeutic efficacy of combined Berber- implications. A systematic review,” BMC Public Health, vol. 11, ine and Glipizide on type 2 diabete,” JournalofClinicalResearch, article 564, 2011. vol. 1, p. 20, 2007. 12 Evidence-Based Complementary and Alternative Medicine

[21] F. R. Lu, L. Shen, Y. Qin, and L. Gao, “Clinical observation [36]Q.Tu,J.Qin,H.Dong,F.Lu,andW.Guan,“EffectsofPanax of Trigonella foenum-graecum saponin combining sulphany- notoginoside on the expression of TGF-𝛽1andSmad-7in lureas on 36 cases of type 2 diabetes mellitus,” China Journal renal tissues of diabetic rats,” Journal of Huazhong University of of Chinese Materia Medica,vol.33,no.2,pp.184–187,2008. Science and Technology, Medical Science,vol.31,no.2,pp.190– [22]Z.Y.Lu,N.S.Zhong,Y.Xie,andP.Y.Hu,Textbook of Internal 193, 2011. Medicine, People’s Health Publishing House, Beijing, China, 7th [37]T.H.Li,C.C.Hou,C.L.Chang,andW.C.Yang,“Anti- edition, 2009. hyperglycemic properties of crude extract and triterpenes from [23] X. H. Chen, X. Bai, Y.H. Liu et al., “Anti-diabetic effects of water Poria cocos,” Evidence-Based Complementary and Alternative extract and crude polysaccharides from tuberous root of Liriope Medicine, vol. 2011, Article ID 128402, 8 pages, 2011. spicata var. prolifera in mice,” JournalofEthnopharmacology, [38]J.H.Hsu,Y.C.Wu,I.Liu,andJ.T.Cheng,“Dioscoreaasthe vol. 122, no. 2, pp. 205–209, 2009. principal herb of Die-Huang-Wan, a widely used herbal mixture [24] L. Wang, Y. Wang, D. Xu, K. Ruan, Y. Feng, and S. Wang, in China, for improvement of insulin resistance in fructose-rich “MDG-1, a polysaccharide from Ophiopogon japonicus exerts chow-fed rats,” Journal of Ethnopharmacology,vol.112,no.3,pp. hypoglycemic effects through the PI3K/Akt pathway in a 577–584, 2007. diabetic KKAy mouse model,” Journal of Ethnopharmacology, [39] K. He, X. Li, X. Chen et al., “Evaluation of antidiabetic potential vol.143,no.1,pp.347–354,2012. of selected traditional Chinese medicines in STZ-induced [25]J.Xu,Y.Wang,D.Xu,K.Ruan,Y.Feng,andS.Wang, diabetic mice,” JournalofEthnopharmacology,vol.137,no.3,pp. “Hypoglycemic effects of MDG-1, a polysaccharide derived 1135–1142, 2011. from Ophiopogon japonicas, in the ob/ob mouse model of [40]D.Y.Kwon,D.S.Kim,H.J.Yang,andS.Park,“Thelignan-rich type 2 diabetes mellitus,” International Journal of Biological fractions of Fructus Schisandrae improve insulin sensitivity via Macromolecules,vol.49,no.4,pp.657–662,2011. the PPAR-𝛾 pathways in in vitro and in vivo studies,” Journal of [26] M. Liu, K. Wu, X. Mao, Y. Wu, and J. Ouyang, “Astragalus Ethnopharmacology,vol.135,no.2,pp.455–462,2011. polysaccharide improves insulin sensitivity in KKAy mice: [41]S.P.Li,G.H.Zhang,Q.Zengetal.,“Hypoglycemicactivity regulation of PKB/GLUT4 signaling in skeletal muscle,” Journal of polysaccharide, with antioxidation, isolated from cultured of Ethnopharmacology,vol.127,no.1,pp.32–37,2010. Cordyceps mycelia,” Phytomedicine,vol.13,no.6,pp.428–433, [27]X.Zhou,Y.Xu,G.Yang,andF.Li,“Increasedgalectin-1 2006. expression in muscle of Astragalus polysaccharide-treated type [42] W.Kan, H. Wang, C. Chien et al., “Effects of extract from solid- 1 diabetic mice,” Journal of Natural Medicines,vol.65,no.3-4, state fermented cordyceps sinensis on type 2 diabetes mellitus,” pp. 500–507, 2011. Evidence-Based Complementary and Alternative Medicine,vol. [28] F.Zou,X.Q.Mao,N.Wang,J.Liu,andJ.P.Ou-Yang,“Astragalus 2012,ArticleID743107,10pages,2012. polysaccharides alleviates glucose toxicity and restores glucose [43] C.-C. Chen, C.-Y. Hsu, C.-Y. Chen, and H.-K. Liu, “Fructus homeostasis in diabetic states via activation of AMPK,” Acta Corni suppresses hepatic gluconeogenesis related gene tran- Pharmacologica Sinica,vol.30,no.12,pp.1607–1615,2009. scription, enhances glucose responsiveness of pancreatic beta- [29] D. Gui, J. Huang, Y. Guo et al., “Astragaloside IV ameliorates cells, and prevents toxin induced beta-cell death,” Journal of renal injury in streptozotocin-induced diabetic rats through Ethnopharmacology,vol.117,no.3,pp.483–490,2008. inhibiting NF-𝜅B-mediated inflammatory genes expression,” [44]C.H.Park,J.S.Noh,T.Tanaka,K.Uebaba,E.J.Cho,andT. Cytokine, vol. 61, no. 3, pp. 970–977, 2013. Yokozawa, “The effects of corni fructus extract and its fractions [30] Y.H. Xu, L. Feng, S. S. Wang et al., “Calycosin protects HUVECs against 𝛼-glucosidase inhibitory activities in vitro and sucrose from advanced glycation end products-induced macrophage toleranceinnormalrats,”TheAmericanJournalofChinese infiltration,” Journal of Ethnopharmacology,vol.137,no.1,pp. Medicine,vol.39,no.2,pp.367–380,2011. 359–370, 2011. [45]X.Shu,J.Lv,J.Tao,G.Li,H.Li,andN.Ma,“Antihyperglycemic [31] Z. Liu, W. Li, X. Li et al., “Antidiabetic effects of malonyl gin- effects of total flavonoids from Polygonatum odoratum in STZ senosides from Panax ginseng on type 2 diabetic rats induced and alloxan-induced diabetic rats,” Journal of Ethnopharmacol- by high-fat diet and streptozotocin,” Journal of Ethnopharma- ogy,vol.124,no.3,pp.539–543,2009. cology,vol.145,no.1,pp.233–240,2013. [46] Y. F. Deng, K. He, X. L. Ye et al., “Saponin rich fractions [32] W.Lee, S. Kao, I. Liu, and J. Cheng, “Increase of insulin secretion from Polygonatum odoratum (Mill.) Druce with more potential by ginsenoside Rh2 to lower plasma glucose in Wistar rats,” hypoglycemic effects,” Journal of Ethnopharmacology,vol.141, Clinical and Experimental Pharmacology and Physiology,vol.33, no. 1, pp. 228–233, 2012. no. 1-2, pp. 27–32, 2006. [47] J. Z. Luo and L. Luo, “American ginseng stimulates insulin pro- [33] K. Kim and H. Y. Kim, “Korean red ginseng stimulates insulin duction and prevents apoptosis through regulation of uncou- release from isolated rat pancreatic islets,” Journal of Ethnophar- pling protein-2 in cultured 𝛽 cells,” Evidence-Based Complemen- macology,vol.120,no.2,pp.190–195,2008. tary and Alternative Medicine,vol.3,no.3,pp.365–372,2006. [34] H. Y. Kim and K. Kim, “Regulation of signaling molecules [48] W. J. Huang, H. S. Niu, M. H. Lin, J. T. Cheng, and F. L. Hsu, associated with insulin action, insulin secretion and pancreatic “Antihyperglycemic effect of catalpol in streptozotocin-induced 𝛽-cell mass in the hypoglycemic effects of Korean red ginseng diabetic rats,” Journal of Natural Products,vol.73,no.6,pp. in Goto-Kakizaki rats,” Journal of Ethnopharmacology,vol.142, 1170–1172, 2010. no. 1, pp. 53–58, 2012. [49]H.Choi,H.Jang,T.Chungetal.,“Catalpolsuppresses [35] W. C. S. Cho, T. T. Yip, W. Chung et al., “Altered expression of advanced glycation end-products-induced inflammatory serum protein in ginsenoside Re-treated diabetic rats detected responses through inhibition of reactive oxygen species in by SELDI-TOF MS,” Journal of Ethnopharmacology,vol.108,no. human monocytic THP-1 cells,” Fitoterapia,vol.86,no.1,pp. 2, pp. 272–279, 2006. 19–28, 2013. Evidence-Based Complementary and Alternative Medicine 13

[50] H. S. Wu, J. H. Xu, L. Z. Chen, and J. J. Sun, “Studies on [64] N. Hamza, B. Berke, C. Cheze et al., “Preventive and curative anti-hyperglycemic effect and its mechanism of Dendrobium effect of Trigonella foenum-graecum L. seeds in C57BL/6J candidum,” Zhongguo Zhong Yao Za Zhi,vol.29,no.2,pp.160– models of type 2 diabetes induced by high-fat diet,” Journal of 163, 2004. Ethnopharmacology,vol.142,no.2,pp.516–522,2012. [51]Y.Zhao,Y.Son,S.Kim,Y.Jang,andJ.Lee,“Antioxidant [65] J. Y. Zhou and S. W. Zhou, “Protection of trigonelline on and anti-hyperglycemic activity of polysaccharide isolated from experimental diabetic peripheral neuropathy,” Evidence-based Dendrobium chrysotoxum Lindl,” JournalofBiochemistryand Complementary and Alternative Medicine,vol.2012,ArticleID Molecular Biology, vol. 40, no. 5, pp. 670–677, 2007. 164219, 8 pages, 2012. [52] H. Zhang, J. He, L. Yuan, and Z. Lin, “In vitro and in vivo [66] A. A. R. Sayed, M. Khalifa, and F. F. Abd El-Latif, “Fenugreek protective effect of Ganoderma lucidum polysaccharides on attenuation of diabetic nephropathy in alloxan-diabetic rats: alloxan-induced pancreatic islets damage,” Life Sciences,vol.73, attenuation of diabetic nephropathy in rats,” Journal of Physi- no. 18, pp. 2307–2319, 2003. ology and Biochemistry, vol. 68, no. 2, pp. 263–269, 2012. [53]C.H.Lau,C.M.Chan,Y.W.Chanetal.,“Pharmacological [67]S.Wu,G.Wang,Z.Liuetal.,“Effectofgeniposide,a investigations of the anti-diabetic effect of Cortex Moutan and hypoglycemic glucoside, on hepatic regulating enzymes in its active component paeonol,” Phytomedicine,vol.14,no.11,pp. diabetic mice induced by a high-fat diet and streptozotoci,” Acta 778–784, 2007. Pharmacologica Sinica, vol. 30, no. 2, pp. 202–208, 2009. [54] H.Hong,Q.Wang,Z.Zhao,G.Liu,Y.Shen,andG.Chen,“Stud- [68] Y. Wang, S. Huang, Y. Feng, M. Ning, and Y. Leng, “Emodin, ies on antidiabetic effects of cortex Moutan polysaccharide-2b an 11𝛽-hydroxysteroid dehydrogenase type 1 inhibitor, regulates intype2diabetesmellitusrats,”Yaoxue Xuebao,vol.38,no.4, adipocyte function in vitro and exerts anti-diabetic effect in pp. 255–259, 2003. ob/ob mice,” Acta Pharmacologica Sinica,vol.33,no.9,pp.1195– [55]D.T.Ha,T.N.Trung,T.T.Hienetal.,“Selectedcompounds 1203, 2012. derived from Moutan Cortex stimulated glucose uptake and [69] H.S.Wu,D.F.Zhu,C.X.Zhouetal.,“Insulinsensitizingactivity glycogen synthesis via AMPK activation in human HepG2 of ethyl acetate fraction of Acorus calamus L. in vitro and in cells,” Journal of Ethnopharmacology,vol.131,no.2,pp.417–424, vivo,” Journal of Ethnopharmacology,vol.123,no.2,pp.288–292, 2010. 2009. [56] Y.-G. Li, D.-F. Ji, S. Zhong et al., “Hybrid of 1-deoxynojirimycin [70]M.Si,J.Lou,C.Zhouetal.,“Insulinreleasingandalpha- and polysaccharide from mulberry leaves treat diabetes mellitus glucosidase inhibitory activity of ethyl acetate fraction of Acorus by activating PDX-1/insulin-1 signaling pathway and regulating calamus in vitro and in vivo,” Journal of Ethnopharmacology,vol. the expression of glucokinase, phosphoenolpyruvate carboxyk- 128,no.1,pp.154–159,2010. inase and glucose-6-phosphatase in alloxan-induced diabetic [71]F.Qa’dan,E.J.Verspohl,A.Nahrstedt,F.Petereit,andK.Z. mice,” JournalofEthnopharmacology,vol.134,no.3,pp.961– Matalka, “Cinchonain Ib isolated from Eriobotrya japonica 970, 2011. induces insulin secretion in vitro and in vivo,” Journal of [57] S. D. Klomann, A. S. Mueller, J. Pallauf, and M. B. Krawinkel, Ethnopharmacology,vol.124,no.2,pp.224–227,2009. “Antidiabetic effects of bitter gourd extracts in insulin-resistant [72] Y. Liu, X. Zhu, Q. Lu et al., “Total saponins from Rhizoma Ane- db/db mice,” British Journal of Nutrition,vol.104,no.11,pp. marrhenae ameliorate diabetes-associated cognitive decline in 1613–1620, 2010. rats: involvement of amyloid-beta decrease in brain,” Journal of [58] S. Yibchok-Anun, S. Adisakwattana, C. Y. Yao, P. Sangvanich, S. Ethnopharmacology,vol.139,no.1,pp.194–200,2012. Roengsumran, and W.H. Hsu, “Slow acting protein extract from [73]Z.Li,D.Zuo,X.Qie,H.Qi,M.Zhao,andY.Wu,“Berberine fruit pulp of Momordica charantia with insulin secretagogue acutely inhibits the digestion of maltose in the intestine,” Journal and insulinomimetic activities,” Biological and Pharmaceutical of Ethnopharmacology,vol.142,no.2,pp.474–480,2012. Bulletin, vol. 29, no. 6, pp. 1126–1131, 2006. [74]M.Wang,J.Wang,R.Tanetal.,“Effectofberberineon [59] A. C. Keller, J. Ma, A. Kavalier, K. He, A. B. Brillantes, and PPAR𝛼/NO activation in high glucose- and insulin-induced E. J. Kennelly, “Saponins from the traditional medicinal plant cardiomyocyte hypertrophy,” Evidence-based Complementary Momordica charantia stimulate insulin secretion in vitro,” and Alternative Medicine,vol.2013,ArticleID285489,9pages, Phytomedicine,vol.19,no.1,pp.32–37,2011. 2013. [60]N.P.C.Fernandes,C.V.Lagishetty,V.S.Panda,andS.R.Naik, [75]L.Tang,W.Wei,L.Chen,andS.Liu,“Effectsofberberineon “An experimental evaluation of the antidiabetic and antilipi- diabetes induced by alloxan and a high-fat/high-cholesterol diet demic properties of a standardized Momordica charantia fruit in rats,” Journal of Ethnopharmacology,vol.108,no.1,pp.109– extract,” BMC Complementary and Alternative Medicine,vol.7, 115, 2006. article 29, 2007. [76] Y. S. Lee, W. S. Kim, K. H. Kim et al., “Berberine, a natural [61] D. Sathishsekar and S. Subramanian, “Beneficial effects of plant product, activates AMP-activated protein kinase with Momordica charantia seeds in the treatment of STZ-induced beneficial metabolic effects in diabetic and insulin-resistant diabetes in experimental rats,” Biological and Pharmaceutical states,” Diabetes,vol.55,no.8,pp.2256–2264,2006. Bulletin, vol. 28, no. 6, pp. 978–983, 2005. [77] L. Zhang, J. Yang, X. Chen et al., “Antidiabetic and antioxidant [62] W. Zhang, C. Liu, P. Wang et al., “Puerarin improves insulin effects of extracts from Potentilla discolor Bunge on diabetic resistance and modulates adipokine expression in rats fed a rats induced by high fat diet and streptozotocin,” Journal of high-fat diet,” European Journal of Pharmacology,vol.649,no. Ethnopharmacology,vol.132,no.2,pp.518–524,2010. 1–3, pp. 398–402, 2010. [78]X.Xing,Z.Zhang,X.Hu,R.Wu,andC.Xu,“Antidiabetic [63] X. Fu-Liang, S. Xiao-Hui, G. Lu, Y. Xiang-Liang, and X. Hui- effects of Artemisia sphaerocephala Krasch. gum, a novel food Bi, “Puerarin protects rat pancreatic islets from damage by additive in China, on streptozotocin-induced type 2 diabetic hydrogen peroxide,” European Journal of Pharmacology,vol. rats,” Journal of Ethnopharmacology,vol.125,no.3,pp.410–416, 529, no. 1–3, pp. 1–7, 2006. 2009. 14 Evidence-Based Complementary and Alternative Medicine

[79] S. B. Wang and J. P. Jia, “Oxymatrine attenuates diabetes- associated cognitive deficits in rats,” Acta Pharmacologica Sinica,vol.35,no.3,pp.331–338,2014. [80] Y. H. Li, S. P. Wen, B. P. Kota et al., “Punica granatum flower extract, a potent 𝛼-glucosidase inhibitor, improves postprandial hyperglycemia in Zucker diabetic fatty rats,” Journal of Ethnopharmacology, vol. 99, no. 2, pp. 239–244, 2005. [81] S.-L. Huang, R.-T. Yu, J. Gong et al., “Arctigenin, a natural compound, activates AMP-activated protein kinase via inhibition of mitochondria complex I and ameliorates metabolic disorders in ob/ob mice,” Diabetologia,vol.55,no.5,pp.1469–1481,2012. [82] Y. Kang and H. Y. Kim, “Glucose uptake-stimulatory activity of Amomi Semen in 3T3-L1 adipocytes,” Journal of Ethnopharma- cology, vol. 92, no. 1, pp. 103–105, 2004. [83] Y. L. Leu, Y. W. Chen, C. Y. Yang et al., “Extract isolated from Angelica hirsutiflora with insulin secretagogue activity,” Journal of Ethnopharmacology,vol.123,no.2,pp.208–212,2009. [84] S. A. Park, M. Choi, M. Kim et al., “Hypoglycemic and hypolipidemic action of Du-zhong (Eucommia ulmoides Oliver) leaves water extract in C57BL/KsJ-db/db mice,” Journal of Ethnophar- macology,vol.107,no.3,pp.412–417,2006. [85]C.Hu,J.Li,K.Cheahetal.,“EffectofSanguisdraconis(a dragon’s blood resin) on streptozotocin- and cytokine-induced 𝛽-cell damage, in vitro and in vivo,” Diabetes Research and Clinical Practice,vol.94,no.3,pp.417–425,2011. [86] Y.M.Li,V.H.Tran,C.C.Duke,andB.D.Roufogalis,“Gingerols of zingiber officinale enhance glucose uptake by increasing cell surface GLUT4 in cultured L6 myotubes,” Planta Medica,vol. 78,no.14,pp.1549–1555,2012. [87] K. Watanabe, K. Kamata, J. Sato, and T. Takahashi, “Fundamen- tal studies on the inhibitory action of Acanthopanax senticosus Harms on glucose absorption,” Journal of Ethnopharmacology, vol.132,no.1,pp.193–199,2010. [88] J. Fu, J. Fu, J. Yuan et al., “Anti-diabetic activities of Acan- thopanax senticosus polysaccharide (ASP) in combination with metformin,” International Journal of Biological Macromolecules, vol. 50, no. 3, pp. 619–623, 2012. [89] L. M. Xiu, J. Q. Liu, X. R. Shang et al., “Discussion of Ephedra and its components improvement of diabetes,” Chinese Journal of Basic Medicine in Traditional Chinese Medicin,pp.1102–1104, 2011. [90] I. E. Juarez-Rojop,´ J. C. D´ıaz-Zagoya,J.L.Ble-Castilloetal., “Hypoglycemic effect of Carica papaya leaves in streptozotocin- induced diabetic rats,” BMC Complementary and Alternative Medicine,vol.12,article236,2012. [91] N. K. Rao and S. Nammi, “Antidiabetic and renoprotective effects of the chloroform extract of Terminalia chebula Retz. seeds in streptozotocin-induced diabetic rats,” BMC Comple- mentary and Alternative Medicine,vol.6,article17,2006. [92] M. Y. Qi, K. Chen, H. R. Liu, Y. H. Su, and S. Q. Yu, “Protective effect of Icariin on the early stage of experimental diabetic nephropathy induced by streptozotocin via modulating transforming growth factor beta1 and type IV collagen expression in rats,” Journal of Ethnopharmacology,vol.138,no.3,pp.731–736, 2011. [93]S.Qian,D.Huo,S.Wang,andQ.Qian,“Inhibitionofglucose- induced vascular endothelial growth factor expression by Salvia miltiorrhiza hydrophilic extract in human microvascular endothelial cells: evidence for mitochondrial oxidative stress,” JournalofEthnopharmacology,vol.137,no.2,pp.985–991,2011. Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2014, Article ID 156398, 8 pages http://dx.doi.org/10.1155/2014/156398

Research Article Screening for Bioactive Metabolites in Plant Extracts Modulating Glucose Uptake and Fat Accumulation

Rime B. El-Houri,1 Dorota Kotowska,2 LouiseC.B.Olsen,3 Sumangala Bhattacharya,4 Lars P. Christensen,1 Kai Grevsen,5 Niels Oksbjerg,4 Nils Færgeman,3 Karsten Kristiansen,2 and Kathrine B. Christensen1

1 Department of Chemical Engineering, Biotechnology and Environmental Technology, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark 2 Department of Biology, University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen N, Denmark 3 Department of Biochemistry and Molecular Biology, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark 4 Department of Food Science, Aarhus University, Blichers Alle,´ P.O. Box 50, 8830 Tjele, Denmark 5 Department of Food Science, Aarhus University, Kirstinebjergvej 10, 5792 Aarslev, Denmark

Correspondence should be addressed to Kathrine B. Christensen; [email protected]

Received 23 January 2014; Revised 4 July 2014; Accepted 7 July 2014; Published 28 August 2014

Academic Editor: Menaka C. Thounaojam

Copyright © 2014 Rime B. El-Houri et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Dichloromethane and methanol extracts of seven different food and medicinal plants were tested in a screening platform for identification of extracts with potential bioactivity related to insulin-dependent glucose uptake and fat accumulation. The screening platform included a series of in vitro bioassays, peroxisome proliferator-activated receptor (PPAR) 𝛾-mediated transactivation, adipocyte differentiation of 3T3-L1 cell cultures, and glucose uptake in both 3T3-L1 adipocytes and primary porcine myotubes, as well as one in vivo bioassay, fat accumulation in the nematode Caenorhabditis elegans. We found that dichloromethane extracts of aerial parts of golden root (Rhodiola rosea) and common elder (Sambucus nigra) as well as the dichloromethane extracts of thyme (Thymus vulgaris)andcarrot(Daucus carota) were able to stimulate insulin-dependent glucose uptake in both adipocytes and myotubes while weekly activating PPAR𝛾 without promoting adipocyte differentiation. In addition, these extracts were able to decrease fat accumulation in C. elegans. Methanol extracts of summer savory (Satureja hortensis), common elder, and broccoli (Brassica oleracea) enhanced glucose uptake in myotubes but were not able to activate PPAR𝛾, indicating a PPAR𝛾-independent effect on glucose uptake.

1. Introduction been withdrawn from the market [2]. Thus there is a need for new insulin sensitizing drugs with fewer side effects. Type2diabetesisanincreasinghealthproblemaffectingpop- TZDs such as rosiglitazone (Rosi) act as full agonists of ulations worldwide. Insulin resistance is the prediabetic state peroxisome proliferator-activated receptor gamma (PPAR𝛾). where insulin sensitive tissues such as muscles, adipocytes, Activation of PPAR𝛾 by agonists leads to a conformational and liver show reduced sensitivity towards insulin and a change in the ligand-binding domain (LBD). This process decreased glucose uptake (GU), which leads to elevated alters the transcription of several target genes involved in blood-glucose levels [1]. In the late 1990s, thiazolidinediones carbohydrate and lipid metabolism [3]. Depending on the (TZDs) were introduced as new effective oral insulin sensi- ligands they can induce different sets of genes as a result tizing drugs for management of type 2 diabetes but due to of differential recruitment of cofactors [4, 5]. Recruitment severe side effects such as increased water retention, weight of some cofactors leads to increased lipid storage and gain, heart enlargement, and hepatotoxicity most TZDs have decreased energy expenditure, whereas recruitment of others 2 Evidence-Based Complementary and Alternative Medicine increases insulin-stimulated GU, glucose metabolism, and 5 mL solvent/g of plant material was used for extractions. ∘ energy expenditure [6, 7]. The activation of PPAR𝛾 by TZDs The plant material was soaked in each solvent for 24 h at 5 C leads to the elimination of free fatty acids from circulation in the dark with occasional shaking. Extracts were filtered by promoting their cellular uptake, their storage within using filter paper with a pore size of 20–25 𝜇manddried ∘ adipocytes, and increase of the plasma concentration of under vacuum (40 C). The described extraction procedure certain hormones such as adiponectin, all factors that are haspreviouslybeenshowntoproduceplantextractswith known to improve insulin sensitivity [5, 8, 9]. The unwanted potential antidiabetic effect containing both lipophilic and side effects of TZDs have been linked to the behavior of TZDs hydrophilic bioactive compounds [18–20]. Water was not as full agonists of PPAR𝛾 [10]. Partial PPAR𝛾 agonists are used in the sequential extraction step because we have compounds with diminished agonist efficacy that maintain not previously been able to detect significant bioactivity the antidiabetic effect of full agonists but do not induce the in water extracts in a sequential extraction procedure and samemagnitudeofsideeffectsasthesebecausetheyrecruit secondly because potential bioactive compounds present in a different set of cofactors compared to full agonists [3, 4, 11]. water extracts are too hydrophilic to have any significant Consequently, the search for promising PPAR𝛾 agonist with bioavailability. A 100 mg/mL sample in dimethylsulfoxide an improved mechanism of action is an important objective (DMSO) was prepared for each extract and was used as stock in the search for new insulin sensitizing drugs. solution for the preparation of individual test solutions. Over 1000 plant species have been estimated to exhibit antidiabetic effects, and therefore plants are considered a 2.2. PPAR𝛾 Transactivation Assay. Mouse embryonic fibrob- promising source of natural products for novel potentially lasts [21] were trypsinized after reaching 70% confluence and antidiabetic compounds [12]. Different groups of secondary transfected using Metafectene Easy (Biontex Laboratories, metabolites have been identified as hypoglycemic agents, for Germany) according to the manufacturer’s recommenda- example, terpenoids, alkaloids, and flavonoids13 [ ]. In this tions.Foreachwell(ina96-wellplate)atotalof0.05𝜇g study, plants were selected either for their known antidiabetic of DNA were used (0.015 𝜇g pM-hPPAR𝛾-LBD + 0.03 𝜇g effects or for their content of metabolites with hypoglycemic Gal4-responsive luciferase reporter + 0.0025 𝜇g pRL-CMV activity [14–20]. The objectives of the present study were to 𝛾 normalization vector). Dulbecco’s modified Eagle’s medium examine the effects of plant extracts on PPAR transactiva- (DMEM), media containing vehicle (0.1% DMSO), positive tion, GU in adipocytes and primary myotube cultures, and fat control (1 𝜇M Rosi), or extract dissolved in DMSO was added accumulation in Caenorhabditis elegans (C. elegans) in order to the cells after 6 h of transfection. Cells were washed with to identify promising sources of natural products with an phosphate buffered saline (PBS) after 18 h of transfection effect on type 2 diabetes. and lysed with lysis buffer (0.2 M2 KH PO4,0.2MK2HPO4, Christensen et al. [18] previously published results of a 0.4% Triton N-101, 100 𝜇M phenylacetic acid, and 100 𝜇M screening of 24 plant species using a platform where extracts oxalic acid). Photinus and Renilla luciferase activities were were screened for their ability to activate PPARs, including 𝛾 measured directly in the plate as previously described [20]. PPAR . Based on the obtained results, the extracts were Photinus activities were normalized to corresponding Renilla then tested for stimulation of adipocyte differentiation and values to compensate for differences in transfection efficiency. effect on GU in adipocytes. The present study used a similar Results are presented as the mean ± SD. platform but was extended by including assay for GU in muscle stem cell derived myotube cultures, as muscles are one of the most important tissues for GU. The nematode C. 2.3. Cell Culture Study. 3T3-L1 preadipocytes were cultured in DMEM with 10% foetal calf serum (FCS) supplemented elegans was used afterwards as a model organism to evaluate ∘ the effects of the extracts on fat storage in vivo.Thusthe with 1% penicillin/streptomycin at 37 C in humidified 95% applied bioassays in the present study represent an improved air and 5% CO2. At day two postconfluence (designated day 𝜇 platform to evaluate the potential antidiabetic effect of plant 0) cells were induced to differentiate with 500 Misobutyl- 𝜇 extracts. methylxanthine, 1 M dexamethasone, 167 nM insulin (MDI protocol), or with 1 𝜇M dexamethasone and 167 nM insulin (DI protocol). For both protocols, the medium was replaced on day 2 with DMEM supplemented with 10% FCS, 1% penicillin/streptomycin, and 167 nM insulin, and thereafter 2. Materials and Methods every second day with DMEM supplemented with 10% FCS 2.1. Plant Material and Extracts. All plant species used and 1% penicillin/streptomycin. Vehicle cells were treated in this study (Table 1), except common elder, were culti- with 0.1% DMSO (v/v) equal to the DMSO concentration in vated at Department of Food Science, Aarhus University, the medium supplemented with extracts. Aarslev, Denmark. Elder was cultivated at Holunderhof Helle, Thumby, Germany. Carrots and golden root were 2.4. Glucose Uptake in 3T3-L1 Cell Cultures. Cells were seeded ∘ used fresh; all other plant materials were frozen (−22 C) on 96-well plates and differentiated according to the MDI directly after harvest. All plant materials were blended before protocol till day +8. At day +8 cells were fed with designated extraction and subjected to a two-step sequential extrac- medium supplemented with DMSO, Rosi, or extract, and a tion procedure with first dichloromethane (DCM) and then GU assay was performed 48 h later. Cells were washed with methanol (MeOH) (HPLC-grade, Sigma-Aldrich, Germany). 200 𝜇L/well PBS (pH 7.2, 1 mM CaCl2, and 1 mM MgSO4), Evidence-Based Complementary and Alternative Medicine 3

Table 1: The seven different plant species tested in the bioassays of this screening study.

Botanical name Common name Family Part of plant Brassica oleracea var. italica Broccoli Brassicaceae Aerial parts B. oleracea var. sabellica Kale Brassicaceae Aerial parts Daucus carota Carrot (cv purple haze) Apiaceae Roots Rhodiola rosea Golden root Crassulaceae Flowers/roots Sambucus nigra Common elder Caprifoliaceae Flowers Satureja hortensis Savory, summer Lamiaceae Aerial parts Thymus vulgaris Thyme Lamiaceae Aerial parts

Table 2: Results obtained for the plant extracts in the bioassays (test concentration 100 𝜇g/mL) of the screening platform. Results are given as either (+) for activation/stimulation or (−) for no activation/stimulation. For C. elegans (+) means reduction of fat accumulation (acc.). Extracts not tested are indicated by (nt), cytotoxic effects are indicated by† ( ), and glucose uptake is indicated as (GU).

Plant species Extract PPAR𝛾 transactivation Adipocyte differentiation GU in adipocytes GU in myotubes Fat acc. in C. elegans DCM + † nt − + Broccoli MeOH − nt nt + − DCM − nt nt − + Kale MeOH − nt nt − + DCM + − ++ + Carrot MeOH − nt nt −− aDCM + − ++ + aMeOH − nt nt − + Golden root bDCM −−++ + bMeOH − nt nt − + DCM + − ++ + Elder MeOH − nt nt + + DCM + − + − + Savory MeOH − nt nt + − DCM + − ++ + Thyme MeOH + − nt + + aAerial parts; broots.

subsequently with 200 𝜇L/well DMEM (1 g/L glucose), and was determined in eight parallel wells for each extract and finally incubated in 200 𝜇L/well of the same medium for 2 h for each insulin concentration. The results are presented as ∘ in the incubator at 37 Cand10%CO2.Cellswerethenwashed the mean ± SD. with 200 𝜇L/well Krebs-Ringer-Hepes buffer (KRHB, pH 7.4) and incubated with 50 𝜇L/well KRHB for 30 min using the same conditions as described above. 50 𝜇L/well KRHB 2.5. Preparation of Myotube Cultures. Satellite cells were iso- containing double amount of the designated concentrations lated from semimembranous muscles of female pigs weighing of insulin was added, and incubation was continued for approximately 12 Kg, as reported by Theil et al. [22], and exactly 15 min. GU was initiated by addition of 50 𝜇L/well stored in liquid nitrogen until used. To prepare myotube KRHB (3.0 mM glucose, 0.15 𝜇L [14C] 2-deoxy-D-glucose cultures, the cells were seeded on Matrigel matrix (BD (5 mCi/L) yielding a final concentration of 1.0 mM glu- Biosciences) coated (1 : 50 v/v) 48-well plates for GU assay. cose). 2-Deoxy-D-glucose was used because this compound Cells were proliferated in porcine growth medium (PGM) is not metabolized by cells. The cells were incubated for consisting of 10% FCS, 10% horse serum, and 80% DMEM ∘ exactly15minintheincubatorat37Cand10%CO2.Then with 25 mM glucose and antibiotics (100 IU/mL penicillin, 50 𝜇L/well Quench buffer (800 mM D-glucose, 50 mM 4-(2- 100 IU/mL streptomycin sulfate, 3 𝜇g/mL amphotericin B, hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH and 20 𝜇g/mL gentamycin). The cells were grown in PGM 7.5, and 262 mM NaCl) was added. Cells were washed three until they reached approximately 80% confluence in a CO2- ∘ times in 200 𝜇L/well ice-cold PBS and lysed in 200 𝜇L/well related humidified incubator (95% air, 5%2 CO at 37 C). 1% sodium dodecyl sulphate by shaking for 2 h. Radioactivity The cells were allowed to proliferate to 100% confluence in the lysates was determined by scintillation counting. GU in media containing DMEM (7 mM glucose), 10% FCS, 4 Evidence-Based Complementary and Alternative Medicine and antibiotics for 24 h and then differentiated into myotubes 2.8. Statistical Analysis. For studies on adipocytes 𝑡-tests were by incubating with differentiation media (DMEM with 7 mM done for assessment of significance. For experiments on glucose, 5% FCS, antibiotics, and 1 𝜇M cytosine arabinoside) porcine myotubes, statistical analysis of data was conducted for at least 48 h. using the mixed model procedure of SAS statistical program- ming software (ver. 9.2, SAS Institute Inc., Cary, NC). The model consisted of the fixed effects of treatments (concen- 2.6.GlucoseUptakeinPorcineMyotubeCellCultures. Dif- tration of extracts and extract type) and their interactions. ferentiated myotubes were treated with serum free media Experiments, replicates, and pigs within treatments were (DMEM with 7 mM glucose, antibiotics, and 1 𝜇Mcytosine included as well as their appropriate interactions as random arabinoside) overnight, followed by incubation with treat- effects. Least square means (LSMeans) ± standard errors mentsfor1h.Themyotubeswerethenwashedthricewith of LSMeans (SEM) were calculated and effects of extract HEPES buffered saline (20 mM HEPES, 140 mM NaCl, 5mM concentrations and extract types are presented relatively to KCl, 2.5 mM MgSO4, and 1 mM CaCl2,adjustedtopH7.4 thecontrol(DMSO).ForstudiesonC. elegans,statistical with 2 M NaOH) and incubated with 250 𝜇Lof0.1mM2- 3 analyses were performed in GraphPad Prism by subjecting deoxy-[ H]-D-glucose per well for 30 min. Again 2-deoxy- the data to a one-way ANOVAfollowed by Dunnett’s multiple D-glucose was used as it is not metabolized by the cells. comparison test. Myotubes were then quickly washed thrice with 500 𝜇Lice- cold PBS per well and the cells lysed by adding 250 𝜇L ∘ of 0.05 M NaOH (37 C) per well and were placed on a shaking board for 30 min. The cell lysate was transferred to a scintillation tube, mixed with scintillation liquid (Ultima 3. Results and Discussion Gold, PerkinElmer Inc.) in 1 : 10 ratio, and counted in a Win In this study several bioassays were used to test the following spectral, 1414 liquid scintillation counter (PerkinElmer). For plant species: Brassica oleracea var. italica (broccoli) and each experiment, satellite cells from 3 pigs were used, with 6 var. sabellica (kale), Daucus carota (carrot), Rhodiola rosea replicates per pig. (golden root), Satureja hortensis (savory), Sambucus nigra (elder), and Thymus vulgaris (thyme) (Table 1)fortheir 2.7. Fat Accumulation in C. elegans. Worms were maintained potential bioactivities related to glucose homeostasis. The as described by Sulston and Hodgkin [23]. The wild-type plants were exposed to a two-step sequential extraction reference strain was the C. elegans Bristol variety strain, N2. procedure using DCM and MeOH to achieve an initial crude Nile red was dissolved in acetone (500 mg/mL) and added separation of the plant metabolites based on their polarity. ∘ to molten nematode growth medium (NGM) (∼55 C) to a The screening platform previously described by Chris- final concentration of 0.05 mg/mL. NGM was poured into tensen et al. [18] that enables the identification of potential 24-well plates (1 mL/well). Wells were seeded with 40 𝜇L partial PPAR𝛾 agonists with little or no promotion of adi- uracil auxotroph E. coli strain OP50 in 2 × yeast (yeast pogenesis was applied in this study as well. The platform tryptone, YT) medium per well and, when dried, 25 𝜇LM9 consists of different bioassays and firstly tests the ability of salt solution (3 g KH2PO4,6gNa2HPO4, 5 g NaCl, 1 mL the plant extracts to activate PPAR𝛾 in transfected cells. If 1M MgSO4,andH2O to 1 L; sterilized by autoclaving) and activation of PPAR𝛾 is present, the adipogenic potential of the 10 𝜇L DMSO or extract were added. Crude extracts were extract is determined in vitro by an adipocyte differentiation diluted to stocks of 20 mg/mL in DMSO; thus they were assay. If no significant stimulation of adipocyte differentiation tested at a final concentration of 200 𝜇g/mL. Worms were is observed, the ability of the extract to enhance insulin- synchronized by standard bleaching protocol [24]followed dependent GU in adipocytes is tested. Muscles are one of the by hatching to L1 in M9 supplemented with cholesterol essential organs for glucose metabolism and furthermore are overnight. L1 larvae were put on the plates and grown for strongly affected by insulin resistance and, hence, the present ∘ 46 h at 20 C until mid-L4 stage. Worms were then mounted screening study also included a bioassay, testing the effect in a drop of 10 mM tetramisole (T1512, Sigma-Aldrich) of the plant extracts on insulin-stimulated GU in porcine atop 2% agarose pads laid on a microscopy glass slide and myotubes. Plant extracts exhibiting the modest activation then overlaid with a cover slip. Fluorescence microscopy of PPAR𝛾, no (or minimal) stimulation of adipocyte dif- (rhodamine channel) was done using a Leica DMI6000 B ferentiation, and ability to enhance insulin-dependent GU microscope equipped with an Olympus DP71 camera. Images in adipocytes and myotubes are therefore considered as a were captured using Visiopharm Integrator System software good source for the isolation and identification of potential (Visiopharm, Denmark). For nile red staining, all worms bioactive constituents with antidiabetic effect. were photographed using 200x magnification, maximum To supplement the studies on glucose homeostasis in fluorescence intensity, and a fixed exposure time of 30 ms. vitro, the extracts were also tested for their effect on fat Images were quantified using ImageJ (image processing and accumulation in the worm C. elegans,whichhasbeenshown analysis in Java; http://rsbweb.nih.gov/ij/). All images in each to serve as a useful model for the genetic analyses of energy experiment were background corrected by subtracting the homeostasis and fat storage pathways in a whole organism same value from each pixel. Staining levels were quantified as [25]. The short life cycle of C. elegans reduces the time needed the integrated fluorescence density. The results are presented for an experimental cycle and therefore it is advantageous as as means ± SDandnormalizedtoDMSOtreatedworms. an in vivo model for fast screening. Evidence-Based Complementary and Alternative Medicine 5

20 25

∗∗∗ ∗∗∗

𝛾 20 15 ∗∗∗

15 ∗∗∗

10 ∗∗∗ ∗∗∗ ∗∗∗ 10 ∗∗∗ 5 ∗∗ ∗ Fold activation of PPAR of activation Fold ∗∗ ∗∗ 5 ∗∗ ∗∗ ∗∗ ∗ glucose uptake of stimulation Fold ∗ 0 0 DMSO 1 10 100 0 3 10 30 100 Concentration (𝜇g/mL) Concentration of insulin (nM) Thyme DCM DMSO Golden root DCM Thyme DCM Golden root DCM Rosi (a) (b)

Figure 1: Effect of DCM extracts of golden rootRhodiola ( rosea)andthyme(Thymus vulgaris)onPPAR𝛾 transactivation (a) and glucose uptake (GU) in adipocytes (b). DMSO (vehicle, set to 1.00) and results were normalized to this. For PPAR𝛾, positive control was rosiglitazone (Rosi, fold activation 79.7 relative to DMSO) and test concentrations of extracts were 1, 10, and 100 𝜇g/mL (a). The GU test was performed at different concentrations of insulin (0, 3, 10, 30, and 100 nM), while the extract concentration was kept at100 𝜇g/mL (b). Plotted values are ∗ ∗∗ ∗∗∗ least square means ± SD of mean of 3 replicates. 𝑃 < 0.05, 𝑃 < 0.01,and 𝑃 < 0.001 indicate significance relative to DMSO.

200 ∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗ 150 ∗∗∗

100

50 Glucose uptake (% control) uptake Glucose

0 0 0.5 0.7 1.0 Concentration (mg/mL) Thyme DCM Golden root DCM

Figure 2: Effect of thyme (Thymus vulgaris)andgoldenroot(Rhodiola rosea) DCM extracts on insulin-stimulated glucose uptake (GU) in primary porcine myotube cultures. The concentration of insulin was kept at 750 pM, while the concentration of the extract was increasing from 0 till 1 mg/mL. GU is given as percent of the control (set to 100). Number of pigs used was 3 and number of replicates per pig was 6. The ∗ ∗∗ ∗∗∗ plotted values are least square means ± SD of mean. 𝑃 < 0.05, 𝑃 < 0.01,and 𝑃 < 0.001 indicate significance relative to DMSO.

Sixteen extracts from seven plant species were tested in have previously been reported to cause antiproliferation the bioassays (Table 2). Seven extracts were able to activate and apoptosis [26] and thus the cytotoxic effect of this PPAR𝛾 and were then tested for their adipogenic potential extract may have been caused by high levels of isothio- in the in vitro adipocyte differentiation assay. No stimulation cyanates. Five of the extracts able to activate PPAR𝛾 without of adipocyte differentiation was observed for any of these stimulation of adipocyte differentiation were also able to extracts except the DCM extract of broccoli, which caused increase insulin-stimulated GU in adipocytes (Table 2). Four cell death (Table 2). Broccoli is known for its high content of the five extracts were able to stimulate GU in adipocytes of glucosinolates that can be hydrolyzed to the lipophilic and to enhance insulin-stimulated GU in primary porcine isothiocyanates by the enzyme myrosinase. Isothiocyanates myotubes. The nine extracts not able to activate PPAR𝛾 were 6 Evidence-Based Complementary and Alternative Medicine

1.2

1.0

0.8 ∗∗∗ ∗∗∗

0.6 ∗∗∗ ∗∗∗

0.4 Fluorescence relative to DMSO to relative Fluorescence

0.2

0 DMSO DCM MeOH DCM MeOH Thyme Golden root (a)

(b) (c)

(d) (e)

Figure 3: Effect of DCM extracts of golden rootRhodiola ( rosea)andthyme(Thymus vulgaris) on fat accumulation in C. elegans. Activation by DMSO (vehicle set to 1.00) and results are given as fluorescence levels relative to this (a). All extracts were tested at 200 𝜇g/mL. Lipid stores in C. elegans were stained with nile red. Differential interference microscopy and nile red images (rhodamine channel) of L4 staged wild-type worms treated with either vehicle (b and c) or 200 𝜇g/mL DCM extract of thyme (d and e) are shown. Fluorescence levels are shown ∗ ∗∗ ∗∗∗ as normalized means ± normalized SEM. 𝑃 < 0.05, 𝑃 < 0.01,and 𝑃 < 0.001 indicate significance relative to DMSO.

included in the test for effect on GU in myotubes and three PPAR𝛾 morethan10-foldrelativetothevehicle(DMSO) of these (MeOH extracts of broccoli, elder, and savory) were without stimulation of adipocyte differentiation. Carvacrol, able to enhance GU significantly. All sixteen plant extracts a major component in thyme, has previously been reported were also tested in the in vivo assay for fat accumulation to activate PPAR𝛾 [17] and this might explain some of the in C. elegans and of these thirteen were able to decrease fat observed bioactivity. Results for thyme are illustrated in accumulation including the four extracts that were able to Figure 1 and correspond to those obtained by Christensen et activate PPAR𝛾 as well as positively affecting GU in both al. for both the DCM and the MeOH extract [18]. Stimulation adipocytes and myotubes. of GU in adipocytes (Figure 1)andmyotubes(Figure 2)by Two species of the Lamiaceae family (thyme and savory) the DCM extract of thyme was significant compared to were tested and the DCM extracts of both were able to activate thecontrol.GU-relatedactivityinadipocyteswasreported Evidence-Based Complementary and Alternative Medicine 7 previously [18] for both thyme and savory extracts, while Abbreviations no records are available on their activity in myotubes. The DCM: Dichloromethane stimulation of GU in myotubes by the DCM extract of thyme DMEM: Dulbecco’s modified Eagle’s medium (Figure 2) was dose-dependent until 0.7 mg/mL and hereafter DMSO: Dimethylsulfoxide activity slightly decreased at the maximum concentration of FCS: Foetal calf serum 1 mg/mL. This decrease in activity might be explained as a GU: Glucose uptake cytotoxic effect of the extract at high concentration, which HEPES: 4-(2-Hydroxyethyl)-1- wasalsoobservedbyRozmanetal.[27], who tested several piperazineethanesulfonic compounds from thyme including carvacrol for their toxicity acid against insects. KRHB: Krebs-Ringer-Hepes buffer DCM extracts of both aerial parts and roots of golden root LBD: Ligand-binding domain were tested in this study. Only the DCM extract of aerial parts MeOH: Methanol activated PPAR𝛾 without stimulating adipocyte differentia- NGM: Nematode growth medium tion (Figure 1) and stimulated GU in adipocytes (Figure 1) PBS: Phosphate buffered saline and myotube cell cultures (Figure 2) as well. Golden root PGM: Porcine growth medium is known for a high content of phenolic glycosides, for PPAR: Peroxisome proliferator-activated receptor example, salidroside that has previously been shown to Rosi: Rosiglitazone have an effect on carbohydrate metabolism and adipocyte TZD: Thiazolidinedione. differentiation16 [ ]. However, these phenolic glycosides are muchmoresolubleinMeOHthaninDCM,andastheMeOH extracts of golden root showed no activity in the bioassays Conflict of Interests this indicates that the active compounds are not phenolic glycosides but other less polar compounds. In C. elegans, The authors declare that there is no conflict of interests both DCM and MeOH extracts of golden root were able regarding the publication of this paper. to suppress fat accumulation significantly compared to the vehicle (Figure 3). Acknowledgment Christensen et al. [18] tested four different extracts of elderflowers (hexane, DCM, MeOH, and ethyl acetate) to The support from the Danish Council for Strategic Research determine their PPAR-related activities and all activated (Project no. 09-063086) is acknowledged. PPAR𝛾 alongwithPPAR𝛼 and 𝛿. In the present study, we were able to confirm that the DCM extract activates PPAR𝛾 but References nottheMeOH.Thiscouldbeduetothedifferentmethods of extraction applied as Christensen et al. did a four-step [1] R. A. DeFronzo, “The triumvirate: 𝛽-cell, muscle, liver. A sequential extraction, while only a two-step procedure was collusion responsible for NIDDM,” Diabetes,vol.37,no.6,pp. applied here. The DCM extract of elderflowers stimulated 667–687, 1988. GU in both adipocytes and myotubes in a dose-dependent [2] H. Yau, K. Rivera, R. Lomonaco, and K. Cusi, “The future of manner corresponding with Christensen et al. [18]. The thiazolidinedione therapy in the management of type 2 diabetes MeOH extract of elderflowers was not tested for effect on GU mellitus,” Current Diabetes Reports,vol.13,no.3,pp.329–341, in adipocytes as it was unable to activate PPAR𝛾 and previous 2013. resultsshowedittobeinactive[18]; however it was found to [3] A. Zieleniak, M. Wojcik,andL.A.Wo´ zniak,´ “Structure and be able to increase GU in myotube cell cultures (Table 2). physiological functions of the human peroxisome proliferator- activated receptor 𝛾,” Archivum Immunologiae et Therapiae Experimentalis,vol.56,no.5,pp.331–345,2008. [4] E. Powell, P. Kuhn, and W. Xu, “Nuclear receptor cofactors in PPAR𝛾-mediated adipogenesis and adipocyte energy 4. Conclusions metabolism,” PPAR Research,vol.2007,ArticleID53843,11 pages, 2007. The present screening provides valuable information on the [5] F. Lizcano and D. Vargas, “Diverse coactivator recruitment bioactivities of different plant species in relation to aspects through differential PPAR𝛾 nuclearreceptoragonism,”Genetics of glucose homeostasis and shows that plant foods in human and Molecular Biology, vol. 36, no. 1, pp. 134–139, 2013. nutrition contain compounds that may help to improve glu- 𝛾 [6] E. Burgermeister, A. Schnoebelen, A. Flament et al., “A novel cose homeostasis. Some extracts were able to activate PPAR partial agonist of peroxisome proliferator-activated receptor-𝛾 and also enhance GU in both adipocytes and myotubes. (PPAR𝛾)recruitsPPAR𝛾-coactivator-1𝛼, prevents triglyceride Other extracts were unable to activate PPAR𝛾 but were still accumulation, and potentiates insulin signaling in vitro,” Molec- able to stimulate GU in myotubes. Future investigations using ular Endocrinology,vol.20,no.4,pp.809–830,2006. bioassay-guided chromatographic fractionations may lead to [7] S. Rocchi, F. Picard, J. Vamecq et al., “A unique PPAR𝛾 ligand identification of specific compounds from these plant extracts with potent insulin-sensitizing yet weak adipogenic activity,” responsible for the observed bioactivities and may explain Molecular Cell,vol.8,no.4,pp.737–747,2001. their mechanism of action in relation to GU both in vitro and [8]Y.Miyazaki,A.Mahankali,E.Wajcberg,M.Bajaj,L.J.Man- in vivo. darino, and R. A. DeFronzo, “Effect of pioglitazone on cir- 8 Evidence-Based Complementary and Alternative Medicine

culating adipocytokine levels and insulin sensitivity in type [24] T. Stiernagle, “Maintenance of C. elegans,” i n The C. elegans 2 diabetic patients,” Journal of Clinical Endocrinology and Research Community, WormBook, 2006, http://www.worm- Metabolism,vol.89,no.9,pp.4312–4319,2004. book.org/. [9]J.W.F.ElteandJ.F.Blickle,´ “Thiazolidinediones for the [25] P. E. Kuwabara and N. O’Neil, “The use of functional genomics treatment of type 2 diabetes,” European Journal of Internal in C. elegans for studying human development and disease,” Medicine,vol.18,no.1,pp.18–25,2007. Journal of Inherited Metabolic Disease,vol.24,no.2,pp.127–138, [10] Y. Guan, C. Hao, D. R. Cha et al., “Thiazolidinediones expand 2001. body fluid volume through PPAR𝛾 stimulation of ENaC- [26] P. Thejass and G. Kuttan, “Augmentation of natural killer cell mediated renal salt absorption,” Nature Medicine, vol. 11, no. 8, and antibody-dependent cellular cytotoxicity in BALB/c mice pp.861–866,2005. by sulforaphane, a naturally occurring isothiocyanate from [11] J. P.Berger, A. E. Petro, K. L. Macnaul et al., “Distinct properties broccoli through enhanced production of cytokines IL-2 and and advantages of a novel peroxisome proliferator-activated IFN-𝛾,” Immunopharmacology and Immunotoxicology,vol.28, protein 𝛾 selective modulator,” Molecular Endocrinology,vol.17, no.3,pp.443–457,2006. no. 4, pp. 662–676, 2003. [27] V. Rozman, I. Kalinovic, and Z. Korunic, “Toxicity of naturally [12] R. J. Marles and N. R. Farnsworth, “Antidiabetic plants and their occurring compounds of Lamiaceae and Lauraceae to three active constituents,” Phytomedicine,vol.2,no.2,pp.137–189, stored-product insects,” Journal of Stored Products Research,vol. 1995. 43,no.4,pp.349–355,2007. [13]M.Jung,M.Park,H.C.Lee,Y.Kan,E.S.Kang,andS.K.Kim, “Antidiabetic agents from medicinal plants,” Current Medicinal Chemistry,vol.13,no.10,pp.1203–1218,2006. [14] N. S. Survay, E. Y. Ko, C. P. Upadhyay et al., “Hypoglycemic effects of fruits and vegetables in hyperglycemic rats for prevention of type-2 diabetes,” Korean Journal of Horticultural Science and Technology,vol.28,no.5,pp.1–7,2010. [15] H. Neef, P. Declercq, and G. Laekeman, “Hypoglycaemic activity of selected European plants,” Phytotherapy Research,vol.9, no. 1, pp. 45–48, 1995. [16] S. H. Wang, W.J. Wang, X. F. Wang, and W.H. Chen, “Effects of salidroside on carbohydrate metabolism and differentiation of 3T3-L1 adipocytes,” JournalofChineseintegrativemedicine,vol. 2, no. 3, pp. 193–195, 2004. [17] M. Hotta, R. Nakata, M. Katsukawa, K. Hori, S. Takahashi, and H. Inoue, “Carvacrol, a component of thyme oil, activates PPAR𝛼 and 𝛾 and suppresses COX-2 expression,” Journal of Lipid Research, vol. 51, no. 1, pp. 132–139, 2010. [18] K. B. Christensen, A. Minet, H. Svenstrup et al., “Identifica- tion of plant extracts with potential antidiabetic properties: effect on human peroxisome proliferator-activated receptor (PPAR), adipocyte differentiation and insulin-stimulated glucose uptake,” Phytotherapy Research,vol.23,no.9,pp.1316–1325, 2009. [19] K. B. Christensen, R. K. Petersen, S. Petersen, K. Kristiansen, andL.P.Christensen,“ActivationofPPAR𝛾 by metabolites from the flowers of purple coneflower (Echinacea purpurea),” Journal of Natural Products,vol.72,no.5,pp.933–937,2009. [20] K. B. Christensen, R. K. Petersen, K. Kristiansen, and L. P. Christensen, “Identification of bioactive compounds from flowers of black elder (Sambucus nigra L.) that activate the human peroxisome proliferator-activated receptor (PPAR) 𝛾,” Phytotherapy Research,vol.24,no.2,pp.S129–S132,2010. [21] J. B. Hansen, R. K. Petersen, B. M. Larsen, J. Bartkova, J. Alsner, and K. Kristiansen, “Activation of peroxisome proliferator- activated receptor 𝛾 bypasses the function of the retinoblastoma protein in adipocyte differentiation,” The Journal of Biological Chemistry,vol.274,no.4,pp.2386–2393,1999. [22]P.K.Theil,I.L.Sørensen,P.M.Nissen,andN.Oksbjerg,“Tem- poral expression of growth factor genes of primary porcine satellite cells during myogenesis,” Animal Science Journal,vol. 77,no.3,pp.330–337,2006. [23] J. Sulston and J. Hodgkin, “Methods,” in The Nematode Caen- orhabditis elegans,B.W.Wood,Ed.,pp.587–606,ColdSpring Harbor Laboratory Press, New York, NY, USA, 1988. Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2014, Article ID 943713, 6 pages http://dx.doi.org/10.1155/2014/943713

Review Article A Review of the Efficacy and Safety of Litramine IQP-G-002AS, an Opuntia ficus-indica Derived Fiber for Weight Management

Pee-Win Chong,1 Kai-Zhia Lau,1 Joerg Gruenwald,2 and Ralf Uebelhack3

1 InQpharm Europe Ltd., Invision House, Wilbury Way, Hitchin, Hertfordshire SG4 0TY, UK 2 Analyze & Realize GmbH, Waldseeweg 6, 13467 Berlin, Germany 3 Universitatsmedizin¨ Charite,´ Campus ChariteMitte,Schumannstraße20/21,10117Berlin,Germany´

Correspondence should be addressed to Kai-Zhia Lau; [email protected]

Received 10 February 2014; Revised 10 July 2014; Accepted 15 July 2014; Published 28 August 2014

Academic Editor: Srinivas Nammi

Copyright © 2014 Pee-Win Chong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Sedentary lifestyle and caloric overconsumption are the key determinants of the escalating obesity prevalence. Reducing dietary fat absorption may help to induce a negative energy balance and thus help in managing weight problem. Apart from approved drug therapies, weight problems may also be aided with alternative and natural treatments. This paper compiled and reviewed the efficacy and safety of Litramine IQP-G-002AS, an Opuntia ficus-indica (OFI) derived fiber, in reducing dietary fat absorption and promoting weight loss. Evidence reviewed shows that Litramine IQP-G-002AS displays efficacy in promoting fat excretion and weight loss in four randomized, placebo-controlled clinical studies (including an unpublished pilot study). With a daily dosage of 3 g over a seven-day period, Litramine IQP-G-002AS showed an increased faecal fat excretion compared with placebo (15.8% (SD 5.8%) versus 4.6% (SD 3.1%); P < 0.001). In a 12-week study, significant greater weight loss (3.8 kg (SD 1.8 kg) versus 1.4 kg (SD 2.6 kg); P < 0.001) was observed in overweight and obese subjects treated with Litramine IQP-G-002AS as compared to placebo. No relevant gastrointestinal side effects have been reported for Litramine IQP-G-002AS at the dosages studied.

1. Introduction reversetheobesityepidemicandtoreducesoaringhealthcare expenses. The prevalence of overweight and obesity has increased The main cause of obesity is an energy imbalance where expeditiously according to the 2012 obesity update by the calories consumed exceeded calories expended [4]. In South- Organisation for Economic Cooperation and Development ern Europe, the dietary fat intake is 45% and 42% of the (OECD) where at least one in two people is overweight or total daily energy requirement, for male and female, respec- obese in more than 50% of the 34 OECD countries, while tively [5], which is approximately 8–10% higher than the ChinaandtheUnitedStateshavethelargestabsoluteincrease recommended dietary fat intake by the European Food Safety in the number of overweight and obese people between 1980 Authority (EFSA). Such high fat dieting behavior facilitates and2008followedbyMexico[1]. caloric overconsumption [6]. In addition, the obesogenic Obesity is associated with many noncommunicable environments where fast food is overabundant and hectic, chronic conditions, such as diabetes and cardiovascular sedentary lifestyles often hinder the desire of the overweight diseases, with more than double the odds of multimorbidity and obese individuals to maintain a healthy diet low in fat comparedtothenonobese[2]; a publication in 2012 reported [7]. Therefore, therapeutic agents, which reduce the dietary that obesity in the United States constituted a notable 190 fat absorption may be useful to help these subjects in their billion US dollar to the annual healthcare expenses [3] weight loss efforts. exceeding smoking as number one public health enemy. Currently, there are several approaches for the reduction Therefore, effective health-care measures are necessary to of dietary fat absorption; these include (1) inhibition of 2 Evidence-Based Complementary and Alternative Medicine the digestion process of dietary fats through inhibition of Recent research using a laboratory test method has shown pancreatic lipase, the main fat digestion enzyme, (2) binding that an OFI cladode powder (NeOpuntia, Nexira Health), to bile acids that slow down the digestion of fats [8], or (3) standardized in its fiber content, is able to bind to dietary reduction of the fat absorption by restricting the physical fat. A similar method has been used for quantifying the contact between nutrients and intestinal villi [9]. Meanwhile, fat binding capacity of other fiber compounds24 [ ]. It is pharmaceutical lipase inhibitor, Orlistat, which prevents 25– postulated that, by binding to dietary fat, the fiber prevents 30% of dietary fat from being absorbed, is the only authorized fats from intestinal digestion process and reduces the fat drug treatment in this category. However, approximately 15– absorption. The capacity of this standardized OFI powder in 30% of patients experience gastrointestinal side effects such as reducing fat absorption has also been shown in a dynamic fatty or oily stool, oily spotting during the treatment, and fecal gastrointestinal model [25]. Additionally, a pilot clinical study incontinence [10]. Safety concerns have been raised about a with 10 healthy subjects showed that subjects receiving 4.8 g possible link between Orlistat and the risk of acute liver injury a day of the standardized OFI powder experienced 27% more [11]. fat excretion, compared to placebo [26]. Alternative treatments for reducing dietary fat uptake Based on the same fat binding mechanism, Litramine have also been evaluated. One of the concepts is the use of IQP-G-002AS was developed and marketed as fat binder in dietary fibers [8]. Baer et al. [9] indicated that an increased recent years. Litramine IQP-G-002AS is a natural fiber com- consumption of dietary fiber resulted in a decrease of metab- plex derived from OFI cladode powder, fortified with soluble olized energy that may be attributed to the reduction of fiber from Acacia spp. and coprocessed with cyclodextrin fat digestion, while a prospective cohort study in 2009 [12] using a patent pending technology, thus optimizing the fat further corroborated the efficacy of dietary fiber in reducing bindingperformance.ThefatbindingcapacityofLitramine body weight and body fat. However, there seem to be major IQP-G-002AS is measured and standardized based on a differences in fat binding properties between different fibers modified in vitro method that simulates the gastrointestinal [13]. conditions [24]. In this paper we compile and review evidence of effective and safe use of dietary fiber derived from Opuntia ficus- 3. Efficacy Review indica, Litramine IQP-G-002AS in weight management. Published and unpublished studies on Litramine IQP-G- 002AS regarding its use in reducing fat absorption and weight 2. Background management were identified for this systematic review. Pub- lished sources consisted of data from various databases such Opuntia ficus-indica (L.) Mill. (OFI) (also known as prickly as PubMed, Scopus, and Google Scholar, while unpublished pear, cactus pear, or nopal) is a species of cacti native to data was obtained from the key authors of the studies. arid and semiarid regions, originates from Mexico, and was Randomized controlled studies in both animal and human propagated to other regions like the Mediterranean region were considered for the review of efficacy. and North Africa [14]. One (1) preclinical study and four (4) clinical studies have The fruit and the cladode of OFI have been part of the been identified, all of which were conducted with Litramine human diet for centuries in these regions. Particularly, the IQP-G-002AS, between 2009 and 2013, to investigate its cladode (or the pad of cactus) is known for its rich fiber con- efficacy and safety in faecal fat excretion, weight loss, and tent. The OFI cladode generally contains approximately 40– weight loss maintenance. 50% dry weight of dietary fibers, which consists of soluble and insoluble fiber. The soluble fiber mainly consists of mucilage, gum, pectin, and hemicellulose while the insoluble fiber 3.1. Animal Study on Weight Gain Prevention and Fecal Fat consists of cellulose and a larger fraction of hemicellulose [15– Excretion. In an unpublished study with Sprague-Dawley 17]. The fiber composition of OFI cladode is believed tobe rats, Litramine IQP-G-002AS in 2 doses (140 mg/kg/day and the main contributor to its reported health benefits, including 210 mg/kg/day, eq. to human daily dose of 1.32 g and 2 g, resp.) improved blood glucose levels and blood lipid profiles18 [ – significantly increased fecal fat excretion compared to the 21]. However, the findings have been inconsistent [21, 22], control group (Figure 1).Inthesamestudy,LitramineIQP-G- which may be attributed to the differences in composition 002ASalsohasshownsignificantefficacyinpreventingbody of the OFI cladode products. It was reported that the fiber weight gain in rats fed with high fat diet, in comparison with composition of the OFI cladode changes according to age the control group (Figure 2). This study provided the proof of of maturity. The insoluble fiber content increases, while the concept of Litramine IQP-G-002AS’s fat binding mechanism soluble fiber decreases with age23 [ ]. Apart from age of and provided useful information for the estimation of an maturation, the composition and the health properties of OFI effective intervention dose in weight management. are also affected by the plant variety, cultivation condition, and post harvesting processing method [17]. Therefore, in 3.2. Pilot Faecal Fat Excretion Study in Human. Apilotstudy reviewing the clinical evidence of Opuntia ficus-indica,itis (unpublished) was conducted in 2009 to elucidate the dietary important to identify the active composition and functional fat binding capacity of Litramine IQP-G-002AS. Forty-six 2 properties of the study materials applied, as they are linked to healthy Caucasian subjects (BMI between 20 and 30 kg/m ) the therapeutic effects. completed the two-armed, randomized, double blind, and Evidence-Based Complementary and Alternative Medicine 3

3 4 2.5 3.5 3.24 2

g faeces 3 1.5 100 1 2.5 g fat/ 0.5 g faeces 2

0 100 Control IQP-G-002AS IQP-G-002AS 1.5

∗ ∗∗ g fat/ (210 mg/kg/day) (140 mg/kg/day) 1.04 1 Figure 1: 24-hour faecal fat excretion (animal study). Faecal fat 0.58 0.6 excretion increased significantly in Sprague-Dawley rats fed with 0.5 LitramineIQP-G-002ASintwodoses,comparedtocontrol(𝑃< 0.01 𝑛=6 0 )( for control and each of the Litramine IQP-G-002AS 002 ∗ Placebo group). Asterisk (∗) denotes statistically significant, compared IQP-G- AS to control and Litramine IQP-G-002AS (140 mg/kg/day); double- Baseline asterisk (∗∗) denotes statistically significant, compared to control. After intervention Error bars denote standard deviation. Figure 3: Faecal fat content before and after intake of Litramine IQP-G-002AS (2009 pilot faecal fat excretion study). Faecal fat 300.00 excretion was greater in Litramine IQP-G-002AS, compared to placebo after treatment𝑃 ( < 0.001)(𝑛=46). Asterisk (∗) denotes 280.00 statistically significant, compared to placebo. Error bar denotes standard deviation. 260.00

240.00 measured in aliquots only, whereas the total daily stool weight 220.00 of each subject had not been measured; hence, the absolute Mean body weight (g) body weight Mean 200.00 amount of fat excreted could only be established through a theoretical calculation based on daily stool weights reported 180.00 in literature. D5 D7 D9 D1 D3 D11 D15 D17 D19 D21 D23 D27 D29 D31 D33 D13 D25 D35 Treatment day 3.3. Faecal Fat Excretion Clinical Study. Asecondfaecalfat Control ∗ excretion trial was conducted in 2011 [27], with additional IQP-G-002AS (210 mg/kg/day) experimental conditions that addressed the corresponding 140 )∗ IQP-G-002AS ( mg/kg/day study limitations, which were observed in the pilot trial. Twenty healthy Caucasian subjects (BMI between 20 and 2 Figure 2: Change in body weight (animal study). Litramine IQP-G- 30 kg/m ) completed the 45-day, double blind, randomized, 002AS (at two doses) has shown significant efficacy in preventing and crossover fat excretion study (Figure 4). During the body weight gain in Sprague-Dawley rats fed with high fat diet, compared to control group (𝑃 < 0.05)(𝑛=6for control and intervention phases, subjects received either two tablets of each of the Litramine IQP-G-002AS group). Asterisk (∗) denotes Litramine IQP-G-002AS (500 mg per tablet) or matching statistically significant. placebo tablets, thrice daily before main meals. In addition, subjects were put on a standardized diet with preprepared meals. Subjects were assigned to one of three different daily energy levels, providing 35% of the total daily energy intake byfat:2200kcal(with85gfat),2600kcal(with101gfat), placebo-controlled study. During the intervention phase, and 3000 kcal (with 115 g of fat). All bowel movements within subjects received either 1.07 g (two tablets) of Litramine IQP- 24 hours were collected either on days 5 and 6 or on days G-002AS or identical placebo for three days and were advised 6 and 7 of the intervention phase. The results show that to adhere to a diet plan containing a daily energy intake of consumption of Litramine IQP-G-002AS over a period of 5- 2500 kcal with a fat content of 30% (80 g). Stool samples were 6 days increased the amount of fat excreted in the faeces. collectedonthethirddayandonthesixthday,forfaecal The percentage of fat excreted relative to daily fat intake fat content analysis. Compared to placebo, Litramine IQP- (equivalent to 100%) was calculated. There was a significant G-002AS has been shown to significantly increase faecal fat (𝑃 < 0.001) difference between the mean percentage of excretion (Figure 3). However, the study design had certain dietary fat excreted in subjects on Litramine IQP-G-002AS limitations as the fat content of the subject’s stool was (15.8% (SD 5.8%)) and subjects on placebo (4.6% (SD 3.1%)). 4 Evidence-Based Complementary and Alternative Medicine

Placebo IP 1 Placebo IP 2

Screening Baseline 1 Intervention 1 Wash- Baseline 2 Intervention 2 Final out visit ∗ V1 V2V3 V4 V5 V6 7 days 012345 6 7 0 12345 6 7 7 days 012345 6 70 12345 6 7 3 days Blood Blood sampling sampling Stool collection (on days 5 and 6 or days 6 and 7) ∗ Randomization

Figure 4: Study design summary of 2011 faecal fat excretion clinical trial.

100 Table 1: Waist circumference and body fat mass (measured by bioimpedance analyser) changes between baseline and week 24. 90 IQP-G-002AS Placebo 𝑃 value 80 Parameter Mean (standard deviation) 70 Waist circumference (cm) −1.7 (3.1) +0.7 (1.5) <0.001 Body fat mass (kg) −1.0 (1.7) +0.4 (1.8) 0.014 60 𝑃 value derives from the nonparametric Mann-Whitney 𝑈 test.; positive 50 values represent increment, while negative values represent reduction. (%)

30 3.5. Follow-Up Weight Maintenance Study. Forty-nine over- 2 20 weight and obese adults (BMI 25–35 kg/m ), with documented weight loss achieved over the last three to six 10 months prior to the study, completed the randomized, double blind, placebo-controlled weight maintenance study [29]. 0 ∗ ∗ IQP-G002AS Placebo No dietary restriction and behavioral modification were applied; however, subjects were encouraged to maintain a Successfully maintained body weight loss nutritionally balanced diet and to continue their physical Unsuccessfully maintained body weight loss activity such as walking and cycling. In addition, subjects received either 3 g/day (1 g after each of the three meals) of Figure 5: Percentage of individuals who successfully and unsuc- Litramine IQP-G-002AS or a matching placebo. Two primary cessfully maintained body weight loss (intent-to-treat population, endpoints were evaluated throughout the 6-month study: (1) 𝑛=49), at week 24. Asterisk (∗) denotes statistically significant 𝑃 < 0.001 𝑃 = 0.012 the difference between body weight at baseline and at final ( for IQP-G002AS group; for placebo). visit and (2) the maintenance of the initially lost body weight in the Litramine IQP-G-002AS group, where maintenance is defined as ≤1% weight gain. Under the free-living condition, subjects in the Litramine IQP-G-002AS group lost significantly more weight than in 3.4. Weight Loss Clinical Study. A randomized, double blind, − placebo-controlled trial with 30 males and 93 females over- the placebo group ( 0.62 (SD 1.55) kg for IQP-G-002AS 2 versus +1.62 (SD 1.48) kg for placebo, difference of 2.24 kg weight and obese subjects (BMI between 25 and 35 kg/m ) 𝑃 < 0.001 was conducted to investigate the efficacy of Litramine IQP-G- ( )) at the end of week 24. In addition, signifi- 002AS in reducing body weight [28]. The subjects consumed cant more Litramine IQP-G-002AS subjects maintained or either 3 g/day of Litramine IQP-G-002AS or placebo tablets further reduced their body weight after initial weight loss. for12weeks.Attheendofthestudy,therewasastatistically Conversely, more subjects in the placebo group gained weight significant 2.4 kg greater weight loss in the Litramine IQP- after 24 treatment weeksFigure ( 5). Moreover, improvements G-002AS group compared to the placebo group (3.8 kg (SD on waist circumference and body fat composition were 1.8 kg) versus 1.4 kg (SD 2.6 kg); 𝑃 < 0.001). Furthermore, observed in the Litramine IQP-G-002AS group (Table 1). subjects treated with Litramine IQP-G-002AS also showed significantly greater reduction in body fat composition0.7 ( % 3.6. Fat Excretion and Weight Loss. Many products claim to (SD 1.7%) versus +0.1%(SD2.5%); difference 0.8%; 𝑃< bind and eliminate dietary fat manifold of their own weight 0.031) and waist circumference (3.9 cm (SD 2.7 cm) versus in in vitro experiments; however the clinical efficacy remains 2.2 cm (SD 2.9 cm); difference 1.7 cm; 𝑃 < 0.001)in questionable [30, 31]. The results from the above clinical comparison to the placebo group. studies showed that increased faecal excretion of dietary Evidence-Based Complementary and Alternative Medicine 5 fat due to consumption of Litramine IQP-G-002AS induces Conflict of Interests weight loss, which concurs with the proposed fat binding mechanism. The weight loss effect of Litramine IQP-G-002AS The authors declare that there is no conflict of interests may also be attributed to other functional properties of the regarding the publication of this paper. fiber such as (1) delayed absorption of nutrients [18–20], (2) satiety promoting effects of the fiber due to the high Authors’ Contribution viscosity of the fiber, which may also slow down nutrients absorption and subsequently minimize postprandial glucose Pee-Win Chong and Kai-Zhia Lau contributed in paper draft- spikes leading to a reduced insulin secretion [32], or (3) ing. Joerg Gruenwald, Ph.D, and Professor Ralf Uebelhack swelling properties of the fiber resulting in satiety signals due contributed in reviewing and approving the paper. to stomach distension [33, 34]. References

[1] R. Perez,´ “Current mapping of obesity,” Nutricion Hospitalaria, 4. Safety Review vol.28,no.5,pp.21–31,2013. [2] C. B. Agborsangaya, E. Ngwakongnwi, M. Lahtinen, T. Cooke, Safety review was performed based on published and unpub- and J.A. Johnson, “Multimorbidity prevalence in the general lished studies referring to Litramine IQP-G-002AS. Pub- population: the role of obesity in chronic disease clustering,” lished sources consist of data from various databases such BMC Public Health, vol. 13, article 1161, 2013. as PubMed, Scopus, and Google Scholar, while unpublished [3] J. Cawley and C. Meyerhoefer, “The medical care costs of data was obtained from the manufacturers. obesity: an instrumental variables approach,” Journal of Health There were no gastrointestinal side effects reported from Economics,vol.31,no.1,pp.219–230,2012. the clinical studies reviewed above, with the consumption of [4] World Health Organization, Obesity and Overweight,2013. about3gofLitramineIQP-G-002ASadayforupto24weeks. [5]I.Elmadfa,A.Meyer,V.Nowaketal.,“Europeannutritionand There were also no clinical changes observed from blood health report 2009,” Annals of Nutrition & Metabolism,vol.55, parameters such as full blood count and clinical chemistry. pp. 1–40, 2009. Furthermore,theintakeofLitramineIQP-G-002ASfor12 [6] B. J. Rolls, “The role of energy density in the overconsumption weeks had not resulted in any clinical relevant changes on of fat,” The Journal of Nutrition,vol.130,no.2,pp.268–271,2000. the serum fat soluble vitamins (A, D, and E) [28]andserum [7] I. Koehler, “Weight management—a suitable target for health mineral level (sodium, potassium, magnesium, and calcium) claims made on foods?” Agro Food Industry Hi Tech,vol.24,pp. [28, 29]. Nevertheless, studies of more than 24 weeks are 4–9, 2013. needed to examine the long-term safety of Litramine IQP-G- [8]T.Tsujita,H.Takaichi,T.Takaku,T.Sawai,N.Yoshida,andJ. 002AS. Hiraki, “Inhibition of lipase activities by basic polysaccharide,” Journal of Lipid Research, vol. 48, no. 2, pp. 358–365, 2007. [9] D. J. Baer, W. V. Rumpler, and C. George, “Dietary fiber decreases the metabolizable energy content and nutrient 5. Conclusion digestibility of mixed diets fed to humans,” Journal of Nutrition, vol. 127, no. 4, pp. 579–586, 1997. The current review examined the efficacy and safety ofLit- [10]D.Rucker,R.Padwal,S.K.Li,C.Curioni,andD.C.W. ramine IQP-G002AS, a dehydrated cladode of OFI enriched Lau, “Long term pharmacotherapy for obesity and overweight: with additional soluble fiber from acacia gum and copro- updated meta-analysis,” British Medical Journal,vol.335,no. cessed with cyclodextrin. Published and unpublished data 7631, pp. 1194–1199, 2007. from randomized, placebo-controlled trials indicate positive [11] I. J. Douglas, J. Langham, K. Bhaskaran, R. Brauer, and L. results for faecal fat excretion, for the promotion of weight Smeeth, “Orlistat and the risk of acute liver injury: Self loss and for the maintenance of body weight. The safety controlled case series study in UK Clinical Practice Research assessment also revealed minimal concern as the studies Datalink,” British Medical Journal,vol.346,ArticleIDf1936, evaluated showed that the consumption of Litramine IQP- 2013. G002AS is well tolerated. Nevertheless, further research is [12] L. A. Tucker and K. S. Thomas, “Increasing total fiber intake warranted to investigate the efficacy and safety of Litramine reduces risk of weight and fat gains in women,” Journal of IQP-G002AS in reducing the risks of obesity related- Nutrition,vol.139,no.3,pp.576–581,2009. comorbidities as a possible measure for health care providers [13] M. Kristensen, M. G. Jensen, J. Aarestrup et al., “Flaxseed and public in general to help alleviate the negative impact of dietary fibers lower cholesterol and increase fecal fat excretion, the obesity epidemic. but magnitude of effect depend on food type,” Nutrition & Me- tabolism,vol.9,article8,2012. [14] M. P. Griffith, “The origins of an important cactus crop, Opuntia ficus-indica (Cactaceae): new molecular evidence,” The Disclosure American Journal of Botany,vol.91,no.11,pp.1915–1921,2004. [15] C. B. Pena-Valdivia,´ C. Trejo, V. B. Arroyo-Pena,A.B.S´ anchez´ Pee-Win Chong and Kai-Zhia Lau are the employees of Urdaneta, and R. Balois Morales, “Diversity of unavailable poly- InQpharm Europe Ltd. saccharides and dietary fiber in domesticated nopalito and 6 Evidence-Based Complementary and Alternative Medicine

cactus pear fruit (Opuntia spp.),” Chemistry & Biodiversity,vol. [32] J. L. Slavin, “Dietary fiber and body weight,” Nutrition,vol.21, 9, no. 8, pp. 1599–1610, 2012. no. 3, pp. 411–418, 2005. [16] M. I. Hernandez-Urbiola,´ E. Perez-Torrero,´ and M. E. [33] N. C. Howarth, E. Saltzman, and S. B. Roberts, “Dietary fiber Rodr´ıguez-Garc´ıa, “Chemical analysis of nutritional content of and weight regulation,” Nutrition Reviews,vol.59,no.5,pp.129– prickly pads (Opuntia ficus indica) at varied ages in an organic 139, 2001. harvest,” International Journal of Environmental Research and [34] M. Sanaka, T. Yamamoto, H. Anjiki, K. Nagasawa, and Y. Public Health,vol.8,no.5,pp.1287–1295,2011. Kuyama, “Effects of agar and pectin on gastric emptying and [17] C. Saenz,´ “Cladodes: a Source of Dietary Fiber,” Journal of the post-prandial glycaemic profiles in healthy human volunteers,” Professional Association for Cactus Development,vol.2,pp.117– Clinical and Experimental Pharmacology and Physiology,vol.34, 123, 1997. no. 11, pp. 1151–1155, 2007. [18]M.P.Godard,B.A.Ewing,I.Pischel,A.Ziegler,B.Benedek, and B. Feistel, “Acute blood glucose lowering effects and long- term safety of OpunDia supplementation in pre-diabetic males and females,” Journal of Ethnopharmacology,vol.130,no.3,pp. 631–634, 2010. [19] I. Bourdon, W. Yokoyama, P. Davis et al., “Postprandial lipid, glucose, insulin, and cholecystokinin responses in men fed barley pasta enriched with 𝛽-glucan,” American Journal of Clinical Nutrition,vol.69,no.1,pp.55–63,1999. [20] A. Frati-Munari, C. de Leon, R. Ariza-Andraca, M. B. Banales- Ham, R. Lopez-Ledesma, and X. Lozoya, “Influence of a dehydrated extract of the nopal (Opuntia ficus-indica mill.) on glycemia,” Archivos de Investigacion Medica,vol.20,no.3,pp. 211–216, 1989. [21] A. Frati-Munari, H. Fernandex, H. D. la Riva, R. Ariza, and M.Torress,“Efectodelnopal(Opuntia spp.) sobre los lipidos sericos, la glucemia y el peso corporal,” Archivos de Investigacion Medica,vol.14,1983. [22] A. C. Frati Munari, O. Vera Lastra, and C. R. Ariza Andraca, “Evaluation of nopal capsules in diabetes mellitus,” Gaceta Medica de Mexico,vol.128,no.4,pp.431–436,1992. [23] M. Hernandez-Urbiola,´ “Study of nutritional composition of nopal (Opuntia ficus-indica cv. Redonda) at different maturity stages,” The Open Nutrition Journal,vol.4,pp.11–16,2010. [24] N. J. N. Izani, M. Rafiquzzaman, M. D. N. Aidah, and M. M. Rafi, “In vitro binding of lipid (olive oil and ghee) with chitosan under the conditions mimicking the gastrointestinal tract,” Saudi Pharmaceutical Journal,vol.17,no.1,pp.78–84, 2009. [25] H. Granato, “Weight management,” Natural Product Insiders, vol.10,pp.1–15,2005. [26] C. Bachmann, “Ein Fasernkomplex zur Gewichts- reduktion und -kontrolle. Ars Medici Thema Phytotherapie,” Ars Medici Thema Phytotherapie,pp.25–27,2010. [27] R. Uebelhack, R. Busch, F. Alt, Z.-M. Beah, and P.-W. Chong, “Effects of cactus fiber on the excretion of dietary fat in healthy subjects: a double blind, randomized, placebo-controlled, crossover clinical investigation,” Current Therapeutic Research, vol. 76, pp. 39–44, 2014. [28]B.Grube,P.W.Chong,K.Z.Lau,andH.D.Orzechowski,“A natural fiber complex reduces body weight in the overweight and obese: a double-blind, randomized, placebo-controlled study,” Obesity,vol.21,no.1,pp.58–64,2013. [29] W. F. Chong, P. W. Chong, B. Grube, and L. Riede, “Weight maintenance in Caucasian adults: safety and efficacy of IQP-G- 002AS over 24 weeks,” Obesity Facts, pp. 121–122, 2013. [30] K. Jen, G. Grunberger, and J. Artiss, “On the binding ratio of 𝛼-cyclodextrin to dietary fat in humans,” Nutrition & Dietary Supplements,vol.5,pp.9–15,2013. [31] M. D. Gades and J. S. Stern, “Chitosan supplementation and fecal fat excretion in men,” Obesity Research, vol. 11, no. 5, pp. 683–688, 2003. Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2014, Article ID 645812, 10 pages http://dx.doi.org/10.1155/2014/645812

Research Article Lingonberry (Vaccinium vitis-idaea L.) Exhibits Antidiabetic Activities in a Mouse Model of Diet-Induced Obesity

Hoda M. Eid,1,2,3,4 Meriem Ouchfoun,1,2,3 Antoine Brault,1,2,3 Diane Vallerand,1,2,3 Lina Musallam,1,2,3 John T. Arnason,2,3 and Pierre S. Haddad1,2,3

1 Natural Health Products and Metabolic Diseases Laboratory, Department of Pharmacology, University of Montreal, Station Centre-Ville, P.O. Box 6128, Montreal, QC, Canada H3C 3J7 2 Phytochemistry, Medicinal Plant and Ethnopharmacology Laboratory, Department of Biology, University of Ottawa, Ottawa, ON, Canada K1N 6N5 3 Canadian Institutes of Health Research Team in Aboriginal Antidiabetic Medicines and Montreal Diabetes Research Center, Canada 4 Department of Pharmacognosy, University of Beni Suef, Beni Suef 62511, Egypt

Correspondence should be addressed to Pierre S. Haddad; [email protected]

Received 16 December 2013; Accepted 19 May 2014; Published 10 June 2014

Academic Editor: Srinivas Nammi

Copyright © 2014 Hoda M. Eid et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Vaccinium vitis-idaea, commonly known as lingonberry, has been identified among species used by the Cree of Eeyou Istchee of northern Quebec to treat symptoms of diabetes. In a previous study, the ethanol extract of berries of V. vitis-idaea enhanced glucose uptake in C2C12 muscle cells via stimulation of AMP-activated protein kinase (AMPK) pathway. The purpose of this study was to examine the effect of plant extract in a dietary mouse model of mild type 2 diabetes. C57BL/6 mice fed a high-fat diet(HFD, ∼35% lipids) for 8 weeks that become obese and insulin-resistant (diet-induced obesity, DIO) were used. Treatment began by adding V. vitis-idaea extract to HFD at 3 different concentrations (125, 250, and 500 mg/Kg) for a subsequent period of 8 weeks (total HFD, 16 weeks). The plant extract significantly decreased glycemia and strongly tended to decrease insulin levels in this model. Thiswas correlated with a significant increase in GLUT4 content and activation of the AMPK and Akt pathways in skeletal muscle. V. v itis- idaea treatment also improved hepatic steatosis by decreasing hepatic triglyceride levels and significantly activated liver AMPK and Akt pathways. The results of the present study confirm that V. v itis-idaea represents a culturally relevant treatment option for Cree diabetics and pave the way to clinical studies.

1. Introduction membrane [1]. An alternative pathway for stimulating glucose uptake is the AMP-activated protein kinase (AMPK) path- Obesity is a complex and multifaceted disorder. Given its way. AMPK stimulates GLUT4 translocation to the plasma current global epidemic stature and strong link to life- membrane by a mechanism distinct from the PI3-K pathway threatening illnesses such as diabetes, cardiovascular dis- stimulated by insulin [2]. It is of note that AMPK upregu- eases, and cancers, the need to prevent or treat obesity and lates the expression of GLUT4, possibly through the direct its complications has become more urgent. phosphorylation of the transcriptional coactivator PPAR𝛾 Insulin resistance usually precedes the development of coactivator-1𝛼 (PGC-1𝛼). On the other hand, activation of type 2 diabetes and is more common in obese individuals. In AMPK decreases intramyocyte accumulation of lipids and skeletal muscle, insulin promotes glucose uptake by activat- increases insulin sensitivity of muscle through phosphoryla- ing the phosphatidylinositol-3 kinase (PI3-K)/Akt pathway tion and inhibition of acetyl-CoA carboxylase (ACC) [3, 4]. and by inducing the translocation of glucose transporter In the liver, AMPK decreases hepatic glucose produc- GLUT4 from intracellular storage vesicles to the plasma tion mainly by inhibiting the expression of gluconeogenic 2 Evidence-Based Complementary and Alternative Medicine genes such as phosphoenolpyruvate carboxylase (PEPCK) extract in a mouse model of diet-induced obesity (DIO), and glucose 6-phosphate (G-6-Pase). Moreover, activation of which closely mimics human metabolic syndrome and early AMPK stimulates fatty acid oxidation and inhibits expression type 2 diabetes linked to unhealthy lifestyle. The most of genes encoding lipogenic enzymes (fatty acid synthase and studied experimental model of DIO is the C57Bl/6J mouse ACC) [5]. strain. This strain becomes obese, insulin-resistant, and SIRT1 is another critical player in mammalian energy hyperglycemic when fed a high-fat diet [16]. Over and homeostasis. It is a nicotinamide adenine dinucleotide- above systemic parameters of glucose and lipid homeostasis, (NAD+-) dependent deacetylase and a member of the mam- we also paid attention to the major tissue components malian sirtuin family. SIRT1 controls a variety of cellular of insulin-dependent and -independent pathways described processes such as apoptosis, cell cycle, and metabolism previously. through deacetylation of target proteins including p53, NFkB, and PGC-1𝛼. It is activated by fasting and caloric restriction as well as by many small molecules such as 2. Materials and Methods the plant phenols quercetin, piceatannol, and resveratrol. 2.1. Plant Materials. Berries of V. vitis-idaea were harvested Activation of SIRT1 was reported to improve glucose in the Eastern James Bay region, QC, Canada, according homeostasis, increase insulin sensitivity, and improve mito- to traditional procedures (season, time of day, location, chondrial function in skeletal muscle of rodent models and gift offering) instructed by Cree elders. They were of type 2 diabetes [6]. Conversely, activation of SIRT1 kept in dry cold place until used. Botanical identity was in the liver increases gluconeogenic genes and represses confirmed by Dr. Alain Cuerrier (Institut de Recherche glycolysis suggesting that SIRT1 induces organ-specific en Biologie Veg´ etale,´ UniversitedeMontr´ eal)´ and voucher metabolic responses. Similar to skeletal muscle, SIRT acti- specimens were deposited at the Montreal Botanical Garden vation in liver promotes fatty acid oxidation and pre- Herbarium (voucher number Whap04-21). The 80% ethano- vents diet-induced hepatic steatosis and insulin resistance lic extract was prepared as previously described [17]follow- [7]. ing standard operating procedures of Professor Arnason’s 𝛼 Finally, peroxisome proliferator activated receptor- laboratory. (PPAR-𝛼) belongs to the superfamily of PPAR nuclear receptors and is highly expressed in tissues with active fat metabolism such as liver, heart, and skeletal muscle. PPAR- 2.2. Animals and In Vivo Experimental Protocols. Four-week- 𝛼 induces the expression of genes controlling the 𝛽-oxidation old male C57BL/6 mice were purchased from Charles River of fatty acids. (St-Constant, QC). After acclimation, mice were randomly Type 2 diabetes has reached unprecedented proportions divided into five groups (𝑛=12each)andstartedonregular across Aboriginal populations all over the world. In Canada, chow (CHOW control group) or high-fat diet (35% fat, the rates have risen exponentially above the national average 20% protein, and 36.5% carbohydrate, Bio-Serv, Frenchtown, over the past few decades and are expected to keep rising. For NJ, USA). After 8 weeks on these diets, the HFD-fed mice instance, the prevalence of diabetes among the Cree Nations were obese and insulin-resistant. They weighed an average of of Eeyou Istchee (CEI) inhabiting the Eastern James Bay 31.78 g ± 2.71 while their CHOW-fed counterparts weighed region of northern Quebec has tripled for adults aged over 24.8 ± 2.07 g. At this point, one group of HFD-fed mice 20 years in the same time period [8]. To address this serious served as DIO control (continued HFD intake for another health issue facing Canadian First Nations, specifically the 8 weeks), whereas the other three groups of HFD-fed mice CEI, our research team aimed to identify culturally relevant received V. vitis-idaea extract at 3 doses (125, 250, and treatments for diabetes within their traditional pharma- 500 mg/kg) incorporated in HFD for another period of 8 copeia. weeks. Lingonberry (V. vitis-idaea) belongs to the Ericaceae Body weight, food intake, water intake, and blood glucose plant family and is closely related to highbush blueberries level were measured from nonfasting animals 2 or 3 times per (Vaccinium corymbosum L.) and cranberries (V. macro- week throughout the study. Tail blood was collected for glu- carpum L.) [9].Theberriesareedibleandareusedinnorthern cose determination using a glucometer (Accu-Check Roche, Europe to make jams, sauces, and other foods [10]. They Montreal,QC).Attheendofthetreatmentstudy,animals are also used traditionally as food by Indigenous Peoples were sacrificed and various tissues were harvested, weighed, of Canada where they are eaten raw, stewed, and served and processed for subsequent analysis. All procedures and withfishormeatormixedwithboiledfisheggs,liver,and experimental protocols were authorized by the Universitede´ fat [11, 12]. The Cree use the berries as a folk medicine to Montreal´ Animal Experimentation Ethics Committee and treat frequent urination and other symptoms of diabetes respected guidelines of the Canadian Council for the Care [13, 14]. and Protection of Animals. Inapreviousstudy,wereportedthattheethanolic extract of the berries of V. vitis-idaea revealed interesting 2.3. Measurement of Plasma Samples. Plasma triglyceride, glucose uptake enhancing properties in cultured C2C12 total cholesterol, LDL, HDL, alanine aminotransferase (ALT), skeletal muscle cells through the activation of AMPK [15]. aspartate aminotransferase (AST), alkaline phosphatase, and In the present work, we assessed the effect of V. vitis-idaea creatinine were assessed using standard clinical biochemistry Evidence-Based Complementary and Alternative Medicine 3 protocolsatSainte-Justine’sChildren’sHospital(Montreal, 2.7. Statistical Analysis. The data were analyzed by SigmaStat Quebec). 3.1 software (Jandel Scientific, San Rafael, CA) using one-way Insulin was measured using a radioimmunoassay kit analysis of variance (ANOVA). Areas under the curve (AUC) (Linco; St-Charles, MO), while adiponectin and leptin were were calculated by using PRISM software (GraphPad, San measured using ELISA kits (Millipore, St-Charles, MO). Diego, CA, USA). Nonparametric data was analyzed by the chi-square test. Statistical significance was set at 𝑃 ≤ 0.05. ± 2.4. Histological Assessment. Liver samples obtained from Results are presented as the mean SEM for the indicated each mouse were fixed in 10% formalin solution, embedded number of determinations or animals. in paraffin, cut into sections, then mounted on glass slides, and stained with hematoxylin phloxine saffron (HPS). Liver 3. Results steatosis was assessed according to the percentage of hepatic cells that exhibited macrovesicular fat droplets as follows: 3.1. V. vitis-idaea Significantly Improves HFD Induced Hyper- grade 0, absent, less than 5% of hepatocytes; grade 1, light, glycemia in DIO Mice. As expected, control DIO animals 5–33% of hepatocytes; grade 2, moderate, 33–66% of hepato- were obese, hyperglycemic, hyperinsulinemic, and dyslipi- cytes; grade 3, severe, >66% of hepatocytes affected [18]. demic (Tables 1 and 2). The observed leptin: adiponectin ratios and hepatic steatosis were also consistent with the 2.5. Determination of Tissue Triglycerides (TG). Tissue establishment of an insulin-resistant state (Tables 2 and 3). (100 mg) was powdered under liquid nitrogen and total V.vitis-idaea treatment had no effect on total body weight lipids were extracted with 50 volumes of Folch reagent (2 : 1 or retroperitoneal and epididymal fat weight (Figure 1(a) chloroform-methanol) [19]. TG content was determined and Table 1). Similarly, caloric intake remained unchanged by using a commercial kit (Randox Laboratories Ltd., in the DIO control and treated groups as compared to UK). the CHOW group (data not shown). Nevertheless, V. v itis- idaea treatment, given over the last eight-week period of experimental protocols at doses of 125 and 250 mg/kg, sig- 2.6. Western Blot Analysis. Immunoblotting was performed nificantly decreased the area under the curve (AUC) of as previously described. Briefly, frozen muscle and liver blood glucose levels by 9 and 12%, respectively, as compared tissues were homogenized in RIPA lysis buffer (25 mM Tris- to DIO controls (Figure 1(b); 𝑃 < 0.05). On the other HClpH7.4,25mMNaCl,0.5mMEDTA,1%Triton-X- hand V. vitis-idaea at 500 mg/kg resulted in a weaker effect 100, and 0.1% SDS) containing a protease inhibitor cocktail (7% reduction in glycemia) that failed to reach statistical (Roche, Mannheim, Germany) as well as 1 mM phenyl- significance. The antihyperglycemic effect was even more methanesulfonyl fluoride and phosphatase inhibitors (1 mM evident at the end of the treatments for the three doses sodium orthovanadate, 10 mM sodium pyrophosphate, and where a significant drop was recorded (28%, 25%, and 10 mM sodium fluoride). The homogenate was centrifuged ∘ 17%decreaseforthe125,250,and500mg/kgdoses,resp.; at 12,000 g at 4 C for 30 min. Aliquots of the supernatant 𝑃 < 0.05). were diluted to a concentration of 1.25 mg/mL total protein On the other hand, insulinemia was not significantly in reducing sample buffer (50 mM Tris-HCl pH 6.8, 1% affected by the various treatments. A trend toward reduction SDS, 10% glycerol, 1% 𝛽-mercaptoethanol, and 0.01% bro- (30%) compared to DIO controls was observed only in the mophenol blue) and boiled for 5 min. Samples (20 𝜇L/well) 500 mg/kg V. vitis-idaea-treated group (Table 2). were subjected to SDS-polyacrylamide gel electrophoresis (PAGE) on 10% polyacrylamide gels and transferred to nitrocellulose membranes (Millipore, Bedford, MA). Mem- 3.2. V. vitis-idaea Treatment Attenuates Hepatic Steatosis and branes were blocked for 2 h at room temperature with Hyperlipidemia in DIO Mice. Hepaticsteatosiswasevaluated Tween-20 and 5% skimmed milk in TBS (20 mM Tris- by histological scoring of liver tissue sections as previously HCl, pH 7.6, and 137 mM NaCl). Membranes were then validated [18]. As expected, 82% of the animals in the DIO ∘ incubated overnight at 4 Cinblockingbufferwithappro- control group exhibited severe (grade 3) steatosis, while 18% priate phospho-specific or pan-specific antibodies against had mild to moderate (grade 1 or 2) steatosis, as compared AMPK, ACC, GLUT4, and acetyl-p53 (Lys 379) (each at with100%healthylivers(grade0)observedinnonobese 1 : 1000, Cell Signaling Technologies, Danvers, MA, USA) CHOW-fed congeners. V. vitis-idaea treatment decreased the and PPAR𝛼 (1 : 200). Membranes were washed 5 times and proportion of DIO animals exhibiting grade 3 steatosis to only incubated 1.5 h at room temperature in TBS plus Tween- 50–66%. Interestingly, animals with healthy livers (grade 0 20 with anti-rabbit HRP-conjugated secondary antibodies at steatosis), which were nonexistent in the control DIO group, 1 : 50000 to 1 : 100000 (Jackson Immunoresearch, Cedarlane were present in proportions ranging between 8 and 33% in Laboratories, Hornby, ON, Canada). Revelation was per- V. vitis-idaea-treated DIO animals. On the other hand, 20– formed using the enhanced chemiluminescence method and 32% of V. vitis-idaea group exhibited either grade 1 or grade 2 blue-light-sensitive film (Amersham Biosciences, Bucking- steatosis (Table 3; 𝑃 < 0.05), confirming overall improvement hamshire, England). Gel band intensities were evaluated by in this parameter. The group receiving the 250 mg/kg/d dose densitometric analysis using ImageJ densitometry software showed the best reduction in steatotic histological profile. (Version 1.6, National Institutes of Health, Bethesda, MD, Consistent with these results, V. vitis-idaea reduced liver USA). triglyceride levels. Both the 125 and the 250 mg/kg/d groups 4 Evidence-Based Complementary and Alternative Medicine

Table1:WeightofbodyandvariousorgansofDIOmicetreatedwithV. vitis-idaea.

V. v itis-idaea CHOW DIO control 125 mg/kg 250 mg/kg 500 mg/kg ∗ ∗ ∗ ∗ Body weight (g) 36.5 ± 1.0 47.6 ± 0.1 45.1 ± 1.3 43.9 ± 1.6 47.3 ± 1.0 ∗ ∗ † ∗ Liver weight (g) 1.6 ± 0.1 2.4 ± 0.1 2.2 ± 0.2 2.0 ± 0.2 2.4 ± 0.2 ∗ ∗ ∗ ∗ Retroperitoneal fat (g) 0.8 ± 0.0 1.7 ± 0.1 1.8 ± 0.1 1.4 ± 0.1 1.8 ± 0.1 ∗ Epididymal fat (g) 1.9 ± 0.1 1.5 ± 0.1 1.8 ± 0.1 1.5 ± 0.1 1.4 ± 0.1 ∗ ∗ ∗ ∗ Brown fat (g) 0.3 ± 0.0 0.5 ± 0.0 0.5 ± 0.1 0.5 ± 0.0 0.5 ± 0.0 ∗ † All values are mean ± SEM (𝑛=12). denotes significant difference as compared to control CHOW, and indicates significant difference from DIO control group (𝑃 ≤ 0.05) as assessed by ANOVA test.

Table 2: Blood parameters at the end of the treatment.

V.v itis-idaea CHOW Control DIO 125 mg/kg 250 mg/kg 500 mg/kg Triglycerides (mmol/L) 0.83 ± 0.08 0.74 ± 0.03 0.65 ± 0.04 0.67 ± 0.06 0.72 ± 0.04 ∗ ∗ ∗† ∗ Total cholesterol (mmol/L) 1.76 ± 0.15 3.34 ± 0.13 3.09 ± 0.19 2.96 ± 0.16 3.46 ± 0.15 ∗ ∗ ∗ ∗ HDL (mmol/L) 0.69 ± 0.1 1.28 ± 0.04 1.30 ± 0.07 1.23 ± 0.07 1.34 ± 0.03 ∗ ∗ ∗† ∗ LDL (mmol/L) 0.69 ± 0.04 1.7 ± 0.1 1.72 ± 0.09 1.49 ± 0.11 1.77 ± 0.11 Insulin (ng/mL) 4.48 ± 0.81 41.96 ± 18.88 43.71 ± 22.79 40.45 ± 15.45 29.11 ± 8.78 ∗ ∗ ∗ ∗ Leptin (ng/mL) 25.97 ± 1.52 34.09 ± 1.60 34.20 ± 1.86 35.65 ± 2.22 36.94 ± 0.92 ∗ ∗ ∗ ∗ Adiponectin (𝜇g/mL) 17.29 ± 0.54 13.44 ± 0.96 14.57 ± 0.82 15.35 ± 1.60 13.87 ± 1.13 ∗ ∗ ∗ ∗ Leptin/adiponectin 1.50 ± 0.07 2.64 ± 0.20 2.37 ± 0.12 2.50 ± 0.25 2.90 ± 0.32 ∗ ∗ ∗ ∗ ALT (U/L ) 26.18 ± 2.71 37.09 ± 3.47 34.66 ± 4.47 32.18 ± 4.90 45.66 ± 6.50 ∗ ∗ ∗ AST (U/L) 123.64 ± 23.50 109.45 ± 8.70 98.50 ± 12.58 102.54 ± 8.22 116.16 ± 11.17 † † Creatinine (U/L) 51.40 ± 4.40 53.09 ± 5.11 59.83 ± 11.38 55.81 ± 6.59 64.50 ± 11.35 ∗ † † † Alc. phosphatase (U/L) 35.45 ± 2.58 64.90 ± 20.00 39.66 ± 3.06 39.63 ± 3.63 47.83 ± 3.82 ∗ † All values are mean ± SEM (𝑛=12). indicates a 𝑃 value < 0.05 which is significantly different from CHOW group, and indicates a 𝑃 value < 0.05 which is significantly different from DIO control group (𝑃 ≤ 0.05) as assessed by ANOVA test.

50 15

40 12

∗ ∗ 30 9

20 6 in body weight/day

10 3 AUC from individual cumulative change change cumulative individual from AUC AUC from individual change of glycemia/day of change individual from AUC 0 0 CHOW DIO V. v itis- V. v itis- V. v itis- CHOW DIO V. v itis- V. v itis- V. v itis- idaea 125 idaea 250 idaea 500 idaea 125 idaea 250 idaea 500 (mg/kg) (mg/kg) (a) (b)

Figure 1: V. v itis-idaea treatment for 8 weeks reduces glycemia with little effect on body weight of DIO mice. (a) Cumulative change in body weight. (b) Nonfasting blood glucose concentration. These parameters were recorded three times per week. ∗ denotes significant difference as compared to control DIO (𝑃 < 0.05) as assessed by ANOVA test; 𝑛=12for each group. Evidence-Based Complementary and Alternative Medicine 5

liver index) liver 15 ∗ ∗

5 T.G (mg/gT.G liver

0 CHOW DIO V. vitis- V. vitis- V. vitis- idaea 125 idaea 250 idaea 500 (mg/kg)

Figure 2: V. v itis-idaea treatment decreases triglyceride content TG in the liver of DIO mice. The colorimetric dosage of TG levels (𝑛=12) was determined using a commercial kit. Data are presented as the mean ± SEM and representative of 12 mice per experimental group. ∗ indicates a 𝑃 value < 0.05 significantly different from CHOW group.

Table 3: Histological scores of liver steatosis from DIO mice treated 3.4. V. vitis-idaea Activates Insulin and AMPK Signaling Path- with V. v itis-idaea. ways in the Liver of DIO Mice. A dose dependent activation of Grades of steatosis both insulin and AMPK pathways was recorded as increases Groups 𝑛 in the phosphorylation of Akt and AMPK, respectively, in 0123 liverofDIOmicefedwithV. vitis-idaea extract, but only the CHOW 11 11000high dose group reached statistical significance (Figures 5(a), Control DIO 11 01195(b),and5(c); 𝑃 < 0.05). This was not associated with an V. v itis-idaea 125 mg/kg 12 2226increase in hepatic content of PPAR-𝛼,akeytranscription V. v itis-idaea 250 mg/kg 12 4017factor controlling hepatic fatty acid oxidation (N.S., Figures V. v itis-idaea 500 mg/kg 12 12185(a) and 5(d)), nor with any changes in acetylated p53 (not illustrated). The scoring is based on the percentage of hepatocytes containing macrovesicular steatosis, grade0: 0–5%, grade 1: 5–33%, grade 2: 33–66%, and grade 3: more than 66% (21) (chi-square; 𝑃 < 0.05). 4. Discussion Due to the adoption of more sedentary lifestyles and a demonstrated a statistically significant reduction (39%) (Fig- 𝑃 < 0.05 gradual transition from traditional to western-type diets by ure 2; ). Moreover, the same 250 mg/kg/d dose Aboriginal populations in Canada, there has been an upsurge was able to significantly reduce total plasma cholesterol intheprevalenceofobesityanddiabetes,twoofthemost and plasma LDL by 12% and 18%, respectively (Table 2; 𝑃 < 0.05 serious threats to global public health [8, 20, 21]. Health ). problems of Aboriginal populations are confounded by the cultural disconnection of modern drug-based therapies, lead- 3.3. V. vitis-idaea Improves Insulin Signaling, Tends to Activate ing to difficulties with compliance and enhanced diabetes AMPK and SIRT1, and Increases Total Protein Content of complications [16]. In an effort to develop culturally adapted GLUT4 in Skeletal Muscle of DIO Mice. When compared to treatment options for Cree diabetics, our research team has DIO control group, western blots for muscle of DIO mice been examining several plants of the Canadian boreal forest fed with V. vitis-idaea revealed that the low, medium, and stemming from Cree traditional medicine. high doses showed a strong tendency to increase AMPK Lingonberry (V. vitis-idaea) was identified through an phosphorylation (Figures 3(a) and 3(b); 𝑃 = 0.057). On ethnobotanical study conducted in collaboration with the the other hand, the high dose of the plant extract showed Cree communities of Eeyou Istchee (northern Quebec, a tendency to decrease the content of acetylated p53 (Lys Canada) [14] and exhibited a potent and promising antidi- 379) (Figures 3(a) and 3(c); 𝑃 = 0.11)andsignificantly abetic activity in cell-based in vitro bioassays [15, 17]. The increased the phosphorylation of Akt (Serine 473) (Figures current studies sought to evaluate this antidiabetic potential 3(a) and 3(d); 𝑃 < 0.05). Moreover, GLUT4 protein levels in vivo. For this purpose, models of diet-induced obesity were significantly increased by 1.4- to 2-fold in DIO mice fed arewidelyusedasnongeneticmodelsfortype2diabetes with the medium and high dose of V. vitis-idaea (Figures 4(a) research to mimic the more common form of human obesity- and 4(b); 𝑃 < 0.05). induced diabetes (coined by some as diabesity). For instance, 6 Evidence-Based Complementary and Alternative Medicine

V. v itis-idaea V. vitis-idaea V. vitis-idaea 0,26 125 mg/kg 250 mg/kg 500 mg/kg CHOW DIO 0,24 Phospho-AMPK 0,22 0,20 0,18 Acetyl p-53 0,16 0 14 -actin ,

Phospho-Akt 𝛽 0,12 0,10 𝛽-Actin p-Akt/ 0,08 0,06 0,04 0,02 0,00 CHOW DIO V. v itis- V. v itis- V. v itis- idaea 125 idaea 250 idaea 500 (mg/kg) (a) (b) 2,2 0,8 †∗ 2,0 0,7 1,8 0,6 1,6 0,5

-actin 1,4 𝛽 / -actin

1,2 𝛽 0 4 53 , 1,0 0,3 0,8 p-Akt/ p-Acetyl p p-Acetyl 0,2 0,6 0,4 0,1

0,2 0,0 0,0 CHOW DIO V. v itis- V. v itis- V. v itis- CHOW DIO V. v itis- V. v itis- V. v itis- idaea 125 idaea 250 idaea 500 idaea 125 idaea 250 idaea 500 (mg/kg) (mg/kg) (c) (d)

Figure 3: V. v itis-idaea activates Akt and AMPK pathways and tends to decrease acetyl p53 content in soleus muscle of DIO mice. Samples of soleus muscles were obtained from CHOW, DIO control, and DIO mice fed with V. v itis-idaea (125, 250, and 500 mg/Kg) and analyzed by immunoblotting. (a) Representative blots for each group are shown for samples probed with p-Akt, p-AMPK, acetyl p53, and 𝛽-actin as loading control. Data are expressed as mean ± SEMfrom12animalsineachexperimentalgroupfor(b)p-Akt(Ser473)/𝛽-actin, (c) p-AMPK𝛼 (Thr 172)/𝛽-actin, and (d) Acetyl p53 (Lys 379)/𝛽-actin. ∗ indicates a 𝑃 value ≤ 0.05 significantly different from CHOW group, and † indicates a 𝑃 value ≤ 0.05 significantly different from DIO control group.

male DIO C57BL/6J mice fed a high-fat diet share many possesses an antihyperglycemic effect despite the continued obesity phenotypes with humans, such as abdominal adi- intake of HFD. Indeed, the attenuation of hyperglycemia posity, hyperinsulinemia, insulin resistance, and fatty liver and dyslipidemia provides evidence of improved insulin [22]. Therefore, this mouse model was chosen to further resistance in V. vitis-idaea-treated DIO groups. These effects investigate the antidiabetic and antiobesity effect of V. v itis- were more pronounced as the dose of the plant extract rose idaea berries. from125to250mg/kgandyetdeclinedthereafter.Sucha Mice fed the HFD regimen for a period of 8 weeks “bell-shaped” dose-response relationship is not unusual for establish an obesity-induced prediabetic state, as confirmed pharmacological agents, particularly medicinal plants [23]. herein. It is at that time-point that low, medium, or high doses V. vitis-idaea treatment did not affect caloric intake and of V.vitis-idaea (125, 250, 500 mg/kg) were added to HFD and showed only a mild tendency to reduce body weight at administered over the subsequent 8-week treatment period. the highest extract dose. It is noteworthy that V. vitis-idaea TheresultsofthisstudyclearlyshowthatV. vitis-idaea was able to significantly reduce glycemia despite unchanged Evidence-Based Complementary and Alternative Medicine 7

V. vitis-idaea V. vitis-idaea V. vitis-idaea CHOWDIO 125 mg/kg 250 mg/kg 500 mg/kg

GLUT4

𝛽-Actin

(a)

2,4 † 2,2 2,0 1 8 , † 1,6 1 4

-actin , 𝛽 /

4 1,2 1,0 GLUT 0,8 0,6 0,4 0,2 0,0 CHOW DIO V. vitis- V. vitis- V. vitis- idaea 125 idaea 250 idaea 500 (mg/kg) (b)

Figure 4: V. v itis-idaea increases GLUT4 protein content in soleus muscle of DIO mice. Samples of soleus muscles were obtained from CHOW, DIO control, and DIO mice fed with V. v itis-idaea (125, 250, and 500 mg/Kg) and analysed by immunoblotting with antibodies specific to GLUT4. (a) Representative blots for each group are shown. (b) Data are expressed as GLUT4/𝛽-actinand are presented as mean ± SEM from 12 animals per experimental group. † indicates a 𝑃 value < 0.05 which is significantly different from DIO control group.

cumulative food intake and body weight. Importantly, V. with increased muscle expression of the effector protein vitis-idaea-treated animals, even at the highest dose of GLUT4, thereby providing a feasible explanation for the 500 mg/kg/d, showed no signs of toxicity, as evidenced by antihyperglycemic effects of V. vitis-idaea. Indeed, GLUT4- a lack of behavioral changes. In addition, parameters of dependent muscle glucose uptake contributes significantly to hematological, liver, and kidney function were similar to DIO peripheral glucose disposition and hence to reduced glycemia controls. The safety of this plant is further supported by the [24]. GRAS (generally regarded as safe) status of the edible berries, We also evaluated SIRT1-mediated deacetylation of p53, being widely consumed by the CEI and other populations. sincethelatterhasbeenusedasanindicatorforSIRT1activity Hence, it is highly unlikely that observed improvements in [25]. Consistent with the previously reported decrease in systemic glucose homeostasis are related to nonspecific toxic SIRT1 activity induced by high caloric diets [6], levels of mus- actions of the plant extracts. cle acetyl p53 tended to increase in control DIO mice, whereas To further understand the underlying mechanisms of the V. vitis-idaea treatment had the opposite effect. Enhanced metabolic effect of V. vitis-idaea and to begin identifying SIRT1 activity may thus participate in the beneficial action molecular targets, we monitored the change in the expression of the plant extract on muscle energy metabolism, although and/or activity of key proteins involved in glucose and lipid further studies are needed to confirm the tendencies observed metabolism in skeletal muscle and liver, the principal organs herein. responsible for regulation of glucose and lipid homeostasis. We next assessed components involved in liver inter- Our results demonstrate that V. vitis-idaea enhances both mediate metabolism. Indeed, in obese individuals, unin- insulin-dependent and -independent pathways in HFD-fed hibited lipolysis in insulin-resistant adipose tissue leads to DIO mice. increased free fatty acid delivery to the liver [22]. The In skeletal muscle, phosphorylation of both Akt and, to resulting abnormal fat accumulation in the liver (hep- a lesser extent, AMPK was observed, indicating an elevation atic steatosis) induces hepatic insulin resistance, impairing intheactivityofbothkinases.Theenhancementofboth insulin-mediated inhibition of hepatic glucose output and insulin-dependent and -independent kinases was associated increasing the risk for type 2 diabetes [26]. In the present 8 Evidence-Based Complementary and Alternative Medicine

V. vitis-idaea V. vitis-idaea V. vitis-idaea CHOWDIO 125 mg/kg 250 mg/kg 500 mg/kg

Phospho-Akt

Phospho-AMPK

PPAR-𝛼

𝛽-Actin

(a)

5,0 † † 3,5 4,5 4,0 3,0 3 5 , 2,5 3 0 -actin ,

-actin 2 0 /𝛽 , 2,5 𝛽 1 5 p-Akt 2,0 , 1,5 p-AMPK/ 1,0 1,0 0,5 0,5 0,0 0,0 CHOW DIO V. v itis- V. v itis- V. v itis- CHOW DIO V. v itis- V. v itis- V. v itis- idaea 125 idaea 250 idaea 500 idaea 125 idaea 250 idaea 500 (mg/kg) (mg/kg) (b) (c)

4 -actin 𝛽 /

𝛼 3

PPAR- 2

0 CHOW DIO V. v itis- V. v itis- V. v itis- idaea 125 idaea 250 idaea 500 (mg/kg) (d)

Figure 5: V. v itis-idaea treatment activates Akt and AMPK pathway but does not increase PPAR-훼 content in the liver of DIO mice. Samples of liver tissue from CHOW, control DIO, and DIO mice fed with V. vitis-idaea (125,250,and500mg/Kg)werehomogenizedandanalysed by immunoblotting. (a) Representative immunoblots of samples probed with p-AMPK, p-Akt, PPAR훼,and훽-actin as loading control are shown. Data are expressed as mean ± SEM from 12 animals per experimental group for (b) p-AMPK/훽-actin, (c) p-Akt/훽-actin, and (d) PPAR훼/훽-actin andlevels were quantified using densitometry. † indicates a 푃 value < 0.05 significantly different from DIO control group.

study, the most effective antihyperglycemic dose of V. v itis- It is thus likely that V. vitis-idaea treatment improved idaea significantly lowered liver triglyceride content and the liver insulin sensitivity. This was corroborated by the histological grade of hepatic steatosis, which is also consistent enhanced liver activation of insulin-dependent Akt recorded with reduced serum levels of LDL and total cholesterol. herein. Evidence-Based Complementary and Alternative Medicine 9

V. vitis-idaea also enhanced liver AMPK activation. [4] G. Zhou, I. K. Sebhat, and B. B. Zhang, “AMPK activators— However, neither the expression of the PPAR-훼 protein potential therapeutics for metabolic and other diseases,” Acta nor the acetylation of p53 (both involved in the control of Physiologica,vol.196,no.1,pp.175–190,2009. hepatic lipid oxidation) was affected by the plant extract. [5]B.Viollet,F.Andreelli,S.B.Jorgensenetal.,“Physiological Hence, V. vitis-idaea treatment may improve hepatic lipid role of AMP-activated protein kinase (AMPK): insights from homeostasis through the activation of AMPK and insulin knockout mouse models,” Biochemical Society Transactions,vol. signaling pathways but does not appear to involve PPAR-훼 31,no.1,pp.216–219,2003. or SIRT-1 related components. [6] G.Boily,E.L.Seifert,L.Bevilacquaetal.,“SirT1regulatesenergy In summary, dietary intake of V. vitis-idaea berry extract metabolism and response to caloric restriction in mice,” PLoS helps normalize blood glucose in HFD-fed DIO mice ONE,vol.3,no.3,ArticleIDe1759,2008. without significantly affecting food intake or body weight. [7] Y. Yamazaki, I. Usui, Y. Kanatani et al., “Treatment with Its mechanism of action involves enhanced expression of SRT1720, a SIRT1 activator, ameliorates fatty liver with reduced GLUT4 in skeletal muscle and diminished hepatic steatosis, expression of lipogenic enzymes in MSG mice,” American both through insulin-dependent and -independent pathways. Journal of Physiology: Endocrinology and Metabolism,vol.297, no.5,pp.E1179–E1186,2009. Together with our previous in vitro study, these collective findings confirm the significant antidiabetic potential of [8] R. A. Hegele, “Genes, environment and diabetes in Canadian aboriginal communities,” Advances in Experimental Medicine V. vitis-idaea berries. Our work thus supports the use of and Biology,vol.498,pp.11–20,2001. this medicinal plant in the context of culturally sensitive dietary and therapeutic interventions for type 2 diabetes in [9] I. Hjalmasson and R. Ortiz, “Lingonberry: botany and horticul- ture,” in Horticultural Reviews,J.J.Janick,Ed.,pp.9–124,John Aboriginal populations of Quebec. Wiley & Sons, New York, NY, USA, 2001. [10] S. Y. Wang, R. Feng, L. Bowman, R. Penhallegon, M. Ding, Conflict of Interests and Y. Lu, “Antioxidant activity in lingonberries (Vaccinium vitis-idea L.) and its inhibitory effect on activator protein-1, The authors declare no conflict of interests regarding the nuclear factor-kappaB, and mitogen-activated protein kinases publication of this paper. activation,” Journal of Agricultural and Food Chemistry,vol.53, no. 8, pp. 3156–3166, 2005. [11] C. A. Heller, Edible and Poisonous Plants of Alaska, University Acknowledgments of Alaska, 1953. [12] A. L. Leighton, Wild Plant Use by the Woods Cree (Nihithawak) This work was supported by a Team Grant from the Canadian of East-Central Saskatchewan, National Museums of Canada, Institutes of Health Research (CIHR Team in Aboriginal Ottawa, 1985. Antidiabetic Medicines) to Pierre S. Haddad, John T. Arna- [13]M.H.Fraser,A.Cuerrier,P.S.Haddad,J.T.Arnason,P.L. son, and Lina Musallam. It was conducted with the consent Owen, and T. Johns, “Medicinal plants of Cree communities andsupportoftheCreeNationsofEeyouIstcheeandof (Quebec, Canada): antioxidant activity of plants used to treat the Cree Board of Health and Social Services of James Bay type 2 diabetes symptoms,” Canadian Journal of Physiology and (Quebec, Canada). Very special thanks are due to E. Coon Pharmacology,vol.85,no.11,pp.1200–1214,2007. Come, M. Gunner, C. Husky Swallow, J. Husky Swallow, R. [14] C. Leduc, J. Coonishish, P. Haddad, and A. Cuerrier, “Plants Loon, and G. Loon from the Cree Nation of Mistissini as usedbytheCreeNationofEeyouIstchee(Quebec,Canada) well as 27 other elders and healers, who kindly agreed to for the treatment of diabetes: a novel approach in quantitative be interviewed. They made this paper possible by allowing ethnobotany,” JournalofEthnopharmacology,vol.105,no.1-2, the authors to use, for the purposes of this research, their pp.55–63,2006. knowledge relating to medicinal plants, transmitted to them [15] D. Harbilas, L. C. Martineau, C. S. Harris et al., “Evaluation of by their elders. Their trust has also enabled a useful exchange the antidiabetic potential of selected medicinal plant extracts between indigenous knowledge and Western science. from the Canadian boreal forest used to treat symptoms of diabetes: part II,” Canadian Journal of Physiology and Pharma- cology,vol.87,no.6,pp.479–492,2009. References [16] J. W. Bullen Jr., M. Ziotopoulou, L. Ungsunan et al., “Short- term resistance to diet-induced obesity in A/J mice is not [1] A. Marette, E. Burdett, A. Douen, M. Vranic, and A. Klip, associated with regulation of hypothalamic neuropeptides,” “Insulin induces the translocation of GLUT4 from a unique American Journal of Physiology: Endocrinology and Metabolism, intracellular organelle to transverse tubules in rat skeletal vol. 287, no. 4, pp. E662–E670, 2004. muscle,” Diabetes,vol.41,no.12,pp.1562–1569,1992. [17] H. M. Eid, L. C. Martineau, A. Saleem et al., “Stimulation [2]A.Pelletier,E.Joly,M.Prentki,andL.Coderre,“Adenosine 耠 of AMP-activated protein kinase and enhancement of basal 5 -monophosphate-activated protein kinase and p38 mitogen- glucose uptake in muscle cells by quercetin and quercetin activated protein kinase participate in the stimulation of glucose glycosides, active principles of the antidiabetic medicinal plant uptake by dinitrophenol in adult cardiomyocytes,” Endocrinol- Vaccinium vitis-idaea,” Molecular Nutrition and Food Research, ogy,vol.146,no.5,pp.2285–2294,2005. vol.54,no.7,pp.991–1003,2010. [3] S. Fogarty and D. G. Hardie, “Development of protein kinase [18] E. M. Brunt, C. G. Janney, A. M. di Bisceglie, B. A. activators: AMPK as a target in metabolic disorders and cancer,” Neuschwander-Tetri, and B. R. Bacon, “Nonalcoholic steato- Biochimica et Biophysica Acta,vol.1804,no.3,pp.581–591,2010. hepatitis: a proposal for grading and staging the histological 10 Evidence-Based Complementary and Alternative Medicine

lesions,” The American Journal of Gastroenterology,vol.94,no. 9, pp. 2467–2474, 1999. [19] J. Folch, M. Lees, and G. H. Sloane Stanley, “A simple method for the isolation and purification of total lipides from animal tissues,” The Journal of Biological Chemistry,vol.226,no.1,pp. 497–509, 1957. [20] T. K. Young, J. Reading, B. Elias, and J. D. O'Neil, “Type 2 diabetes mellitus in Canada's First Nations: status of an epidemic in progress,” Canadian Medical Association Journal, vol. 163, no. 5, pp. 561–566, 2000. [21] P.T. Katzmarzyk, “Obesity and physical activity among Aborig- inal Canadians,” Obesity,vol.16,no.1,pp.184–190,2008. [22] S. K. Ha and C. Chae, “Inducible nitric oxide distribution in the fatty liver of a mouse with high fat diet-induced obesity,” Experimental Animals,vol.59,no.5,pp.595–604,2010. [23]W.Ni,X.Zhang,B.Wangetal.,“Antitumoractivitiesand immunomodulatory effects of ginseng neutral polysaccharides in combination with 5-fluorouracil,” Journal of Medicinal Food, vol. 13, no. 2, pp. 270–277, 2010. [24] H. M. Eid, M. Ouchfoun, A. Brault et al., “W9, a medicinal plant from the pharmacopeia of the Eastern James Bay Cree, exihibits anti-diabetic activities in two mouse model of diabetes,” Planta Medica, vol. 77, article 1308, 2011. [25]H.Kang,J.W.Jung,M.K.Kim,andJ.H.Chung,“CK2is the regulator of SIRT1 substrate-binding affinity, deacetylase activity and cellular response to DNA-damage,” PLoS ONE,vol. 4, no. 8, Article ID e6611, 2009. [26] K. Qureshi and G. A. Abrams, “Metabolic liver disease of obesity and role of adipose tissue in the pathogenesis of nonalcoholic fatty liver disease,” World Journal of Gastroenterology,vol.13,no. 26, pp. 3540–3553, 2007. Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2014, Article ID 415097, 9 pages http://dx.doi.org/10.1155/2014/415097

Research Article Ethanol Extract of Alismatis rhizome Inhibits Adipocyte Differentiation of OP9 Cells

Yeon-Ju Park,1 Mi-Seong Kim,1 Ha-Rim Kim,1,2 Jeong-Mi Kim,1 Jin-Ki Hwang,1 Sei-Hoon Yang,3 Hye-Jung Kim,4 Dong-Sung Lee,5 Hyuncheol Oh,5,6,7 Youn-Chul Kim,5,6,7 Do-Gon Ryu,8 Young-Rae Lee,1,2,9 and Kang-Beom Kwon1,2,8

1 Center for Metabolic Function Regulation, Wonkwang University School of Medicine, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea 2 BK21 Plus program & Department of Smart Life-Care Convergence, Wonkwang University, Graduate School, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea 3 Department of Internal Medicine, Wonkwang University School of Medicine, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea 4 Department of Family Medicine, The Catholic University of Korea, Incheon St. Mary’s Hospital, 56 Dongsu-ro, Bupyeong-gu, Incheon 403−720, Republic of Korea 5 Hanbang Body-Fluid Research Center, Wonkwang University, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea 6 Standardized Material Bank for New Botanical Drugs, College of Pharmacy, Wonkwang University, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea 7 Institute of Pharmaceutical Research and Development, College of Pharmacy, Wonkwang University, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea 8 Department of Korean Physiology, Wonkwang University School of Korean Medicine, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea 9 Department of Oral Biochemistry, and Institute of Biomaterials-Implant, Wonkwang University School of Dentistry, 460 Iksan-daero, Iksan City, Jeonbuk 570−749, Republic of Korea

Correspondence should be addressed to Young-Rae Lee; [email protected] and Kang-Beom Kwon; [email protected]

Received 6 February 2014; Revised 7 May 2014; Accepted 8 May 2014; Published 9 June 2014

Academic Editor: Ravirajsinh Jadeja

Copyright © 2014 Yeon-Ju Park et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The rhizome of Alisma orientale (Alismatis rhizome) has been used in Asia for promoting diuresis to eliminate dampness from the lower-jiao andtoexpelheat.Inthisstudy,anethanolextractoftherhizomeofAlisma orientale (AOE) was prepared and its effects on adipocyte differentiation of OP9 cells were investigated. Treatment with AOE in a differentiation medium for 5 days resulted indose- dependent inhibition of lipid droplet formation in OP9 cells. Furthermore, AOE significantly inhibited adipocyte differentiation by downregulating the expression of the master transcription factor of adipogenesis, peroxisome proliferation-activity receptor 𝛾 (PPAR𝛾), and related genes, including CCAAT/enhancer binding protein 𝛽 (C/EBP𝛽), fatty acid-binding protein (aP2), and fatty acid synthase (FAS). AOE exerted its inhibitory effects primarily during the early adipogenesis stage (days 1-2), at which time it also exerted dose-dependent inhibition of the expression of C/EBP𝛽, a protein related to the inhibition of mitotic clonal expansion. Additionally, AOE decreased the expression of autophagy-related proteins, including beclin 1, and the autophagy-related genes, (Atg) 7 and Atg12. Our results indicate that AOE’s inhibitory effects on adipocyte differentiation of OP9 cells are mediated by reduced C/EBP𝛽 expression, causing inhibition of mitotic clonal expansion and autophagy.

1. Introduction has been commonly used for the treatment of dampness- retention syndromes, such as edema, dysuria, and diarrhea Alismatis rhizome (AR) is the rhizome of Alisma orientale in Asia. Furthermore, a number of experimental studies have (Sam.) Juzepzuk and belongs to the Alismataceae family. AR reported its therapeutic potential as an anti-inflammatory 2 Evidence-Based Complementary and Alternative Medicine

[1, 2], antiallergic [3, 4], antibacterial [5], and antioxidant [6] pulverized rhizomes of Alisma orientale (50 g) were extracted agent. However, the effects of AR on adipocyte differentiation twice with hot 70% ethanol (1 L) for 2 h at room temperature have not yet been investigated. and filtered with filter paper. The filtrate was evaporated in Obesity is a serious health problem and is related to the vacuo to produce a 70% ethanol extract (12.15 g, 24.3 w/w%). development of diseases such as type 2 diabetes, dyslipi- The 70% ethanol extract was suspended in distilled water demias, atherosclerosis, and even some cancers [7–10]. At (100 mL), followed by filtration. The residue derived from the the cellular level, obesity is characterized by increases in the filtration was dissolved in hot ethanol and filtered again. The number and volume of adipocytes, the primary storage site filtrate was then evaporated in vacuo to obtain a standard- for energy in animals and humans. Adipogenesis is the pro- ized fraction of Alisma orientale extract (AOE; NNMBS073, cess by which undifferentiated preadipocytes are converted to 600 mg, 1.2 w/w%). A 50 mg of AOE powder was dissolved fully differentiated adipocytes [11]. At the onset of adipocyte in 1 mL of DMSO for treatment with OP9 cells. NNMBS073 differentiation, the expression of CCAAT/enhancer binding was deposited at the Standardized Material Bank for New protein 𝛽 (C/EBP𝛽)andC/EBP𝛿 is induced and these Botanical Drugs, Wonkwang University. transcription factors are thought to mediate the expression 𝛾 𝛾 of peroxisome proliferator-activated receptor (PPAR )and 2.3. Cell Culture and Induction of Adipocyte Differentia- 𝛼 𝛼 𝛾 C/EBP [12–14]. The activation of C/EBP and PPAR leads tion. OP9 cells were cultured in MEM𝛼, containing 20% to terminal differentiation through their subsequent trans- FBS, 2 mM l-glutamine, 100 U/mL penicillin, and 100 𝜇g/mL ∘ activation of adipocyte-marker genes, such as adiponectin, streptomycin, at 37 Cina5%CO2 incubator. To induce lipoprotein lipase (LPL), fatty acid-binding protein 2 (aP2), differentiation, 1-day postconfluent preadipocytes were incu- and fatty acid synthase (FAS), all of which are involved in lipid bated in a differentiation medium, containing 10% FBS, metabolism [15]. 0.5 mM IBMX, 0.25 𝜇MDEXA,175nMinsulin,2mMl- Autophagy is a major, evolutionarily conserved, cytoplas- glutamine, 100 U/mL penicillin, and 100 𝜇g/mL streptomycin mic degradation pathway that has also been implicated in for2days.ThemediumwasthenchangedtoMEM𝛼, adiposetissuedevelopment[16–18]. The genes encoding the containing 10% FBS, 2 mM l-glutamine, and 175 nM insulin, basic components of the autophagy machinery are named Atg and the cells were cultured for a further 3 days. (autophagy-related) genes, and autophagy-deficient MEFs 5−/− 7−/− (atg , atg ) exhibit markedly reduced efficiency during 2.4. Determination of Cell Viability. Effects of AOE on OP9 adipogenesis [16, 18]. cell viability were determined using an established MTT Thus, in the present study, we set out to examine the anti- assay. Briefly, cells were seeded in a 96-well dish and incu- ∘ adipogenic actions of an extract of Alisma orientale (AOE) bated at 37 Cfor24htoallowattachment.Theattachedcells rhizomesandtostudythemechanismsinvolved. were kept untreated or treated with 10, 20, and 40 𝜇g/mL ∘ AOE for various time periods at 37 C. The cells were then washed with phosphate-buffered saline (PBS) prior to adding 2. Materials and Methods ∘ MTT (0.5 mg/mL PBS) and incubating at 37 Cfor30min. 2.1. Reagents. OP9 cells were purchased from the American Formazan crystals were dissolved with dimethyl sulfoxide Type Culture Collection (Manassas, VA, USA). Minimum (100 𝜇L/well) and detected at OD570 using an Emax Endpoint essential medium alpha (MEM𝛼), fetal bovine serum (FBS), ELISA microplate reader (Molecular Devices, Sunnyvale, Alexa Fluor 568 goat anti-rabbit IgG, and BODIPY 493/503 CA, USA). dye were purchased from Invitrogen (Carlsbad, CA, USA). Insulin, 3-isobutyl-1-methylxanthine (IBMX), dexametha- 2.5. Oil Red O Staining. After the induction of adipocyte sone (DEXA), and Oil Red O dye were purchased from differentiation, cells were washed with cold PBS, fixed at room Sigma Chemical Co. (St Louis, MO, USA). Antibodies against temperature with 4% formalin for 1 h, and then rinsed with 𝛾 𝛼 𝛽 PPAR ,C/EBP ,C/EBP , cyclin A, cyclin D1, cyclin D2, 60% isopropanol. OP9 cells were stained at room temperature 𝛽 𝛽 beclin 1, ATG7, ATG13, LC3, insulin R ,and -actin were withOilRedOfor1handwashed4timeswithdistilledwater. purchased from Santa Cruz Biotechnology (Santa Cruz, Intracellular Oil Red O dye was quantified by elution into CA, USA). Antibodies against extracellular signal-regulated isopropanol and measuring the OD500. kinases 1 and 2 (ERK1/2), phospho-ERK1/2, protein kinase B (Akt), and phospho-Akt were obtained from Cell Signaling 2.6. Automated Image Acquisition and Processing. After dif- Technology (Beverly, MA, USA). All of the chemicals used ferentiation, adipocytes were washed with cold PBS, fixed were of analytical grade. at room temperature with 4% paraformaldehyde for 30 min, andthenwashedagain3timeswithcoldPBS.Blocking 2.2. Preparation of Extracts. Rhizomes of Alisma orientale buffer was then added and incubated for 45 min at room (Alismataceae) were purchased in February 2010 from the temperature to prevent nonspecific antibody binding. PPAR𝛾 University Oriental Herbal Drugstore, Iksan, Korea, and were or C/EBP𝛽 antibodies were added and incubated overnight. identified by Professor Youn-Chul Kim, College of Phar- Cellswerethenwashed3timesandincubatedfor1h macy, Wonkwang University (Korea). A voucher specimen with BODIPY 493/503 dye for lipid droplet staining, DAPI (Number WP10-02-4) was deposited at the Herbarium of for nuclear staining, and Alexa Fluor 568 goat anti-rabbit the College of Pharmacy, Wonkwang University. Dried and or anti-mouse IgG for PPAR𝛾 and C/EBP𝛽,respectively. Evidence-Based Complementary and Alternative Medicine 3

Table 1: Primers and probes for real-time quantitative PCR.

Genes Primer sequence Accession no. 󸀠 󸀠 5 -GAAAGACAACGGACAAATCACC-3 PPAR𝛾 󸀠 󸀠 NM 011146 5 -GGGGGTGATATGTTTGAACTTG-3 󸀠 󸀠 5 -TTGTTTGGCTTTATCTCGGC-3 C/EBP𝛼 󸀠 󸀠 NM 007678 5 -CCAAGAAGTCGGTGGACAAG-3 󸀠 󸀠 5 -AGCCTTTCTCACCTGGAAGA-3 FABP4 󸀠 󸀠 NM 024406 5 -TTGTGGCAAAGCCCACTC-3 󸀠 󸀠 5 -TGATGTGGAACACAGCAAGG-3 FAS 󸀠 󸀠 NM 007988 5 -GGCTGTGGTGACTCTTAGTGATAA-3 󸀠 󸀠 5 -GGAGCACTACAAACGCAACGA-3 HSL 󸀠 󸀠 NM 010719 5 -TCGGCCACCGGTAAAGAG-3 󸀠 󸀠 5 -GGACGGTAACGGGAATGTATGA-3 LPL 󸀠 󸀠 NM 008509 5 -TGACATTGGAGTCAGGTTCTCTCT-3 󸀠 󸀠 5 -CGTCCCGTAGACAAAATGGT-3 GAPDH 󸀠 󸀠 NM 008084 5 -TTGATGGCAACAATCTCCAC-3

∘ Images were acquired on an ArrayScanTM VTi automated overnight at 4 Cwith1𝜇g/mL of a 1 : 2,000 dilution of microscopy and image analysis system (Cellomics Inc., Pitts- primary antibody. HRP-conjugated IgG (1:2,000 dilution) burgh, PA, USA). Using this automated and highly sensitive was used as the secondary antibody. Protein expression levels fluorescence-imaging microscope with a 20x objective and were determined by signal analysis using an image analyzer suitable filter sets, the stained cells were identified with DAPI (Fuji-Film, Tokyo, Japan). in fluorescence channel 1, BODIPY 493/503 in channel 2, and Alexa Fluor 568 in channel 3, respectively. Arbitrary values for BODIPY, C/EBP𝛽,andPPAR𝛾 fluorescence were 2.9. Statistical Analysis. Statistical analyses were performed calculated from the standard deviation of pixel intensity using analysis of variance with Duncan’s posttest; 𝑃 values of under the DAPI channel, reflecting the intact DNA content >0.05 were considered to be statistically significant. of the cell.

2.7.Quantitative Real-Time Polymerase Chain Reaction (PCR). 3. Results Total RNA was extracted from cells using a FastPure RNA kit 3.1. Effects of AOE on Adipocyte Differentiation. To investi- (TaKaRa, Shiga, Japan). The RNA concentration and purity gate the actions of AOE on adipocyte differentiation, OP9 were determined by absorbance at 260/280 nm. cDNA was 𝜇 preadipocytes were induced to differentiate between the synthesized from 1 g of total RNA using a PrimeScript absence or presence of various concentrations of the extract. RT reagent kit (TaKaRa). Expression of mRNA related to We observed that there were decreasing effects in lipid adipocyte differentiation was determined by real-time PCR, accumulation, as revealed by Oil Red O staining (Figures using the ABI PRISM 7900 Sequence Detection System 1(b) and 1(c)). Following on from these results, we checked andSYBRGreenI(AppliedBiosystems,FosterCity,CA, whether AOE might affect cell viability. We found that in USA). The primer sequences used are listed in Table 1.All differentiating cells treated for various periods with 20 or results were normalized to the GAPDH housekeeping gene 40 𝜇g/mL AOE, cytotoxicity was not apparent when com- to control for variation in mRNA concentrations. Relative ΔΔ𝐶 pared to the control cells (Figure 1(a)). quantificationwasperformedusingthecomparative 𝑡 To investigate at which stage of the differentiation process method according to the manufacturer’s instructions. AOE inhibits adipogenesis, we treated the cells with AOE at different times, during the early (days 0–2) or late stages (days 2.8. Western Blot Analysis. OP9 cells were pretreated with ∘ 3–5), or for the entire (days 0–5) differentiation period. The 40 𝜇g/mLAOEfor1handthendifferentiatedat37C. formation of lipid droplets and accumulation of triglyceride Cells were lysed with ice-cold mammalian protein extrac- in adipocytes were blocked in all treatment groups, as tion reagent (M-PER) (Pierce Biotechnology, Rockford, IL, revealed by BODIPY staining (green), which is specific for USA), and the protein concentration in the lysate was intracellular lipids (Figures 2(a) and 2(b)). We also stained determined using the Bradford method. Samples (20 𝜇g) PPAR𝛾 protein to determine the expression level (red) and were separated by sodium dodecyl sulfate-polyacrylamide found it to be downregulated in all AOE-treated groups gel electrophoresis with 10% acrylamide and transferred to (Figures 2(a) and 2(c)). Hybond-P polyvinylidene fluoride membranes (GE Health- care Life Sciences, Buckinghamshire, UK) using a western blot apparatus. Each membrane was blocked for 2 h with 2% 3.2. Effects of AOE on Adipocyte Differentiation-Related Genes. bovine serum albumin or 5% skim milk and then incubated Adipocyte differentiation is accompanied by increased 4 Evidence-Based Complementary and Alternative Medicine

100 ND D5 10 80

40 20 40 Viability (%) Viability N

0 0 24 48 72 96 Incubation time (hour) 20 𝜇g/mL 40 𝜇g/mL (a) (b)

4 ∗ 3

2 ∗∗ Oil-red O (fold) Oil-red 1

0 ND D5102040 N AOE (𝜇g/mL) (c)

Figure 1: Effects of AOE on viability and lipid accumulation in OP9 cells. (a) Confluent OP9 cells were differentiated into adipocytes in medium containing adipogenic inducers for varying time intervals in the presence or absence of AOE (20 and 40 𝜇g/mL), as described in Materials and Methods. Effects of AOE on cell viability were measured by MTT assay and data were represented as relative cell viability values. ((b) and (c)) Cells were treated with adipogenic inducers to trigger differentiation into adipocytes in the presence or absence of various concentrations of AOE. After 5 days of differentiation, the cells were subjected to Oil Red O staining for a qualitative (b) and quantitative (c) comparison of intracellular lipid accumulation. The bars represent fold increases compared with ND groups. Data are presented as mean ± ∗ ∗∗ SD values of at least 3 independent experiments. 𝑃 < 0.05; 𝑃 < 0.01 compared to the D5 group. ND: no differentiation, D5: differentiation day 5, and N: negative control (20 𝜇g/mL Radix Astragali extract). expression of various transcription factors and adipocyte- C/EBP𝛼, two key adipogenic transcription factors. We found specific genes. PPAR𝛾 and C/EBP𝛼 are essential for ter- that C/EBP𝛽 expression was significantly decreased during minal adipocyte differentiation and we found their expres- the early stage of adipogenesis (days 0–2) in OP9 adipocytes sion to be significantly decreased in all treatment groups treated with either 20 or 40 𝜇g/mL of AOE (Figures 4(a) upon treatment with 40 𝜇g/mL AOE (Figure 3). We fur- and 4(b)). When growth-arrested preadipocytes were treated ther investigated whether AOE-induced reduction of PPAR𝛾 with adipogenic inducers during the early stage, the num- and C/EBP𝛼 levels regulated the expression of their target ber of adipocytes increased by approximately twofold. This genes, including adipocyte protein 2 (aP2), fatty acid syn- response was significantly inhibited by treatment with AOE, thase (FAS), hormone-sensitive lipase (HSL), and lipoprotein with the number of AOE-treated OP9 adipocytes being lipase (LPL). Treatment with AOE (40 𝜇g/mL) significantly similartothatofthecontrolgroup(Figure 4(c)). decreased expression of each of these proteins at various time intervals (Figure 3). 3.4. Effects of AOE on Cyclin and Autophagy-Related Protein Expression. To determine the signaling pathway through 3.3. Effects of AOE on C/EBP𝛽 Expression during the Early which AOE inhibits clonal expansion during the early stage Stage of Adipogenesis. C/EBP𝛽 is induced at a very early stage of adipogenesis, cyclins A, D1, and D2, ERK, and Akt of adipogenesis and plays a crucial role in initiating the differ- protein expressions were examined. As shown in Figures 5(a) entiation program by activating the expression of PPAR𝛾 and and 5(b), cyclin D1 expression was decreased, while cyclins Evidence-Based Complementary and Alternative Medicine 5

0–23–50–5 (day) ND D 20 4020 40 20 40 (𝜇g/mL)

DAPI

BODIPY

PPAR𝛾

Merge

(a)

14 7

12 ) 6 4 ) 5

10 ×10 5 ×10 ∗∗ ∗∗ ∗∗ 8 ∗∗ 4 ∗∗ ∗∗

6 (intensity, 3 (intensity, ∗∗ 𝛾 2 4 ∗∗ ∗∗ ∗∗ ∗∗ Lipid ( PPAR ∗∗ 2 1

0 0 ND D 20 40 20 40 20 40 (𝜇g/mL) ND D 20 40 20 40 20 40 (𝜇g/mL) 0–2 3–5 0–5 (day) 0–203–5 –5 (day) (b) (c)

Figure 2: Effects of AOE on lipid droplet formation and PPAR𝛾 expression in OP9 cells. OP9 cells were treated with adipogenic inducers to trigger differentiation into adipocytes. AOE 20 (40 𝜇g/mL) was then added during the early stage (0–2 days), late stage (3–5 days), or the entire period of differentiation (0–5 days). (a) After 5 days of differentiation, immunohistochemical staining of OP9 cells was carried out using a specific antibody to visualize PPAR𝛾 (red), BODIPY 493/503 for lipid droplets (green), and DAPI to visualize nuclei (blue). (b) Total cellular lipid droplet content was determined by averaging cytosolic BODIPY intensities of individual cells. (c) PPAR𝛾 levels were determined by averaging the intensities of nuclear antibody staining in individual cells. Approximately 5,000 cells were analyzed for lipid droplet content ∗∗ and PPAR𝛾 levels. Data are expressed mean ± SD values of at least 3 independent experiments. 𝑃 < 0.01 compared to the D group. ND: no differentiation, D: differentiation.

A and D2 were not altered by treatment with 40 𝜇g/mL reduced levels of beclin1, Atg7, Atg12, and LC3 proteins AOE. Furthermore, ERK and AKT phosphorylations were (Figure 5(c)). both increased after treatment with adipogenic inducers for 10 min, but treatment with AOE attenuated AKT, but 4. Discussion and Conclusions not ERK, phosphorylation. Since autophagy is one of the major factors involved in regulating the early events in In the present study, we show that AOE exerts anti-adipo- adipocyte differentiation, we also examined the expression genic effects by a complex mechanism. We found that AOE of autophagy-related proteins after 1 day of treatment with treatment remarkably reduced levels of Oil Red O staining AOE. Wefound beclin1, Atg7,Atg12, and LC3 expression to be in a concentration-dependent manner, without affecting cell increased after 1 day of treatment with adipogenic inducers. viability (Figure 1). However, in cells treated with 40 𝜇g/mL AOE, activation Itiswellknownthatwhenpreadipocytesareinducedto of autophagy was significantly inhibited, as indicated by differentiate, the cells first initiate several rounds of mitotic 6 Evidence-Based Complementary and Alternative Medicine

4 PPRA𝛾 4 C/EBP𝛼

3 3

2 2 mRNA (fold) mRNA 1 1

0 0 ND D 0–23–50–5 ND D 0–23–50–5

Day Day (a) (b)

7 aP2 FAS 4 6 5 3 4 3 2 mRNA (fold) mRNA 2 1 1

0 0 ND D 0–23–50–5 ND D 0–23–50–5

Day Day (c) (d) 6 7 HSL LPL 5 6

4 5

3 4 3

mRNA (fold) mRNA 2 2 1 1

0 0 ND D 0–23–50–5 ND D 0–23–50–5

Day Day (e) (f)

Figure 3: Effects of AOE on expression of PPAR𝛾 and PPAR𝛾-target genes. OP9 cells were treated with adipogenic inducers to trigger differentiation into adipocytes. AOE (40 𝜇g/mL) was added during the early stage (0–2 days), late stage (3–5 days), or for the entire differentiation period (0–5 days). After 5 days of differentiation, real-time PCR was carried out using specific primers forPPAR𝛾,C/EBP𝛼, aP2, FAS, HSL, and LPL, as described in Table 1. The genes transcript levels are expressed as ratios relative GAPDH expression, with the level in ND to 1. Data are expressed as mean ± SD values of at least 3 independent experiments. ND: no differentiation, D: differentiation. clonal expansion and then become quiescent while the coor- we found that, during the early stage, AOE inhibited lipid dinated transcription of adipogenic genes is initiated [19]. droplet formation and suppressed C/EBP𝛽 expression. AOE Preadipocytes undergo mitotic clonal expansion through also inhibited adipocyte differentiation through suppression upregulation of C/EBP𝛽 and C/EBP𝛿 during the early stage of cell proliferation. Cell proliferation during adipogenesis of adipocyte differentiation (day 0–2)13 [ ]. In this study, occurs through the G1/S checkpoint, as shown by activation Evidence-Based Complementary and Alternative Medicine 7

Day 1 Day 2

ND D 20 40 ND D 20 40 (𝜇g/mL)

DAPI

C/EBP𝛽

Merge

(a) 16 40 14 35 ) 4 12 30 ∗

×10 # ) 25 10 4 ∗∗ ×10 ## 8 ∗ ## 20 ∗

(intensity, 6 15 Cells ( 𝛽 ∗∗ ## ∗∗ 4 10

C/EBP 2 5 0 0 𝜇 ND DD20 40 ND 20 40 (𝜇g/mL) NDDD20 40 ND 20 40 ( g/mL) Day 1 Day 2 Day 1 Day 2 (b) (c)

Figure 4: Effects of AOE on C/EBP𝛽 expression and cell proliferation in OP9 cells. (a) OP9 cells were pretreated with 20 or 40 𝜇g/mL AOE for 1 h and then cultured with adipogenic inducers. After 1 day and 2 days of differentiation, immunohistochemical staining of OP9 cells was carried out using a specific antibody to visualize C/EBP𝛽 (red) and DAPI to visualize nuclei (blue). (b) C/EBP𝛽 expression levels were determined by averaging the nuclear antibody staining intensity from 5,000 individual cells. (c) The number of cells treated with 20 and 40 𝜇g/mL AOE was determined using a hemocytometer. Experiments were carried out in triplicate and data are expressed as the mean ± ∗, # ∗∗, ## SD values of at least 3 independent experiments. 𝑃 < 0.05; 𝑃 < 0.01 compared to the D group at days 1 and 2, respectively. ND: no differentiation, D: differentiation.

1 of CDK2-cyclin E/A and cyclin D1, turnover of P27kip ,and the most characterized adipocyte-specific regulatory DNA hyperphosphorylation of Rb protein [20]. Furthermore, the motifs contain binding sites for both factors [23]. PPAR𝛾 PI3K/Akt pathway affects cell cycle progression, through isknowntobindtothepromoterregionthatinducesthe 1 regulation of cyclin D and P27kip expression [21]. Here, we expression of C/EBP𝛼,whichis,inturn,regulatedbyC/EBP𝛽 found that AOE treatment decreased cyclin D expression and during adipocyte differentiation24 [ ]. C/EBP𝛽 is expressed phosphorylation of Akt in response to adipogenic inducers at earlier time points than both C/EBP𝛼 and PPAR𝛾 during in OP9 cells (Figures 5(a) and 5(b)). In contrast, while adipogenesis [22], and it is known to induce the expression adipogenic inducers also stimulate the MEK/ERK pathway, of C/EBP𝛼 and PPAR𝛾 [15]. We found that AOE consid- resultinginenhancedactivityofC/EBP𝛽 and induction erablyreduceslevelsofC/EBP𝛽 protein during the early of adipocyte differentiation22 [ ], AOE-treatment does not phase (Figures 4(a) and 4(b)), and that it also significantly alter this response. These results suggest that AOE may inhibits expression of C/EBP𝛼 and PPAR𝛾 at the mRNA level exert its inhibitory effects on adipocyte differentiation via (Figure 3). It has been reported that adipogenesis-related downregulation of cyclin D1 and C/EBP𝛽 expression, which, genes, such as aP2, FAS, HSL, and LPL, are targets of PPAR𝛾 in turn, happens because of decreased Akt activation. and C/EBP𝛼. In our study, AOE inhibited the expression of PPAR𝛾 and C/EBP𝛼 are both known to be direct each of these adipocyte-specific genesFigure ( 3), suggesting transcriptional activators of adipocyte differentiation, and that AOE inhibits the expression of C/EBP𝛽 during the 8 Evidence-Based Complementary and Alternative Medicine

Day 1 Day 2 10 min 3 h ND DD40 ND 40 (𝜇g/mL) NDDD40 ND 40 (𝜇g/mL) Cyclin A P-ERK

ERK Cyclin D1 P-AKT 2 Cyclin D AKT

𝛽-Actin 𝛽-Actin

(a) (b) ND D140(𝜇g/mL) Beclin 1

ATG7

ATG12

LC3B I LC3B II

𝛽-Actin

(c)

Figure 5: Effects of AOE on cell proliferation and autophagy-related protein expression in OP9 cells. OP9 cells pretreated with40 𝜇g/mL AOE were then cultured with adipogenic inducers for the designated times. After harvesting, the lysates were subjected to western blot analysis for cyclins A, D1, and D2 (a) and ERK, p-ERK, Akt, and p-Akt (b) and beclin1, Atg7, Atg12, and LC3B I and II (c). ND: no differentiation, D: differentiation, D1: differentiation day 1. early stage of adipogenesis. This, in turn, leads to reduced therefore has promising therapeutic potential in preventing expression of PPAR𝛾 and C/EBP𝛼,ultimatelyleadingto obesity. inhibition of lipid accumulation. A recent advance in understanding adipogenesis is the Conflict of Interests role played by autophagy, a catabolic process for degradation of bulk cytoplasmic contents and subcellular organelles [25]. The authors declare that they have no conflict of interests Most of the genes involved in autophagy, named autophagy- regarding the publication of this paper. related genes (Atg), have been identified. Importantly, genetic deletion of Atg5 and Atg7, two essential autophagy genes, significantly inhibits adipocyte differentiation in 3T3-L1 cells Authors’ Contribution and attenuates diet-induced obesity in mice [16, 18]. Wefound Yeon-Ju Park and Mi-Seong Kim contributed equally to this that after 1 day of differentiation, levels of autophagy-related work. specific proteins in OP9 cells, such as beclin 1, Atg7, Atg12, and LC3, were increased by adipogenic inducers. However, Acknowledgments in the AOE-treated groups, increases in autophagy-related proteins were repressed (Figure 5(c)). These findings demon- This research was supported by a National Research Founda- strate the functional importance of autophagy inhibition tion of Korea (NRF) Grant, funded by the Korean Govern- in AOE-induced repression of adipocyte differentiation in ment (MEST) (no. 2011-0030130), Republic of Korea, and by OP9 cells. Since early induction of both C/EBP𝛽 expression a Basic Science Research Program Grant from the National and autophagy is crucial for adipocyte differentiation, it is Research Foundation of Korea (NRF), funded by the Ministry plausible that the inhibition of autophagy induced by AOE of Education, Science, and Technology (NRF-2012R1A1A4A0 may be related to the decrease of C/EBP𝛽 expression. 1011520). In summary, we have shown that AOE suppresses adipocyte differentiation in OP9 cells by downregulating the References expression of C/EBP𝛽 and consequently decreasing PPAR𝛾 and C/EBP𝛽 levels. AOE also inhibits adipogenesis by atten- [1] L. Bravo, “Polyphenols: chemistry, dietary sources, metabolism, uating autophagy in response to adipogenic inducers. Thus, and nutritional significance,” Nutrition Reviews,vol.56,no.11, our studies show that AOE exerts antiadipogenic actions and pp. 317–333, 1998. Evidence-Based Complementary and Alternative Medicine 9

[2] Y. Dai, B. Hang, Z. Huang, and P. Li, “Anti-inflammatory activ- National Academy of Sciences of the United States of America, ities and effect of rhizoma Alismatis on immune system,” vol. 106, no. 47, pp. 19860–19865, 2009. Zhongguo Zhong Yao Za Zhi,vol.16,no.10,pp.622–625,1991. [19] O. A. MacDougald and M. D. Lane, “Adipocyte differentiation. [3]J.H.Lee,O.S.Kwon,H.-G.Jin,E.-R.Woo,Y.S.Kim,andH.P. When precursors are also regulators,” Current Biology,vol.5,no. Kim, “The rhizomes of Alisma orientale and alisol derivatives 6, pp. 618–621, 1995. inhibit allergic response and experimental atopic dermatitis,” [20] K.-M. Choi, Y.-S. Lee, D.-M. Sin et al., “Sulforaphane inhibits Biological and Pharmaceutical Bulletin,vol.35,no.9,pp.1581– mitotic clonal expansion during adipogenesis through cell cycle 1587, 2012. arrest,” Obesity,vol.20,no.7,pp.1365–1371,2012. [4] H. Matsuda, T. Kageura, I. Toguchida, T. Murakami, A. Kishi, [21] R. C. Muise-Helmericks, H. L. Grimes, A. Bellacosa, S. E. and M. Yoshikawa, “Effects of sesquiterpenes and triterpenes Malstrom,P.N.Tsichlis,andN.Rosen,“CyclinDexpressionis from the rhizome of Alisma orientale on nitric oxide production controlled post-transcriptionally via a phosphatidylinositol 3- in lipopolysaccharide-activated macrophages: absolute stere- kinase/Akt-dependent pathway,” JournalofBiologicalChem- ostructures of alismaketones-B 23-acetate and -C 23-acetate,” istry, vol. 273, no. 45, pp. 29864–29872, 1998. Bioorganic and Medicinal Chemistry Letters, vol. 9, no. 21, pp. [22] Q.-Q. Tang, T. C. Otto, and M. Daniel Lane, “Mitotic clonal 3081–3086, 1999. expansion: a synchronous process required for adipogenesis,” [5] H.-G. Jin, Q. Jin, A. Ryun Kim et al., “A new triterpenoid from Proceedings of the National Academy of Sciences of the United Alisma orientale and their antibacterial effect,” Archives of States of America,vol.100,no.1,pp.44–49,2003. Pharmacal Research, vol. 35, no. 11, pp. 1919–1926, 2012. [23] U. A. White and J. M. Stephens, “Transcriptional factors that [6]C.W.Han,E.S.Kang,S.A.Ham,H.J.Woo,J.H.Lee,and promote formation of white adipose tissue,” Molecular and H. G. Seo, “Antioxidative effects of Alisma orientale extract in Cellular Endocrinology,vol.318,no.1-2,pp.10–14,2010. palmitate-induced cellular injury,” Pharmaceutical Biology,vol. [24] Y. Hou, P. Xue, Y. Bai et al., “Nuclear factor erythroid- 50,no.10,pp.1281–1288,2012. derived factor 2-related factor 2 regulates transcription of [7] S. D. Hursting, L. M. Lashinger, L. H. Colbert et al., “Energy CCAAT/enhancer-binding protein 𝛽 during adipogenesis,” Free balance and carcinogenesis: underlying pathways and targets Radical Biology and Medicine, vol. 52, no. 2, pp. 462–472, 2012. for intervention,” Current Cancer Drug Targets,vol.7,no.5,pp. [25] B. Levine and J. Yuan, “Autophagy in cell death: an innocent 484–491, 2007. convict?” Journal of Clinical Investigation,vol.115,no.10,pp. [8]D.C.W.Lau,B.Dhillon,H.Yan,P.E.Szmitko,andS.Verma, 2679–2688, 2005. “Adipokines: molecular links between obesity and atheroslcero- sis,” American Journal of Physiology: Heart and Circulatory Physiology, vol. 288, no. 5, pp. H2031–H2041, 2005. [9] M. W. Rajala and P. E. Scherer, “Minireview: the adipocyte— at the crossroads of energy homeostasis, inflammation, and atherosclerosis,” Endocrinology,vol.144,no.9,pp.3765–3773, 2003. [10] P.Zimmet,K.G.M.M.Alberti,andJ.Shaw,“Globalandsocietal implications of the diabetes epidemic,” Nature,vol.414,no. 6865, pp. 782–787, 2001. [11] T. C. Otto and M. D. Lane, “Adipose development: from stem cell to adipocyte,” Critical Reviews in Biochemistry and Molecu- lar Biology, vol. 40, no. 4, pp. 229–242, 2005. [12]F.M.Gregoire,C.M.Smas,andH.S.Sul,“Understanding adipocyte differentiation,” Physiological Reviews,vol.78,no.3, pp. 783–809, 1998. [13] J. M. Ntambi and K. Young-Cheul, “Adipocyte differentiation and gene expression,” Journal of Nutrition,vol.130,no.12,pp. 3122S–3126S, 2000. [14] Q. Tong and G. S. Hotamisligil, “Molecular mechanisms of adipocyte differentiation,” Reviews in Endocrine and Metabolic Disorders,vol.2,no.4,pp.349–355,2001. [15] S. R. Farmer, “Transcriptional control of adipocyte formation,” Cell Metabolism,vol.4,no.4,pp.263–273,2006. [16]R.Baerga,Y.Zhang,P.-H.Chen,S.Goldman,andS.Jin, “Targeted deletion of autophagy-related 5 (atg5) impairs adipogenesis in a cellular model and in mice,” Autophagy,vol.5,no. 8, pp. 1118–1130, 2009. [17] M. Tsukada and Y. Ohsumi, “Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae,” FEBS Letters,vol.333,no.1-2,pp.169–174,1993. [18] Y. Zhang, S. Goldman, R. Baerga, Y. Zhao, M. Komatsu, and S. Jin, “Adipose-specific deletion of autophagy-related gene 7 (atg7) in mice reveals a role in adipogenesis,” Proceedings of the Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2014, Article ID 648308, 18 pages http://dx.doi.org/10.1155/2014/648308

Review Article Herbal Medicines for the Treatment of Nonalcoholic Steatohepatitis: Current Scenario and Future Prospects

Ravirajsinh Jadeja,1 Ranjitsinh V. Devkar,2 and Srinivas Nammi3,4

1 Division of Gastroenterology and Hepatology, Department of Medicine, Medical College of Georgia, Georgia Regents University, Augusta, GA 30912, USA 2 Division of Phytotherapeutics and Metabolic Endocrinology, Department of Zoology, Faculty of Science, The M. S. University of Baroda, Vadodara, Gujarat 390002, India 3 School of Science and Health, University of Western Sydney, Sydney, NSW 2751, Australia 4 NICM, Centre for Complementary Medicine Research, University of Western Sydney, Sydney, NSW 2751, Australia

Correspondence should be addressed to Srinivas Nammi; [email protected]

Received 17 March 2014; Accepted 30 April 2014; Published 3 June 2014

Academic Editor: Menaka C. Thounaojam

Copyright © 2014 Ravirajsinh Jadeja et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Nonalcoholic steatohepatitis (NASH) is a multifactorial disease and has close correlations with other metabolic disorders. This makes its treatment difficult using a single pharmacological drug. Use of plant extract/decoction or polyherbal formulation to treat various liver diseases is very well mentioned in various traditional systems of medicine (Ayurveda, Japanese or traditional Chinese Medicine, and Kampo medicine). Medicinal herbs are known for their multifaceted implications and thus can form an effective treatment schedule against NASH. Till date, several plant extracts, polyherbal formulations, and phytochemicals have been evaluated for their possible therapeutic potential in preventing onset and progression of NASH in experimental models, but clinical studies using the same are sparse. Herbal extracts with antioxidants, antidiabetic, and antihyperlipidemic properties have been shown to ameliorate symptoms of NASH. This review article is a meticulous compilation of our current knowledge on the role of natural products in alleviating NASH and possible lacunae in research that needs to be addressed.

1. Introduction theUnitedStatesofAmericaareestimatedtohavepro- gressedtoNASHandsome600,000toNASH-related The term nonalcoholic fatty liver disease (NAFLD) refers cirrhosis. Recent data confirms high prevalence in cases to a broad spectrum of diseases characterized by fatty of NAFLD/NASH in Middle East, Far East, Africa, the infiltration of the liver, steatosis, steatohepatitis, and cirrhosis Caribbean, and Latin America due to its close association [1]. Nonalcoholic steatohepatitis (NASH) is a more severe with lifestyle disorders such as diabetes and obesity [4]. form of NAFLD characterized by severe oxidative stress, The available treatment options for NASH include weight hepatocellular inflammation, and steatosis that culminates loss, dietary and lifestyle modifications, use of insulin sensi- in cirrhosis and hepatocellular carcinoma [2]. This concept tizing, and lipid lowering drugs [5]. Furthermore, combina- was introduced by Ludwig and his colleagues in 1980 during tions of these approaches have also been tried for manage- their study on patients suffering with fatty liver but no prior ment of NASH [6, 7]. Since NASH is a multifactorial disease, history of alcohol consumption [3]. In the last couple of single target based therapy has limited implications. Hence, decades, NAFLD and NASH are at the pinnacle of liver the use of herbal medicines could be a promising alternative diseases in Western countries [4]. Interestingly, prevalence of due to their multipronged mechanisms of action [8]. Avail- NAFLD/NASH has doubled during the last 20 years, whereas able scientific information and experiments on antiobesity prevalence of other chronic liver diseases has remained and antidiabetic plant extracts/phytochemicals/polyherbal stable or even decreased. About 6 million individuals in formulations greatly outnumber the preclinical and clinical 2 Evidence-Based Complementary and Alternative Medicine

High calorie intake Sedentary life style hit” that eventually leads to a “second hit.” Recent research findings have clearly demonstrated that hepatic steatosis is notjusta“firsthit”buttherootcauseformanyother pathological manifestations [12]. Hence, based on the recent findingsithasnowbeenmodifiedas“multipleparallelhits” Dyslipidemia Lipid Lipid hypothesis, wherein insulin resistance is considered to be lowering lowering Insulin a priming condition for induction of NASH [13]. Briefly, sensitizer hyperinsulinemia-induced increased inflow of free fatty acids (FFA) or augmented de novo lipogenesis is considered as the Insulin resistance Obesity root cause for development of a steatotic liver. Hence, the “multiple parallel hits” are characterized by factors such as Insulin Antiobesity major hepatic injury via oxidative stress, inflammation, and sensitizer NAFLD lipid peroxidation [14]. In addition, exacerbated accumulation of lipids in the liver leads to subsequent lipotoxicity and Antioxidants chronic inflammation.

NASH 3. Animal Models of NASH There has been a wide range of animal models that are Hepatocellular available for studying onset and progression of NASH and Cirrhosis carcinoma are mainly classified into genetic, dietary, and combination models (Table 1). However, ideal in vivo models of Mortality NAFLD/NASH are the ones that develop pathophysiological and morbidity alterations in liver similar to the ones seen in humans during NAFLD/NASH. The desired pathophysiological changes for Figure 1: An overview of the pathogenesis of nonalcoholic fatty experimental models of NASH include steatosis, intralob- liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) ular inflammation, hepatocellular ballooning, and ideally and potential targets for herbal therapeutic intervention.Green color perisinusoidal fibrosis in zone-3 with increased susceptibility graphics represent herbal property that could be beneficial against to liver tumors [15]. Furthermore, these pathophysiological NASH. features should be accompanied by metabolic abnormalities such as obesity, insulin resistance, dyslipidemia, and altered adipokine profile [16]. studies conducted on NASH so far. This review article is a meticulous compile of our current knowledge on the role of 4. Treatment Options for naturalproductsinalleviatingNASHandpossiblelacunaein research that need to be addressed. NASH and Limitations The recommended management of NASH includes gradual 2. Pathogenesis of NASH weight loss through lifestyle modifications, restricted calorie intake, and exercise. A variety of pharmacological strategies According to the American Association for the Study of Liver have been attempted to correct NASH, but most trials Diseases (AASLD), development of fatty liver in patients with have been too short to determine an impact on important no prior history of chronic high alcohol intake (i.e., alcohol patient-centered clinical outcomes [7]. These pharmacolog- intake is <20 g ethanol/day) is referred to as nonalcoholic fatty ical interventions include the use of antioxidants (vitamin-E liver disease (NAFLD) [9]. As per the AASLD’s guidelines, and vitamin-C; betaine), insulin-sensitizing agents (thiazo- NAFLD is histologically subdivided into a condition called lidinediones and metformin), lipid-lowering drugs (statins, the nonalcoholic fatty liver (NAFL) and a more severe orlistat, and probucol), cytoprotective agents (ursodeoxy- condition referred as nonalcoholic steatohepatitis (NASH). cholic acid), and anti-inflammatory (pentoxifylline) or antifi- After several decades, these pathophysiological conditions brotic (angiotensin-receptor blockers) drugs [17]. Addition- may advance into life-threatening hepatic cirrhosis and hep- ally, bariatric surgery is also available for the management of atocellular carcinoma (Figure 1)[10]. NASH [18]. Table 2 lists the available nonherbal therapeutic Basedonthepreclinicaldataavailable,DayandJames drugs for management of NASH. were the first to propose a “two-hit” hypothesis for explaining Generally, treatment regime for NASH includes a combi- the pathogenesis of NASH. The same was very well accepted nation of lipid-lowering, insulin sensitizing, and antioxidant and stayed as the only comprehensive explanation for NASH drugs. By far, the antioxidants used for the management of [11]. Recently, a better understanding of the clinical symptoms NASH are devoid of side effects. However, common side of NASH and its interaction with metabolic diseases has led effects, such as head and muscle aches, drowsiness, dizziness, to a modification of this hypothesis. As per the “two hit” nausea and/or vomiting, and diarrhea, have been associated hypothesis, hepatic steatosis was considered to be the “first with most lipid-lowering and insulin sensitizing drugs. These Evidence-Based Complementary and Alternative Medicine 3 ] 22 – ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 39 28 38 27 29 30 31 32 37 33 19 23 24 36 26 34 33 20 24 35 25 [ [ [ [ [ [ [ [ [ [ [ [ [ [ -oxidation of 𝛽 Bessential 𝜅 PTEN gene Fed on high carbohydrate-fat free diet 4daysperweekandfastingforthe remaining 3 days Defective peroxisomal light chain fatty acids Fat- and sugar-enriched diet and chronic stress Mutation prevents adiponectin receptor expression Decreased levels of antioxidantsgenes and involved in lipid oxidation Mutation in NF- modulator genes + HFD Mutation prevents synthesis of leptinMCD + Mutation prevents c-Jun amino-terminal kinases expression + MCD Loss of melanocortin and an obesephenotype due to hyperphagia Mutation prevents synthesis of leptinhigh + calorie + MCD 20–40% fat containing diet, 60% fructose rich diet, methionine-choline deficient diet (MCD) Mutation in leptin receptor + high calorie Overexpression of SREBP-1c in adipose tissue rats rats +HFD +MCD Dawley rats null mice - L-KO mice and null mice Mutation in y Wistar Wistar null mice −/− Table 1: Various animal models for the study of nonalcoholic steatohepatitis. Male Adiponectin null AFasKO miceSfrp5 knockout Mutation in adipose fatty Defective acid synthase Wnt signaling pathway [ [ AOX MAT1A C57BL/6J miceob/ob mice 45–60% fat containing diet (HFD) Mutation prevents synthesis of leptinob/ob mice + MCD [ [ Male db/db mice Mutation in leptin receptor [ NEMO PTEN db/db mice + MCD Mutation in leptin receptor + MCD [ ob/ob mice + MCD + HFD Wistar fa/fa rats Mutation in leptin receptor [ Sprague fa/fa rats + HFD JNK1 SREBP-1c transgenic mice KK-A Feeding and Fasting cycles CategoryDietary Genetic ModelGenetic + Dietary Mode of inductionDietary + physical stress Reference 4 Evidence-Based Complementary and Alternative Medicine

Table 2: Some popularly used nonherbal therapeutic drugs for nonalcoholic steatohepatitis.

Category Synthetic drug References Antiobesity drugs Orlistat, sibutramine, mazindol [40] Vitamin E, vitamin C, Antioxidants [41] polyphenols (resveratrol, etc.) Ursodeoxycholic acid, n-3 Cytoprotective polyunsaturated fatty acids (EPA [42] agents and DHA) Metformin (biguanide), Insulin sensitizers thiazolidines (pioglitazone, [43] Rosiglitazone) Lipid lowering Statins, fibrates, NPC1L1 [44] drugs inhibitors (ezetimibe) Angiotensin II receptor blockers, angiotensin-converting enzyme inhibitors, antialdosterone (spironolactone and eplerenone), RAS blockers renin inhibitor (aliskiren), [17] incretin-related agents, GLP-1 agonists/analogs (exenatide and liraglutide), DPP-4 inhibitors (sitagliptin and vildagliptin) side effects generally get compounded when drugs are taken experimentally induced NASH was provided by Park et al. in combination. Hence, multipronged therapeutic nature and [84]. It was demonstrated that oral administration of AS stem safety of herbal medicine are important for their use in bark ethanolic extract (400 or 800 mg/kg) to ob/ob mice treating NASH. for 8 weeks significantly reduced weight gain and visceral adiposity and improved insulin resistance. Furthermore, 5. Natural Products for achangeinliverweightandhistopathologicalfeaturesof the Treatment of NASH NASH were minimized by AS treatment. The authors have also evaluated the effect of AS extract on mRNA expression Alternative herbal medicines are being used in three dif- of hepatic carbohydrate and lipid metabolizing enzymes ferent forms, plant extracts, polyherbal formulations, and wherein significant decrements in the mRNA expressions phytochemicals. The following section consists of detailed of glucose 6-phosphatase (G6Pase), phosphoenolpyruvate description of selected 20 plant extracts that have been carboxykinase (PEPCK), sterol regulatory element-binding evaluated for their beneficial action in controlling NASH. protein (SREBP-1), fatty acid synthase (FAS), and stearoyl- Various scientific databases (PubMed, Scopus, Biomed Cen- CoA desaturase-1 (SCD-1) were observed in AS treated obese tral,GoogleScholar,andWebofScience)weresearched mice. Based on these observations, it was concluded that AS with key words such as “nonalcoholic steatohepatitis and acts as an insulin sensitizer and decreases circulating glucose herbal,”“nonalcoholic steatohepatitis and plant extract,”“non- and lipids which in turn improves hepatic lipogenesis and alcoholic fatty liver disease and herbal,”and“non-alcoholic carbohydrate metabolism resulting in prevention of NASH. fatty liver disease and plant extract” (last accessed on 30th ofJanuary2013).Theselectioncriteriainclude(1)availability 5.2. Alisma orientalis (Alismatis rhizome). Alisma orien- of full-text articles in English, (2) profound evaluation using talis Juzep(AO;family:Alismataceae)hasbeenprescribed in vivo model including liver histopathology, (3) exclusion of for diuretic and anti-inflammatory purposes in traditional herbs with reported in vitro studies only, and (4) exclusion of Chinese medicine and used for urolithiasis, hypertension, herbs with reported hypolipidemic activity only. chronic nephritis, and kidney failure [85]. Laboratory studies have reported that AO extract possesses potent lipid lowering 5.1. Acanthopanax senticosus (Siberian Ginseng). Acan- potential and improves insulin resistance in experimental thopanax senticosus (Rupr. et Maxim.) Harms. (AS; family: animals [86, 87]. The efficacy of AO methanolic extract Araliaceae) is an oriental herb commonly distributed (AOME) in ameliorating experimental NASH was evaluated throughout the North Eastern parts of Asia. It is a by Hong et al., 2006, in high fat diet-fed rats [85]. Admin- popular traditional Chinese medicine used for the istrationofAOMEat150,300,or600mg/kgbodyweight treatment of arthritis, hypertension, heart disease, gastric for 12 weeks significantly reduced serum and hepatic lipids ulcers, and tumors [80]. Various studies have reported and improved fasting serum glucose and insulin resistance. antidiabetic [81, 82]andantiobesity[83]potentialsofAS Moreover, high fat diet-induced hepatic oxidative stress was extracts/fractions. The evidence for its role in ameliorating also minimized by AOME treatment. These sets of changes Evidence-Based Complementary and Alternative Medicine 5 were in agreement with the observed decrease in the hepatic induced insulin resistance, NASH, and related inflammatory injurymarkers.Histopathologicalfeaturessuchassteato- changes in rats [93, 94]. In this study, it was found that dietary sis, augmented inflammation, and collagen deposition were supplementation of CQ extract (10%) for 45 days significantly improved in AOME supplemented rats. These observations improved insulin sensitivity, reduced liver damage, prevented demonstrate the potential benefit of AOME on NAFLD and oxidative changes [94], and improved insulin sensitivity [93]. possible clinical usage for the management of NASH. Interestingly, CQ supplementation to HFFD rats significantly reduced mRNA expression of tumor necrosis factor-𝛼 𝛼 𝛽 𝛽 5.3. Camellia sinensis (Green Tea). Camellia sinensis,(CS; (TNF- ), transforming growth factor (TGF- )andalpha 𝛼 family: Theaceae) is also popularly referred as green tea and smooth muscle actin ( -SMA). Collectively these studies is now cultivated across the world in tropical and subtropical comprehendtheroleofCQinregulatingNASHandrelated regions. Green tea was first cultivated in China and then fibrosis mainly via improving insulin sensitivity and reducing in Japan, but commercial cultivation of green tea begun in oxidative stress. Indonesia, Indian subcontinent, and Europe between the 15th and the 17th centuries. Based on their content of polyphenols, 5.5. Clerodendron glandulosum (Kuthab Laba). Clerodendron tea is classified into green tea, oolong tea, and black tea. glandulosum Coleb (CG; family: Verbenaceae) is endemic to Catechins (flavan-3-ols) are the major polyphenols present North-Eastern states of India and is locally known as kuthab ingreenteaandconstitute30–42%ofthesolidweightof Laba/kuthap Laba [95]. Leaves of this perennial (wild or thebrewedtea.Themajorteacatechinsincludeepicatechin cultivated) shrub are used by the tribes of North-East India (EC), epicatechin gallate (ECG), epigallocatechin (EGC), as a therapeutic agent against hypertension [96, 97], whereas and epigallocatechin gallate (EGCG). First evidence for the the tender shoots are used against fever and abdominal pain protective role of green tea extract (GTE) against hepatic [98]. Traditionally, rural and urban populace of Manipur injury and steatosis was provided by Bruno et al., 2008, consume decoction of CG leaves for treating diabetes, obesity, using ob/ob mouse model of obesity-triggered NAFLD [88]. and hypertension [99]. A series of experiments conducted Efficacy of GTE has also been reported in other experimental models of NASH such as nitrite-injection, choline-deficient from our laboratory documented its hypolipidemic [100], diet fed, high fat diet (HFD) fed rats, and SREBP-1c overex- antihypertensive [101], antidiabetic [101], antiobesity [102], pressing models [51, 89]. It was documented that GTE and and hepatoprotective potentials [103]. Based on its mul- its active component catechins provide protection against tifaceted therapeutic potential, series of experiments were liver injury, steatosis, and subsequent progression to NASH. conducted by our research group to assess its efficacy in Supplementation of 1-2% GTE in the diet has been shown mitigating NASH using in vitro and in vivo experimental to regulate body weight, without any significant alterations models [19]. Supplementation of CG aqueous extract for 16 in food intake. Furthermore, GTE dosed experimental ani- weeks significantly minimized HFD-induced elevated plasma mals showed decrement in hepatic lipid accumulation and markers of liver damage, plasma and hepatic lipids, and mito- decrease titres of plasma markers of hepatic damage (AST and chondrial oxidative stress and improved the status of enzy- ALT). Similar results were also obtained using 3.2% EGCG matic and nonenzymatic antioxidant. Also, histopathology of in the diet [51] Interestingly, a fermented GTE (3%, w/w) liver of NASH mice showed reduced damage to hepatocytes. containing primarily ECG and gallocatechin but low amounts Results obtained from the in vitro study showed significant of EGCG was also effective in reducing hepatic triglyceride attenuation of oleic acid induced lipid accumulation in HepG2 cells in presence of CG extract [104]. In addition, levels in rats maintained on a choline-deficient-high-fat diet 𝜇 for 10 weeks [90]. In contrast, 3% of microbially fermented HepG2 cells treated with CG extract (20–200 g/mL) showed GTE (rich in ECG and gallocatechin) failed to improve the significantly low levels of lipid peroxidation and cytotoxicity. inflammation in rats fed with choline-deficient-high-fat diet These in vivo and in vitro studies were the first comprehensive also given daily intraperitoneal injections of nitrite. However, experimental evidences that established the efficacy of CG the treatment normalised fibrosis as evidenced by histological extract in preventing high fat/fatty acid induced NASH [19]. findings [90]. However, these research groups could not However, further investigations are needed to explore the explainthecauseofthevariationsintheresultsobtainedafter bioactive phytochemicals in CG extracts that account for the using variety of catechins against NASH. However, it appears said effects. that regulations of hepatic lipid accumulation at multiple levels and prevention of inflammation and oxidative stress 5.6. Curcuma longa (Turmeric). The powdered rhizome of are the possible mechanisms for GTE mediated regulation of Curcuma longa L. (CL; family: Zingiberaceae) has been NASH. extensively used in many parts of the world as a coloring spice. It is also useful in prevention of human ailments 5.4. Cissus quadrangularis (Asthisamharaka). Cissus quad- such as metabolic syndrome and inflammatory conditions rangularis Linn (CQ; family: Vitaceae) is a herb indigenous [104]. Beneficial role of CL extract and its active ingredient, to India, Srilanka, Malaysia, Thailand, and Africa [91]. Stem curcumin, in regulating obesity and type 2 diabetes has bark of CQ has been used traditionally for various ailments been extensively reported by various research groups via [92]. Chidambaram et al. has reported on the beneficial role preclinical and clinical studies [105]. Recently, the preven- of CQ stem extract against high fat-fructose diet- (HFFD-) tive role of CL rhizome powder on high fat diet-induced 6 Evidence-Based Complementary and Alternative Medicine hepatic steatosis has been reported wherein dietary supple- density lipoprotein cholesterol (VLDL-C) overproduction mentation of turmeric (5% in the diet) for 6 weeks was and triglyceride (TG) synthesis in the liver of fructose-fed instrumental in significantly reducing the elevated titer of rats. These sets of experiments clearly indicate that curcumin markers enzymes of liver damage and serum dyslipidemia has potential to control experimentally induced NASH. [106]. CL extract was also reported to reduce hepatic lipid peroxidation and improve antioxidants status. Histopatho- 5.7. Eriobotrya japonica (Loquat). Eriobotrya japonica (EJ; logical evaluation of liver had revealed reduced degree of family: Rosaceae) is a fruiting tree whose leaves have been steatosis and inflammatory changes in CL supplemented rats used in traditional Kampo and Chinese medicinal system and the same was attributed to its powerful antioxidant [107].ExtractsofEJhavebeenshowntoimprovehyper- potential [106]. On similar lines, the beneficial role of CL lipidemia and insulin resistance, regulate adipogenesis and on hypercholesterolemia-induced fatty liver was reported body weight gain in high fat diet-fed mice [110], and reduce by Yiu and coworkers [107] wherein oral administration of hyperglycemia in type II diabetic rats and mice [111]. Also, CL (100 mg/kg or 300 mg/kg body weight) to hypercholes- the EJ seed extract (70% ethanol) has been put to scrutiny terolemic diet-fed rats minimized dyslipidemia and improved to assess its ameliorative property against experimentally hepatic injury [107]. Interestingly, supplementation of CL induced NASH. Plasma AST and ALT levels were signifi- extract significantly increased mRNA expression of choles- 𝛼 cantlyreducedinMCD+EJseedextractfedratsascompared terol 7 -hydroxylase, hemeoxygenase-1, and low-density to the MCD diet-fed rats. There was a significant improve- lipoprotein receptors (LDL-R) with subsequent decrease ment in the hepatic antioxidant enzymes in EJ supplemented in 3-hydroxy-3-methyl-glutaryl- CoA reductase (HMG Co group. Furthermore, deposition of fatty droplets in the liver A reductase) compared to rats fed with normal or high- and subsequent pathological changes was nominal in EJ sup- cholesterol diets [107]. Apparently, it can be concluded plemented rats. Expression of markers of oxidative stress (8- thatapartfromitsantioxidantpotential,regulationofkey hydroxy-2-deoxyguanosine and 4-hydroxy-2-nonenal) and cholesterol metabolizing enzymes is also a mechanism for CL fibrosis (TGF-𝛽 and collagen) were significantly reduced in induced improvement of experimentally induced NASH. the EJ supplemented rats compared to MCD diet-fed rats. Compared to its extract, curcumin has been evaluated Overall, it was demonstrated that multifaceted regulatory role in detail for its protective role against NASH. Initial study of EJ seed imparts protection against NASH by regulating carried out by Asai and Miyazawa [108]reportedthat steatosis, inflammation, and oxidative stress. diet containing 1 g% of curcuminoids can minimize hepatic lipid accumulation. Using a more specific model of NASH, Leclercq et al., 2004 [109], demonstrated that 1 g% of cur- 5.8. Ginkgo biloba (Maidenhair Tree). Ginkgo biloba (GB; cumin in the diet successfully decreased histopathological family: Ginkgoaceae) is used in traditional Chinese medicine indices of inflammation, plasma alanine transaminase (ALT), and up to date, its extract is widely used for treating NF-kB-DNA binding, expressions of hepatic intracellular avarietyofhumanailments[112]. GB extract has been adhesion molecule-1 (ICAM-1), cyclooxygenase-2 (COX- showntoameliorateinsulinresistanceandhighfatdiet- 2), monocyte chemotactic protein-1 (MCP-1), and type 1 induced dyslipidemia [113, 114]. Recently, its beneficial effects collagen in methionine-choline deficient (MCD) diet-fed in controlling NASH were reported by Wang et al., 2012, rats. Vizzutti et al. had reported about the ameliorative role [115]viain vitro and in vivo experimental evaluations. of curcumin in NASH-associated fibrogenesis and stellate cell In rats with experimentally induced NASH, dosing of GB activation [49]. It was observed that curcumin administration (0.25%, W/W) could significantly reduce hepatic triglyceride (25 𝜇g/kg) to MCD diet-fed rats reduced elevation in serum and fatty acids. Notably, the expression and total activity 𝛽 ALT, fibrotic changes in liver, and hepatic oxidative stress. level of the rate-limiting fatty acid -oxidation enzyme and Anti-inflammatory and antifibrogenic potentials of curcumin carnitine palmitoyltransferase-1a (CPT-1a) were decreased were attributed to decreased expression of hepatic MCP-1, following GB treatment. In HepG2 cells, GB and its active CD11b, procollagen type I, 𝛼-SMA, and tissue metallopep- ingredients (quercetin, kaempferol, and isorhamnetin) could tidase inhibitor-1 (TIMP-1). Li et al., 2010 [50], evaluated significantly prevent accumulation of cellular triglyceride the molecular mechanism responsible for protective effect of content and upregulated expression and total activity of CPT- curcumin against high fructose diet-induced NASH in rats. 1a [115]. Hence, GB extract induced modulation of CPT-1a Authors convincingly demonstrated that curcumin inhibits could be considered as the possible underlying mechanism over activated PTP1B (c protein-tyrosine phosphatase 1 B) for prevention of NASH. to enhance phosphorylation of insulin receptor (IR), insulin receptor substrate-1 (IRS1), and janus kinase 2 (JAK2) along 5.9. Linum usitatissimum (Linseed/Flaxseed). Linum usitatis- with activation of serine/threonine-specific protein kinase simum (LU; family: Linaceae) is considered to be the richest (Akt) and extracellular signal-regulated kinases (ERK1/2) dietary source of 𝛼-lipoic acid, phytoestrogen, lignans, and pathways. Simultaneously, it also prevents overstimulation soluble fiber that are documented as lipid-lowering agents. of signal transducer and activator of transcription-3 (STAT- It has been shown to improve insulin resistance in diabetic 3) and suppressor of cytokine signaling 3 (SOCS-3). It rats [116]andhumans[117]. Additionally, flaxseed lignan also enhanced insulin and leptin signal transduction by andfiberhavebeenshowntolowercirculatinglevelsof promoting peroxisome proliferator-activated receptor alpha cholesterol and reduce risk of liver related diseases in hyper- (PPAR-𝛼) expression and subsequently reduced very low cholesterolemic patients [118, 119]. Its beneficial role against Evidence-Based Complementary and Alternative Medicine 7 experimentally induced NASH was scrutinized by Yang et enzyme, and phosphatidic acid phosphohydrolase were not al., 2009, using HFD-fed hyperlipidemia of hamsters as an altered significantly. Hence, it was concluded that the benefi- experimental model [120]. Liver weight, hepatic cholesterol, cial effects imparted by OLE is due to its potent antioxidant and triacylglycerol were significantly lowered by feeding potential. HFD-fed hamsters on LU (0.2%) supplementation for 6 weeks. Additionally, serum lipids, markers of liver damage 5.12. Phyllanthus urinaria (Chamber Bitter). Phyllanthus uri- (AST and ALT), and indices of hepatic lipid peroxidation naria (PU; family: Euphorbiaceae) is widely distributed in were significantly decreased along with an improvement in China, South India, and South America and used as a reduced glutathione (GSH). Moreover, mRNA expression traditional medicine for the treatment of several human ail- levels of hepatic matrix metalloproteinases-9 (MMP-9) were ments [129]. Recently, its antidiabetic potential was reported reduced, but hepatic MMP-2 was unaltered following LU by Garg Munish, 2012 [132]. In a detailed study by Shen treatment in NASH mice. et al., 2008, molecular mechanism for its protective role against NASH was also reported. Dietary supplementation 5.10. Nelumbo nucifera (Lotus). The leaf, rhizome, seed, and of PU (1000 ppm) for 10 days ameliorated MCD diet- flower of Nelumbo nucifera (family: Nymphaeaceae) are inducedNASHinC57BL/6anddb/dbmice.Thiseffect traditionally used for the treatment of respiratory, hepatic, was associated with decreased levels of hepatic lipid perox- digestive, and reproductive diseases [121]. Preclinical studies ides, cytochrome P450-2E1 (CYP2E1), TNF-𝛼, interleukin- have reported that various extracts/fractions of lotus are 6 (IL-6), CCAAT/enhancer binding protein (C/EBP) and effective in ameliorating HFD-induced obesity and in vitro activation of c-Jun N-terminal kinase (JNK), and nuclear adipocyte differentiation [122–124]. Its potential in control- factor kappa B (NF-kB) along with increased expression ling NASH was reported by Tsuruta et al., 2012, wherein 5% of cytochrome P450 (Cyp4a10), Authors concluded that of lotus root mixed with HFD (fed for 6 weeks) significantly PU reduces TG overload by promoting CYP4A10-catalyzed minimized HFD-induced increment in plasma markers of lipid peroxidation and by suppressing lipogenic regulator hepatic injury and hepatic steatosis in db/db mice [125]. C/EBP. On the other hand, PU also lowers oxidative stress Furthermore, influence of lotus powder on mRNA expression directly and via blocking CYP2E1-mediated lipid peroxida- of lipogenic and inflammatory genes was also evaluated tion and reduces subsequent inflammatory changes along wherein it was found to inhibit hepatic steatosis by decreasing with reduced expression of TNF-𝛼 and IL-6 and by down- expression of lipogenic (acetyl coA carboxylase-1 and FAS) regulation of JNK and NF-kB pathways [133]. and proinflammatory genes in liver (c-reactive protein, MCP- 1, and TNF-𝛼). From this study it was hypothesized that 5.13. Picrorhiza kurroa Royle (Kutki). Picrorhiza kurroa (PK; polyphenols might be the active ingredients that account for family: Scrophulariaceae) is a small perennial herb found the said result. In another study by same research group, in the Himalayan region growing at an elevation of 3000– efficacy of lotus polyphenols in controlling NASH was put 5000 meters. It is a well-known herb in the Ayurvedic to a scrutiny wherein the beneficial effects were attributed to system of medicine and has been used to treat fever, dys- catechin and gallocatechin present in lotus extract [126]. pepsia, chronic diarrhea, scorpion sting, and other liver and respiratory disorders [134]. Laboratory studies have 5.11. Olea europaea (Olive). Olea europaea L. (family: demonstrated its ameliorative potential against diabetes [135], Oleaceae) is a small tree native to tropical and temperate diabetic nephropathy [136], hyperlipidemia [137], and insulin regions of the world. It is distributed in the coastal areas resistance [138]. Shetty et al., 2010, evaluated the protective of the eastern Mediterranean Basin, adjoining coastal areas role of PK rhizome extract against HFD induced NASH in of southeastern Europe, western Asia, and Northern Africa rats [139]. Oral administration of PK at 200 or 400 mg/kg for till the south end of the Caspian Sea [127]. Consumption 4 weeks significantly minimized hepatic lipid accumulation. ofMediterraneandietrichinoliveoilhasbeenshownto Further, hepatic vacuolation and inflammatory infiltration have a beneficial influence on conditions like metabolic syn- were minimized by PK supplementation. These sets of obser- drome (MetS), obesity, and diabetes mellitus [128]. Dietary vations are preliminary but encouraging enough to evaluate supplementation with 3% olive leaf extract (OLE) for 8 possible molecular mechanism responsible for the observed weeks was reported to have beneficial effects against adverse effects. cardiovascular, hepatic, and metabolic changes induced by a high-carbohydrate, high-fat (HCHF) diet in rats [129]. 5.14. Platycodon grandiflorum (Balloon Flower). Platycodon Notably, OLE fed groups had negligible lipid accumulation, grandiflorum (PG; family: Campanulaceae) is a perennial inflammatory cell infiltration, and fibrosis. Beneficial roleof plant found in East Asian countries and is widely used in OLE against NASH has been reported, but its underlying traditional herbal medicine as an expectorant for pulmonary mechanism(s) has (have) not been scrutinized [130]. Omagari disease and other respiratory disorders [140]. Root extract et al., 2010, had reported on the beneficial role of OLE of PG has been shown to regulate HFD induced obesity (1000 or 2000 mg/kg) improving hepatic histopathological and insulin resistance in fa/fa Zucker rats. The observed features and reducing expressions of thioredoxin-1 and 4- effects were attributed to improved glucose transporter type- hydroxynonenal (4-HNE) in the liver of NASH mice. [131]. 4 (GLUT-4) translocation in PG treated rats [141]. Noh et al., Interestingly, activity levels of hepatic CPT-1, FAS, malic 2010, found that the whole extract (500 mg/kg body weight) 8 Evidence-Based Complementary and Alternative Medicine and its saponin fraction (50 mg/kg body weight) significantly 5.17.SidarhomboideaRoxb(Mahabala).Sidarhomboidea reduced body weight gain, plasma leptin titer, and hepatic Roxb (SR; family: Malvaceae) is a shrubby weed found lipidaccumulationinHFDinducedNASHinC57BL/6Jmice. growing throughout India. In Ayurveda, it is known as Further, PG treatment also improved microvesicular hepatic “Mahabala” and has been used as a home remedy against steatosis. Interestingly, mRNA expressions of the SREBP1c obesity and diabetes by local populace and tribes in parts of and stearoyl-CoA desaturase (SCD1) gene were suppressed in North-Eastern India [153]. Our studies have demonstrated the T-PG and S-PG groups. Authors opined that PG regulates that SR aqueous extract is potent in controlling experimen- NASH by modulating liver FAS and CPT activities in HFD- tally induced hyperlipidemia and hypercholesterolemia [153], fed C57BL/6 mice [142]. insulin resistance [153], obesity [154], and atherosclerosis [155]. Based on its protective role against various facets of metabolic diseases, we evaluated its beneficial role against 5.15.PunicagranatumL.(Pomegranate).Punicagranatum HFD induced NASH in C57BL/6J mice [156]. Supplemen- L., (PG; family: Punicaceae) trees are cultivated through- tation of HFD fed mice with SR extract (1% and 3% for out the Mediterranean region, Himalayas, Southeast Asia, 16 weeks) prevented high fat diet-induced elevated plasma California, and Arizona for their use in several systems of markers of liver damage (AST and ALT), plasma and hepatic medicines [143]. Although, all aerial parts of pomegranate are lipids, and mitochondrial oxidative stress and improved useful as therapeutants, pomegranate flower (PGF) has been status of enzymatic and nonenzymatic antioxidants. In oleic prescribed in Unani and Ayurvedic medicines for the treat- acid treated HepG2 cells, addition of SR extract minimized ment of diabetes [144]. Beneficial role of PGF in controlling oleic acid induced lipid accumulation, lipid peroxidation, experimental hyperlipidmia, insulin resistance, and diabetes and cytotoxicity and improved overall cell viability. These hasbeenverywelldocumented[145–149]. Its potent PPAR in vivo and in vitro studies suggest that SR extract has a 𝛼/𝛾 activating property [148] makes it ideal candidate for potential in preventing HFD induced NASH mainly due to its possible therapy of insulin resistance-induced NASH. PGF- hypolipidemic and antioxidant properties. However, further treatment (500 mg/kg for 6 weeks) to ZDF rats has shown studies are required to identify bioactive principles present in to reduce liver weight and hepatic lipid content. In parallel, SR and their molecular mechanisms in manifesting the said these effects were accompanied by enhanced hepatic gene effects. expression of PPAR-𝛼, CPT-1, acyl-CoA oxidase (ACO), and reduced SCD-1. Interestingly, PGF showed minimal effects 5.18. Silybum marianum (Milk Thistle). Milk thistle (family: on expression of genes responsible for synthesis, hydrolysis, Compositae) is an annual or biennial tree native to the or uptake of fatty acid and triglycerides. In HepG2 cells, Mediterranean but now widespread throughout the world. PGF treatment upregulated PPAR-𝛼 and ACO mRNA levels. Perhapsitisthemostwidelystudiedandusedherbal The authors concluded that PGF ameliorates diabetes and medicine for the treatment of various hepatic ailments. obesity-associated fatty liver, at least in part by activating hep- Recently, Haddad et al., 2011 [157], examined the thera- atic expression of genes responsible for fatty acid oxidation peutic effect of silibinin in an experimental rat model of [150]. NASH. Treatment with silibinin improved liver steatosis and inflammation and decreased lipid peroxidation, plasma 5.16. Salacia oblonga (Salacia). Historically, the Salacia plant insulin, and TNF-𝛼. Additionally, silibinin decreased the hasbeenusedintraditionalAyurvedicsystemofIndian release of free radicals and restored relative liver weights medicine to treat diabetes. Further, extracts of Salacia are andGSHlevels.Theauthorsconcludedthatacomplexwith consumed as food supplements in Japan for the treatment of phosphatidyl-choline is effective in reversing inflammation, diabetes and obesity. Experimental studies have reported that oxidative stress, steatosis, and insulin resistance in an in vivo the extract of Salacia oblonga (SO; family: Hippocrateaceae) rat model of diet-induced NASH. In a study by Serviddio et improves experimental and clinical symptoms of diabetes al., 2010 [158], the efficacy of silybin-phospholipid complex [151]. Hsun-Wei Huang et al., 2006, [152] had demonstrated (SILIPHOS) on liver redox balance and mitochondrial func- the beneficial role of SO in experimentally induced NASH. tion in a dietary model of NASH were evaluated. SILIPHOS Administration of SO (100 mg/kg for 6 weeks) extract had treatment reduced glutathione depletion and mitochondrial no effect on plasma triglyceride and cholesterol levels in hydrogen peroxide production, preserved mitochondrial fasted ZDF rats but inhibited olive oil-induced hyperlipi- bioenergetics, and prevented mitochondrial proton leakage demia in ZDF rats. Additionally, treatment with SO upreg- and ATP reduction. Further, it suppressed formation of 4- ulated expression of hepatic PPAR𝛼, CPT-1, and ACO in HNE and malondialdehyde- (MDA-) protein adducts in the ZDF rats. Furthermore, SO extract and its main compo- liver. SILIPHOS mediated alterations in mitochondrial mem- nent, mangiferin, activated mRNA expressions PPAR-𝛼 and brane fatty acid composition and was claimed as possible lipoprotein lipase in human embryonic kidney 293 cells and mode of action. THP-1 differentiated macrophages, respectively. Collectively, both in vivo and in vitro studies suggested that SO extract 5.19. Teucrium polium (Golden Germander). Teucrium functions as a PPAR-𝛼 activator and regulates postprandial polium (TP; family: Lamiaceae) has been reported for its hyperlipidemia and subsequent hepatic steatosis in diabetes beneficial role in controlling diabetes and hyperlipidemia and obesity [152]. in experimental models. Ethyl acetate extract has been Evidence-Based Complementary and Alternative Medicine 9 reported to ameliorate MCD diet-induced NASH in albino of structural analogues of naturally occurring compounds is rats [159, 160]. In another report, ethyl acetate extract of TP thefocusofmoderndayresearchandhasledtodiscovery has been reported to minimize NAFLD by blocking excessive of more efficient compounds than their parental ones. The oxidation, JNK activation, and stimulation of ERK1/2 [161]. presently available phytochemicals for treatment of NASH But TP extract has also been reported to be hepatotoxic by are listed in Table 3.Onlyfewofthemsuchascurcumin, some research groups. In a case report by Starakis et al., quercetin,silymarin,andEGCGhavebeenscreenedindepth 2006, it was documented that a 70-year-old man who had through preclinical and clinical studies. consumed 1-2 L of golden germander tea daily for 1 month developed acute hepatitis. However, in this case, autoimmune hepatitis could not be ruled out [162]. In another report, two 7. Polyherbal Formulations for NASH women who took unspecified amounts of golden germander Traditional medicinal systems such as Ayurveda, Japanese tea for 2-3 months developed severe jaundice [163]. It was Kampo medicine, and Traditional Chinese medicine have surmised that TP contains an alkaloid that is responsible reported on the therapeutic role of polyherbal formulations for hepatotoxicity and hence, its clinical usage is at present in treating hepatic ailments including NASH. The available a big concern. Since, animal research strongly suggests that polyherbal therapy for NASH mainly includes Kampo and appropriate extracts could be safe and effective for patients Chinese medicinal formulations. Not many Ayurvedic for- with NAFLD, a detailed investigation is warranted to resolve mulations have been put for a scrutiny in the treatment this issue. of NASH. Table 4 enlists the currently available polyherbal formulations that have been shown to be effective in ame- 5.20. Zingiber officinale (Ginger). Zingiber officinale Roscoe liorating NASH in experimental animals or NASH/NAFLD (family: Zingiberaceae) is a well-known food spice which has patients. Interestingly, many polyherbal formulations are also been used traditionally in a wide variety of ailments already available in the market for curing NASH and they are [164]. Various pharmacological studies have reported the widely accepted as an alternative therapy. Major hurdle in the beneficial role of ginger against diabetes, hyperlipidemia, and use of polyherbal formulations for clinical trial is their effec- obesity [165–171]. Studies from our laboratory had reported tive standardization. It is highly recommended that only after on the underlying mechanisms of ginger in regulating hepatic proper chemical standardization they should be evaluated for cholesterol and lipid metabolism in high fat diet-fed rats clinical trials. Recent advances in standardization techniques [172, 173]. In this study, hypercholesterolemia was mainly are expected to expand currently existing list of polyherbal regulated via increased protein expression of hepatic low- formulations used for treating NASH. density lipoprotein (LDL) receptor and reduced HMG-CoA reductase. Recently, we had reported attenuation of HFD 8. Toxicological Aspect of the Herbal Medicine induced hepatic inflammation by ginger extract via inhibition of NF-kB [174]. Gao et al., 2012, reported that alcoholic extract The major hindrance in the use of herbal medicine for of ginger (50 mg/kg) significantly minimized dyslipidemia therapeutic purpose is lack of profound data on their safety, and hepatic lipid accumulation in fructose-induced NASH because majority of the ancient systems of medicine believe [175]. Furthermore, ginger extract decreased expression of that herbal drugs are always devoid of any side effects. carbohydrate response element-binding protein (ChREBP) Further, United States Food and Drug Administration act and nuclear ChREBP protein expression without altering does not classify herbal drugs as a medicine and hence expression of PPAR-𝛾 and SREBP1c. In parallel, ACC, FAS, their safety profile need not be reported. Although many SCD, and G6Pase were significantly decreased by ginger herbal drugs are devoid of side effects, there have been cases extract treatment. It was concluded that ethanolic extract of related to acute/chronic toxicity. Owing to these reasons, ginger ameliorates fructose-induced fatty liver and hyper- determination of toxicity dosage of any herbal preparation triglyceridemia in rats which involves modulation of the through preclinical acute and subchronic toxicity evaluations hepatic ChREBP-mediated pathway [175]. becomes necessary.

6. Phytochemicals and NASH 9. Conclusions and Future Prospects Use of plant extract/decoction and polyherbal formulation Nonalcoholic hepatic steatosis (NASH) is difficult to diagnose represents traditional system of medicine, whereas isolation due to its asymptomatic nature and hence, even after a decade of active principle and their use for therapy represent mod- of research and clinical trials, no single pharmaceutical ern pharmacological system. Most of the western countries intervention has been proven to be effective. Therapeutic accept single characterized compound over uncharacterized strategies such as treatment with fibrates and TZDs coupled plant extract and polyherbal formulations.Recent advances with optimizing body weight and controlling risk factors in the field of medicinal chemistry have led to isolation have met with limited success. Natural products of herbal and characterization of active principle from whole plant origin have been extensively reported to prevent hepatic lipid extract preparations. Numerous phytochemicals have now accumulation without exhibiting major side effects. Hence, been screened for various human ailments and few of them assessing the merits of these herbals in treatment of NASH are already available in the market. In addition, synthesis remains a major area of research. In many instances, bioactive 10 Evidence-Based Complementary and Alternative Medicine ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 60 59 39 49 50 52 56 58 64 46 47 48 51 55 57 61 63 54 45 53 62 [ [ [ [ [ [ [ 𝛼 Bp65andiNOS [ 𝜅 and down-regulation of SREBP 𝛼 proteinexpressionintheliver [ 𝛼 Decreasing oxidative stressDecreasing hyperlipidemia and oxidative stress [ [ Inhibition of PTP1B and subsequently improvementinsulin of and leptin sensitivity Reducing hepatic inflammation, insulin resistanceoxidative stress and Down-regulating hepatic SREBP-1cActivating hepatic SIRT1-AMPK signalingInhibition of hepatic lipid accumulation [ [ Regulation of Wnt10b- and FGFR1-mediated signaling cascade transcriptional regulation of liver X [ receptor Attenuation of multiple pro-fibrotic and pro-inflammatory gene pathways Suppression of hepatic stellate cell activationBy anti-oxidant, anti-inflammatory, and anti-apoptotic mechanisms [ Up-regulation of PPAR expressions MCD diet fed C57BL/6J mice Fasting and feeding cycle in rats nSREBP-1c transgenic mice HFD fed C57BL/6J mice HFD fed C57BL/6N mice HFD fed C57BL/6J mice HFD fed ratsHFD fed C57BL/6N mice HFD fed C57BL/6J mice MCD diet fed C57BL/6J mice Increasing PPAR MCD diet fed Long-Evans Tokushima Fatty rats MCD + HFD fed C57BL/6J mice Table 3: Phytochemicals for the treatment of nonalcoholic steatohepatitis. g/kg MCD diet fed rats Inhibition of stellate cell activation [ M 𝜇 𝜇 30–60 mg/kg HFD fed gerbils Regulating the expressions of Sirt1, NF- 50 mg/kg 25 10 mg/kg 15, 30 or 60 mg/kg Fructose-fed rats 0.05 or 0.1% in diet 5 1 g% in diet1 g/L in drinking water MCD diet fed rats0.003, 0.006, and 0.012% in diet Inhibition of hepatic NF-kB activation50 mg/kg 100 mg/kg [ HFD fed rats Activation of hepatic AMPK [ )-Epigallocatechin − PhytochemicalBaicalin5-Caffeoylquinic acid, 3.5-dicaffeoylquinic acid and 5-feruloylquinic acid Carvacrol DoseCurcumin 80 mg/kg( -3-gallate 0.1 g% in diet AnimalLycopene modelMyricetin HFD fed ratsNaringenin Oleuropein Mode of actionPiperine 4 mg/kg Targeting the hepatic AMPK 75, 150 or 300 mg/kgQuercetin HFDResveratrol fed rats 0.05% in diet HFD fedRutin ratsSilymarinTheaflavin Improvement [ of insulin resistance and oxidative stress References 1.6 g/kg in diet 0.5% in diet mg/kg 30 [ HFD fed rats Decreasing oxidative stress and inflammation [ MCD: methionine-choline deficient; HFD: high fat diet. Evidence-Based Complementary and Alternative Medicine 11 ] ] ] ] ] ] ] ] 71 68 69 70 67 65 66 68 [ [ [ Modulation of AMPK signaling pathway Regulation of oxidative stress, inflammation, and fibrogenesis By reducing oxidative stress NAFLD patients Not defined [ HFD fed white rabbits Not defined [ HFD fed rats HFD fed C57BL/6J mice HFD fed rats Not defined [ HFD fed white rabbits Not defined [ NAFLD patients Not defined [ HFD fed rats for the management of nonalcoholic steatohepatitis. , , , , , , Radix Ficus , and ., and Radix , and Cordyceps , Coptis japonica Poria cocos Paeonia lactiflora , , , Radix Gentiana Polygonum Fructus Crataegus , L, Radix Codonopsis Pilosula and Fructus Silybi Massa Fermentata , Rhizoma atractylodis Radix Isati-dis , , , Radix Paeoniae lactiflora Citrus aurantium , Radix Salvia Miltiorrhizae Rheum palmatum L and Fructus schisandrae chinensis , , Entada pursaetha, Radix Angelica Sinensis , and , and Rhizoma Alisma Ori-rhizome Paeonia suffruticosa Andrews , Gardenia jasminoides Ellis, , Prunus persica Batsch , Radix Astragalus membranaceus and , Table 4: Polyherbal therapeutic approaches available Macrophylla Rhizoma Dioscorea, Radix Re-hmannia Medicina-lis Curcuma Phellodendron amurense Ruprecht Gynostemma pentaphyllammak Rhizoma Polygonatum Radix Glycyrrhiza Salviae Miltiorrhiza Makino Herba Swertiae Rheum rhabarbarum Semen persicae Cinnamomum cassia Blume Pallas Wolf, Nigella sativa Scutellaria baicalensis Georgi Rhizoma alismatis macrocephalae Crataegus pinnatifida Herba Artemisia glomerata Alba sachalinense, Pollen pini, NameDangfei Liganning Capsules Danning Tablet Fuzheng Huayu recipe (FZHY) Keishibukuryogan (KBG, TJ-25), CompositionLiv-Pro-08 Orengedokuto (OGT, TJ-15) Ping-tang Recipe Qianggan Capsule Model Mode of action Reference 12 Evidence-Based Complementary and Alternative Medicine ] ] ] ] ] ] ] ] ] 72 73 77 68 78 75 76 79 74 [ [ Regulation of Free fatty acid oxidation Reduced fatty acid oxidation HFD fed rats NAFLD patients Not defined [ NASH patients Not defined [ HFD fed white rabbits Not defined [ HFD fed C57BL/6J mice Not definedHFD fed rats [ HFD fed rats Not defined [ NASH patients Not defined [ Table 4: Continued. , , , , Salvia , , Radix Radix , , and Citrus Rhizoma Alisma , , Gardenia Fructus and l-carnitine HFD fed C57BL/6J mice Not defined [ and , and Rhizoma Polygoni Gardenia Pinellia rhizome , , isoflavone and , Herba Hedyotis Radix Glycyrrhizae Curcuma longa Panax ginseng C.A. Fructus Ziziphi Glycyrrhiza glabra , , Semen Persicae Eucommia ulmoides Rheum L, and and , DC, Polygonum sachalinense and and Crataegus tourn Radix Scutellariae Radix Paeoniae , , , Glycine max Camellia sinensis, Raphanus sativus, Scutellaria baicalensis Georgi , , , , Hypericum japonicum Thunb Radix Codonopsis Pilosulae , Rhizoma Polygoni Cuspidati , , Glycyrrhiza uralensis Fischer, ,Cassiatora, , triviale Rheum rhabarbarum miltiorrhiza Cuspidati Rhizoma Curcumae Longae, jasminoides Ellis Peonia albaflora tangerina jasminoides Ellis, Aurantii Immaturus, Artemisia capillaries Thunb Radix Bupleuri Jujubae Morindae Officinalis, Vitis vinifera BupleurumfalcatumLinne Radix Bupleuri Bupleurum chinense Artemisia capillaries Thunb Panax pseudoginseng Polygonati rhizome, Glycyrrhizae Praeparata Diffusae Breitenbach Zizyphus rhizome Miller Pinelliae Meyer Zingiber officinale Roscoe Vitis vinifera L-carnitine NameQushi Huayu Decoction QuYuHuaTanTongLuo Decoction CompositionRGTC RISC Shosaikoto (SST, TJ-9) Sinai San decoction Tiaozhi Yanggan Decoction ModelYinchenhao Decoction Yojyohenshiko(YHK) Mode of action Reference Evidence-Based Complementary and Alternative Medicine 13

compounds of medicinal herbals are not fully characterized [15] Y. Takahashi, Y. Soejima, and T. Fukusato, “Animal models of and hence, it is imperative to identify new plant extracts nonalcoholic fatty liver disease/ nonalcoholic steatohepatitis,” and develop medium-to-high throughput screening assays World Journal of Gastroenterology,vol.18,no.19,pp.2300–2308, for isolation and characterization of bioactive compounds. 2012. [16] M. Ninomiya, Y. Kondo, and T. Shimosegawa, “Murine models of nonalcoholic fatty liver disease and steatohepatitis,” ISRN Conflict of Interests Hepatology, vol. 2013, Article ID 237870, 7 pages, 2013. [17] K. Nakajima, “Multidisciplinary pharmacotherapeutic options The authors declare that there is no conflict of interests for nonalcoholic fatty liver disease,” International Journal of regarding the publication of this paper. Hepatology, vol. 2012, Article ID 950693, 13 pages, 2012. [18] N. C. Chavez-Tapia, F. I. Tellez-Avila, T. Barrientos-Gutierrez, References N. Mendez-Sanchez, J. Lizardi-Cervera, and M. Uribe, “Bariatric surgery for non-alcoholic steatohepatitis in obese [1]N.Chalasani,Z.Younossi,J.E.Lavineetal.,“Thediagnosis patients,” Cochrane Database of Systematic Reviews,no.1, and management of non-alcoholic fatty liver disease: Practice Article ID CD007340, 2010. Guideline by the American Association for the Study of Liver [19] R. N. Jadeja, M. C. Thounaojam, D. S. Dandekar, R. V. Devkar, Diseases, American College of Gastroenterology, and the Amer- and A. V. Ramachandran, “Clerodendron glandulosum.Coleb ican Gastroenterological Association,” Hepatology,vol.55,no.6, extract ameliorates high fat diet/fatty acid induced lipotoxicity pp. 2005–2023, 2012. in experimental models of non-alcoholic steatohepatitis,” Food [2] P. Paschos and K. Paletas, “Non alcoholic fatty liver disease and and Chemical Toxicology, vol. 48, no. 12, pp. 3424–3431, 2010. metabolic syndrome,” Hippokratia,vol.13,no.1,pp.9–19,2009. [20]C.JayaandC.V.Anuradha,“Cissusquadrangularisstem [3]J.Ludwig,T.R.Viggiano,D.B.McGill,andB.J.Ott,“Nonalco- alleviates insulin resistance, oxidative injury and fatty liver holic steatohepatitis. Mayo Clinic experiences with a hitherto disease in rats fed high fat plus fructose diet,” Food and Chemical unnamed disease,” Mayo Clinic Proceedings,vol.55,no.7,pp. Toxicology,vol.48,no.8-9,pp.2021–2029,2010. 434–438, 1980. [21] Z.-J. Xu, J.-G. Fan, X.-D. Ding, L. Qiao, and G.-L. Wang, “Char- acterization of high-fat, diet-induced, non-alcoholic steatohep- [4] M. D. Beaton, “Current treatment options for nonalcoholic atitis with fibrosis in rats,” Digestive Diseases and Sciences,vol. fatty liver disease and nonalcoholic steatohepatitis,” Canadian 55,no.4,pp.931–940,2010. Journal of Gastroenterology,vol.26,no.6,pp.353–357,2012. [22] H. S. Oz, T. S. Chen, and M. Neuman, “Methionine deficiency [5] M. Durazzo, P.Belci, A. Collo, E. Grisoglio, and S. Bo, “Focus on and hepatic injury in a dietary steatohepatitis model,” Digestive therapeutic strategies of nonalcoholic fatty liver disease,” Inter- Diseases and Sciences,vol.53,no.3,pp.767–776,2008. national Journal of Hepatology,vol.2012,ArticleID464706,9 [23] Z. Li, S. Yang, H. Lin et al., “Probiotics and antibodies to TNF pages, 2012. inhibit inflammatory activity and improve nonalcoholic fatty [6]B.LamandZ.M.Younossi,“Review:treatmentoptionsfor liver disease,” Hepatology,vol.37,no.2,pp.343–350,2003. nonalcoholic fatty liver disease,” Therapeutic Advances in Gas- [24] C. Z. Larter and M. M. Yeh, “Animal models of NASH: troenterology,vol.3,no.2,pp.121–137,2010. getting both pathology and metabolic context right,” Journal of [7]M.MouzakiandJ.Allard,“Non-alcoholicsteatohepatitis:the Gastroenterology and Hepatology,vol.23,no.11,pp.1635–1648, therapeutic challenge of a global epidemic,” Annals of Gastroen- 2008. terology,vol.25,no.3,pp.207–217,2012. [25]H.Nakayama,S.Otabe,T.Uenoetal.,“Transgenicmice [8] M. C. Thounaojam, R. N. Jadeja, R. V. Devkar, and A. V. expressing nuclear sterol regulatory element-binding protein 1c Ramachandran, “Non-alcoholic steatohepatitis: an overview in adipose tissue exhibit liver histology similar to nonalcoholic including treatments with herbals as alternative therapeutics,” steatohepatitis,” Metabolism, vol. 56, no. 4, pp. 470–475, 2007. Journal of Applied Biomedicine, vol. 10, no. 3, pp. 119–136, 2012. [26] K. Okumura, K. Ikejima, K. Kon et al., “Exacerbation of dietary [9] B. A. Neuschwander-Tetri and S. H. Caldwell, “Nonalcoholic steatohepatitis and fibrosis in obese, diabetic KK-Ay mice,” steatohepatitis: summary of an AASLD Single Topic Confer- Hepatology Research,vol.36,no.3,pp.217–228,2006. ence,” Hepatology,vol.37,no.5,pp.1202–1219,2003. [27] Y. Horie, A. Suzuki, E. Kataoka et al., “Hepatocyte-specific [10] K. Nakajima, “Multidisciplinary pharmacotherapeutic options Pten deficiency results in steatohepatitis and hepatocellular for nonalcoholic fatty liver disease,” International Journal of carcinomas,” Journal of Clinical Investigation,vol.113,no.12,pp. Hepatology, vol. 2012, Article ID 950693, 13 pages, 2012. 1774–1783, 2004. [28] P. Nagarajan, M. Jerald Mahesh Kumar, R. Venkatesan, S. S. [11] C. P. Day and O. F. W. James, “Steatohepatitis: a tale of two Majundar, and R. C. Juyal, “Genetically modified mouse models “Hits”,” Gastroenterology,vol.114,no.4I,pp.842–845,1998. for the study of nonalcoholic fatty liver disease,” World Journal [12] H.Cortez-Pinto,M.C.deMoura,andC.P.Day,“Non-alcoholic of Gastroenterology, vol. 18, no. 11, pp. 1141–1153, 2012. steatohepatitis: from cell biology to clinical practice,” Journal of [29] S. C. Lu, L. Alvarez, Z.-Z. Huang et al., “Methionine adenosyl- Hepatology,vol.44,no.1,pp.197–208,2006. transferase 1A knockout mice are predisposed to liver injury [13] H. Tilg and A. R. Moschen, “Evolution of inflammation and exhibit increased expression of genes involved in prolifer- in nonalcoholic fatty liver disease: the multiple parallel hits ation,” Proceedings of the National Academy of Sciences of the hypothesis,” Hepatology,vol.52,no.5,pp.1836–1846,2010. United States of America, vol. 98, no. 10, pp. 5560–5565, 2001. [14] M. Bongiovanni and F. Tordato, “Steatohepatitis in HIV- [30] T.Asano,K.Watanabe,N.Kubotaetal.,“Adiponectinknockout infected subjects: pathogenesis, clinical impact and implications mice on high fat diet develop fibrosing steatohepatitis,” Journal in clinical management,” Current HIV Research,vol.5,no.5,pp. of Gastroenterology and Hepatology,vol.24,no.10,pp.1669– 490–498, 2007. 1676, 2009. 14 Evidence-Based Complementary and Alternative Medicine

[31] S. Wueest, R. A. Rapold, D. M. Schumann et al., “Deletion [47] E. Kim, Y. Choi, J. Jang, and T. Park, “Carvacrol protects of Fas in adipocytes relieves adipose tissue inflammation and against hepatic steatosis in mice fed a high-fat diet by enhancing hepatic manifestations of obesity in mice,” Journal of Clinical SIRT1-AMPK signaling,” Evidence-Based Complementary and Investigation,vol.120,no.1,pp.191–202,2010. Alternative Medicine,vol.2013,ArticleID290104,10pages,2013. [32] N. Ouchi, A. Higuchi, K. Ohashi et al., “Sfrp5 is an anti- [48] I. A. Leclercq, G. C. Farrell, C. Sempoux, A. D. Pena,˜ and Y. inflammatory adipokine that modulates metabolic dysfunction Horsmans, “Curcumin inhibits NF-𝜅B activation and reduces in obesity,” Science,vol.329,no.5990,pp.454–457,2010. the severity of experimental steatohepatitis in mice,” Journal of [33]C.P.M.S.deOliveira,V.M.R.deLima,F.I.Simplicioet Hepatology,vol.41,no.6,pp.926–934,2004. al.,“Preventionandreversionofnonalcoholicsteatohepatitisin [49] F. Vizzutti, A. Provenzano, S. Galastri et al., “Curcumin limits OB/OB mice by S-nitroso-N-acetylcysteine treatment,” Journal the fibrogenic evolution of experimental steatohepatitis,” Labo- of the American College of Nutrition,vol.27,no.2,pp.299–305, ratory Investigation,vol.90,no.1,pp.104–115,2010. 2008. [50] J. M. Li, Y. C. Li, L. D. Kong, and Q. H. Hu, “Curcumin [34] M. E. Rinella, M. S. Elias, R. R. Smolak, T. Fu, J. Borensztajn, inhibits hepatic protein-tyrosine phosphatase 1B and prevents and R. M. Green, “Mechanisms of hepatic steatosis in mice fed hypertriglyceridemia and hepatic steatosis in fructose-fed rats,” a lipogenic methionine choline-deficient diet,” Journal of Lipid Hepatology,vol.51,no.5,pp.1555–1566,2010. Research,vol.49,no.5,pp.1068–1076,2008. [51]M.Bose,J.D.Lambert,J.Ju,K.R.Reuhl,S.A.Shapses,andC. [35] M. Carmiel-Haggai, A. I. Cederbaum, and N. Nieto, “Ahigh-fat S. Yang, “The major green tea polyphenol, (-)-epigallocatechin- diet leads to the progression of non-alcoholic fatty liver disease 3-gallate, inhibits obesity, metabolic syndrome, and fatty liver in obese rats,” FASEB Journal,vol.19,no.1,pp.136–138,2005. disease in high-fat-fed mice,” Journal of Nutrition,vol.138,no. [36] J. M. Schattenberg, Y. Wang, R. Singh, R. M. Rigoli, and M. J. 9,pp.1677–1683,2008. Czaja, “Hepatocyte CYP2E1 overexpression and steatohepatitis [52] T. Ueno, T. Torimura, T. Nakamura et al., “Epigallocatechin- lead to impaired hepatic insulin signaling,” Journal of Biological 3-gallate improves nonalcoholic steatohepatitis model mice Chemistry,vol.280,no.11,pp.9887–9894,2005. expressing nuclear sterol regulatory element binding protein-1c [37]F.T.Wunderlich,T.Luedde,S.Singeretal.,“HepaticNF- 𝜅 in adipose tissue,” International Journal of Molecular Medicine, B essential modulator deficiency prevents obesity-induced vol.24,no.1,pp.17–22,2009. insulin resistance but synergizes with high-fat feeding in tumorigenesis,” Proceedings of the National Academy of Sciences [53] I. H. Bahcecioglu, N. Kuzu, K. Metin et al., “Lycopene prevents of the United States of America,vol.105,no.4,pp.1297–1302, development of steatohepatitis in experimental nonalcoholic 2008. steatohepatitis model induced by high-fat diet,” Veterinary Medicine International,vol.2010,ArticleID262179,8pages, [38] J.-H. Fu, H.-S. Sun, Y. Wang, W.-Q. Zheng, Z.-Y. Shi, and Q.-J. 2010. Wang, “The effects of a fat- and sugar-enriched diet and chronic stress on nonalcoholic fatty liver disease in male wistar rats,” [54] C. J. Chang, T.-F. Tzeng, S.-S. Liou, Y.-S. Chang, and I.- Digestive Diseases and Sciences, vol. 55, no. 8, pp. 2227–2236, M. Liu, “Myricetin increases hepatic peroxisome proliferator- 2010. activated receptor protein expression and decreases plasma lipids and adiposity in rats,” Evidence-Based Complementary [39] L. Bujanda, E. Hijona, M. Larzabal et al., “Resveratrol inhibits and Alternative Medicine, vol. 2012, Article ID 787152, 11 pages, nonalcoholic fatty liver disease in rats,” BMC Gastroenterology, 2012. vol. 8, article 40, 2008. [40]N.RafiqandZ.M.Younossi,“Effectsofweightlosson [55] K. W. Cho, Y. O. Kim, J. E. Andrade, J. R. Burgess, and Y.-C. Kim, “Dietary naringenin increases hepatic peroxi- nonalcoholic fatty liver disease,” Seminars in Liver Disease,vol. 𝛼 28, no. 4, pp. 427–433, 2008. some proliferators-activated receptor proteinexpressionand decreases plasma triglyceride and adiposity in rats,” European [41] S. A. Al-Busafi, P. Wong, P. Ghali, and M. Deschenes, “Antioxi- Journal of Nutrition, vol. 50, no. 2, pp. 81–88, 2011. dant therapy in nonalcoholic steatohepatitis,” Hepatitis Research and Treatment, vol. 2012, Article ID 947575, 8 pages, 2012. [56]S.Park,Y.Choi,S.-J.Um,S.K.Yoon,andT.Park,“Oleuropein [42] A. Duseja, “Therapy of nonalcoholic steatohepatitis (NASH)— attenuates hepatic steatosis induced by high-fat diet in mice,” antioxidants and cytoprotective agents,” Tropical Gastroenterol- Journal of Hepatology,vol.54,no.5,pp.984–993,2011. ogy, vol. 32, supplement 1, pp. S33–S37, 2011. [57] H. Jwa, Y. Choi, U.-H. Park, S.-J. Um, S. K. Yoon, and T. 𝛼 [43] L. L. Stein, M. H. Dong, and R. Loomba, “Insulin sensitizers Park,“Piperine,anLXR antagonist, protects against hepatic in nonalcoholic fatty liver disease and steatohepatitis: current steatosis and improves insulin signaling in mice fed a high-fat status,” Advances in Therapy,vol.26,no.10,pp.893–907,2009. diet,” Biochemical Pharmacology,vol.84,no.11,pp.1501–1510, 2012. [44] W. Nseir, J. Mograbi, and M. Ghali, “Lipid-lowering agents in nonalcoholic fatty liver disease and steatohepatitis: human [58] E. Marcolin, B. San-Miguel, D. Vallejo et al., “Quercetin studies,” Digestive Diseases and Sciences,vol.57,no.7,pp.1773– treatment ameliorates inflammation and fibrosis in mice with 1781, 2012. nonalcoholic steatohepatitis,” Journal of Nutrition,vol.142,no. [45] H.-X. Guo, D.-H. Liu, Y. Ma et al., “Long-term baicalin admin- 10, pp. 1821–1828, 2012. istration ameliorates metabolic disorders and hepatic steatosis [59] E.´ Marcolin, L. F. Forgiarini, G. Rodrigues et al., “Quercetin in rats given a high-fat diet,” Acta Pharmacologica Sinica,vol. decreases liver damage in mice with non-alcoholic steatohep- 30,no.11,pp.1505–1512,2009. atitis,” Basic and Clinical Pharmacology and Toxicology,vol.112, [46] T. Murase, K. Misawa, Y. Minegishi et al., “Coffee polyphe- no. 6, pp. 385–391, 2013. nols suppress diet-induced body fat accumulation by down- [60] H.-Z. Ying, Y.-H. Liu, B. Yu, Z.-Y. Wang, J.-N. Zang, and C.-H. regulating SREBP-1c and related molecules in C57BL/6J Yu, “Dietary quercetin ameliorates nonalcoholic steatohepatitis mice,” TheAmericanJournalofPhysiology—Endocrinologyand induced by a high-fat diet in gerbils,” Food and Chemical Metabolism,vol.300,no.1,pp.E122–E133,2011. Toxicology,vol.52,pp.53–60,2013. Evidence-Based Complementary and Alternative Medicine 15

[61] J. Shang, L.-L. Chen, F.-X. Xiao, H. Sun, H.-C. Ding, and H. soy isoflavone and l-carnitine: implications in cardiovascular Xiao, “Resveratrol improves non-alcoholic fatty liver disease by and non-alcoholic fatty liver diseases,” Food and Chemical activating AMP-activated protein kinase,” Acta Pharmacologica Toxicology,vol.49,no.9,pp.2453–2458,2011. Sinica, vol. 29, no. 6, pp. 698–706, 2008. [76] Q. Zhang, Y. Zhao, D.-B. Zhang, and L.-J. Sun, “Effect of [62] S. K. Panchal, H. Poudyal, T. V. Arumugam, and L. Brown, Sinai San decoction on the development of non-alcoholic “Rutin attenuates metabolic changes, nonalcoholic steatohep- steatohepatitis in rats,” World Journal of Gastroenterology,vol. atitis, and cardiovascular remodeling in high-carbohydrate, 11, no. 9, pp. 1392–1395, 2005. high-fat diet-fed rats,” Journal of Nutrition,vol.141,no.6,pp. 1062–1069, 2011. [77] C.-L. Gu, Y.-K. Zhang, Y.-X. Fu, S.-F. Yang, and X.-Q. Li, “Effect of Tiaozhi Yanggan Decoction in treating patients with non- [63]M.Kim,S.-G.Yang,J.M.Kim,J.-W.Lee,Y.S.Kim,andJ.I. alcoholic fatty liver,” Chinese Journal of Integrative Medicine,vol. Lee, “Silymarin suppresses hepatic stellate cell activation in a 13, no. 4, pp. 275–279, 2007. dietary rat model of non-alcoholic steatohepatitis: analysis of isolated hepatic stellate cells,” International Journal of Molecular [78]S.-D.Chen,Y.Fan,andW.-J.Xu,“EffectsofYinchenhao Medicine,vol.30,no.3,pp.473–479,2012. Decoction for non-alcoholic steatohepatitis in rats and study of [64] X.-Y. Luo, T. Takahara, J. Hou et al., “Theaflavin attenuates the mechanism,” Journal of Traditional Chinese Medicine,vol.31, ischemia-reperfusion injury in a mouse fatty liver model,” no.3,pp.220–223,2011. Biochemical and Biophysical Research Communications,vol.417, [79] N. Chande, M. Laidlaw, P. Adams, and P. Marotta, “Yo Jyo no. 1, pp. 287–293, 2012. Hen Shi Ko (YHK) improves transaminases in nonalcoholic [65] H.-Y. Song, Z.-M. Mao, L.-L. Yang et al., “Dangfei liganning steatohepatitis (NASH): a randomized pilot study,” Digestive capsules attenuate the susceptibility of rat nonalcoholic fatty Diseases and Sciences,vol.51,no.7,pp.1183–1189,2006. liver to carbon tetrachloride toxicity,” Journal of Traditional [80] I. Vermaak, A. M. Viljoen, and J. H. Hamman, “Natural Chinese Medicine, vol. 31, no. 4, pp. 327–333, 2011. products in anti-obesity therapy,” Natural Product Reports,vol. [66] G. Ji, J.-G. Fan, J.-J. Chen et al., “Effectiveness of Danning 28,no.9,pp.1493–1533,2011. Tablet in patients with non-alcoholic fatty liver of damp-heat [81] T.-P. Liu, C.-S. Lee, S.-S. Liou, I.-M. Liu, and J.-T. Cheng, syndrome type: a multicenter randomized controlled trial,” “Improvement of insulin resistance by Acanthopanax sentico- ZhongXiYiJieHeXueBao,vol.6,no.2,pp.128–133,2008. sus root in fructose-rich chow-fed rats,” Clinical and Experimen- [67] Y.-H. Jia, R.-Q. Wang, H.-M. Mi et al., “Fuzheng Huayu recipe tal Pharmacology and Physiology,vol.32,no.8,pp.649–654, prevents nutritional fibrosing steatohepatitis in mice,” Lipids in 2005. Health and Disease, vol. 11, article 45, 2012. [82] J. Fu, J. Fu, J. Yuan et al., “Anti-diabetic activities of Acan- [68] M. Fujimoto, K. Tsuneyama, M. Kainuma et al., “Evidence- thopanax senticosus polysaccharide (ASP) in combination with based efficacy of kampo formulas in a model of non alcoholic metformin,” International Journal of Biological Macromolecules, fatty liver,” Experimental Biology and Medicine,vol.233,no.3, vol.50,no.3,pp.619–623,2012. pp. 328–337, 2008. [69] M. Suriyavathana Vedanarayanan and N. Krishnan, “Ayurvedic [83] Y.-S. Cha, S.-J. Rhee, and Y.-R. Heo, “Acanthopanax senticosus formulation of Liv-Pro-08 reduces nonalcoholic fatty liver extract prepared from cultured cells decreases adiposity and disease in rats fed with high-fat diet,” Journal of Acupuncture obesity indices in C57BL/6J mice fed a high fat diet,” Journal and Meridian Studies,vol.4,no.4,pp.236–241,2011. of Medicinal Food,vol.7,no.4,pp.422–429,2004. [70] S.-Y. Yang, N.-J. Zhao, X.-J. Li, H.-J. Zhang, K.-J. Chen, and [84]S.H.Park,S.G.Lee,S.K.Kang,andS.H.Chung,“Acan- C.-D. Li, “Ping-tang recipe improves insulin resistance and thopanax senticosus reverses fatty liver disease and hyper- attenuates hepatic steatosis in high-fat diet-induced obese rats,” glycemia in ob/ob mice,” Archives of Pharmacal Research,vol. Chinese Journal of Integrative Medicine,vol.18,no.4,pp.262– 29,no.9,pp.768–776,2006. 268, 2012. [85]X.Hong,H.Tang,L.Wu,andA.Li,“Protectiveeffectsofthe [71] L. Li, X.-J. Zhang, Y. Lan, L. Xu, X.-Z. Zhang, and H.-H. Wang, Alisma orientalis extract on the experimental nonalcoholic fatty “Treatment of non-alcoholic fatty liver disease by Qianggan liver disease,” Journal of Pharmacy and Pharmacology,vol.58, capsule,” Chinese Journal of Integrative Medicine,vol.16,no.1, no. 10, pp. 1391–1398, 2006. pp. 23–27, 2010. [86] X. B. Yang and Z. M. Huang, “Effects of rhizome alismatis [72] H.-S. Li, Q. Feng, L.-L. Xu, S.-D. Chen, X.-M. Li, and Y.- extract on blood glucose in normal and diabetes,” Pharmacology Y.Hu,“EffectsofQushiHuayuDecoctioninpreventionand and Clinics of Chinese Materia Medica,vol.14,pp.19–23,2004. treatment of fatty liver in rats based on adiponection-free fatty acid pathway,” Zhong Xi Yi Jie He Xue Bao,vol.7,no.6,pp.546– [87] X.-B. Yang, Z.-M. Huang, W.-B. Cao et al., “Effects of rhizome 551, 2009. alismatis extract on blood biochemical indices and insulin in hyperglycemic mice,” Chinese Journal of Clinical Rehabilitation, [73] H. Zhang, Q. Feng, H.-S. Li et al., “Effects of Qushi Huayu vol. 8, no. 6, pp. 1196–1197, 2004. Decoction on cathepsin B and tumor necrosis factor-𝛼 expression in rats with non-alcoholic steatohepatitis,” ZhongXiYiJie [88] R. S. Bruno, C. E. Dugan, J. A. Smyth, D. A. DiNatale, and S. I. He Xue Bao,vol.6,no.9,pp.928–933,2008. Koo, “Green tea extract protects leptin-deficient, spontaneously [74]J.S.Kang,W.K.Lee,W.K.Yoonetal.,“Acombinationofgrape obese mice from hepatic steatosis and injury,” Journal of extract, green tea extract and l -carnitine improves high-fat diet- Nutrition,vol.138,no.2,pp.323–331,2008. induced obesity, hyperlipidemia and non-alcoholic fatty liver [89] N. Kuzu, I. H. Bahcecioglu, A. F. Dagli, I. H. Ozercan, B. disease in mice,” Phytotherapy Research,vol.25,no.12,pp.1789– Ustundag,¨ and K. Sahin, “Epigallocatechin gallate attenuates 1795, 2011. experimental non-alcoholic steatohepatitis induced by high fat [75]J.S.Kang,W.K.Lee,C.W.Leeetal.,“Improvementofhigh- diet,” Journal of Gastroenterology and Hepatology,vol.23,no.8, fat diet-induced obesity by a mixture of red grape extract, pp. e465–e470, 2008. 16 Evidence-Based Complementary and Alternative Medicine

[90] K. Nakamoto, F. Takayama, M. Mankura et al., “Beneficial [105] L. Alappat and A. B. Awad, “Curcumin and obesity: evidence effects of fermented green tea extract in a rat model of non- and mechanisms,” Nutrition Reviews,vol.68,no.12,pp.729– alcoholic steatohepatitis,” Journal of Clinical Biochemistry and 738, 2010. Nutrition, vol. 44, no. 3, pp. 239–246, 2009. [106] R. Kaffashi Elahi, “Preventive effects of turmeric (Curcuma [91] A. H. M. Viswanatha Swamy, R. V. Kulkarni, A. H. M. longa Linn.) powder on hepatic steatosis in the rats fed with Thippeswamy, B. C. Koti, and A. Gore, “Evaluation of hep- high fat diet,” Life Science Journal,vol.9,no.4,pp.5462–5468, atoprotective activity of Cissus quadrangularis stem extract 2012. against isoniazid-induced liver damage in rats,” Indian Journal [107] W.-F. Yiu, P.-L. Kwan, C.-Y. Wong et al., “Attenuation of fatty of Pharmacology,vol.42,no.6,pp.397–400,2010. liver and prevention of hypercholesterolemia by extract of [92] M. K. Sen and B. K. Dash, “Areview on phytochemical and phar- Curcuma longa through regulating the expression of CYP7A1, macological aspects of Cissus quadrangularis L,” International LDL-receptor, HO-1, and HMG-CoA reductase,” Journal of Journal of Green Pharmacy,vol.6,no.3,pp.169–173,2012. Food Science, vol. 76, no. 3, pp. H80–H89, 2011. [93] J. Chidambaram and A. Carani Venkatraman, “Cissus quadran- [108] A. Asai and T. Miyazawa, “Dietary curcuminoids prevent high- gularis stem alleviates insulin resistance, oxidative injury and fat diet-induced lipid accumulation in rat liver and epididymal fatty liver disease in rats fed high fat plus fructose diet,” Food adipose tissue,” Journal of Nutrition,vol.131,no.11,pp.2932– and Chemical Toxicology,vol.48,no.8-9,pp.2021–2029,2010. 2935, 2001. [94] J. Chidambaram, V. Vetriselvi, and A. Carani Venkatraman, [109]I.A.Leclercq,G.C.Farrell,C.Sempoux,A.D.Pena,˜ and Y. “Inflammatory responses in liver induced by high fat plus Horsmans, “Curcumin inhibits NF-𝜅B activation and reduces fructose diet: therapeutic potential of cissus quadrangularis the severity of experimental steatohepatitis in mice,” Journal of stem,” International Journal Of Biological and Medical Research, Hepatology,vol.41,no.6,pp.926–934,2004. vol. 1, no. 4, pp. 120–124, 2010. [110] J. Oh, O.-J. Min, H.-A. Kim, Y. J. Kim, H. Y. Baek, and D. Y. [95]R.N.Jadeja,M.C.Thounaojam,T.B.Singh,R.V.Devkar, Rhyu, “Effect of Eriobotrya japonica on adipogenesis and body and A. Ramachandran, “Traditional uses, phytochemistry and weight,” Journal of Applied Biological Chemistry,vol.54,no.3, pharmacology of Clerodendron glandulosum Coleb—a review,” pp. 382–387, 2011. Asian Pacific Journal of Tropical Medicine,vol.5,no.1,pp.1–6, 2012. [111] K. Tanaka, S. Nishizono, N. Makino, S. Tamaru, O. Terai, and I. Ikeda, “Hypoglycemic activity of Eriobotrya japonica seeds [96] C. P. Kala, “Ethnomedicinal botany of the Apatani in the in type 2 diabetic rats and mice,” Bioscience, Biotechnology and Eastern Himalayan region of India,” Journal of Ethnobiology and Biochemistry,vol.72,no.3,pp.686–693,2008. Ethnomedicine,vol.1,article11,2005. [112] M. Singh, C. K. Jain, and A. Mathur, “Phyto-pharmacological [97] S. Deb, A. Arunachalam, and A. K. Das, “Indigenous knowledge potential of Ginkgo biloba: a review,” Journal of Pharmacy of Nyishi tribes on traditional agroforestry systems,” Indian Research,vol.5,no.10,pp.5028–5030,2012. Journal of Traditional Knowledge,vol.8,no.1,pp.41–46,2009. [113] T. R. Cong W, J. Tian, J. Zhao, Q. Liu, and F. Ye, “EGb761, an [98] J. Purkayastha, S. C. Nath, and M. Islam, “Ethnobotany of extract of Ginkgo biloba leaves, reduces insulin resistance in a medicinal plants from Dibru-Saikhowa Biosphere Reserve of high-fat-fed mouse model,” Acta Pharmaceutica Sinica,vol.1, Northeast India,” Fitoterapia,vol.76,no.1,pp.121–127,2005. no. 1, pp. 14–20, 2011. [99]R.N.Jadeja,M.C.Thounaojam,R.V.Devkar,andA.V. Ramachandran, “A preliminary study on hypolipidemic effect [114]J.Xia,X.Zhang,X.Ye,J.Liu,L.Wang,andY.Zhong, of aqueous leaf extract of Clerodendron glandulosum.Coleb,” “Intervention study of Ginkgo biloba extract in rat model of International Journal of Green Pharmacy,vol.3,no.4,pp.285– lipid-induced insulin resistance,” Journal of Medicinal Plant 289, 2009. Research,vol.5,no.27,pp.6284–6290,2011. [100] R. N. Jadeja, M. C. Thounaojam, R. V. Devkar, and A. V. [115] S. D. Wang, Z. Q. Xie, J. Chen et al., “Inhibitory effect of Ramachandran, “Clerodendron glandulosum Coleb., Verbe- ginkgo biloba extract on fatty liver: regulation of carnitine naceae, ameliorates high fat diet-induced alteration in lipid and palmitoyltransferase 1a and fatty acid metabolism,” Journal of cholesterol metabolism in rats,” Brazilian Journal of Pharmacog- Digestive Diseases,vol.13,no.10,pp.525–535,2012. nosy,vol.20,no.1,pp.117–123,2010. [116] M. F. Elshal and K. O. Abulnaja, “Influence of defatted flaxseed [101] R. N. Jadeja, M. C. Thounaojam, V. B. Patel, R. V. Devkar, diet on insulin sensitivity, vascular permeability and lipid profile and A. V. Ramachandran, “Protective effect of Clerodendron in a rat model of type 2 diabetes mellitus,” Journal of Medicinal glandulosum extract against experimentally induced metabolic Plants Research,vol.6,no.11,pp.2188–2193,2012. syndrome in rats,” Pharmaceutical Biology,vol.48,no.12,pp. [117] Y. Rhee and A. Brunt, “Flaxseed supplementation improved 1312–1319, 2010. insulin resistance in obese glucose intolerant people: a random- [102] R.N.Jadeja,M.C.Thounaojam,U.V.Ramani,R.V.Devkar,and ized crossover design,” Nutrition Journal,vol.10,no.1,article44, A. V. Ramachandran, “Anti-obesity potential of Clerodendron 2011. glandulosum.Coleb leaf aqueous extract,” Journal of Ethnophar- [118] S. Fukumitsu, K. Aida, H. Shimizu, and K. Toyoda, “Flaxseed macology,vol.135,no.2,pp.338–343,2011. lignan lowers blood cholesterol and decreases liver disease [103] R. N. Jadeja, M. C. Thounaojam, S. V.Jadav et al., “Toxicological risk factors in moderately hypercholesterolemic men,” Nutrition evaluation and hepatoprotective potential of Clerodendron Research,vol.30,no.7,pp.441–446,2010. glandulosum.Coleb leaf extract,” Human and Experimental [119]M.Kristensen,M.G.Jensen,J.Aarestrupetal.,“Flaxseed Toxicology,vol.30,no.1,pp.63–70,2011. dietary fibers lower cholesterol and increase fecal fat excretion, [104] “Curcuma longa (turmeric). Monograph,” Alternative Medicine but magnitude of effect depend on food type,” Nutrition & Review,vol.6,supplement,pp.S62–S66,2001. Metabolism,vol.9,article8,2012. Evidence-Based Complementary and Alternative Medicine 17

[120] S.-F. Yang, J.-K. Tseng, Y.-Y. Chang, and Y.-C. Chen, “Flaxseed [136] H.-S. Lee and S.-K. Ku, “Effect of Picrorrhiza rhizoma extracts oil attenuates nonalcoholic fatty liver of hyperlipidemic ham- on early diabetic nephropathy in streptozotocin-induced dia- sters,” Journal of Agricultural and Food Chemistry,vol.57,no.11, betic rats,” Journal of Medicinal Food,vol.11,no.2,pp.294–301, pp. 5078–5083, 2009. 2008. [121]P.K.Mukherjee,D.Mukherjee,A.K.Maji,S.Rai,andM.Hein- [137] H. S. Lee, C. B. Yoo, and S. K. Ku, “Hypolipemic effect of water rich, “The sacred lotus (Nelumbo nucifera)—phytochemical extracts of Picrorrhiza kurroa in high fat diet treated mouse,” and therapeutic profile,” Journal of Pharmacy and Pharmacol- Fitoterapia,vol.77,no.7-8,pp.579–584,2006. ogy,vol.61,no.4,pp.407–422,2009. [138] G. M. Husain, P. N. Singh, and V. Kumar, “Antidiabetic activity [122]B.Xie,J.Wan,W.Q.Wang,C.Y.Shi,X.L.Hou,andJ.G. of standardized extract of Picrorhiza kurroa in rat model of Fang, “Nelumbo nucifera alkaloid inhibits 3T3-L1 preadipocyte NIDDM,” Drug Discoveries & Therapeutics,vol.3,no.3,pp.88– differentiation and improves high-fat diet-induced obesity and 92, 2009. body fat accumulation in rats,” Journal of Medicinal Plants [139]S.N.Shetty,S.Mengi,R.Vaidya,andA.D.B.Vaidya,“A Research,vol.5,no.10,pp.2021–2028,2011. study of standardized extracts of Picrorhiza kurroa Royle ex [123]Y.Ono,E.Hattori,Y.Fukaya,S.Imai,andY.Ohizumi,“Anti- Benth in experimental nonalcoholic fatty liver disease,” Journal obesity effect of Nelumbo nucifera leaves extract in mice and of Ayurveda and Integrative Medicine,vol.1,no.3,pp.203–210, rats,” Journal of Ethnopharmacology,vol.106,no.2,pp.238–244, 2010. 2006. [140] L.-K. Han, B.-J. Xu, Y. Kimura, Y.-N. Zheng, and H. Okuda, [124] C.-H. Wu, M.-Y. Yang, K.-C. Chan, P.-J. Chung, T.-T. Ou, and “Platycodi radix affects lipid metabolism in mice with high fat C.-J. Wang, “Improvement in high-fat diet-induced obesity and diet-induced obesity,” Journal of Nutrition,vol.130,no.11,pp. body fat accumulation by a nelumbo nucifera leaf flavonoid- 2760–2764, 2000. rich extract in mice,” JournalofAgriculturalandFoodChem- [141] K.-S. Kim, E.-K. Seo, Y.-C. Lee et al., “Effect of dietary Platy- istry, vol. 58, no. 11, pp. 7075–7081, 2010. codon grandiflorum on the improvement of insulin resistance [125]Y.Tsuruta,K.Nagao,B.Shirouchietal.,“Effectsoflotusroot in obese Zucker rats,” JournalofNutritionalBiochemistry,vol. (the edible rhizome of nelumbo nucifera) on the deveolopment 11, no. 9, pp. 420–424, 2000. of non-alcoholic fatty liver disease in obese diabetic db/db [142] J.-R. Noh, Y.-H. Kim, G.-T. Gang et al., “Preventative effects mice,” Bioscience, Biotechnology and Biochemistry,vol.76,no. of Platycodon grandiflorum treatment on hepatic steatosis in 3, pp. 462–466, 2012. high fat diet-fed C57BL/6 mice,” Biological and Pharmaceutical [126] Y. Tsuruta, K. Nagao, S. Kai et al., “Polyphenolic extract of lotus Bulletin,vol.33,no.3,pp.450–454,2010. root (edible rhizome of Nelumbo nucifera) alleviates hepatic [143] J. Jurenka, “Therapeutic applications of pomegranate (Punica steatosis in obese diabetic db/db mice,” Lipids in Health and granatum L.): a review,” Alternative Medicine Review,vol.13,no. Disease,vol.10,article202,2011. 2, pp. 128–144, 2008. [127] R. Ghanbari, F. Anwar, K. M. Alkharfy, A.-H. Gilani, and N. [144]J.Wang,X.Rong,I.S.I.Um,J.Yamahara,andY.Li,“55- Saari, “Valuable nutrients and functional bioactives in different week treatment of mice with the Unani and Ayurvedic medicine parts of olive (Olea europaea L.)—a review,” International pomegranate flower ameliorates ageing-associated insulin resis- Journal of Molecular Sciences,vol.13,no.3,pp.1291–1340,2012. tance and skin abnormalities,” Evidence-Based Complementary [128] P. Perez-Mart´ ´ınez, A. Garc´ıa-R´ıos, J. Delgado-Lista, F. Perez-´ and Alternative Medicine, vol. 2012, Article ID 350125, 8 pages, Jimenez,´ and J. Lopez-Miranda,´ “Mediterranean diet rich in 2012. olive oil and obesity, metabolic syndrome and diabetes melli- [145] M. A. Jafri, M. Aslam, K. Javed, and S. Singh, “Effect of Punica tus,” Current Pharmaceutical Design,vol.17,no.8,pp.769–777, granatum Linn. (flowers) on blood glucose level in normal and 2011. alloxan-induced diabetic rats,” Journal of Ethnopharmacology, [129] S.-T. Huang, J.-H. S. Pang, and R.-C. Yang, “Anti-cancer effects vol.70,no.3,pp.309–314,2000. of Phyllanthus urinaria and relevant mechanisms,” Chang Gung [146] T. H. W. Huang, G. Peng, B. P. Kota et al., “Anti-diabetic action Medical Journal,vol.33,no.5,pp.477–487,2010. of Punica granatum flower extract: activation of PPAR-𝛾 and [130] H. Poudyal, F. Campbell, and L. Brown, “Olive leaf extract identification of an active component,” Toxicology and Applied attenuates cardiac, hepatic, and metabolic changes in high Pharmacology,vol.207,no.2,pp.160–169,2005. carbohydrate-, high fat-fed rats,” Journal of Nutrition,vol.140, [147]T.H.-W.Huang,G.Peng,B.P.Kotaetal.,“Pomegranateflower no. 5, pp. 946–953, 2010. improves cardiac lipid metabolism in a diabetic rat model: role [131] K. Omagari, S. Kato, K. Tsuneyama et al., “Olive leaf extract pre- of lowering circulating lipids,” British Journal of Pharmacology, vents spontaneous occurrence of non-alcoholic steatohepatitis vol. 145, no. 6, pp. 767–774, 2005. in SHR/NDmcr-cp rats,” Pathology,vol.42,no.1,pp.66–72, [148] Y. Li, S. Wen, B. P. Kota et al., “Punica granatum flower 2010. extract, a potent 𝛼-glucosidase inhibitor, improves postpran- [132] G. C. Garg Munish, “Effect of phyllanthus urinaria in biochem- dial hyperglycemia in Zucker diabetic fatty rats,” Journal of ical profile of experimental hyperglycemic albino rats,” Research Ethnopharmacology, vol. 99, no. 2, pp. 239–244, 2005. Journal of Pharmaceutical Sciences,vol.1,no.1,pp.2–6,2012. [149]P.Bagri,M.Ali,V.Aeri,M.Bhowmik,andS.Sultana, [133] B. Shen, J. Yu, S. Wang et al., “Phyllanthus urinaria ameliorates “Antidiabetic effect of Punica granatum flowers: effect on the severity of nutritional steatohepatitis both in vitro and in hyperlipidemia, pancreatic cells lipid peroxidation and antiox- vivo,” Hepatology,vol.47,no.2,pp.473–483,2008. idant enzymes in experimental diabetes,” Food and Chemical [134] “Picrorhiza kurroa. Monograph,” Alternative Medicine Review, Toxicology,vol.47,no.1,pp.50–54,2009. vol. 6, no. 3, pp. 319–321, 2001. [150] K. Z.-Y. Xu, C. Zhu, M. S. Kim, J. Yamahara, and Y. Li, [135] K. L. Joy and R. Kuttan, “Anti-diabetic activity of Picrorrhiza “Pomegranate flower ameliorates fatty liver in an animal model kurroa extract,” Journal of Ethnopharmacology,vol.67,no.2,pp. of type 2 diabetes and obesity,” Journal of Ethnopharmacology, 143–148, 1999. vol. 123, no. 2, pp. 280–287, 2009. 18 Evidence-Based Complementary and Alternative Medicine

[151] Y. Li, G. Peng, Q. Li et al., “Salacia oblonga improves car- efficacy profiles,” Phytomedicine,vol.12,no.9,pp.684–701, diac fibrosis and inhibits postprandial hyperglycemia in obese 2005. zucker rats,” Life Sciences,vol.75,no.14,pp.1735–1746,2004. [165] S. P.Akhani, S. L. Vishwakarma, and R. K. Goyal, “Anti-diabetic [152] T. Hsun-Wei Huang, G. Peng, G. Qian Li, J. Yamahara, B. activity of Zingiber officinale in streptozotocin-induced type I D. Roufogalis, and Y. Li, “Salacia oblonga root improves diabetic rats,” Journal of Pharmacy and Pharmacology,vol.56, postprandial hyperlipidemia and hepatic steatosis in Zucker no. 1, pp. 101–105, 2004. 𝛼 diabetic fatty rats: activation of PPAR- ,” Toxicology and Applied [166] V. Sivakumar and S. Sivakumar, “Effect of an indigenous Pharmacology,vol.210,no.3,pp.225–235,2006. herbal compound preparation ’Trikatu’ on the lipid profiles [153] M. C. Thounaojam, R. N. Jadeja, R. V. Devkar, and A. V. of atherogenic diet and standard diet fed Rattus norvegicus,” Ramachandran, “Prevention of high fat diet induced insulin Phytotherapy Research,vol.18,no.12,pp.976–981,2004. resistance in C57BL/6J mice by Sida rhomboidea ROXB. [167]N.Mascolo,R.Jain,S.C.Jain,andF.Capasso,“Ethnopharma- extract,” Journal of Health Science, vol. 56, no. 1, pp. 92–98, 2010. cologic investigation of ginger (Zingiber officinale),” Journal of [154] M. C. Thounaojam, R. N. Jadeja, U. V. Ramani, R. V. Devkar, Ethnopharmacology,vol.27,no.1-2,pp.129–140,1989. and A. V. Ramachandran, “Sida rhomboidea. Roxb leaf extract [168]A.Kar,B.K.Choudhary,andN.G.Bandyopadhyay,“Com- 𝛾 down-regulates expression of PPAR 2 and leptin genes in high parative evaluation of hypoglycaemic activity of some Indian fat diet fed C57BL/6J mice and retards in vitro 3T3L1 pre- medicinal plants in alloxan diabetic rats,” Journal of Ethnophar- adipocyte differentiation,” International Journal of Molecular macology,vol.84,no.1,pp.105–108,2003. Sciences,vol.12,no.7,pp.4661–4677,2011. [169] Z. M. Al-Amin, M. Thomson, K. K. Al-Qattan, R. Peltonen- [155] M. C. Thounaojam, R. N. Jadeja, S. P.Salunke, R. V.Devkar, and Shalaby, and M. Ali, “Anti-diabetic and hypolipidaemic prop- A. V. Ramachandran, “Sida rhomboidea.Roxb aqueous extract erties of ginger (Zingiber officinale) in streptozotocin-induced down-regulates in vivo expression of vascular cell adhesion diabetic rats,” British Journal of Nutrition,vol.96,no.4,pp.660– molecules in atherogenic rats and inhibits in vitro macrophage 666, 2006. differentiation and foam cell formation,” Immunopharmacology [170] R. K. Goyal and S. V. Kadnur, “Beneficial effects of Zingiber and Immunotoxicology,vol.34,no.5,pp.832–843,2012. officinale on goldthioglucose induced obesity,” Fitoterapia,vol. [156] M. C. Thounaojam, R. N. Jadeja, D. S. Dandekar, R. V. Devkar, 77, no. 3, pp. 160–163, 2006. and A. V. Ramachandran, “Sida rhomboidea.Roxb extract alle- [171] L.-K. Han, X.-J. Gong, S. Kawano, M. Saito, Y. Kimura, and viates pathophysiological changes in experimental in vivo and H. Okuda, “Antiobesity actions of Zingiber officinale Roscoe,” in vitro models of high fat diet/fatty acid induced non-alcoholic Yakugaku Zasshi,vol.125,no.2,pp.213–217,2005. steatohepatitis,” Experimental and Toxicologic Pathology,vol.64, no. 3, pp. 217–224, 2012. [172]S.Nammi,S.Sreemantula,andB.D.Roufogalis,“Protective [157]Y.Haddad,D.Vallerand,A.Brault,andP.S.Haddad,“Antiox- effects of ethanolic extract of zingiber officinale rhizome onthe idant and hepatoprotective effects of silibinin in a rat model of development of metabolic syndrome in high-fat diet-fed rats,” nonalcoholic steatohepatitis,” Evidence-based Complementary Basic and Clinical Pharmacology and Toxicology,vol.104,no.5, and Alternative Medicine, vol. 2011, Article ID 647903, 10 pages, pp. 366–373, 2009. 2011. [173]S.Nammi,M.S.Kim,N.S.Gavande,G.Q.Li,andB.D. [158] G. Serviddio, F. Bellanti, A. M. Giudetti et al., “A silybin- Roufogalis, “Regulation of low-density lipoprotein receptor and phospholipid complex prevents mitochondrial dysfunction in 3-hydroxy-3- methylglutaryl coenzyme A reductase expression a rodent model of nonalcoholic steatohepatitis,” Journal of by zingiber officinale in the liver of high-fat diet-fed rats,” Basic Pharmacology and Experimental Therapeutics,vol.332,no.3,pp. and Clinical Pharmacology and Toxicology,vol.106,no.5,pp. 922–932, 2010. 389–395, 2010. [159] R. Amini, N. Nosrati, R. Yazdanparast, and M. Molaei, “Teu- [174] X.-H. Li, K. C.-Y. McGrath, S. Nammi, A. K. Heather, and B. criumpoliuminpreventionofsteatohepatitisinrats,”Liver D. Roufogalis, “Attenuation of liver pro-inflammatory responses International,vol.29,no.8,pp.1216–1221,2009. by zingiber officinale via inhibition of NF-kappa B activation in high-fat diet-fed rats,” Basic and Clinical Pharmacology and [160] R. Amini, R. Yazdanparast, S. Aghazadeh, and S. H. Ghaffari, Toxicology,vol.110,no.3,pp.238–244,2012. “Teucrium polium reversed the MCD diet-induced liver injury in rats,” Human and Experimental Toxicology,vol.30,no.9,pp. [175] H.Gao,T.Guan,C.Lietal.,“Treatmentwithgingerameliorates 1303–1312, 2011. fructose-induced fatty liver and hypertriglyceridemia in rats: modulation of the hepatic carbohydrate response element- [161] S. Aghazadeh and R. Yazdanparast, “Inhibition of JNK along binding protein-mediated pathway,” Evidence-based Comple- with activation of ERK1/2 MAPK pathways improve steatohep- mentary and Alternative Medicine,vol.2012,ArticleID570948, atitis among the rats,” Clinical Nutrition,vol.29,no.3,pp.381– 12 pages, 2012. 385, 2010. [162] I. Starakis, D. Siagris, L. Leonidou, E. Mazokopakis, A. Tsaman- das, and C. Karatza, “Hepatitis caused by the herbal remedy Teucrium polium L,” European Journal of Gastroenterology and Hepatology, vol. 18, no. 6, pp. 681–683, 2006. [163]S.Savvidou,J.Goulis,I.Giavazis,K.Patsiaoura,P.Hytiroglou, and C. Arvanitakis, “Herb-induced hepatitis by Teucrium polium L.: report of two cases and review of the literature,” European Journal of Gastroenterology and Hepatology,vol.19, no. 6, pp. 507–511, 2007. [164]S.Chrubasik,M.H.Pittler,andB.D.Roufogalis,“Zingiberis rhizoma: a comprehensive review on the ginger effect and Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2014, Article ID 718379, 14 pages http://dx.doi.org/10.1155/2014/718379

Research Article Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice

Su Jin Song, Sena Choi, and Taesun Park

Department of Food and Nutrition, Brain Korea 21 PLUS Project, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-749, Republic of Korea

Correspondence should be addressed to Taesun Park; [email protected]

Received 16 December 2013; Accepted 2 March 2014; Published 10 April 2014

Academic Editor: Ravirajsinh Jadeja

Copyright © 2014 Su Jin Song et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study investigated whether decaffeinated green coffee bean extract prevents obesity and improves insulin resistance and elucidated its mechanism of action. Male C57BL/6N mice (𝑁 = 48) were divided into six dietary groups: chow diet, HFD, HFD-supplemented with 0.1%, 0.3%, and 0.9% decaffeinated green coffee bean extract, and 0.15% 5-caffeoylquinic acid. Based on the reduction in HFD-induced body weight gain and increments in plasma lipids, glucose, and insulin levels, the minimum effective dose of green coffee bean extract appears to be 0.3%. Green coffee bean extract resulted in downregulation ofgenes involved in WNT10b- and galanin-mediated adipogenesis and TLR4-mediated proinflammatory pathway and stimulation of GLUT4 translocation to the plasma membrane in white adipose tissue. Taken together, decaffeinated green coffee bean extract appeared to reverse HFD-induced fat accumulation and insulin resistance by downregulating the genes involved in adipogenesis and inflammation in visceral adipose tissue.

1. Introduction include adipocyte lipid binding protein (aP2), cluster of differentiation 36 (CD36), lipoprotein lipase (LPL), and fatty Coffee is one of the most widely consumed beverages in acid synthase (FAS), which together induce lipid accumula- the world, and therefore the potential health consequences tion and metabolism. Thus, inactivation of these adipogenic of coffee consumption are of great public interest. Heavy regulators may be a novel way to suppress adipogenesis and coffee drinking may result in sleep disorders, hypokalemia, ultimately prevent obesity. and cardiac arrhythmias [1–4]. At the same time, several Anothercriticalaspectofadiposetissueisthatitservesas epidemiologic studies have reported that the risk of Parkin- an endocrine organ, releasing biologically active adipokines. son’s disease, Alzheimer’s disease, and certain types of cancer Toll-like receptor (TLR) 2 and TLR4 induce the expression is reduced in regular coffee consumers [5]. In addition, of a large number of proinflammatory target genes. It was coffee has recently received scientific attention as current recently discovered that TLR4 can sense free fatty acids epidemiologic and in vivo studies have revealed its health (FFAs) engaging proinflammatory pathways that lead to benefits against obesity and metabolic disorders, especially secretion of cytokines [16]. Furthermore, several studies have type 2 diabetes [6–10]. These health advantages are mostly demonstrated a causative relationship between inflammation derived from chlorogenic acids contained in coffee beans [11– and insulin resistance [17]. JNK, especially, serves as a main 14]. mediator that leads to insulin resistance by impairing GLUT4 Adipogenesis is a process of mesenchymal precur- translocation. Thus, reducing the FFA level in blood and sor cells differentiating into adipocytes where peroxisome peripheral tissues such as the adipose tissue and muscles proliferator-activated receptor 𝛾2(PPAR𝛾2) and CCAAT/ might result in therapeutic effects against obesity by attenuat- enhancer-binding protein 𝛼 (C/EBP𝛼)arethemastertran- ing not only adipogenesis but also inflammation and insulin scriptional regulators [1, 15]. Downstream targets for PPAR𝛾2 resistance. 2 Evidence-Based Complementary and Alternative Medicine

Raw coffee beans are rich in chlorogenic acids and they were divided into six weight-matched groups (𝑛=8): caffeine, and their contents in coffee beans are significantly the chow diet (CD), high-fat diet (HFD), 0.1%, 0.3%, and decreased during the roasting and decaffeination processes 0.9% green coffee bean extract-supplemented diet (GCD), [18]. Green coffee bean extract used in the present study and 0.15% 5-CQA-supplemented diet (CQD) groups (Sigma, is prepared from decaffeinated and unroasted coffee beans, MO, USA). The HFD was composed of 200 g of fat/kg (170g making it a novel source of chlorogenic acids and eliminating of lard plus 30 g of corn oil) and 1% (w/w) cholesterol. The the possible side effects of caffeine [1–3]. There is no report on GCD was identical to the HFD, except that it included 0.1%, toxicological studies on green coffee bean extract. In a clinical 0.3%, or 0.9% green coffee bean extract. The CQD was also trial, decaffeinated green coffee bean extract induced weight identicaltotheHFDexceptthatitcontained0.15%5-CQA. loss in overweight volunteers, provided with 400 mg/day The diets were given in the form of pellets for eleven weeks. for 60 days [19]. Yet, further investigation on toxic dose Food intake of the mice was recorded daily and their body of green coffee bean extract is required in animal models. weights were measured weekly during the feeding period. Cho et al. revealed that 5-caffeoylquinic acid (CQA), a At the end of the experimental period, the animals were representative chlorogenic acid in green coffee beans, exhibits anesthetized with ether following a 12 h fasting period. Blood antiobesity properties in mice fed a HFD [12]. Another samplesweredrawnfromtheabdominalaortaintoanEDTA- study reported that decaffeinated green coffee bean extract, coated tube, and plasma samples were obtained by centrifu- ∘ delivered through drinking water for 20 weeks, significantly gation at 1,000 ×gfor15minat4C. Visceral fat pads from improved HFD-induced insulin resistance in mice; however, four different regions (epididymal, perirenal, mesenteric, and the dose delivered to mice was not clearly indicated and its retroperitoneal regions) were excised, rinsed with phosphate- ∘ molecular mechanism on improving insulin sensitivity has buffered saline (PBS), and stored at −80 Cuntilanalysis. not been examined [10]. Also, the antiobesity effect of decaf- All animal experiments adhered to the Korean Food and feinated green coffee bean extract has not yet been reported Drug Administration (KFDA) guidelines. The protocols were in HFD-induced obese mice. Therefore, the aims of this study reviewed and approved by the Institutional Animal Care and were to investigate whether decaffeinated green coffee bean Use Committee (IACUC) of the Yonsei Laboratory Animal extract exerts protective effects against visceral obesity and Research Center (YLARC) (Permit no. 2013-0104). All mice insulinresistanceinmicefedaHFDandtoevaluatewhether were maintained in the specific pathogen-free facility of the these effects are derived from 5-CQA. Furthermore, we YLARC. explored the potential molecular mechanisms of the health benefits of decaffeinated green coffee bean extract, focusing 2.3. Histological Analysis. The epididymal fat pads were fixed on the gene expression involved in adipogenesis and insulin in neutral buffered formalin and embedded in paraffin, resistance in white adipose tissue (WAT). sectioned at thicknesses of 5 𝜇m. The tissue sections were stained with hematoxylin and eosin (H&E). 2. Materials and Methods 2.4. Biochemical Analysis. The plasma concentrations of 2.1. Extraction and HPLC Analysis of Decaffeinated Green triglycerides (TG), FFA, total cholesterol (TC), and glucose Coffee Bean Extract. The decaffeinated green coffee bean were measured enzymatically using commercial kits (Bio- extract utilized for this study was provided by Naturex Inc. Clinical System, Gyeonggi-do, Republic of Korea). Plasma (Avignon, France) under the trade name Svetol. Svetol was leptin, adiponectin, interleukin-6 (IL-6), monocyte chemoat- obtained by extracting decaffeinated raw green coffeeCoffea ( tractant protein-1 (MCP-1), and insulin levels were analyzed ∘ canephora robusta) beans with 30% ethanol at 70 Cfor using an ELISA kit (Millipore, MA, USA). The homeostasis 2 h. To determine 5-CQA (IUPAC numbering) content in model assessment of basal insulin resistance (HOMA-IR) decaffeinated green coffee bean extract, HPLC analysis was was used to calculate an index from the product of the performedviaaSupelcoC18column(250× 4.6 mm, 5 𝜇m fasting concentrations of plasma glucose (mmol/L) and ∘ inner diameter) at 40 C with a flow rate of 1.4 mL/min using a insulin (pmol/L) divided by 22.5. Lower HOMA-IR values gradient mobile phase composed of water (A) and acetonitrile indicate greater insulin sensitivity and higher HOMA-IR (B). The mobile phase was 95 : 5 mixture of components Aand values indicate insulin resistance. B as the initial condition of the chromatography; the sample 𝜇 injection volume was 2 L. The absorption spectrum of 5- 2.5. Oral Glucose Tolerance Test. An oral glucose tolerance CQA was monitored at 330 nm using the photodiode array test (OGTT; gavage with 2 g glucose/10 mL per kg body detector. weight) was performed 2 weeks before the end of the treatment on 18 h fasted mice by administering glucose orally. 2.2. Animal Care and Experimental Protocol. Forty-eight Bloodwascollectedfromthetailveinat0,15,30,60,90,and male C57BL/6N mice (Orient, Gyeonggi-do, Republic of 120 min following glucose administration to determine blood Korea) were housed in standard cages and placed in a room glucose. ∘ where the temperature was maintained at 23 ± 1 C, relative humidity at 50 ± 1%, and the light at a 12 h light/dark cycle. 2.6. Semiquantitative Reverse Transcriptase Polymerase Chain During a 1-week acclimatization period, all mice consumed Reaction (RT-PCR). Total RNA was isolated from the epi- a commercial diet and tap water ad libitum.Afterwards, didymal adipose tissue of each mouse with Trizol (Invitrogen, Evidence-Based Complementary and Alternative Medicine 3

CA, USA). Of the total RNA, 4 𝜇Lwasreverse-transcribed DAD1 A, sig =330,4 ref = off 20130722 2013 07 22 17 15 59 201307220000019 to cDNA using the Superscript II kit (Invitrogen) according (chlorogenic acid\ - - - - \ .D) to the manufacturer’s instructions. Table 1 shows the forward (F) and reverse (R) primer sequences. The PCR procedure 800

∘ ∘ acid was designed as follows: 10 min at 94 C, 30–35 cycles at 94 C 600 14.073-

∘ ∘ chlorogenic for 30 s, 55 Cfor30s,72 C for 1 min, and 10 min of incubation ∘ 400 at 72 C. Next, 4 𝜇L of each PCR reaction mixture was mixed Norm. with 1 𝜇L of 6-fold-concentrated loading buffer and then 200 loaded onto a 2% agarose gel containing ethidium bromide. 0 The mRNA levels were normalized to the glyceraldehyde- 0 5 10 15 20 25 30 35 3-phosphate dehydrogenase (GAPDH) mRNA levels, which (min) were used as an internal control. Figure 1: The HPLC chromatogram of decaffeinated green coffee bean extract. The peak was assigned based on the isolation of 5- 2.7. Western Blot Analysis. The epididymal adipose tissues CQA. of each mouse were homogenized in an extraction buffer containing 100 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100, 1 mM phenylmethanesulfonyl fluoride, groups during the 11-week feeding period (Figure 2(b)), and 2 𝜇g/mL aprotinin, 1 𝜇g/mL pepstatin A, and 1 𝜇g/mL leu- the food efficiency ratio (FER) was significantly decreased in peptin. The tissue homogenates were centrifuged at 1,300 ×g mice fed the 0.3GCD when compared with mice fed the HFD ∘ for 20 min at 4 C. The protein concentrations of the tissue (Figure 2(c)). The total visceral fat-pad weight of mice fed the extracts were measured via Bradford assay (Bio-Rad, CA, HFD was reduced when the mice were supplemented with USA). The protein samples were separated by SDS-PAGE 0.3% green coffee bean extract (Figures 2(d) and 2(e)). No and electrophoretically transferred to nitrocellulose mem- further reduction in body weight gain and visceral fat-pad branes (Amersham, Buckinghamshire, UK). The samples weight was noted in the 0.9GCD group. Moreover, 0.3% green were incubated overnight and hybridized with primary anti- coffee bean extract decreased body weight gain and visceral ∘ bodies (diluted 1 : 1,000) at 4 C. Antibodies to the following adiposity as much as 0.15% 5-CQA did. Based on the results proteins were purchased from the indicated sources: 𝛽- above, 0.3% appears to be the minimum effective dose at catenin, 𝛽-actin (Santa Cruz Biotechnology, CA, USA), c-Jun which green coffee bean extract reduces body weight gain and N-terminal kinase (JNK), p-JNK (Tyr183), insulin receptor visceral fat-pad weight. Therefore, the histological analysis substrate (IRS), p-IRS (Ser307), protein kinase B (AKT), p- of epididymal adipose tissue sections by H&E staining was AKT(Thr308),GLUT4,andGAPDH(CellSignalingTech- done with the 0.3GCD group among the green coffee bean nology, MA, USA). The membranes were incubated with the extract supplemented groups. The staining data showed that corresponding secondary antibody. Next, immunoreactive the average adipocyte diameter was significantly smaller in signals were detected via a chemiluminescent detection the 0.3GCD and CQD groups when compared with the HFD system (Amersham, Buckinghamshire, UK) and quantified group (Figures 2(f) and 2(g)). using Quantity One analysis software (Bio-Rad). 3.3. Plasma Biochemistries. Mice fed a 0.3GCD exhibited sig- 2.8. Statistical Analysis. The data on body weight gain, nificantly lower levels of plasma lipids, leptin, and cytokines plasma biochemistries, and adipocyte diameter is expressed and significantly higher levels of adiponectin than those fed as the mean ± SEM of 8 mice. The RT-PCR and Western aHFD(Figure 3). Yet, mice fed a 0.9GCD showed no further data are means from 𝑛=8±SEM of three independent decreases in these plasma measures. The changes in plasma experiments (𝑛=2, 3 per experiment) for each group. Data biomarkers related to obesity and inflammation that occurred were analyzed by one-way analysis of variance (ANOVA), in the 0.3GCD group were similar to those observed with the followed by Duncan’s multiple range tests. 𝑃 values < 0.05 CQD group. were considered statistically significant. 3.4. Glucose Utilization and Insulin Sensitivity. We investi- 3. Results gated whether green coffee bean extract influenced insulin sensitivity. OGTT was performed after 9 weeks of diet 3.1. HPLC Analysis of Decaffeinated Green Coffee Bean Extract. supplementation to determine the effect of green coffee bean The extraction yield of decaffeinated green coffee beans was extractand5-CQAonglucosetoleranceinHFD-fedmice 15%. The HPLC analysis (Figure 1) revealed that decaffeinated (Figure 4(a)). Integrated plasma glucose concentration, as green coffee bean extract (Svetol) contained 16.4% 5-CQA. calculated by the area under the curve (AUC), was significantly reduced in 0.3GCD-fed mice than in HFD-fed mice 3.2. Body and Visceral Fat-Pad Weights. After 11 weeks of (Figure 4(b)). Moreover, 0.3GCD-fed mice demonstrated a experimental feeding, the final body weight gain was dose- similar reduction level in the integrated glucose concen- dependently decreased in the 0.1GCD and 0.3GCD groups tration as CQD-fed mice did. Furthermore, when fasting (Figure 2(a)). Food intake did not differ among experimental plasma glucose and insulin levels were measured at the end 4 Evidence-Based Complementary and Alternative Medicine

Table 1: Primer sequences and PCR conditions.

󸀠 󸀠 ∘ Gene description Primers Sequences (5 -3 ) 𝑇𝑚 ( C) Size (bp) F CTTGGTGTCCTTGCGCTTTA SFRP 5 61 155 R CTGATGGCCTCATGGAACAG F TCATTCCCTGTTCTTCAGCG DKK2 55 144 R GCATTTCCTTCAGATTGGCA F TTTTGGCCACTCCTCTTCCT WNT10b 61 183 R TCCTTTTCCAACCGAAAACC F GAGCCTTGATCCTGCACTGA Galanin 60 121 R AGTGGCTGACAGGGTCACAA F CCAAGGGGGTATCCCAGTAA GalR1 60 147 R GGCCAAACACTACCAGCGTA F ATAGTGGTGCTCATGCTGGAA GalR2 60 134 R AGGCTGGATCGAGGGTTCTA F CTGAGCGCTGCAAGAAGAAC PKC𝛿 60 146 R TGGAAACTTTGATCCTGCACTGA F TGGGAAGTTTTGTTGGGTCA Cyc-D 55 144 R TCCTTGTCCAGGTAATGCCA F TTCGGAATCAGCTCTGTGGA PPAR𝛾2 55 148 R CCATTGGGTCAGCTCTTGTG F AAGGCCAAGAAGTCGGTGGA C/EBP𝛼 55 189 R CCATAGTGGAAGCCTGATGC F TTGCCCGAGTCAGAGAACC FAS 55 171 R CGTCCACAATAGCTTCATAGC F CTCCAAGGTTGTCCAGGGTT Leptin 55 143 R AAAACTCCCCACACAATGGG F ATGACGTGGCAAAGAACAGC CD36 55 160 R GAAGGCTCAAAGATGCCTCC F ACATGAAAGTGGGAGTG aP2 55 128 R AAGTACTCTCTGACCGGATG F TCTAAAGTCGATCCGCGACAT TLR2 55 344 R TACCCAGCTCGCTCACTACGT F ACCTCTGCCTTCACTACAGA TLR4 48.6 223 R AGGGACTTCTCAACCTTCTC F TGTCTCAGCCTCTTCTCATT TNF𝛼 55 156 R AGATGATCTGAGTGTGAGGG F CCAGCAAGATGATCCCAATG MCP1 55 450 R CTTCTTGGGGTCAGCACAGA F ATGGCTAGGCTCTGTGCTTTCCT IFN𝛼 58 638 R GGGCTCTCCAGATTTCTGCTCTG F CCACAGCCCTCTCCATCAACTATAAGC IFN𝛽 56 372 R AGCTCTTCAACTGGAGAGCAGTTGAGG F TTGCCTTCTTGGGACTGATG IL-6 55 162 R CCACGATTTCCCAGAGAACA F AGAACATCATCCCTGCATCC GAPDH 60 321 R TCCACCACCCTGTTGCTGTA SFRP 5: secreted frizzled-related protein 5; DKK2: Dickkopf 2; WNT10b: wingless-type MMTV integration site family, member 10B; GalR1: galanin receptor 1; PKC𝛿:proteinkinaseCdelta;Cyc-D:cyclinD;PPAR𝛾2: peroxisome proliferator-activated receptor gamma; C/EBP𝛼: CCAAT/enhancer-binding protein, alpha; FAS: fatty acid synthase; CD36: fatty acid translocase; aP2: adipocyte protein2; TLR: Toll-like receptor; TNF𝛼: tumor necrosis factor alpha; IFN: interferon; MCP1: monocyte chemoattractant protein 1; IL-6: interleukin-6; GAPDH: gyceraldehyde-3-phosphate dehydrogenase. Evidence-Based Complementary and Alternative Medicine 5

Body weight gain (g/11 wks) 25 a Food intake (g/day) FER 4.4 0.12 b a a b a 18 c c 3.3 b b b b 0.09 c b b b 2.2 0.06 11 c d 1.1 0.03 4 0.0 0.00 CD HFD 0.1 0.3 0.9 CQD CD HFD 0.1 0.3 0.9 CQD CD HFD 0.1 0.3 0.9 CQD GCD GCD GCD (a) (b) (c) CD HFD 0.3GCD CQD 5 Visceral fat weight (g) a ab

4 c bc Epididymal c 3 a a 2 b b b a Perirenal b b d 1 a ab b b c c bc bc a ab c bc abc d c 0 d

Retroperitoneal Total Perirenal Mesenteric Epididymal Retroperitoneal Mesenteric CD 0.9GCD 0.3GCD 0.1GCD HFD CQD (d) (e) 𝜇 CD HFD 0.3GCD CQD 120 Adipocyte diameter ( m) a 100 b 80 b

60 c

40 CD HFD 0.3GCD CQD (f) (g)

Figure 2: Effects of green coffee bean extract and 5-CQA supplementation on body weight gain, food efficiency ratio (FER), and visceral fat-pad weights of mice fed a HFD. Mice were fed the experimental diets for 11 weeks. (a) Body weight gain, (b) food intake, (c) FER, ((d), (e)) visceral fat-pad weights, (f) representative pictures of H&E-stained fat cells from mice epididymal adipose tissue (×100), and (g) densitometric analysis of adipocyte diameter in epididymal tissue. Data represent mean ± SEM, 𝑛=8. Mean values indicated with different letters indicate statistical significance (𝑃 < 0.05). FER = body weight gain for experimental period (g)/food intake for experimental period (g).

of the feeding period, 0.3GCD group exhibited significant were shown in 0.9GCD-fed mice. The effect of 0.3GCD to reductions in plasma glucose and insulin levels in comparison decrease plasma glucose and insulin levels and to improve to the HFD group (Figures 4(c) and 2(d)).Alongwiththe insulin sensitivity was quantitatively similar to that of plasma glucose and insulin levels, the HOMA-IR values CQD. indicated that insulin sensitivity was improved significantly in 0.3GCD group (Figure 4(e)). No further decreases in these 3.5. Expression of Genes Related to Adipogenesis. We explored markers related to glucose utilization and insulin sensitivity the potential mechanisms by which green coffee bean extract 6 Evidence-Based Complementary and Alternative Medicine

Triglyceride (mM) Free fatty acid (mEq/L) 1.4 a 800.0 a a 1.1 b 700.0 b b b b bc c bc 0.8 bc 600.0 0.5 500.0 0.2 400.0 CD HFD 0.1 0.3 0.9 CQD CD HFD 0.1 0.3 0.9 CQD GCD GCD (a) (b)

Total cholesterol (mM) Leptin (ng/mL) 30.0 7.0 a a a b 6.0 b b 24.0 b 5.0 18.0 c c d 12.0 4.0 c e 3.0 6.0 2.0 0.0 CD HFD 0.1 0.3 0.9 CQD CD HFD 0.1 0.3 0.9 CQD GCD GCD (c) (d)

Adiponectin (ng/mL) IL-6 (pg/mL) 22.0 a a 80.0 19.0 b 60.0 c c 16.0 d 40.0 b 13.0 b e b b b 10.0 20.0 7.0 0.0 CD HFD 0.1 0.3 0.9 CQD CD HFD 0.1 0.3 0.9 CQD GCD GCD (e) (f)

MCP-1 (pg/mL) 80.0 a 74.0 a 68.0 b b b 62.0 b 56.0 50.0 CD HFD 0.1 0.3 0.9 CQD GCD (g)

Figure 3: Effects of green coffee bean extract and 5-CQA supplementation on plasma levels of lipids, leptin, adiponectin, and proinflammatory cytokines in mice fed a HFD. (a) TG, (b) FFA, (c) TC, (d) leptin, (e) adiponectin, (f) IL-6, and (g) MCP-1. Bars represent mean ± SEM, 𝑛=8. Mean values indicated with different letters indicate statistical significance (𝑃 < 0.05).

may attenuate HFD-induced adipogenesis in the epididymal by green coffee bean extract supplementationFigure ( 5(b)). adiposetissueof0.3GCD-fedmice.Wefoundthatgreencof- Furthermore, green coffee bean extract significantly reduced fee bean extract decreased the expression of secreted frizzled- mRNA levels of galanin, galanin receptor (GalR) 1, GalR2, receptor protein 5 (SFRP5) and dickkopf 2 (DKK2) and protein kinase C (PKC) 𝛿,andcyclin-D(Figure 5(c)). As increased expression of wingless-type MMTV integration site Figure 5(d) demonstrates, the mRNA levels of adipogenic family 10b (WNT10b) (Figure 5(a)). Western blot analysis transcription factors, PPAR𝛾2andC/EBP𝛼,weresignifi- indicated that 𝛽-catenin levels were significantly elevated cantlydownregulatedinmicefedthegreencoffeebean Evidence-Based Complementary and Alternative Medicine 7

OGTT 33.0 · 29.0 57 AUC (mmol/L h) a 25.0 51 21.0 ab 45 bc 17.0 c bc 39 13.0

Glucose (mmol/L) Glucose d 9.0 33 5.0 27 0 306090120CD HFD 0.1 0.3 0.9 CQD Time (min) GCD

CD HFD 0.1GCD 0.3GCD 0.9GCD CQD (a) (b)

Glucose (mmol/L) Insulin (ng/mL) 30.0 1.5 a a a 25.0 1.2 a b b b b b 0.9 b 20.0 b c 0.6 15.0 0.3 10.0 0.0 CD HFD 0.1 0.3 0.9 CQD CD HFD 0.1 0.3 0.9 CQD GCD GCD (c) (d)

HOMA-IR (mmol/L) 1.5 a a 1.2 0.9 b b b 0.6 c 0.3 0 CD HFD 0.1 0.3 0.9 CQD GCD (e)

Figure 4: Effect of green coffee bean extract and 5-CQA supplementation on glucose utilization and insulin sensitivity in mice fed aHFD. (a) OGTT; (b) AUC; (c) glucose; (d) insulin; (e) HOMA-IR. Bars represent mean ± SEM, 𝑛=8. Mean values indicated with different letters indicate statistical significance (𝑃 < 0.05).

extractcomparedwiththoseinmicefedtheHFD.ThemRNA bean extract in the epididymal adipose tissue of mice main- levels of key adipogenic genes such as FAS, leptin, CD36, tained on the HFD. Gene expression of inflammatory media- and aP2 were significantly decreased in green coffee bean tors such as TLR2 and TLR4 was downregulated in 0.3GCD- extract supplemented groups (Figure 5(d)). Moreover, these fedmicewhencomparedwithHFD-fedmice(Figure 6(a)). significant changes in the expression of adipogenic genes that Furthermore, immunoblot results indicated that JNK phos- occurred in the 0.3GCD group were similar to those observed phorylation in GCD-fed mice occurred significantly less than in the CQD group (Figure 5(d)). in HFD-fed mice (Figure 6(b)). The expression of proinflammatory cytokines, including tumor necrosis factor (TNF) 3.6. Expression of Inflammation-Related Signaling Molecules. 𝛼, MCP-1, interferon (IFN) 𝛼,IFN𝛽,andIL-6,inGCD- We examined the anti-inflammatory effects of green coffee fedmicewassignificantlydownregulatedincomparison 8 Evidence-Based Complementary and Alternative Medicine

CD HFD 0.3GCD CQD SFRP5

DKK2 CD HFD 0.3GCD CQD 𝛽 WNT10b -Catenin

GAPDH GAPDH

3 1.2

2.5 a a a 1.0 2 a b b 0.8 b 1.5 a b c b a 0.6 1 b b a

b -Catenin/GAPDH 𝛽 0.4

Relative gene expression gene Relative 0.5

0 0.2 SFRP5 DKK2 WNT10b CD HFD 0.3GCD CQD

CD 0.3GCD CD 0.3GCD HFD CQD HFD CQD (a) (b)

CD HFD 0.3GCD CQD 4 Galanin a 3.5 a GalR1 3 a 2.5 a GalR2 b b a 2 b b PKC𝛿 b b b 1.5 bcbbbb c b Cyc-D 1 0.5 GAPDH 0 Relative gene expression gene Relative Galanin GalR1 GalR2PKC𝛿 Cyc-D

CD 0.3GCD HFD CQD (c) CQD CD HFD 0.3GCD 4.5 a PPAR𝛾2 4 C/EBP𝛼 3.5 a a a FAS 3 2.5 b a a Leptin 2 b b b b b b CD36 1.5 b b b b c bc b b b b b aP2 1 0.5 GAPDH

Relative gene expression gene Relative 0 PPAR𝛾2 C/EBP𝛼 FAS Leptin CD36 aP2

CD 0.3GCD HFD CQD (d)

Figure 5: Effects of green coffee bean extract and 5-CQA supplementation on genes regulating adipogenesis in mice fed the HFD. (a)The expression of WNT10b-related genes in the epididymal adipose tissue was determined by RT-PCR and normalized to that of GAPDH. (b) Protein levels of 𝛽-catenin and GAPDH in the epididymal adipose tissue were determined by Western blotting. (c) and (d) The expression of galanin-related and adipogenic target genes in the epididymal adipose tissue was determined by RT-PCR and normalized to that of GAPDH. Data represent the results of three independent experiments (𝑛=2, 3 mice per experiment). 𝑃 < 0.05 indicates statistical significance. Values are the mean ± SEM, 𝑛=8for each group. Evidence-Based Complementary and Alternative Medicine 9

CD HFD 0.3GCD CQD CD HFD 0.3GCD CQD TLR2 p-JNK TLR4 JNK GAPDH

3.5 2.4 a 3 2.1 2.5 a 1.8 b 2 a 1.5 b 1.5 b b b b b b 1.2 1 b

Relative gene expression gene Relative 0.5 0.9

0 CD) versus change p-JNK/JNK (fold 0.6 TLR2 TLR4 CD HFD 0.3GCD CQD

CD 0.3GCD CD 0.3GCD HFD CQD HFD CQD (a) (b) CD HFD 0.3GCD CQD 5 TNF𝛼 a MCP1 4 a 𝛼 3 a IFN a a 2 IFN𝛽 b b b b b b b b b b b IL-6 1 b b b b GAPDH 0

Relative gene expression gene Relative TNF𝛼 MCP1IFN𝛼 IFN𝛽 IL-6

CD 0.3GCD HFD CQD (c)

Figure 6: Effects of green coffee bean extract and 5-CQA supplementation on the expression of gene involved in inflammation in micefeda HFD. (a) The expression of TLR2 and TLR4 in epididymal adipose tissue was determined by RT-PCR and normalized to that of GAPDH. (b) Protein levels of p-JNK and JNK in the epididymal adipose tissue were determined by Western blotting. (c) The expression of proinflammatory cytokine genes in the epididymal adipose tissue was determined by RT-PCR and normalized to that of GAPDH. Data represent the results of three independent experiments (𝑛=2, 3 mice per experiment). 𝑃 < 0.05 indicates statistical significance. Values are the mean ± SEM, 𝑛=8 for each group. with those in HFD-fed mice (Figure 6(c)). These significant coffee bean extract-fed mice when compared with HFD-fed changes of gene expression related to inflammation exhibited mice (Figure 7(c)). Moreover, 0.3GCD was as effective in in 0.3GCD-fed mice were also shown in CQD-fed mice improving insulin sensitivity and enhancing GLUT4 translo- (Figure 6). cationtothemembraneasCQDwas(Figure 7).

3.7. Expression of Genes Related to Insulin Resistance. We 4. Discussion evaluated the protein levels of genes involved in insulin resistance in the epididymal fat tissue of 0.3GCD-fed mice. In the present study, decaffeinated green coffee bean extract Western blot analysis revealed that phosphorylation of IRS-1 has demonstrated a significant weight-lowering effect in (Ser307) and AKT (Thr308) was significantly decreased and HFD-fed mice. Among the green coffee bean extract dosages increased, respectively, in GCD-fed mice when compared (0.1%, 0.3%, and 0.9%), 0.3% green coffee bean extract was to HFD-fed mice (Figures 7(a) and 7(b)). The amount of proved to be the minimum effective dose for preventing GLUT4 found in the membrane fraction of the epididymal body weight gain, fat accumulation, and insulin resistance in adipocytes was significantly increased, whereas the amount mice fed the HFD for 11 weeks. No further dose-dependent of total cellular GLUT4 in cytosol remained the same in green decreases in body weight gain, visceral fat-pad weights, and 10 Evidence-Based Complementary and Alternative Medicine

CD HFD 0.3GCD CQD CD HFD 0.3GCD CQD p-AKT p-IRS1 (Thr308) (Ser307) IRS1 AKT

2.00 1.2

a b 1.70 a 1.0 b

1.40 b b 0.8 1.10 b p-AKT/total AKT p-AKT/total p-IRS1/total IRS1 p-IRS1/total 0.6 c 0.80

0.50 0.4 CD HFD 0.3GCD CQD CD HFD 0.3GCD CQD

CD 0.3GCD CD 0.3GCD HFD CQD HFD CQD (a) (b) CD HFD 0.3GCD CQD 1.5 Glut4(M) 1.2 a a a a a 𝛽-Actin 0.9 b b c 0.6 Glut4(T) 0.3 GAPDH Relative protein expression protein Relative 0.0 Glut4(M) Glut4(T)

CD 0.3GCD HFD CQD (c)

Figure 7: Effects of green coffee bean extract and 5-CQA supplementation on the proteins involved in GLUT4 translocation in mice feda HFD. Protein levels of p-IRS1, p-AKT, plasma membrane GLUT4, and corresponding total proteins in the epididymal adipose tissue were determined by Western blotting. Data represent the results of three independent experiments (𝑛=2, 3 mice per experiment). 𝑃 < 0.05 indicates statistical significance. Values are the mean ± SEM, 𝑛=8for each group.

plasma lipids and glucose profiles were noted at 0.9% green Green coffee beans are a rich source of polyphenols, coffeebeanextractdosage.Thedoseof0.3%greencoffeebean especially chlorogenic acids. Of a variety of chlorogenic acids, extract (300 mg green coffee bean extract/kg diet) in mice 5-CQAhasbeenknowntoprotecttissuesfromoxidative corresponds to approximately 1,460 mg/60 kg body weight stress,modulateglucosemetabolism,andmediateantiobesity inhumanwhencalculatedonthebasisofnormalizationto effect [12, 21, 22]. In the present study, 5-CQA was the most body surface area as recommended by Reagan-Shaw et al. abundant and active component contained in green coffee [20]. In order to obtain 1.460 mg of decaffeinated green coffee bean extract and exerted a significant weight-lowering effect bean extract, 9.7 grams of decaffeinated green coffee beans in HFD-fed mice (Figure 1). Based on our assumption that the is required as calculated from its extraction yield of 15%. antiobesity effect of decaffeinated green coffee bean extract According to Moon, the content of total chlorogenic acids was expected to be dose dependent and be derived from is reduced by approximately 90% in dark roasted beans [18]. 5-CQA, the dose of 5-CQA in CQD was chosen to match This implies that 10 times more dark roasted beans (97 grams) the amount of 5-CQA contained in the 0.9GCD (the highest are required to produce similar weight-reducing effects as the dose of decaffeinated green coffee bean extract). Nevertheless, decaffeinated green coffee beans. weight-suppressing and insulin-sensitizing effects of green Evidence-Based Complementary and Alternative Medicine 11

SFRP5

WNT10b DKK2 Galanin FFA FFA GLUT4 LRP I R FZDR GalR1 GalR2 TLR2 TLR4 P IRS1 (Ser307)

P PKC𝛿 JNK 𝛽 -Catenin AKT

P ERK GLUT4 AP-1 vesicle

𝛽 GLUT4 translocation -Catenin Nucleus Cyc-D Target genes Target genes 𝛽-Catenin TNF𝛼 FAS TCF LEF MCP1 Leptin IFN𝛼 CD36 IFN𝛽 𝛾2 C/EBP𝛼 aP2 PPAR AP-1 IL-6 Adipogenesis Inflammation

HFD GCD

Figure 8: The possible molecular mechanisms of decaffeinated green coffee bean extract in attenuating adipogenesis, inflammation, and insulin resistance induced by HFD. Decaffeinated green coffee bean extract reverses HFD-induced changes in expression of genes involved in WNT10b- and galanin-mediated adipogenesis cascades in the epididymal adipose tissue. The downstream adipogenic transcription factors (PPAR𝛾2andC/EBP𝛼) and their target genes were also suppressed by decaffeinated green coffee bean extract in the epididymal adipose tissue. Decaffeinated green coffee bean extract reverses the HFD-induced changes in the expression of genes related to TLR2/4-mediated proinflammatory signaling cascades and proteins involved in GLUT4 translocation in the epididymal adipose tissue.

coffee bean extract plateaued at 0.3% supplementation. The proteins induce PPAR𝛾2andC/EBP𝛼 [23–25]. Of the various 0.3GCD (containing 0.05% 5-CQA) significantly reduced upstream molecules, the adipogenic mechanism of WNT10b body weight gain and improved insulin sensitivity as much as has been thoroughly researched both in vivo and in vitro [23]. the CQD (containing 0.15% 5-CQA) did. This effect could be WNT signaling initiates as WNT10b, a glycoprotein, binds possibly due to other polyphenols contained in green coffee to fizzled receptors (FZDR) and lipoprotein-receptor-related bean extract which exert beneficial effects against obesity and protein (LRP) [23]. Upon WNT10b signaling activation, insulin resistance. The extent to which 0.3GCD decreased 𝛽-catenin phosphorylation and its subsequent degradation body weight gain and increased insulin sensitivity in mice are prevented [26]. Then, hypophosphorylated 𝛽-catenin fed the HFD was also shown in 0.9GCD. Exhibiting no accumulates in the cytoplasm and translocates into the further preventive effect against obesity and insulin resistance nucleus, where it binds to the T-cell-specific transcription in 0.9GCD, green coffee bean extract seems to reach its factor/lymphoid-enhancer-binding factor (TCF/LEF) and maximum effect at 31% and 24% reductions in body weight suppresses PPAR𝛾2andC/EBP𝛼.TheWNT10bsignaling gain and fasting plasma glucose, respectively, in HFD-fed pathway is suppressed by extracellular antagonists, such as mice. SFRP5 and DKK2. Secreted from adipocytes, SFRP5 and As food intake did not differ among the experimental DKK2 inhibit WNT10b signaling in adipose tissue via an groups, we can hypothesize that the weight-reducing effect autocrine/paracrine mechanism (Figure 8). SFRP5 binds and of green coffee bean extract is mediated by the inhibition sequesters WNT10b from FZD receptors, whereas DKK2 of adipogenesis. Indeed, we have confirmed from mRNA binds and disrupts LRP from binding to FZDR [27, 28]. expression levels that adipogenic target genes of PPAR𝛾2and Mice fed the green coffee bean extract exhibited lower gene C/EBP𝛼 were downregulated in mice fed the green coffee expression of SFRP5 and DKK2 compared with those fed the bean extract. Several upstream molecules such as WNT10b, HFD only. Transcriptional regulation on SFRP5 and DKK2 galanin, fibroblast growth factor 1, and bone morphogenetic genes has not yet been explored in WAT. Yet, Qi et al. 12 Evidence-Based Complementary and Alternative Medicine have reported that epigenetic silencing of SFRP5 mediated “lean” fat cells are constantly exposed to overnutrition and by hypermethylation causes constitutive activation of WNT store excess fat beyond a “critical size,” they become “fat” signaling and colorectal tumorigenesis in colorectal tumor fat cells, which are a good source of adipokines [37]. In cells [29]. Epigenetic regulation of the SFRP5 gene in adipose this modified milieu, from a metabolic to proinflammatory tissue has not been reported; however, similar epigenetic environment, inflammatory mediators such as TLR2 and silencing of the SFRP5 gene could possibly induce WNT TLR4 are chronically expressed in adipocytes [36]. TLRs play signaling in adipose tissue. Perhaps, green coffee bean extract a role in the innate immune response, which discriminates plays a role in epigenetic silencing of SFRP5, resulting between “self” and “nonself” and activates proinflammatory in lower SFRP5 expression in adipose tissue but whether processes upon stimulation via pathogen-associated molec- it directly or indirectly modulates its expression requires ular patterns such as lipopolysaccharides [38]. Activation of further investigation. TLRs induces phosphorylation of JNK and recruitment of Galanin, a 29/30-residue neuropeptide, regulates food activator protein-1 (AP-1), which acts as a transcriptional consumption, memory, neurogenesis, and neuroendocrine activator of proinflammatory cytokines such as 𝛼TNF , MCP1, function by binding to receptors in the hypothalamic regions IFN𝛼,IFN𝛽,andIL-6[16, 39–41]. Our data revealed that [30]. It is well known that galanin is expressed and widely the expression of TLR2 and TLR4 was reduced in mice fed distributed in the central nervous system. However, recent the green coffee bean extract when compared with those fed studies have revealed that galanin expression has also been the HFD. This implies that green coffee bean extract may observed in peripheral tissues such as stomach, WAT, and attenuate WAT from becoming a HFD-induced inflamed and taste buds [24, 31]. In our previous study, we discovered modified environment. Recently, it was reported that fatty that diet-induced obese mice exhibited the upregulation of acids, particularly saturated fatty acids (C14:0, C16:0, and galanin and its receptors in WAT [24]. As a result, increased C18:0), serve as ligands to TLR4 [16, 40]. In the present study, levels of galanin activate galanin receptor subtypes, which mice fed the green coffee bean extract exhibited lower plasma are members of the G protein-coupled receptor family. FFA levels when compared with those fed a HFD. From this, Signaling properties of GalR1 and GalR2 are somewhat we suggest that green coffee bean extract may have attenuated different, but both eventually lead to the activation of ERK. activation of TLR4-mediated signaling pathway and therefore Upon prolonged HFD consumption, the activation of GalR1 resulted in the decreased expression of proinflammatory increases mitogen-activated protein kinase (MAPK) activity cytokines, confirmed by their mRNA expression levels. Col- in a PKC-independent manner by coupling to Gi-type G- lectively, we speculate that green coffee bean extract may proteins via G𝛽𝛾 subunits and induces extracellular signal- suppress proinflammatory responses by not only decreasing regulated kinases 1/2 (ERK) activation [32]. The activation of the expression of TLR2 and TLR4 but also decreasing ligand- GalR2, coupled to Gq/11-type G-proteins, increases phospho- inducedTLR4-mediatedinflammatorysignaling. lipase C (PLC) activation. PLC cleaves phosphatidylinositol Fasting plasma glucose and insulin levels and OGTT 4,5-bisphsphate into inositol 1,4,5-triphosphate and diacyl results demonstrated that insulin sensitivity was enhanced in glycerol, a PKC𝛿 activator. Subsequently, PKC𝛿 induces the green coffee bean extract fed mice. Improvement in insulin activation of ERK, which increases the expression of PPAR𝛾2 sensitivity was further confirmed by Western blot analysis of and C/EBP𝛼 and promotes adipogenesis. The mRNA levels insulin signaling-related molecules and membrane GLUT4. ofgenesinvolvedingalanin-mediatedadipogenesiswere Mice fed the green coffee bean extract exhibited increased reduced in mice fed green coffee bean extract. Green coffee phosphorylation of AKT and translocation of GLUT4 from bean extract appears to suppress adipogenesis by reversing the cytosol to the membrane when compared with those HFD-induced increased expression of galanin, its receptors, fed a HFD. Whether green coffee bean extract has a direct and adipogenic transcription factors. influence on GLUT4 translocation requires further inves- Since leptin secretion from adipose tissues is positively tigation. However, we speculate that the beneficial effects correlated with TG accumulation in adipocytes, plasma leptin against insulin resistance could be associated with decreased level is a biomarker in assessing obesity in both experimental inflammatory responses. Recent studies have suggested that animals and humans [33, 34]. Increments of serum leptin JNK, an important stress sensor, plays a crucial role in the reg- levels usually occur together with adipocyte hypertrophy. ulation of HFD-induced insulin resistance and inflammation In the present study, HFD-fed mice demonstrated higher [36]. When WAT becomes inflamed, JNK is phosphorylated plasma leptin levels and larger adipocyte size than CD-fed and p-JNK inactivates IRS-1 by phosphorylating its serine mice. Yet, green coffee bean extract seems to decrease plasma residue [39]. Serine phosphorylation on IRS-1 blocks GLUT4 leptin and its mRNA expression along with the average translocation and therefore impairs insulin sensitivity [42]. adipocytediameterinHFD-fedmice. Thus, green coffee bean extract may have reversed HFD- Lower levels of plasma proinflammatory cytokines such induced insulin resistance by decreasing JNK activation and as IL-6 and MCP-1 were observed in mice fed green cof- increasing GLUT4 translocation. fee bean extract when compared with mice fed the HFD. In conclusion, the present study shows that green coffee Generally, the levels of plasma cytokines correlate with the bean extract significantly reduces visceral fat-pad accumu- expression of proinflammatory adipokines in WAT35 [ , 36]. lation and improves insulin resistance in mice fed the HFD Adipocytes under normal or healthy conditions referred at a minimum effective dose of 0.3% supplementation. We to as “lean” fat cells engage metabolic pathways, leaving suggest that 5-CQA and other polyphenols in green coffee immune-responsepathwaysinactive[36]. However, when bean extract may bring an additive effect in decreasing Evidence-Based Complementary and Alternative Medicine 13

body weight gain and increasing insulin sensitivity. These in high-fat diet-induced-obese mice,” FoodandChemicalToxi- beneficial effects are possibly due to the downregulation cology,vol.48,no.3,pp.937–943,2010. of genes associated with adipogenesis and inflammation in [13] H. Hemmerle, H.-J. Burger, P. Below et al., “Chlorogenic acid the WAT of mice. Taken as a whole, decaffeinated green coffee and synthetic chlorogenic acid derivatives: novel inhibitors of bean extract may be used as a therapeutic agent that prevents hepatic glucose-6-phosphate translocase,” Journal of Medicinal obesity and metabolic syndrome. Chemistry,vol.40,no.2,pp.137–145,1997. [14] D. V. R. de Sotillo and M. Hadley, “Chlorogenic acid modifies plasma and liver concentrations of: cholesterol, triacylglycerol, Conflict of Interests and minerals in (fa/fa) Zucker rats,” The Journal of Nutritional Biochemistry, vol. 13, no. 12, pp. 717–726, 2002. The authors declare that there is no conflict of interests regarding the publication of this paper. [15] S. M. Rangwala and M. A. Lazar, “Transcriptional control of adipogenesis,” Annual Review of Nutrition,vol.20,pp.535–559, 2000. Acknowledgment [16] H. Shi, M. V. Kokoeva, K. Inouye, I. Tzameli, H. Yin, and J. S. Flier, “TLR4 links innate immunity and fatty acid-induced ThisresearchwassupportedbytheSRCprogram(Centerfor insulin resistance,” The Journal of Clinical Investigation,vol.116, Food & Nutritional Genomics: Grant no. 2008-0062618) of no. 11, pp. 3015–3025, 2006. the National Research Foundation (NRF) of Korea funded by [17] H. Xu, G. T. Barnes, Q. Yang et al., “Chronic inflammation in fat the Ministry of Education, Science and Technology. plays a crucial role in the development of obesity-related insulin resistance,” The Journal of Clinical Investigation,vol.112,no.12, References pp.1821–1830,2003. [18] J.-K. Moon, H. S. Yoo, and T. Shibamoto, “Role of roasting [1] A. Smith, “Effects of caffeine on human behavior,” Food and conditions in the level of chlorogenic acid content in coffee Chemical Toxicology,vol.40,no.9,pp.1243–1255,2002. beans: correlation with coffee acidity,” Journal of Agricultural [2] C. C. Appel and T. D. Myles, “Caffeine-induced hypokalemic and Food Chemistry,vol.57,no.12,pp.5365–5369,2009. paralysis in pregnancy,” Obstetrics & Gynecology,vol.97,no.5, [19] O. Dellalibera, B. Lemaire, and S. Lafay, “Svetol, green coffee part 2, pp. 805–807, 2001. extract, induces weight loss and increases the lean to fat mass [3] P. W. Curatolo and D. Robertson, “The health consequences of ratio in volunteers with overweight problem,” Phytotherapie, caffeine,” Annals of Internal Medicine,vol.98,no.5,part1,pp. vol. 4, no. 4, pp. 194–197, 2006. 641–653, 1983. [20] S. Reagan-Shaw, M. Nihal, and N. Ahmad, “Dose translation [4] M. C. Cornelis, “Coffee intake,” Progress in Molecular Biology from animal to human studies revisited,” The FASEB Journal, and Translational Science, vol. 108, pp. 293–322, 2012. vol.22,no.3,pp.659–661,2008. [5]A.Rosso,J.Mossey,andC.F.Lippa,“Caffeine:neuroprotective [21] Z. Zhao, H. S. Shin, H. Satsu, M. Totsuka, and M. Shimizu, “5- functions in cognition and Alzheimer’s disease,” American caffeoylquinic acid and caffeic acid down-regulate the oxidative Journal of Alzheimer’s Disease & Other Dementias,vol.23,no. stress- and TNF-𝛼-induced secretion of interleukin-8 from 5, pp. 417–422, 2008. Caco-2 cells,” JournalofAgriculturalandFoodChemistry,vol. [6] R. M. van Dam and F. B. Hu, “Coffee consumption and risk of 56, no. 10, pp. 3863–3868, 2008. type 2 diabetes: a systematic review,” The Journal of the American [22] B.K.Bassoli,P.Cassolla,G.R.Borba-Muradetal.,“Chlorogenic Medical Association,vol.294,no.1,pp.97–104,2005. acid reduces the plasma glucose peak in the oral glucose [7] J. A. Greenberg, C. N. Boozer, and A. Geliebter, “Coffee, tolerance test: effects on hepatic glucose release and glycaemia,” diabetes, and weight control,” The American Journal of Clinical Cell Biochemistry and Function,vol.26,no.3,pp.320–328,2008. Nutrition,vol.84,no.4,pp.682–693,2006. [23] C. Christodoulides, C. Lagathu, J. K. Sethi, and A. Vidal-Puig, [8] K. Tanaka, S. Nishizono, S. Tamaru et al., “Anti-obesity and “Adipogenesis and WNT signalling,” Trends in Endocrinology & hypotriglyceridemic properties of coffee bean extract in SD Metabolism,vol.20,no.1,pp.16–24,2009. rats,” Food Science and Technology Research,vol.15,no.2,pp. [24] A. Kim and T. Park, “Diet-induced obesity regulates the 147–152, 2009. galanin-mediated signaling cascade in the adipose tissue of [9] T. Murase, K. Misawa, Y. Minegishi et al., “Coffee polyphenols mice,” Molecular Nutrition & Food Research,vol.54,no.9,pp. suppress diet-induced body fat accumulation by downregu- 1361–1370, 2010. lating SREBP-1c and related molecules in C57BL/6J mice,” [25] T. J. Schulz and Y.-H. Tseng, “Emerging role of bone mor- American Journal of Physiology: Endocrinology and Metabolism, phogenetic proteins in adipogenesis and energy metabolism,” vol. 300, no. 1, pp. E122–E133, 2011. Cytokine&GrowthFactorReviews,vol.20,no.5-6,pp.523–531, [10] L. Ho, M. Varghese, J. Wang et al., “Dietary supplementation 2009. with decaffeinated green coffee improves diet-induced insulin [26] X. He, “A Wnt-Wnt situation,” Developmental Cell,vol.4,no.6, resistance and brain energy metabolism in mice,” Nutritional pp. 791–797, 2003. Neuroscience,vol.15,no.1,pp.37–45,2012. [27] A. Rauch and S. Mandrup, “Lighting the fat furnace without [11] K. W. Ong, A. Hsu, and B. K. H. Tan, “Chlorogenic acid SFRP5,” The Journal of Clinical Investigation,vol.122,no.7,pp. stimulates glucose transport in skeletal muscle via AMPK 2349–2352, 2012. activation: a contributor to the beneficial effects of coffee on [28] B. Gustafson and U. Smith, “The WNT inhibitor dickkopf diabetes,” PLoS ONE,vol.7,no.3,ArticleIDe32718,2012. 1 and bone morphogenetic protein 4 rescue adipogenesis in [12] A.-S. Cho, S.-M. Jeon, M.-J. Kim et al., “Chlorogenic acid hypertrophic obesity in humans,” Diabetes,vol.61,no.5,pp. exhibits anti-obesity property and improves lipid metabolism 1217–1224, 2012. 14 Evidence-Based Complementary and Alternative Medicine

[29] J. Qi, Y.-Q. Zhu, J. Luo, and W.-H. Tao, “Hypermethylation and expression regulation of secreted frizzled-related protein genes in colorectal tumor,” World Journal of Gastroenterology,vol.12, no. 44, pp. 7113–7117, 2006. [30] I. Saar, J. Runesson, I. McNamara, J. Jarv,¨ J. K. Robinson, and U.¨ Langel, “Novel galanin receptor subtype specific ligands in feeding regulation,” Neurochemistry International,vol.58,no.6, pp.714–720,2011. [31]Y.Seta,S.Kataoka,T.Toyono,andK.Toyoshima,“Expression of galanin and the galanin receptor in rat taste buds,” Archives of Histology and Cytology,vol.69,no.4,pp.273–280,2006. [32] R. Lang, A. L. Gundlach, and B. Kofler, “The galanin peptide family: receptor pharmacology, pleiotropic biological actions, andimplicationsinhealthanddisease,”Pharmacology & Ther- apeutics,vol.115,no.2,pp.177–207,2007. [33] M. Maffei, J. Halaas, E. Ravussin et al., “Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects,” Nature Medicine, vol. 1, no. 11, pp. 1155–1161, 1995. [34] R.N.Jadeja,M.C.Thounaojam,U.V.Ramani,R.V.Devkar,and A. V. Ramachandran, “Anti-obesity potential of Clerodendron glandulosum.Colebleafaqueousextract,”Journal of Ethnophar- macology,vol.135,no.2,pp.338–343,2011. [35]S.E.Shoelson,J.Lee,andA.B.Goldfine,“Inflammationand insulin resistance,” The Journal of Clinical Investigation,vol.116, no.7,pp.1793–1801,2006. [36] M. F. Gregor and G. S. Hotamisligil, “Inflammatory mechanisms in obesity,” Annual Review of Immunology,vol.29,pp. 415–445, 2011. [37] S. Mittra, V.S. Bansal, and P.K. Bhatnagar, “From a glucocentric to a lipocentric approach towards metabolic syndrome,” Drug Discovery Today,vol.13,no.5-6,pp.211–218,2008. [38] C. Erridge, “Endogenous ligands of TLR2 and TLR4: agonists or assistants?” Journal of Leukocyte Biology,vol.87,no.6,pp. 989–999, 2010. [39] M. T. A. Nguyen, H. Satoh, S. Favelyukis et al., “JNK and tumornecrosisfactor-𝛼 mediate free fatty acid-induced insulin resistance in 3T3-L1 adipocytes,” The Journal of Biological Chemistry,vol.280,no.42,pp.35361–35371,2005. [40] J. K. Kim, “Fat uses a TOLL-road to connect inflammation and diabetes,” Cell Metabolism,vol.4,no.6,pp.417–419,2006. [41] S.-J. Kim, Y. Choi, Y.-H. Choi, and T. Park, “Obesity activates toll-like receptor-mediated proinflammatory signaling cascades in the adipose tissue of mice,” The Journal of Nutritional Biochemistry,vol.23,no.2,pp.113–122,2012. [42] R. Feinstein, H. Kanety, M. Z. Papa, B. Lunenfeld, and A. Karasik, “Tumor necrosis factor-𝛼 suppresses insulin-induced tyrosine phosphorylation of insulin receptor and its substrates,” The Journal of Biological Chemistry,vol.268,no.35,pp.26055– 26058, 1993. Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2014, Article ID 293961, 12 pages http://dx.doi.org/10.1155/2014/293961

Review Article The Active Role of Leguminous Plant Components in Type 2 Diabetes

Monika Gwtek,1 Natalia Czech,1 MaBgorzata Muc-WierzgoN,1 Elhbieta Grochowska-Niedworok,2 Teresa Kokot,1 and Ewa Nowakowska-Zajdel1

1 Department of Internal Medicine, Bytom, Silesian Medical University, 41-902 Bytom, Katowice, Poland 2 Department of Human Nutrition, Zabrze, Silesian Medical University, 41-808 Zabrze, Katowice, Poland

Correspondence should be addressed to Monika Gętek; [email protected]

Received 10 December 2013; Revised 19 January 2014; Accepted 20 January 2014; Published 11 March 2014

Academic Editor: Menaka C. Thounaojam

Copyright © 2014 Monika Gętek et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Diabetes appears to be one of the most frequent noncommunicable diseases in the world. A permanent growth in the incidence of diabetes can be observed and according to the International Diabetes Federation (IDF) the year 2030 will mark the increase in the number of diabetics to 439 mln worldwide. Type 2 diabetes accounts for about 90% of all diabetes incidence. Nutrition model modification not only features the basic element in type 2 diabetes treatment but also constitutes the fundamental factor influencing a morbidity rate decrease. Leguminous plants are a key factor in the diabetic diet; plants such as pulses or soybeans are nutritious products valued highly in nutrition. These legumes are high in the content of wholesome protein and contain large amounts of soluble alimentary fiber fractions, polyunsaturated fatty acids, vitamins and minerals, and bioactive substances with antioxidant, anti-inflammatory, and anticancer activity. They are distinguished by the high amount of bioactive compounds that may interfere with the metabolism of glucose. The most significant bioactive compounds displaying antidiabetic activity in leguminous plants are as follows: genistein and daidzein, alpha-amylase inhibitors, and alpha-glucosidase inhibitors. In vitro research using leguminous plant extracts has confirmed their antidiabetic properties. Leguminous plants should be employed in the promotion of healthy lifestyles in terms of functional food.

1. Introduction most important hazard factors leading to type 2 diabetes are as follows: obesity, arterial hypertension, lipid balance Diabetes appears to be one of the most frequent noncom- disorder, highly calorific diet with a prevalence of saturated municable diseases in the world. A permanent growth in fats, limited physical activity, ageing processes, and tobacco the incidence of diabetes can be observed and according smoking [2–4]. In type 2 diabetes pathogenesis a significant to the International Diabetes Federation (IDF) the year influence is caused by hypoinsulinaemia resulting from 𝛽 cell 2030 will mark the increase in the number of diabetics pancreatic islet secretory functional disorder together with to 439 mln worldwide. In Europe, the highest morbidity lowered peripheral tissue sensitivity to insulin activity (fatty rates are observed in Germany (8.9% population), Spain tissue, muscles, liver, and others). Both growing insulin resis- (8.7%), and Belgium (8.0%) and the lowest rates in Great tance and hyperinsulinism are observed because a decline Britain (4.9%) and Sweden (5.2%). The biggest populations in sensitivity to insulin leads to enhanced secretion of this of diabetics worldwide, however, are to be found in India hormone before the first meal, that is, on an empty stomach (51 mln), China (43 mln), and the USA (27 mln). and after the meal. Nutrition model modification constitutes Type 2 diabetes accounts for about 90% of all diabetes not only the basic element in type 2 diabetes treatment but incidence. It is estimated that about 50% of diabetics remain also the fundamental factor influencing a morbidity rate undiagnosed [1]. Judging from epidemiological research, the decrease. Modifying nutrition patterns involves a volume 2 Evidence-Based Complementary and Alternative Medicine reduction in easily absorbed carbohydrates in favour of as progesterone [10].Naturalestrogensareabletobindto low glycaemia products, an increase in the daily supply both estrogen receptors in humans (ER𝛼 and ER𝛽)butwith of nutrifiber, and a reduction of fatty product uptake in ahigheraffinitytoER𝛽 [11]. Genistein has been shown to the overall daily energy supply. This is especially true for have a 20-fold higher binding affinity to ER𝛽 than ER𝛼 saturated fats while increasing the amount of polyunsaturated andwhencomparedto17𝛽 estradiol affinity for𝛼 ER ,the fatty acids. potency of genistein for the receptor is 130-fold lower [12, Leguminous plants, for example, pulses (dry beans, 13]. Genistein displays both agonist and antagonist activity chickpeas, lentils, and peas) and oil seed (soybeans), are a towards the estrogenic receptors which may be important in key factor in the diabetic diet. These plants are nutritious breast cancer prevention [14]. A similar activity is manifested products valued highly in nutrition. This specific group bytamoxifenwhichisappliedinbreastcancertreatment. provides wholesome products of vegetable protein whose Estrogen equol and genistein can replace natural estrogen and volume ranges from 20% in beans and peas up to 38–40% in testosterone. These isoflavonoids influence the reproduction, soya beans. These proteins contain a large amount of lysine, growth, and maturation of cells. They perform important especially in beans, which is the reason they are regarded as regulatory functions in the maintenance of organ activity. wholesome. Protein nutritive value is reduced by subdued As antioxidants, genistein and daidzein protect cells against sensitivity to proteolysis, low contents of sulphur amino the effects of harmful free radicals which are responsible acids, and the presence of nonprotein substances such as for ageing and concomitant diseases such as atherosclerosis, phytic acid and tannic acid and nonphysiological proteins arthritis, or diabetes [15, 16]. (lactinine, protease inhibitors). The legumes are known to Equol is a metabolite of soy isoflavones—daidzin and contain large amount of soluble alimentary fiber fractions (4– daidzein. It is produced by intestinal bacteria but not in all 6%), polyunsaturated fatty acids (18% in soya bean), B group people. The term equol-producers identifies those individuals vitamins, and minerals (phosphorus, potassium, calcium, who can produce equol in response to consumption of soy magnesium, iron, zinc, and copper). They are described isoflavones. There is also an established hypothesis that equol- as possessing a low glycaemia index (<50) and they are producers consuming soy diet had greater health benefits alkalogenic products, which is especially vital in acid-alkaline than equol-nonproducers [17]. balance maintenance in organisms [5–7]. Leguminous plants The alpha-amylases inhibitors are, inter alia, compounds are notable for their high levels of bioactive compounds, which suppress carbohydrate absorption through inhibiting which can influence glucose metabolism by the following: enzymes responsible for starch digestion. Alpha-amylase inhibitors are found in legumes, fruit, green and black teas, (1) carbohydrate digestion inhibition and the suppres- wheat, and rice. Three isoforms of alpha-amylase inhibitors sion of glucose absorption in the intestine, are found in legumes: alpha-amylase inhibitor isoform 1 (2) stimulation of insulin secretion from pancreatic 𝛽 cell (Alpha- AI1), alpha-amylase inhibitor isoform 2 (Alpha-A12), liver glucose release modulation, and alpha-amylase inhibitor isoform like (Alpha-AIL). The (3) insulin receptor activation [8]. alpha-AI1 isoform displays activity in humans. Phaseolamin is the generic name for the common white bean extract Legume intake worldwide differs depending on the containing alpha-amylase inhibitors. Alpha-AI1 is found in region. The highest intakes are registered in South America germsandseedsandcannotbefoundinotherplantparts. (10.7 kg/person annually), Africa (9.8 kg/person annually), Alpha-AI1 synthesis occurs at the same time as the phase- and Asia (5.9 kg/person annually) [5]. The average con- oline and phytohaemagglutinin (PHA), stored in vacuole. sumption in Europe comes to about 2.7 kg/person annually These are typical lectines, synthesised in rough endoplasmic (FAOSTAT 2009). In Poland it is round 1 kg/person annually reticulum and modified through Golgi apparatus in the form and at the end of the last decade it fell by 43% [9]. of signal peptide removal and N-glycosylation. They possess homologousaminoacidsequences,from50to90%[18, 19]. 2. Bioactive Substances Contained in Alpha-AI1 is detected 17 days after pollination in seed axes Leguminous Plants and cotyledons. Regular growth happens up till the 28th day. The level of Alpha-AI1 decreases slightly during the drying The most crucial bioactive compounds displaying antidia- process [18]. Alpha-AI1 prevents starch digestion through betic activity in leguminous plants are as follows: blockingcompleteaccesstotheactiveenzymeposition. The factors which refer to Alpha-AI1 inhibitor activity are (1) genistein and daidzein, reaction, temperature, incubation period, and certain ion presence.TheoptimalreactionpHvaluefortheinhibitoris (2) alpha-amylase inhibitors, ∘ (3) alpha-glucosidase inhibitors. 4.5–5.5 and optimal temperature is 22–37 C, and it becomes inactivated completely after 10 minutes of cooking [20]. Genistein and daidzein are natural estrogens found in In vitro research has proved the inhibiting effect of soya beans and soya derivative products. Their similarity assorted bean variety extracts on alpha-glycosidase, espe- to estrogens enables binding to receptors in human cells cially in the case of “Azuki” beans. However, it was Yao and in choriocarcinoma cell lines as well (BeWo and Jeg3) et al. who described the bioactive components—flavonoids [10]. High dosages of genistein and daidzein may reduce cell responsible for this effect. These are vitexin and isovitexin. proliferation and the production of the steroid hormones Vitexin activity (apigenin C glucoside) thus far confirmed Evidence-Based Complementary and Alternative Medicine 3 concerns the widening of coronary vessels, angina pectoris in skeletal muscle. It was discovered that a high phytoestrogen prevention, sedative functions, and spasmolytic and anti- diet may alter mitochondrial metabolism and disturb expres- inflammatory activity. Vitexin is pharmacologically signifi- sion of peroxisome proliferator activated receptor alpha cantduetoitsabilitytoimprovecoronaryflow.Itislisted (PPAR𝛼)andPPAR-l𝛾 intheliver,whiteadiposetissue,and as a mild cardiac drug. Isovitexin (2-0-GIV) makes a strong muscles suggesting fatty-acids beta-oxidation [31]. Poten- antioxidant. The blocking effect of these flavonoids on alpha- tially, with nonfatty mice PPAR𝛼 activation may lead to a glycosidase is also confirmed by research conducted on other change in glucose utilization into fatty acid oxidation instead plants [21–23](seeTable 1). of new triglyceride progression [49]. Increased fatty acid oxidation may protect against nonalcoholic liver steatosis and improve sensitivity to insulin and glucose metabolism in the 3. Genistein and Daidzein: liver. Moreover, a decrease in liver triglycerides is correlated Antidiabetic Activity with lowered insulin resistance; however, the governing mechanism of triglyceride influence on insulin resistance has 3.1. Animal Studies. Genistein and daidzein are two of the not been recognized [50]. the best known flavonoids which have effects on secretory Kim and Lim studied diabetic mice which were divided pancreas functions. Research confirms that these substances into two groups according to fasting glucose levels (FBG): in physiologically achieved concentrations exert beneficial medium high FBG (DMMH; FBG 250–450 mg/dL) and high effects on the functions of pancreatic 𝛽 cells [48]. FBG (DMH; FBG 450–600 mg/dL). Mice were fed with Choi et al. tested the genistein and daidzein influence different diets and further divided into the following groups on glucose and insulin metabolism in nonfat mice, in which (𝑛=9or 10 individuals in each group): nondiabetic mice autoimmunological, insulin-dependent diabetes was devel- (CON), diabetic mice in the control group (DMC; DMMH- oped [29]. Isoflavonoids supplied at the dosage of 0.2 g/kg C, DMH-C) fed without genistein supplementation, and within nine weeks led to insulin production maintenance by diabetic mice with genistein supplementation: DMMH— pancreatic 𝛽 cells, while with mice from the control group 0.025%, DMH—0.025%, DMMH—0.1%, and DMH—0.1%. insulin production did not appear [29]. Another examination At the end of treatment body weight, food intake, and in vivo carried out on nonfat mice with STZ-induced diabetes, fasting blood glucose level were measured once a week. fed with fermented soya (5 g genistein/100 g 6 week-diet), Genistein supplementation did not prevent the decrease of proved that insulin doses in pancreas were higher with body weight. Food intake is significantly increased in diabetic the soya-fed mice group in comparison to the control one. mice with genistein supplementation compared to the CON Apart from increases in pancreatic insulin production, soya group. Only 0.025% genistein supplementation in DMMH dieting contributed to an improvement in peripheral tissue significantly reduced the level of FBG. Genistein supplemen- sensitivity to insulin [30]. Similar results were achieved by tation in the DMH is not reflected in a difference in the Lu et al. testing rats with STZ-induced diabetes and fed on levels of FBG. Plasma concentrations of total cholesterol and a highly isoflavonic diet48 [ ]. triglyceride were more elevated in DMC than in CON. There Soya isoflavonoids also display the regulatory ability of were no significant differences between DMC and the groups triglyceride synthesis in the liver. According to the men- of genistein supplementation. Plasma levels of high density tioned examination by Lu et al. carried out on nonobese, lipoprotein cholesterol did not differ between the groups [43]. diabetic mice, soya isoflavonoids, genistein, and daidzein Fu et al. tested 32 male C57BL/6 mice with obesity and were applied at the ratio of 0.2 mg/kg lower glucose levels in diabetes generated by the high fat content of the diet and low blood thus decreasing triglyceride gradients in the liver. The dosage streptozotocin injections. The mice were divided into research corroborated diminishing glucose-6-phosphatase 4 groups (8 mice in each group) and fed a standard diet with activity and phosphoenolpyruvate carboxykinase (PEPCK) 10% of calories from fat, a diet with a high fat content of 60% as well, together with a glucokinase activity increase, suggest- of calories from fat, and a diet containing 250 mg genistein/kg ing that genistein and daidzein block glucose production in body weight. Consumption of genistein (250 mg/kg (−1)) the liver [29, 30]. resulted in improved hyperglycaemia, glucose tolerance, and Cederroth et al. tested the effect of daidzein and genistein insulin levels in the blood. This diet did not affect body supplementation in healthy mice CD-1. As a result of a weight gain, food intake, fat deposits, serum lipid profiles, or phytoestrogen rich diet (198 ppm daidzein and 286 ppm peripheral insulin sensitivity. Genistein caused an increase in genistein) from the conception period up to adult age, AMP- the number of insulin-positive 𝛽 cells of the islets, promoted activated protein kinase (AMPK) activation was observed survival of islet 𝛽,andkeptisletmass[41]. in the liver and in white fatty tissue, as well as in muscles. Park et al. conducted research on male Slc: ICR mice This includes reduced lipid contents in adipocytes, increased in which diabetes was induced by injection of STZ, for the phosphorylation of AMPK and acetyl-CoA carboxylase inhibitory effect of daidzein on alpha-amylase and alpha- (ACC), increased expression of peroxisome proliferator- glucosidase. Healthy mice and mice with STZ-induced dia- activated receptor gamma coactivator (PPAR-l𝛾) and genes betes were randomly divided into 3 groups of 7 mice. In the involved in mitochondrial biogenesis and reactive oxygen- fasting state, the mice were orally administered soluble starch species detoxification (ROS) enzymes, increased insulin sen- (2 g/kg) or daidzein, starch (10 mg/kg) or acarbose, and starch sitivity, and reduction of the pathway mammalian target of (10 mg/kg). The effect of daidzein in postprandial blood rapamycin/ribosomal protein S6 kinase beta-1 (mTOR/S6K1) glucoselevelswasstudiedinnormalanddiabeticmice.Blood 4 Evidence-Based Complementary and Alternative Medicine

Table 1: The antidiabetic effect of the active compounds from legumes in research conducted in 2004–2014.

Body Food Authors Typeofstudy Bioactivecompounds Glycaemia Insulin Other activities weight intake In vivo 1500 mg water extract Udani et al., 2004 ↓Triglycerides Human of a common white ——↓BMI — [24] level double-blank test bean/day In vivo Udani and Singh, 1000 mg fractionated Human ——↓BMI — — 2007 [25] white bean extract/day double-blank test In vivo Human Celleno et al., 445 mg Phase 2 + ↓Body weight randomized, 2007 0.5 mg of chromium ——↓BMI — ↓Fat mass double-blind, [26] picolinate ↓WHR placebo- controlled In vivo Maruyama et al., Azuki juice 150 g ∗ ↓Triglycerides Human ——↓BMI — 2008 [27] 5/day level double-blank test ↓Activity Maruyama et al., 100 mg Azuki bean In vitro ————alpha-glucosidase 2008 [27] extract by 32.6% ↓Plasma Vitexin and isovitexin C-peptide, Yao et al., In vivo MBS (3 and 2 g/kg ∗ ↓Blood glucose ↑Insulin ↓Glucagon, ↓total 2008 Mice 11.68, 5.40 mg/g) —— level immunoreactivity cholesterol, [28] control group MBSC (3 g/kg ∗ 15.22, ↓Triglycerides, 11.42 mg/g) ↓BUN In vivo Choi et al., Genistein and daidzein ↓Glucose level in ↑Insulin ↓Triglycerides Mice —— 2008 [29] 0.2/kg/day blood production gradient in liver control group ↑Insulin In vivo Kim et al., production Mice 5 g genistein/100 g diet — —— — 2008 [30] ↑Insulin control group sensitivity ↓Lipid contents in adipocytes, ↑Phosphorylation In vivo of AMPK and Cederroth et al., 198 ppm daidzein and ↑Insulin Mice — —— acetyl-CoA 2008 [31] 286 ppm genistein/day sensitivity control group carboxylase (ACC), ↑Expression of (PPR-l 𝛾) In vitro ↑Glucose- Fu and Liu, 2009 clone cells insulin Genistein — stimulated insulin —— — [32] secreting secretion (INS-lE) In vivo Vinson et al., Human Phase 2 ↓Blood glucose 2009 crossover, ———— 750 mg, 1500 mg level [33] placebo- controlled In vivo Udani et al., Human Phase 2 ↓Blood glucose 2009 ———— crosses, 1500, 2000, 3000 mg level [34] randomized study Evidence-Based Complementary and Alternative Medicine 5

Table 1: Continued. Body Food Authors Typeofstudy Bioactivecompounds Glycaemia Insulin Other activities weight intake In vivo Human Wu et al., 2010 double-blinded Phase 2 No changes in ——↓BMI — [35] placebo- 2000 mg WHR controlled study In vivo No change in 88 mg isoflavones No change in Human fasting and Gobert et al., 2010 (genistein, daidzein, indexes of insulin No change in placebo- postprandial —— [36] and glycitein)/day sensitivity and HbA1c levels controlled glucose or insulin equol resistance group levels In vivo Bertoglio et al., Rats 𝛾-Conglutin ↓Glucose level in 2011 placebo- 10.5 mg, 21 mg, and ———— blood [37] controlled 42 mg trial In vivo 𝛾-Conglutin Bertoglio et al., Human 157.5 mg, 315 mg, and ↓Glucose level in 2011 placebo- ———— 630 mg blood [37] controlled trial In vivo Dove et al., 2011 ↓Postprandial Human 22 g lupin protein ———— [38] glycaemia control group In vivo ↓C-Peptide Human concentration in Spadafranca et al., Alpha-amylase ↓Blood glucose ↓Food double-blind, ↑Insulin level — blood plasma 2013[39] inhibitor 6% ∗ 100 mg level intake randomized, ↓Ghrelin after a crossover study meal Vitexin 1, 3, and 15 mg Choo et al., In vivo 50, 100, and 200 mg ↓Postprandial 2012 Mice and rats Isovitexin ———— glycaemia [40] control group 1, 3, and 15 mg 20, 50, and 100 mg ↑Insulin levels in ↓Hyperglycaemia the blood In vivo ↑Glucose Genistein No change in No No Fu et al., 2012 [41] Mice tolerance— — 250 mg ∗ kg (−1)/day insulin sensitivity change change control group positive 𝛽 cells of ↑Number of the islets insulin ↓Total cholesterol and triglyceride In vivo ↑HDL levels Human Squadrito et al., Genistein No ↓Systolic and placebo- ↓Glucose levels ↓Insulin levels — 2013 [42] 54 mg/day change diastolic BP controlled ↓Visfatin and trial homocysteine levels In vivo Genistein Kim and Lim, No ↑Food Mice 0.1%, 0.025% in daily 0.025 ↓FBG — 2013 [43] change intake control group diet Loi et al., In vivo Alpha-amylase ↓Blood glucose ↓Food 2013 Rats inhibitor/caffeoylquinic —— — level intake [44] control group acid In vivo Park et al., 2013 Daidzein 10 mg ∗ kg ↓Postprandial Mice ———— [45] body weight/day glycaemia control group 6 Evidence-Based Complementary and Alternative Medicine

Table 1: Continued. Body Food Authors Typeofstudy Bioactivecompounds Glycaemia Insulin Other activities weight intake Yao and Ren, In vivo Extruded adzuki bean ↓Blood glucose 2014 Rats extract ———— level [46] control group 200 mg In vivo Capraro et al., Rats 𝛾-conglutin ↓Glucose level in ↓Food 2014 placebo- —— — 125 mg blood intake [47] controlled trial glucoselevelsinmicetreatedwithdaidzeinwerelowerthan and triglyceride decreased statistically at both time points inboththecontrolmiceandmicefedadietsupplemented compared to the placebo. HDL levels increased significantly with acarbose. When daidzein was added to healthy mice inthegrouptreatedwithgenistein.Intheplacebogroupthere diet, the increase in postprandial blood glucose levels was was no change. Systolic and diastolic blood pressure were significantly inhibited16.79 ( ± 2.08, 18.72 ± 1.03,and15.37 ± significantly reduced in the group receiving genistein. BMI 2.10 mmol in 30, 60, and 120 minutes, respectively, 𝑃 ≤ 0.05). showed no significant changes in both groups. Visfatin and The postprandial blood glucose levels in healthy mice treated homocysteine levels were significantly reduced at 6 and 12 with daidzein starch were also significantly lower𝑃 ( ≤ 0.05). months of the study only in the group receiving genistein Similarly, the area under the curve of blood glucose levels in [42]. thediabeticmicegroupfedwithstarchanddaidzein(2043.0± In a randomized, double-blind, placebo-controlled 204.9 mmol min L) was significantly lower (𝑃 ≤ 0.05)than group, Gobert et al. studied the effects of soy protein and the control group (204.2 ± 2475.2 mmol min L) [45]. isoflavones and did not receive a positive result. Adults with In vitro studies indicate both the effect of (S)-equol to acti- type 2 diabetes (𝑛=29) consuming a diet containing soy vate PPAR and the elevation in the expression of GLUT4 and protein (SPI) and milk protein isolate (MPI) were studied. IRS-1bywhichinturnsuspendsinsulin-stimulatedglucose Thestudylasted57days.PeriodsofdietarySPIandMPI uptake in adipocytes. Other in vitro studies have shown that were separated by 4 weeks of washout. Blood samples were (S)-equol affects rat gene SHARP 2. The conclusions of both collectedondays1and57ofeachtreatmentperiodfor studies indicate that (S)-equol and daidzein may be useful in analysis of fasting HbA1c, postprandial and fasting plasma the control of type 2 diabetes [51, 52]. glucose, and a fasting serum insulin level and the calculated ratios and sensitivity to insulin resistance. In order to analyse isoflavone in urine, samples were collected 24 hours after the 3.2. Clinical Studies. Clinical studies show conflicting results. endofeachtreatmentperiod.Isolateswerecomparableto Genistein does not affect glucose transporter-2 expres- the following energy and nutrient contents per day: 837 kJ, sion or adenosine triphosphate (ATP) cellular production 8-9 grams of carbohydrates, 40 g protein from soy (SPI) but increases pyruvate-stimulated insulin secretion in INS- or milk (MPI), 88 mg (SPI), or 0 mg (MPI) isoflavones 1E cells, which indicates that insulin secretory function (65% genistein, 31% daidzein, and 4% glycitein). Isoflavone improvement through long-lasting exposure to genistein is excretion was significantly higher in the SPI group compared not connected with alternative glucose uptake or glycoly- with the MPI. 20.7% of patients (𝑛=6)wereclassified sis pathways. Increased insulin secretion due to genistein as equol excretors. Consumption of the SPI diet did not 2+ is connected with increased intracellular Ca ion gra- significantly influence the level of fasting and postprandial dient and is protein kinase A dependent together with glucose, insulin, fasting HbA1c, and indexes of insulin new proteins synthesis, and this effect is utterly blocked sensitivity and resistance. by N-[2-(p-bromocinnamylamino)ethyl]-5 or isoquinoline When the authors considered the analysis of equol excre- sulphonamide cycloheximide. These results prove that genis- tors as a variable in the statistical model the results were not tein may be a new bioactive compound displaying antidi- changed and there was no significant interaction between abetic effects owing to pancreatic 𝛽 cell insulin secretion equol production by individuals and diet treatment without improvement [32]. the markers of glycemic control [36]. In a randomized study of a 12-month, double-blind trial, a placebo controlled trial was attended by 120 women with metabolic syndrome, aged 49–67 years, and postmenopausal 4. Alpha-Amylase Inhibitors for at least 12 months. They received either genistein𝑛= ( 60), 54 mg/day, or a placebo (𝑛=60). Genistein in serum Proteins are one of the basic components of food but increased after 6 and 12 months only in patients in the group have different nutritional values because they contain very treated with genistein. In this group glucose and insulin levels different amino acid compositions. The value is determined were significantly decreased. These two parameters did not bythenumberofaminoacidsofproteins,theirqualitative change in the placebo group. Horizontal total cholesterol composition, bioavailability, and digestibility. Proteins ensure Evidence-Based Complementary and Alternative Medicine 7 proper construction of tissue, regulate metabolic processes, triglyceride level decrease in the group obtaining the extract. and facilitate the absorption of minerals. Peptides derived The differences were not statistically significant [24]. Another from food proteins affect the circulatory system, nervous control examination carried out among 10 participants with system, alimentary system, immune system, and functional normoglycaemia proved that phaseolamin caused a quicker properties. One of several activities is regulation of enzyme postprandial glycaemia reduction than in the control group, inhibitory peptides. At the cellular level proteins can act by and glucose absorption was 57% lower [56]. inactivating ribosomes or inhibiting the active site cell, such In a randomized, double-blind, placebo-controlled study as alpha-amylase inhibitors [53]. examining 60 overweight (5–15 kg above) people, Celleno et The monitoring of carbohydrate digestion as well as al. showed that the use of Phase 2 results in a statistically glucose absorption enables better control of postprandial gly- significant decrease in body weight, fat mass, and WHR. caemia, especially after highly carbohydratic meals. Released Patients received either one 445 mg tablet of Phase 2 + 0.5 mg glucose is absorbed by intestinal enterocytes through trans- chromium picolinate or a placebo daily for 30 consecutive mitters. Digestive enzyme inhibition or glucose transporters days prior to a meal rich in carbohydrates (2000–2200 calo- reduceglucosereleaseandabsorptioninthesmallintes- ries).Bodyweight,BMI,fatmass,adiposetissuethickness, tine and, as a consequence, suppress postprandial hypergly- and waist,/hip/ thigh circumferences were reduced after 30 caemia. days [26]. In the in vitro research it was proved that white beans bind Wu et al. in a randomized, double-blind, and placebo- alpha-amylase forming a 1 : 1 complex blocking the enzyme. controlled study examined 101 volunteers ( 50 placebo group The research on rats showed that it decreases basic and and 51 study group) with a BMI between 25 and 40. The postprandial glucose levels in blood. Moreover, it diminishes study group received two 1000 mg Phase 2 capsules or a appetite, which, in turn, contributes to weight control [54]. reference substance in the form of two capsules containing In three experiments on healthy Wistar rats, Loi et al. microcrystalline cellulose of a volume and appearance of the studied the effect on hypoglycaemia and decreasing food capsules of Phase 2. Subjects treated with Phase 2 showed intake of Phaseolus vulgaris extract (PVE) and Cynara scoly- a statistically significantly greater decrease in both body mus extract (CSE). In experiment 1, 36 rats were divided into weight 1.9 kg compared to 0.4 kg in the placebo group and 4groups(𝑛=9). Three days before the experiment, rats were waist circumference 1.9 cm compared to 0.4 cm. Accordingly, treated acutely with three different compositions of PVE, body weight and BMI dropped significantly too. There was CSE, PVE+CSE, or without extracts. In experiment 2, 32 rats no significant change in hip circumference. Among the were used. Rats were fed a chocolate drink, a normal chow biochemical parameters, only the creatinine value was higher diet, and water. After 15 days feeding rats were divided into 4 andGPTlowerinthegroupreceivingPhase2;however,the groups (𝑛=8) and treated acutely for 3 days like the previous differences were not statistically significant [35]. group. In experiment 3, 28 rats, after 6-hour fasting, were In further studies, the authors obtained statistically sig- divided into 4 groups (𝑛=7)ofthreedifferentcompositions nificantresultsbutthetestedgroupswerenotverylarge. of PVE, CSE, PVE+CSE (the doses were different compared UdaniandSinghresearchusedarandomized,double- to groups 1 and 2), or without extracts. When the lights in blank test method, which lasted 4 weeks and involved 25 the cages were off rats were fed 3 g/kg starch. In experiment healthy participants. Twice a day the tested subjects con- 1, administration compositions which included only PVE or sumed 1000 mg fractionated white bean PVE or placebo PVE+CSE showed a statistically significant effect in lowering between meals. All the tested participants were additionally blood glucose and consumption over 24 hours (𝑃 ≤ 0.0001). subjectedtoaweight-lossplanwhichwasbasedonadiet There was a reduction of food intake by an average of 25%. (some participants consumed high-carbohydratic meals) and In experiment 2, after consuming a chocolate beverage on exercises. In both groups, that obtaining the extract and thetestdayadecreaseinbloodglucoseandfoodintakewas that receiving the placebo, weight loss was observed. A noted in the PVE and PVE+CSE groups compared to the division was made in respect to the amount of consumed control group (𝑃 ≤ 0.0005). The reduction of food intake was carbohydrates. In the group placed in the highest tertile of on average 35%. As a result of experiment 3 the PVE+CSE carbohydrate uptake, the tested panel obtaining fractionated (𝑃 ≤ 0.005) group showed a statistically significant decrease white bean PVE, there was a significantly bigger weight loss in blood glucose levels to 33% [44]. together with fatty mass decrease compared to the placebo Whitebeanextract,apartfromalpha-amylaseinhibition, group (𝑃 = 0.042)[25]. stimulates cholecystokinin (CCK) and disturbs the food Udanietal.againtestedPhase2impactonbloodglucose uptake mechanism. A high ratio of phaseolamin application levels in conducted open-label, crossover, 6-arm, randomized weakens rat growth speed [55]. The research conducted on studyof13peoplewithaBMIof18–25.Thistimetheauthors people showed contradictory results. wanted to determine whether the addition of Phase 2 of high- Udani et al. tested the influence of water extract of a GI foods (white bread) lowers GI. They carried out GI stan- common white bean on weight loss and triglyceride level. dardized tests by measuring blood glucose concentrations The randomized examination was carried out using a double- after consumption of white bread with butter, with and with- blanktestonapanelof39obesepeople(35womenand4 out the addition of Phase 2 in the form of capsules or powder. men) who were given 1500 mg water extract of a common In both preparations, Phase 2 was administered at dosages white bean with their meals, twice a day. The examination up to 1500 mg, 2000 mg, and 3000 mg. Phase 2 powder was lasted 8 weeks. The results showed a higher weight loss and mixed with butter. The dosage of 2000 mg and 3000 mg Phase 8 Evidence-Based Complementary and Alternative Medicine

2 capsules resulted in a slight reduction in GI. The dosage patients owing to its high alimentary fibre contents as well as of 1500 mg and 2000 mg of Phase 2 powder caused a slight protein [58]. The latest research has confirmed large amounts reduction in GI. A significant result was obtained with dosage of bioactive components in its contents, including phenol of 3000 mg Phase 2 powder which is about 34.11% reduction compounds [59]. Itoh et al. proved that “Azuki” beans display in blood glucose levels after a meal𝑃 ( = 0.023)[34]. alpha-glucosidase enzyme blocking activity in rats with STZ- Vinson et al. obtained similar results to Udani et al. when induced diabetes. It has also been observed that “Azuki” man- they conducted 2 studies, a crossover study and a placebo- ifests the highest ability to block this enzyme among sixteen controlled one. The first study involved 11 respondents (men other bean variations. Research on antidiabetic “Azuki” bean and women, aged 21 to 57). Subjects were given 4 slices of property has focused mainly on bean extract activity, and its whitebreadand42gmargarinesupplementedornotwith components have not been defined strictly [60]. 1500mgofPhase2.Phase2wasaddedtothemargarine. Sreerama et al. in their research conducted on extracts The meals were 610 calories and 60.5 g carbohydrates. Tests of four-bean variations (mung, moth, red, and black “Azuki” were made one week apart measuring glucose concentrations variations) confirmed the biggest influence in terms of alpha- inbloodplasma.Inthestudygroupaverageplasmaglucose glucosidase blocking in the black “Azuki” bean variation. concentration versus the time curve was 66% lower compared Mung beans showed the least activity [57]. to the control group (𝑃 ≤ 0.05). It is concluded that the In their research, Yao et al. for the first time ascribed addition of 1500 mg of Phase 2 to the meal will absorb 1/3 compounds present in “Azuki” beans which are active and carbohydrates from white bread. In the second study with display alpha-glucosidase enzyme blocking activity. Using 7 patients (men and women aged 23–43 years) the authors 70% of ethanol, the authors extracted four fractions out of tested another lower dosage of Phase 2: 750 mg. Members “Azuki”beans.Theethylacetate(EtOAc)solublefraction had previously eaten frozen meals consisting of fried steak, manifested the biggest alpha-glucosidase blocking activity. mashed potatoes, green beans, and cherry-apple pie with Two major active components, vitexin and isovitexin, were or without 750 mg of Phase 2 (mixed with the sauce). The isolated from “Azuki” beans. Fluorescent spectroscopy exam- meals were 630 calories and 64 g of carbohydrates. The study ination corroborated these flavonoid properties. The most ∘ decreased average plasma glucose concentrations versus time beneficial effect is achieved at the temperature of 37 C, in curve by 28%. It is concluded that 2/3 of carbohydrates from laboratory conditions [21]. themealwereabsorbed.Itcanbeseenfromtheresultofthe Earlier authors have studied the antidiabetic effects of dose dependency [33]. mung bean sprout extract (MBS: DCI, vitexin and isovi- Spadafranca et al., as with previous authors, studied the texin: 24.16, 11.68, 5.40 mg/g) and mung bean seed coat impact of PVE on the levels of glucose and insulin, C-peptide extract (MBSC: DCI, vitexin and isovitexin: 0.0053, 15.22 concentrations in blood plasma, and ghrelin after a meal and 11.42 mg/g) using mice with type 2 diabetes: 50 KK- and the impact on the control of appetite. A double-blind, Ay male mice and 10 healthy male mice C57BL/6. Diabetic randomized, crossover study included 12 healthy subjects mice were divided into five groups and fed different dosages (6 women, 6 men) aged 20–26 years, with normal weight MBS (1, 2, 3 g/kg), MBSC (3 g/kg), and without extracts. (BMI:19.7–23.5,fat:31.5–11.5%).Thesubjects,infastingstate Group 6 included C57BL/6 mice. For all mice the follow- for at least 12 hours, received standardized meals consisting ing were measured: glucose blood, the plasma C-peptide, of a sandwich of white bread, ham, butter, and tomato glucagon, total cholesterol, triglycerides, and blood urea +100 mg tablets of PVE (≥6% tested alpha-amylase inhibitor nitrogen (BUN). Oral administration of MBS (3 and 2 g/kg) and phytohemagglutinin) or 100 mg placebo tablets. PVE or and MBSC (3 g/kg) showed lowered blood glucose levels placebo tablets were consumed just before a meal. After a 7- compared with control KK-Ay mice. The supplementation day washout period the test was repeated. PVE supplemen- of MBS (2 g/kg) and MBSC (3 g/kg) reversed the blood C- tation reduced postprandial glucose, insulin, and C-peptide peptide and glucagon levels in type 2 diabetic animals as excursions and affected satiety sensations, inducing a lower compared with untreated diabetic mice. In mice fed with desiretoeat[39]. MBSC and 3 and 2 g/kg MBS increases in triglycerides and total cholesterol level were eliminated. The plasma levels of BUN in MBS groups (2 g/kg) were lowered as compared 5. Alpha-Glucosidase Inhibitors with the KK-Ay mice control group. Mice which have taken MBS (2 g/kg) and MBSC (3 g/kg) had a significant increase Alpha-glucosidase generated by the small intestine epithe- in insulin immunoreactivity as compared with untreated lium is one of the key enzymes responsible for carbohydrate diabetic mice [28]. digestion and triglyceride absorption. Its function is one Chooetal.obtainedpositiveresultsinhealthyand of the modulating factors of postprandial hyperglycaemia. diabetic animals, and they also investigated the inhibitory Intestinal alpha-glucosidase activity suppressors, just like effect of isovitexin and vitexin from Ficus deltoidea for alpha- alpha-amylase, may delay the digestion process and carbo- glucosidase. hydrate absorption and lower postprandial hyperglycaemia AuthorsusedhealthymiceandratswithSTZ-induced [8, 57]. diabetes divided into 8 groups of 6 animals. Six groups of mice “Azuki” beans underwent thorough research into their were dosed by oral gavage at three different dosages (1 mg/kg, biological activity. In Asia, especially in Japan, Korea, and 3 mg/kg, and 15 mg/kg) of vitexin or isovitexin. A positive China, this food is recommended as suitable for diabetic control group of mice were given acarbose (3 mg/kg). Six Evidence-Based Complementary and Alternative Medicine 9 groups of rats were dosed by oral gavage with various dosages in the group taking CA, the triglycerides level was decreased of vitexin (50, 100, and 200 mg/kg) or isovitexin (20, 50, and statistically insignificantly (𝑃 = 0.055). The authors exam- 100 mg/kg). Positive control rats received acarbose (5 mg/kg). ined the alpha-glucosidase blocking faculty of “Azuki” juice After administration of treatments to mice and rats, they were and CA in vitro.A100mqdosageofbeanextractreduced treated with sucrose at 2.5 g/kg and 4 g/kg, respectively. Nor- enzyme activity by 32.6% [27]. moglycemic mice given 1 mg/kg vitexin showed a significant (𝑃 ≤ 0.05) reduction in blood glucose levels by 24.7%. At higher dosages of 3 and 15 mg/kg, the percentage reduction 6. Conglutin Gamma Protein increased to 26.5% and 31.3%. When mice were given 1, 3, and 15 mg/kg isovitexin blood glucose levels were significantly Lupinplants,growinginpopularityinWesternEuropeand (𝑃 ≤ 0.05) lower at 30 minutes. The highest (19.7%) Australia, are acknowledged alongside soya as one of the most reductioninbloodglucoselevelwasobservedindiabetic valued vegetable protein sources. In in vitro research, using rats at 60 minutes when 200 mg/kg vitexin was administered lupin isolated protein called conglutin gamma has proved to orally. After administration of 100 mg/kg isovitexin the largest possess an insulin-binding property and to lower postpran- reduction in blood glucose level was observed (19.7%). The dial glycaemia. This activity has been compared to metformin administration of all three doses of isovitexin significantly [61]. In randomized research on 24 adult individuals it has (𝑃 ≤ 0.05) reduced postprandial blood glucose concentra- been proved that adding lupin kernel flour with 12.5 g fiber tions [40]. and 22 g protein (lupin) into a drink containing 50 g glucose The extrusion is the next method to obtain extracts led to postprandial glycaemia reduction compared to subjects from “Azuki” beans. This method decreases the antioxidant from a control group, consuming a drink with 50 g glucose activity in extruded “Azuki” beans by 41.86% and increases added. Similar results were achieved in a group consuming the antidiabetic activity in inhibited rat intestinal alpha- a drink with 50 g glucose added plus 12.5 g fiber and 22 g glucosidase in extruded “Azuki” beans by 307.60% compared protein from soya isolates (soya) [38]. to raw “Azuki” beans. Capraroetal.studiedcontrolledbodyweightgainand Yao and Ren studied the antidiabetic effects of extruded hypoglycemic properties proteins derived from Lupin plants “Azuki” beans on 80 male rats fasting. In 40 rats, diabetes was including conglutin gamma. Authors observed by 3 weeks, induced using 45 mg/kg STZ. Healthy and diabetic rats were two groups of rats (fed pasta with or without addition of pure divided into 4 groups each: control group, positive control protein from Lupinus). In the results a significant reduction in group (50 mg/kg acarbose), extract “Azuki” bean group (ABE, food intake and glycaemia was observed in animals fed pasta 200 mg/kg), and extract extruded “Azuki” bean group (EABE, with supplemented lupin protein [47]. 200 mg/kg). 30 minutes after administration of treatment In another experiment, Bertoglio et al. investigated the the animals were orally administered fasted sucrose (2 g/kg). characteristics of dried extract rich in conglutin gamma (con- In the control group of healthy rats, blood glucose levels glutin gamma content was about 47% of the total proteins in averaged 10.4 mmol/L 30 minutes after the administration of thedrypowder)inrats,andforthefirsttimeinhumans.The sucrose.InthegrouptreatedwithEABEtheglucoselevel animal study was conducted on 100 rats divided into 5 groups: after 30 min only averaged 8.79 mmol/L j in comparison with placebo, positive control group (50 mg/kg metformin), and thecontrolgroup.Bloodglucoselevelsdroppedby15.6%in three groups with different dosages of conglutin gamma (10.5, the treatment with EABE and by 22.6% in the treatment with 21.0, and 42.0 mg). 30 minutes before the glucose overloading acarbose. In the control group of diabetic rats blood glucose experiment (2 g/kg) the treatment was administrated. At levels rose to an average of 31.2 mmol/L 30 minutes after 0, 30, 60, and 90 min from glucose administration all rats sucrose administration. However, the measurement of blood received a dose of 50 mg/kg Na thiopental. Another part of glucose levels in the groups that received EABE and acarbose the study concerned humans (a placebo-controlled study) was difficult to do. Compared with the control group, the and was performed on 15 healthy adult participants. By 7 glucoseleveldecreasedby28.4%inthecaseofadministration weeks, participants were offered either one of three doses of of 300 mg/kg EABE and 23.0% when administered with powder from Lupin plant extract (750, 1500, and 3000 mg 20 mg/kg acarbose [46]. = 157.3, 315, and 630 mg conglutin gamma) or placebo 30 For comparison, Maruyama et al. tested “Azuki” bean minutes before a meal consisting of 85 g of white rice (75 g extract activity on a panel of 33 female students. The mean age carbohydrate). A study on rats showed a statistically signif- ofthe33subjectswas21.3 ± 0.8 years, BMI 19.8 ± 1.5,non- icant correlation between the dosage of powder extract and smokers, without metabolic diseases, and with regular men- blood glucose level. According to the dosage level of glucose, strual cycles, who had not used preparations with “Azuki” it was reduced by 14%, 42%, and 64%. The effect obtained bean extract before. The chosen method was a double-blank after administration of the highest dosage was not different test. The subjects were randomly divided into three groups: from the effect of the administration of 50 mg/kg metformin. control, “Azuki,” and concentrated “Azuki” (CA) juice. All The results of human studies confirmed the hypoglycemic drank 150 g of the isocaloric assigned juice 5 times a day for properties of conglutin gamma. Compared to the control one menstrual cycle, along with their staple diet uptake. The group, after three doses in 60 minutes lowered glucose levels results showed that in the control group body weight went averaged 81%. In 90 minutes, the 750 mg dosage caused an up slightly and triglyceride level was decreased substantially increase of the glucose level to 83% when compared to the within the group consuming bean juice (𝑃 ≤ 0.05), whereas placebo,but1500mgincreasedabout61%andthedosage 10 Evidence-Based Complementary and Alternative Medicine of 3000 mg increased the glucose level about 71% compared (4) Leguminous plants should be employed in the pro- totheplacebogroup.Asaresultofmeasurementsofthe motion of a healthy lifestyle as a form of functional areasunderthecurveglucosewassignificantlydecreasedby food. dosages of 1500 mg of 75% and 3000 mg of 79% compared to (5) More studies are required to estimate the potential placebos. There were no significant differences in the level of role of the leguminous plants in therapy including serum insulin [37]. cancer, inflammation, and coronary diseases.

7. Bioavailability of Bean Active Components Abbreviations The interest in active components included in food is caused ABE/EABE: Adzuki bean extract/extruded adzuki predominantly by the results of epidemiological examina- bean extract tions. In order to establish unambiguous evidence of the ACC: Acetyl-CoA carboxylase effectiveness of these compounds, including polyphenols, in Alfa-AI1: a-Amylaseinhibitorisoform1 their role as disease prophilaxy, it is indispensable to deter- Alfa-AI2: a-Amylaseinhibitorisoform2 mine their bioavailability and next their biological activity. Alfa-AIL: a-Amylaseinhibitorisoformlike Bioavailability of assorted phenol compounds varies a lot, AMPK: AMP-activated protein kinase and those which are mostly consumed in a staple diet do not ATP: Adenozynotrifosforan always manifest positive bioavailability profiles [62]. Themajorityoftheresearchtasksdealingwiththeinflu- BMI: Body mass index ence of phenol compounds coming from food products were BUN: Blood urea nitrogen conducted under in vitro conditions or on animal models, CA: Concentrated Azuki considering concentrations higher than those consumed in cAMP: Cyclic adenosine monophosphate an everyday diet. It should be noted that polyphenol profiles CCK: Cholecystokinin for the given product usually remain the same, whereas CSE: Cynara scolymus extract differences in concentrations occur, for example, in the case DMC: Diabetic mice control group of Cabernet Sauvignon wine grapes in the Napa Valley DMH/DMH-C: Diabetic mice height FBG/-control (California, USA) in 1989. It contained 0.9 mg/L resveratrol, group while in the year 1994 it contained 8.9 mg/L. DMMH/DMMH-C: Diabetic mice medium hight The main factors influencing polyphenol bioavailability FBG/-control group are as follows: environmental factors (exposure to sun rays, EGCG: Epigallocatechingallate maturity level), food product availability, cooking and heat EtOAc: Ethylacetate treatment, homogenisation, lyophilisation, storage, and the FBG: Fasting blood glucose presence of other compounds which suppress or enhance GI: Glycemic index assimilation, compounds made with proteins or other GLUT4: Insulin-regulated glucose transporter polyphenols with similar absorption mechanisms, chemical GPT: Glutamatepyruvatetransaminase structure, concentrations in food, the amounts consumed GSIS: Glucose-stimulated insulin secretion with food, enzyme activity, intestinal passage time, intestinal INS-1E: Clone cells insulin secretion microflora composition, age, health condition, genetic fac- IRS-1: Insulin receptor substrate 1 tors, and physiological conditions [62]. KATP : ATP-sensitive potassium Compounds found in leguminous plants, whose antidia- MBS/MBSC: Mung bean sprouts extract/mung betic activity is supported by laboratory tests and on animal bean seed coat extract models (e.g. genistein, daidzein, alpha-amylase, and alpha- mTOR: Pathwaymammaliantargetof glucosidase inhibitors) display low bioavailability, genistein rapamycin mainly due to its poor solubility in water. Alpha-amylase and PEPCK: Phosphoenolpyruvate carboxykinase alpha-glucosidase enzymes inhibitors lose their properties in PGC-1𝛾: Peroxisome proliferator-activated heat treatment time [20, 60, 62]. receptor 𝛾 coactivator PHA: Phytohaemagglutinin 8. Conclusion PPAR𝛼: Peroxisome proliferator-activated receptor alpha (1) Legumes should constitute a permanent dietary ele- 𝛾 PPR1 : Peroxisome proliferator-activated ment in a balanced diet, especially with type 2 diabetic receptor gamma coactivator patients. PVE: Phaseolus vulgaris extract (2) Legumes are a source of wholesome protein, ali- ROS: Reactive oxygen species mentary fiber, and bioactive substances displaying S6K1: Ribosomal protein S6 kinase beta-1 antioxidant activity together with anti-inflammatory SHARP 2: Hypoxia-regulated transcription and antineoplastic properties. factor (3) The in vitro research using leguminous plants extracts SPI/MPI: Diet containing soy protein/diet confirmed their antidiabetic properties. containing milk protein. Evidence-Based Complementary and Alternative Medicine 11

Conflict of Interests [18] W. C. Obiro, T. Zhang, and B. Jiang, “The nutraceutical role of the Phaseolus vulgaris 𝛼-amylase inhibitor,” British Journal of The authors declare that there is no conflict of interests. Nutrition,vol.100,no.1,pp.1–12,2008. [19] A. M. Iguti and F. M. Lajolo, “Occurrence and purification of 𝛼- References amylase isoinhibitors in bean (Phaseolus vulsaris L.)varieties,” Journal of Agricultural and Food Chemistry,vol.39,no.12,pp. [1] L. Guariguata, “Tracking the global epidemic—new estimates 2131–2136, 1991. from the IDF diabetes atlas update for 2012,” Diabetes Voice,vol. [20] M. L. Barrett and J. K. Udani, “Aproprietary 𝛼-amylase inhibitor 57, no. 3, pp. 12–15, 2012. from white bean (Phaseolus vulgaris): a review of clinical studies [2] K. Korzeniowska and A. Jabłecka, “Cukrzyca (czę´sc´ I),” Farma- on weight loss and glycemic control,” Nutrition Journal,vol.10, cja Wspołczesna´ ,vol.1,pp.231–235,2008. article 24, 2011. [21] Y. Yao, X. Cheng, L. Wang, S. Wang, and G. Ren, “A determi- [3] W. Wieteska-Skrzeczynska´ and K. Grzelkowska-Kowalczyk, 𝛼 “Molekularne mechanizmy insulinooporno´sci—ich znaczenie nation of potential -glucosidase inhibitors from azuki beans wpowstawaniucukrzycytypu2,”Medycyna Metaboliczna,vol. (Vigna angularis),” International Journal of Molecular Sciences, 3, pp. 37–45, 2010. vol. 12, no. 10, pp. 6445–6451, 2011. [22]X.F.Peng,Z.P.Zheng,K.-W.Chengetal.,“Inhibitoryeffectof [4]Y.Bi,T.Wang,M.Xuetal.,“Advancedresearchonriskfactors mung bean extract and its constituents vitexin and isovitexin of type 2 diabetes,” Diabetes/Metabolism Research and Reviews, on the formation of advanced glycation endproducts,” Food vol. 28, pp. 32–39, 2012. Chemistry,vol.106,no.2,pp.475–481,2008. [5] M. Gornicka,´ J. Pierzynowska, M. Wi´sniewska, and J. [23]X.Wang,Y.Liang,L.Zhuetal.,“Preparativeisolationand ˙ Frąckiewicz, “Analiza spozycia suchych nasion ro´slin purification of flavone C-glycosides from the leaves of Ficus strączkowych w latach 1999–2008 w Polsce,” Bromatologia microcarpa L.f by medium-pressure liquid chromatography, iChemiaToksykologiczna, vol. 4, pp. 1034–1038, 2011. high-speed countercurrent chromatography, and preparative [6] M. Soral-Smietana´ and U. Krupa, “Wpływ czynnikow´ fizy- liquid chromatography,” Journal of Liquid Chromatography & cznych na dostępno´sc´ enzymatyczną in vitro białek nasion fasoli Related Technologies,vol.33,no.4,pp.462–480,2010. ˙ (Phaseolus Sp.),” Zywno´s´c. Nauka. Technologia. Jako´s´c,vol.2,pp. [24] J. Udani, M. Hardy, and D. C. Madsen, “Blocking carbohydrate 121–132, 2005. absorption and weight loss: a clinical trial using phase 2 [7] P. Leterme, “Recommendations by health organizations for brand proprietary fractionated white bean extract,” Alternative pulse consumption,” British Journal of Nutrition,vol.88,sup- Medicine Review,vol.9,no.1,pp.63–69,2004. plement 3, pp. S239–S242, 2002. [25] J. Udani and B. B. Singh, “Blocking carbohydrate absorption and [8] K. Hanhineva, R. Torr¨ onen,¨ I. Bondia-Pons et al., “Impact weight loss: a clinical trial using a proprietary fractionated white of dietary polyphenols on carbohydrate metabolism,” Interna- bean extract,” Alternative Therapies in Health and Medicine,vol. tionalJournalofMolecularSciences, vol. 11, no. 4, pp. 1365–1402, 13, no. 4, pp. 32–37, 2007. 2010. [26]L.Celleno,M.V.Tolaini,A.d’Amore,N.V.Perricone,and [9] http://www.fao.org. H. G. Preuss, “A dietary supplement containing standardized [10]D.-U.Richter,S.Abarzua,M.Chrobaketal.,“Effectsofphy- Phaseolus vulgaris extract influences body composition of toestrogen extracts isolated from flax on estradiol production overweight men and women,” International Journal of Medical and ER/PR expression in MCF7 breast cancer cells,” Anticancer Sciences,vol.4,no.1,pp.45–52,2007. Research,vol.30,no.5,pp.1695–1699,2010. [27] C. Maruyama, R. Araki, M. Kawamura et al., “Azuki bean [11] K. D. Setchell and A. Cassidy, “Dietary isoflavones: biological juice lowers serum triglyceride concentrations in healthy young effects and relevance to human health,” Journal of Nutrition,vol. women,” Journal of Clinical Biochemistry and Nutrition,vol.43, 129, no. 3, pp. 758–767, 1999. no. 1, pp. 19–25, 2008. [28] Y. Yao, F. Chen, M. Wang, J. Wang, and G. Ren, “Antidiabetic [12] G. G. Kuiper, B. Carlsson, K. Grandien et al., “Comparison of 𝑦 activity of Mung bean extracts in diabetic KK-A mice,” Journal the ligand binding specificity and transcript tissue distribution of Agricultural and Food Chemistry,vol.56,no.19,pp.8869– of estrogen receptors 𝛼 and 𝛽,” Endocrinology,vol.138,no.3,pp. 8873, 2008. 863–870, 1997. [29] M.S.Choi,U.J.Jung,J.Yeo,M.J.Kim,andM.K.Lee,“Genistein [13] G. G. Kuiper, J. G. Lemmen, B. Carlsson et al., “Interaction and daidzein prevent diabetes onset by elevating insulin level of estrogenic chemicals and phytoestrogens with estrogen and altering hepatic gluconeogenic and lipogenic enzyme activ- receptor 𝛽,” Endocrinology,vol.139,no.10,pp.4252–4263,1998. ities in non-obese diabetic (NOD) mice,” Diabetes/Metabolism [14] J. L. Limer and V. Speirs, “Phyto-oestrogens and breast cancer Research and Reviews,vol.24,no.1,pp.74–81,2008. chemoprevention,” Breast Cancer Research,vol.6,no.3,pp.119– [30] D.-J. Kim, Y.-J. Jeong, J.-H. Kwon et al., “Beneficial effect of 127, 2004. chungkukjang on regulating blood glucose and pancreatic 𝛽- [15] S. Barnes, H. Kim, V. Darley-Usmar et al., “Beyond ER𝛼 and cell functions in C75BL/KsJ-db/db mice,” Journal of Medicinal ER𝛽: estrogen receptor binding is only part of the isoflavone Food,vol.11,no.2,pp.215–223,2008. story,” Journal of Nutrition,vol.130,no.3,pp.656–657,2000. [31] C. R. Cederroth, M. Vinciguerra, A. Gjinovci et al., “Dietary [16] S. F. Brouns, “Soya isoflavones: a new and promising ingredient phytoestrogens activate AMP-Activated protein kinase with for the health foods sector,” Food Research International,vol.35, improvement in lipid and glucose metabolism,” Diabetes,vol. no. 2-3, pp. 187–193, 2002. 57, no. 5, pp. 1176–1185, 2008. [17] K. D. R. Setchell and C. Clerici, “Equol: history, chemistry, and [32] Z. Fu and D. Liu, “Long-term exposure to genistein improves formation,” JournalofNutrition,vol.140,no.7,pp.1355S–1362S, insulin secretory function of pancreatic 𝛽-cells,” European 2010. Journal of Pharmacology,vol.616,no.1–3,pp.321–327,2009. 12 Evidence-Based Complementary and Alternative Medicine

[33] J. A. Vinson, H. Al Kharrat, and D. Shuta, “Investigation of diabetic cataracts in streptozotocin-induced diabetic rats,” an amylase inhibitor on human glucose absorption after starch Nutrition Research,vol.28,no.7,pp.464–471,2008. consumption,” The Open Nutraceuticals Journal,vol.2,pp.88– [49] H. Liang and W. F. Ward, “PGC-1𝛼: a key regulator of energy 91, 2009. metabolism,” American Journal of Physiology,vol.30,no.4,pp. [34] J. K. Udani, B. B. Singh, M. L. Barrett, and H. G. Preuss, 145–151, 2006. “Lowering the glycemic index of white bread using a white bean [50] C. Postic and J. Girard, “Contribution of de novo fatty acid extract,” Nutrition Journal,vol.8,article52,2009. synthesis to hepatic steatosis and insulin resistance: lessons [35]X.Wu,X.Xu,J.Shen,N.V.Perricone,andH.G.Preuss, from genetically engineered mice,” The Journal of Clinical “Enhanced weight loss from a dietary supplement containing Investigation,vol.118,no.3,pp.829–838,2008. standardized Phaseolus vulgaris extract in overweight men and [51] A. Haneishi, K. Takagi, K. Asano et al., “Analysis of regulatory women,” Journal of Applied Research,vol.10,no.2,pp.73–79, mechanisms of an insulin-inducible SHARP-2 gene by (S)- 2010. equol,” Archives of Biochemistry and Biophysics,vol.525,no.1, [36]C.P.Gobert,E.A.Pipe,S.E.Capes,G.A.Darlington,J. pp. 32–39, 2012. W. Lampe, and A. M. Duncan, “Soya protein does not affect [52]K.W.Cho,O.-H.Lee,W.J.Banz,N.Moustaid-Moussa,N.F. glycaemic control in adults with type 2 diabetes,” British Journal Shay, and Y.-C. Kim, “Daidzein and the daidzein metabolite, of Nutrition,vol.103,no.3,pp.412–421,2010. equol, enhance adipocyte differentiation and PPAR𝛾 transcrip- [37] J. C. Bertoglio, M. A. Calvo, J. L. Hancke et al., “Hypoglycemic tional activity,” Journal of Nutritional Biochemistry,vol.21,no. effect of lupin seed 𝛾-conglutin in experimental animals and 9,pp.841–847,2010. healthy human subjects,” Fitoterapia,vol.82,no.7,pp.933–938, [53]A.IwaniakandB.Dziuba,“Motifswithpotentialphysiological 2011. activity in food proteins—BIOPEP database,” Acta Scientiarum [38]E.R.Dove,T.A.Mori,G.T.Chewetal.,“Lupinandsoya Polonorum,vol.8,no.3,pp.59–85,2009. reduce glycaemia acutely in type 2 diabetes,” British Journal of [54] M. A. Tormo, I. Gil-Exojo, A. R. de Tejada, and J. E. Campillo, Nutrition,vol.106,no.7,pp.1045–1051,2011. “Hypoglycaemic and anorexigenic activities of an 𝛼-amylase [39] A. Spadafranca, S. Rinelli, A. Riva et al., “Phaseolus vulgaris inhibitor from white kidney beans (Phaseolus vulgaris)in extract affects glycometabolic and appetite control in healthy Wistar rats,” British Journal of Nutrition,vol.92,no.5,pp.785– human subjects,” British Journal of Nutrition,vol.109,no.10,pp. 790, 2004. 1789–1795, 2013. [55] N. Fantini, C. Cabras, C. Lobina et al., “Reducing effect of a [40]C.Y.Choo,N.Y.Sulong,F.Mana,andT.W.Wong,“Vitexin Phaseolus vulgaris dry extract on food intake, body weight, and and isovitexin from the leaves of Ficus deltoidea with in-vivo a- glycemia in rats,” JournalofAgriculturalandFoodChemistry, glucosidase inhibition,” Journal of Ethnopharmacology,vol.142, vol. 57, no. 19, pp. 9316–9323, 2009. no. 3, pp. 776–781, 2012. [56] J. A. Vinson, “Investigation on the efficacy of Phaseolamin [41]Z.Fu,E.R.Gilbert,L.Pfeiffer,Y.Zhang,Y.Fu,andD.Liu, 2250, a purified bean extract from Pharmachem Laboratories,” “Genistein ameliorates hyperglycemia in a mouse model of University of Scranton, 2001. nongenetic type 2 diabetes,” Applied Physiology, Nutrition and [57] Y. N. Sreerama, Y. Takahashi, and K. Yamaki, “Phenolic antiox- Metabolism, vol. 37, no. 3, pp. 480–488, 2012. idants in some Vigna species of legumes and their distinct [42] F. Squadrito, H. Marini, A. Bitto et al., “Genistein in the inhibitory effects on 𝛼-glucosidase and pancreatic lipase activi- metabolic syndrome: results of a randomized clinical trial,” The ties,” Journal of Food Science,vol.77,no.9,pp.C927–C933,2012. Journal of Clinical Endocrinology & Metabolism,vol.98,pp. [58] S. H. Lee, H. K. Chun, H. J. Park, and Y. S. Lee, “Supplementary 3366–3374, 2013. effect of the high dietary fiber rice on blood glucose in diabetic [43] M. J. Kim and Y. Lim, “Protective effect of short-term genistein KK-Ay mice,” The Korean Journal of Nutrition,vol.37,pp.75–80, supplementation on early stage in diabetes-induced renal dam- 2004. age,” Mediators of Inflammation, vol. 2013, Article ID 510212, 14 [59] P.-Y. Lin and H.-M. Lai, “Bioactive compounds in legumes and pages, 2013. their germinated products,” JournalofAgriculturalandFood [44] B. Loi, N. Fantini, G. Colombo et al., “Reducing effect of a Chemistry,vol.54,no.11,pp.3807–3814,2006. combination of Phaseolus vulgaris and Cynara scolymus extracts [60] T. Itoh, N. Kita, Y. Kurokawa, M. Kobayashi, F. Horio, and on food intake and glycemia in rats,” Phytotherapy Research,vol. Y. Furuichi, “Suppressive effect of a hot water extract of 27,no.2,pp.258–263,2013. adzuki beans (Vigna angularis) on hyperglycemia after sucrose [45] M. Park, J. Ju, M. Park, and J. Han, “Daidzein inhibits carbo- loading in mice and diabetic rats,” Bioscience, Biotechnology and hydrate digestive enzymes in vitro and alleviates postprandial Biochemistry,vol.68,no.12,pp.2421–2426,2004. hyperglycemia in diabetes mice,” European Journal of Pharma- [61] M. Duranti, “Grain legume proteins and nutraceutical proper- cology,vol.712,no.1–3,pp.48–52,2013. ties,” Fitoterapia,vol.77,no.2,pp.67–82,2006. [46] Y. Yao and G. Ren, “Suppressive effect of extruded adzuki beans [62] M. d’Archivio, C. Filesi, R. Var`ı, B. Scazzocchio, and R. Masella, (Vigna angularis) on hyperglycemia after sucrose loading in “Bioavailability of the polyphenols: status and controversies,” rats,” Industrial Crops and Products,vol.52,pp.228–232,2014. International Journal of Molecular Sciences, vol. 11, no. 4, pp. [47] J. Capraro, C. Magni, A. Scarafoni et al., “Pasta supplemented 1321–1342, 2010. with isolated lupin protein fractions reduces body weight gain and food intake of rats and decreases plasma glucose concentration upon glucose overload trial,” Food & Function, 2014. [48] M.-P. Lu, R. Wang, X. Song et al., “Dietary soy isoflavones increase insulin secretion and prevent the development of