Enhanced Phosphocholine Metabolism Is Essential for Terminal Erythropoiesis

Enhanced phosphocholine metabolism is essential for terminal erythropoiesis

The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters.

As Published 10.1182/BLOOD-2018-03-838516

Publisher American Society of Hematology

Version Author's final manuscript

Citable link https://hdl.handle.net/1721.1/125205

Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ From www.bloodjournal.org by guest on May 1, 2018. For personal use only. Blood First Edition Paper, prepublished online April 30, 2018; DOI 10.1182/blood-2018-03-838516

Enhanced phosphocholine metabolism is essential for terminal erythropoiesis

Nai-Jia Huang1, Ying-Cing Lin2, Chung-Yueh Lin1,4, Novalia Pishesha1,3, Caroline A.

Lewis1, Elizaveta Freinkman1, Colin Farquharson5, José Luis Millán6, Harvey

Lodish*,1,3,4

1 Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02142, USA.

2Ragon Institute of MGH, MIT and Harvard, Cambridge, MA 02139, USA

3 Department of Biological Engineering, Massachusetts Institute of Technology,

Cambridge, MA 02139, USA

4Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139,

USA

5The Roslin Institute, University of Edinburgh, Easter Bush EH25 9RG, United Kingdom

6Sanford Children’s Health Research Center, Sanford Burnham Prebys Medical

Discovery Institute, La Jolla, CA 92037, USA

* Corresponding author, Email address: [email protected]

PHOSPHO1 regulates phosphocholine metabolism, ATP production, and amino

acid supply during erythropoiesis

Abstract

Red cells contain a unique constellation of membrane lipids. While much is known about regulated protein expression, the regulation of lipid metabolism during erythropoiesis is poorly studied. Here we show that transcription of PHOSPHO1, a phosphoethanolamine and phosphocholine phosphatase that mediates the hydrolysis of phosphocholine to choline, is strongly upregulated during the terminal stages of erythropoiesis of both human and mouse erythropoiesis, concomitant with increased catabolism of phosphatidylcholine and phosphocholine as shown by global lipidomic analyses of mouse and human terminal erythropoiesis. Depletion of PHOSPHO1 impaired differentiation of fetal mouse and human erythroblasts, and in adult mice depletion impaired phenylhydrazine-induced stress erythropoiesis. Loss of PHOSPHO1 also impaired phosphocholine catabolism in mouse fetal liver progenitors and resulted in accumulation of several lipids; ATP production was reduced as a result of decreased oxidative phosphorylation. Glycolysis replaced oxidative phosphorylation in PHOSPHO1 knockout erythroblasts and the increased glycolysis was used for the production of serine or glycine. Our study elucidates the dynamic changes in lipid metabolism during terminal erythropoiesis and reveals the key roles of phosphatidylcholine and phosphocholine metabolism in energy balance and amino acid supply.

Introduction

The lipid and protein organization of the red cell membrane is critical for the survival and deformability of red cells, as elucidated by the pathological disturbances of red cell membranes in several genetic disorders. 1 While most abnormalities, such as

2 From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

spherocytosis and elliptocytosis, are caused by mutant membrane or skeletal proteins, hereditary high red cell membrane phosphatidylcholine hemolytic anemia and spur anemia result from an altered lipid composition. 2,3 Thus, generating and maintaining the specific lipid composition of red cell membranes is essential. 4 Mature red cells can incorporate fatty acids from the circulation and utilize acyl-coenzyme A and an amino- phospholipid translocase to homeostatically maintain the lipid composition. 5 However, the processes by which this specific lipid composition is formed during erythropoiesis remain unclear. Therefore, we performed metabolomic analysis on cells undergoing terminal erythropoiesis to investigate the dynamic changes in lipid metabolism. We delineate a function for catabolism of phosphatidylcholine and its downstream metabolite phosphocholine in directing metabolic activity in terminal erythropoiesis, and show that the PHOSPHO1 gene and its encoded protein is one of the important regulators of these catabolic steps during erythroblast differentiation. These findings expand our understanding of the links between the regulation of lipid composition and energy metabolism during terminal erythropoiesis.

Material and Methods

Flow cytometry analyses and antibodies

All flow cytometry data were acquired on a FACS Fortessa flow cytometer (BD

Biosciences) and analyzed using Flowjo software. All stainings were carried out in FACS buffer (100 μM EDTA and 2% FBS in PBS) for 30 minutes at room temperature unless otherwise described. The following are the antibodies used at 1:100 dilution: anti-human

CD235A-APC (eBioscience, 17-9987042), anti-mouse Ter119-APC (eBioscience, 17-

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

5921-83), and anti-mouse CD71-PE (Affymetrix, 12-0711-83). Hoechst 33342 (Life

Technologies, H1399) was used to visualize nuclei.

Antibodies for western blotting

Anti-AMPKα (Cell Signaling Technology, 2603), anti-Phospho-AMPKα (Thr172) (Cell signaling Technology, 2535), anti-Phospho1 antibody (Abcam, ab90581), anti-GAPDH

(Santa Cruz Biotechnology, sc-32233), anti-beta-actin (BioLegend, 622101)

Human CD34+ cell culture

Granulocyte-colony stimulating factor (G-CSF)–mobilized CD34+ peripheral blood stem cells were thawed according to the vendor’s protocol. Cells were cultured according to methods published previously.6

Isolation of erythroid progenitors from murine fetal liver cells

Enriched erythroid progenitors were purified from E14.5 C57BL/6J mouse embryos, and cultured in vitro for erythroid differentiation following a protocol described in detail previously. 6 Briefly, pregnant C57BL/6J mice at embryonic day 14.5 were sacrificed by

CO2 asphyxiation and their embryos were collected. The fetal livers were isolated and suspended in PBS with 2% FBS and 100 μM EDTA. Mature RBCs in the cell suspension were lysed by incubation for 10 min with an ammonium chloride solution (Stemcell).

Following the manufacturer’s protocol, lineage negative cells were obtained after magnetic depletion of lineage positive cells using the BD Pharmingen Biotin

MouseLineage Panel (559971; BD Biosciences) and BD Streptavidin Particles Plus-DM

(557812; BD Biosciences). These lineage negative fetal liver cells were enriched for more than 90% for erythroid progenitors.

Viral infection and culture of murine erythroid progenitors

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Following the isolation step, lineage negative fetal liver cells were plated in 24-well plates at 100,000 cells per well, covered by 1 ml virus containing supernatant, and centrifuged at 500xg for 90 min at 30°C. After this spin-infection, the virus supernatant was replaced with erythroid maintenance medium (StemSpan-SFEM; StemCell

Technologies) supplemented with 100 ng/mL recombinant mouse stem cell factor (SCF)

(R&D Systems), 40 ng/mL recombinant mouse IGF1 (R&D Systems), 100 nM dexamethasone (Sigma), and 2 U/mL erythropoietin (Amgen) and cultured at 37°C.

GFP+ cells were sorted by flow cytometry after 16 h and cultured for another 48 h in erythroid differentiation medium (Iscove modified Dulbecco’s medium containing 15%

(vol/vol) FBS (Stemcell), 1% detoxified BSA (Stemcell), 500 μg/mL holo-transferrin

(Sigma-Aldrich), 0.5 U/mL Epoetin (Epo; Amgen), 10 μg/mL recombinant human insulin (Sigma-Aldrich), and 2 mM L-glutamine (Invitrogen)) at 37 °C.

Seahorse assays

800,000 cells/well were plated into 24 well poly-lysine coated Seahorse microplate and cells were plated in XF media (Sigma #D5030 medium powder, 1.85 g NaCl and 600 μl phenol red (0.5%) in 1 L) containing 25 mM glucose, 2 mM L-glutamine and 1mM pyruvate), pH7.4. The microplate was centrifuged at 400xg for 5 mins and incubated at

37°C in a non-CO2 incubator for 45 mins before measuring. Extracellular acidification rates and oxygen consumption rates were measured on a Seahorse Bioscience XF24–3

Extracellular Flux Analyzer. 1 μM oligomycin and FCCP, 0.5 μM Rotenone and antimycin were used during the measurement. For glycolysis assay, XF media containing

2 mM L-glutamine and 1mM pyruvate was used for plating cells, 25 mM glucose, 1 μM oligomycin, and 50 mM 2-Deoxy-Glucose were used during the measurement.

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Mouse study

Our mouse studies were conducted under animal protocols approved by the Division of

Comparative Medicine at MIT. PHOSPHO1 KO mice were gifted from Professor Colin

Farquharson and were re-derived onto C57BL/6J (Jackson Laboratory) strain.

PHOSPHO1-R74X mutant mice (referred to as PHOSPHO1 KO) were previously described.7 PHOSPHO1 KO mice were genotyped by performing PCR (primer 1: 5’-

TCCTCCTCACCTTCGACTTC-3’; primer 2: 5’-ATGCGGCGGAATAAACTGT-3’) and BsRDI enzyme digestion of the PCR product. The PCR product from wild type mice is uncut and the PCR product from knockout mice is cut into two bands. Mice were bled at indicated time points for performing complete blood count analysis on a SIEMENS

ADVIA 2120i machine. Stress erythropoiesis was introduced by injecting 40 mg/kg

Phenylhydrazine hydrochloride (Sigma #114715) at day 1 and day 3.

Blood from WT or KO mice were stained with 5 μM carboxyfluorescein succinimidyl ester (CFSE) according to the manufacturer's instructions (Life Technologies). 10% FBS in PBS was then added to cells for quenching the staining reaction. CFSE-labeled red cells were then washed twice with PBS and resuspended in sterile PBS for intravenous injection into recipient mice. A drop of blood, ~20 μl, was collected into heparinized tubes by retro-orbital bleeding at indicated time points and percentage of CFSE-stained cells were identified by flow cytometry.

For morphological analyses blood from 7 week old WT or KO mice was stained on slides with May-Grünwald-Giemsa and diaminobenzidine hydrochloride reagents (Sigma-

Aldrich GS-500 and D-9015).

Osmotic fragility test

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Peripheral blood was collected in heparinized tubes and subsequently diluted with PBS. 8

μl of diluted blood was suspended in 200 μl NaCl solutions ranging from 0% to 0.9% w/v. After incubation for 20 minutes at room temperature, samples were centrifuged at

700xg at 4°C and supernatants were collected. Hemoglobin concentration in the supernatant was measured from the absorbance at 540 nm with a microplate reader.

LC/MS-Based Metabolomics and Quantification of Metabolite Abundance within

Samples

1 million (WT mouse R2-R5 cells) and 2 million (KO mouse R2-R5 cells, Diff1-Diff5 stages human CD34+ cells) cells/sample were washed in cold 0.9% NaCl, and resuspended in -20°C, 600 μL LC/MS grade methanol containing 17 isotope-labeled internal standards. 300 μL LC/MS grade water and -20°C, 400 μL LC/MS grade chloroform were added subsequently. Samples were vortexed at 4°C 10 min and spun at

14,000xg 10 min at 4°C. The top layer (polar metabolites) and bottom layer (lipid metabolites) were analyzed by LC/MS. The values after normalization by total lipid abundance were used as variables for the multivariate statistical data analysis. All analyses and modeling were carried out using Metaboanalyst 3.0

(http://www.metaboanalyst.ca) 8 9. Please see Supplementary Methods for the details of polar and lipid metabolites profiling by LC/MS. qRT-PCR primer malas2 F:5’-GCAGGGCAACAGGACTTTG-3’, R:5’-

GGCAGCGTCCAATACTAAATAGG-3’, mfoxo3a:F:5’-

CTTCCCATATACCGCCAAGA-3’, R: 5’-TGGATAGTCTGCATGGGTGA-3’; mfech:

F: 5’- GGTGGATCCCCCATCAAGAT-3’; R: 5’-CACCATGCCTTCTCCTTGCT -3’;

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

mhbb-b:F: 5’-CCTTTGCCAGCCTCAGTGAG-3’; R: 5’-

CAGGATCCACATGCAGCTTGT-3’; mepb4.1: F: 5’-

ACCTGAACTCTGTCCCTCTG-3’;R: 5’-CATATCCCAGGATCTGTTGCC -3’; mkit:

F: 5’-AGCAATGGCCTCACGAGTTCTA-3’, R: 5’-

CCAGGAAAAGTTTGGCAGGAT -3’.mslc4a: F: 5’-

TCAGGTCTATGTGGAGCTTCA-3’, R: 5’-CATCCTCTCGAAGGTTTTCCTC-3’; m18srRNA: F: 5’-AGGGGAGAGCGGGTAAGAGA-3’; R: 5’-

GGACAGGACTAGGCGGAACA-3’; mphos1:F:5’-GGCGATTTGTTGCAGTTCATA-

3’; R: 5’-GAGGATGCGGCGGAATAAA-3’ hphos1:F:5’-

GAAGGGAGATTCGGCAAAGA-3’;R:CCGAGGTGGGTTAACTGAATAG-3’; hgapdh: F: 5’-GTGGTCTCCTCTGACTTCAAC-3’; R: 5'-

CCTGTTGCTGTAGCCAAATTC-3'; mhk1: F:5’-CACTGATGGAGGTGAAGAAGA

A-3; R:5’-GGGATGCTCCGAACATAAGAA-3; mhk2: F:5’-

GCTGGAGGTTAAGAGAAGGAT G-3; R:5’-TGGAGTGGCACACACATAAG-3; mgpi1: F:5’-CCGTGTCTGGTTTGTCTCTAA-3; R:5’-

GAAGGTCTTGGAGGCGATTAT-3; mpfkm: F:5’- GGCTCTCGTCTCAACATCATC-

3; R:5’-TCATATCCAAGGCGCTTCAC-3; mpfkl: F:5’-

CTGGTGAAGGAAGGCAAGAT-3; R:5’-AGTGCCACAGAAGTCGTTATC-3; maldoa: F:5’- CCTCGCTTGTCAAGGAAAGTA-3; R:5’-

GCCTTAGTTCAGCTCTGGTTAG-3; mpgk1: F:5’-GGGCAAGGATGTTCTGTTCT-3;

R:5’-TCCCTTCCCTTCTTCCTCTAC-3; mpgam1: F:5’-

GGTCTGACAGGTCTCAACAAA-3; R:5’-GGCGGTGGGACATCATAAG-3; meno1:

F:5’-CTCAAGACTGCAATCGCAAAG-3; R:5’- CATACTTGCCAGACCTGTAGAA-

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

3; matf4: F:5’-CCACTCCAGAGCATTCCTTTAG-3; R:5’-

CTCCTTTACACATGGAGGGATTAG-3; mphgdh: F:5’-

TGGTGGAGAAGCAGAACTTG-3; R:5’-GACATCAGCAGTGACCTTAGTAG-3; mpsat1: F:5’-GCATTCGTGCCTCTCTGTATAA-3; R:5’-

AGCTGATGCATCTCCAAGAAA-3; mpsph: F:5’-

GCAGTGTGCTTTGATGTTGATAG-3; R:5’-ATGGCTCTCCGTGTCATTTC-3; mshmt1: F:5’-GGAATTCGGCGATCCACTT-3; R:5’-

GTCTGTTCCTCCGGTCTTTATG-3; mshmt2: F:5’-GACCCGGAAGTTACCTTTCTT-

3; R:5’-CCTGGCTCTTGCCCTAAAT-3.

Generation of recombinant retroviruses and lentiviruses

293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) with 10% FBS in a humidified 5% CO2 atmosphere at 37°C. MSCV based plasmids and pCLECO or pLKO.3G based plasmids and packaging vectors, VSV-G and pD8.9, were incubated with medium and Fugene 6 according to the Promega protocol. The mixture medium was changed after 6 h; retrovirus and lentivirus were collected after 24 h and 72 h for transfection, respectively. Retroviruses for shRNA were constructed using the MSCV- pgkGFP-U3-U6P-Bbs vector (murine stem cell retroviral vector-pgk promoter-GFP-U6 promotershRNA). The control shRNA construct was designed against the firefly luciferase gene. The sequence of shRNA against mphospho1 are: phospho1-1:

GCTCCTGCTTCGAGGTTATTCGTCGACGAATAACCTCGAAGCAGGAGC, phospho1-6:

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

GAGCCGTCCCTATCTATGCAGTTAAGTCGACTTAACTGCATAGATAGGGACG

GCTC phospho1-7:

GGACTACGATGCCTATCTAGGGTCGACCCTAGATAGGCATCGTAGTCC

Lentiviruses for shRNA were constructed using the pLKO.3G vector cut with EcoRI and

PacI site. The sequence of shRNA against hphospho1 are:

Phos1-3:

GAATTTCTGGAATCTCGTATTCTCGAGAATACGAGATTCCAGAAATTC

Phos1-4:

TCAGAGCCGTCCCTATCTATTCTCGAGAATAGATAGGGACGGCTCTGA

Statistical analysis

All analysis data are presented as mean ± standard error of the mean (s.e.m.) unless specified otherwise. Prism was used to calculate the statistical significance. Unless otherwise mentioned, an unpaired two-tailed Student’s t-test was used to calculate the p values. p < 0.05 was considered significant. * p < 0.05; * * p < 0.01; * * * p < 0.001; * *

* * p < 0.0001.

Results

Increased phosphocholine metabolism during terminal erythropoiesis

As murine erythrocytes progress through differentiation, they sequentially induce synthesis of the transferrin receptor, CD71, followed by induction of Ter119, and subsequently lose CD71. We isolated subpopulations of erythroblasts, R2, R3, R4, and

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

R5, from E14.5 mouse fetal livers according to the surface expression of CD71 and

Ter119 (Figure 1A) and extracted polar and lipid metabolites. We observed a decrease in total lipid abundance during terminal erythropoiesis from the R2 to R5 stage (Figure 1B).

Using partial least squares discriminant analysis to calculate the variable importance in projection (VIP), we identified a significant decrease of phosphatidylcholine (PC) and an increase of triglyceride (TG) and sphingomyelin (SM) levels during differentiation from

R2 to R5 (Figure1C), suggesting dynamic changes in lipid composition during terminal erythropoiesis. Two of the most significantly altered polar metabolites are the hydrolyzed product of phosphatidylcholine, phosphocholine, and its catabolic end product, choline

(Figs.1D, E). The level of phosphocholine is significantly downregulated, as is phosphatidylcholine, the lipid precursor of phosphocholine. Conversely, the level of choline is significantly upregulated during terminal differentiation (Figure 1D). Taken together, our data suggest that the catabolism of phosphatidylcholine and phosphocholine to choline occurs during terminal mouse erythropoiesis.

Terminal erythropoiesis is a series of dynamic and intricate processes involving fine coordination of gene expression, cell proliferation, hemoglobin production, cell size decrease, cell cycle exit, chromatin condensation, and enucleation.10-12 Using RNAseq data from human and mouse terminal erythropoiesis,13,14 we found that sixteen conserved highly expressed genes were at least two fold up-regulated both from the murine R2 to

R4 or R5 stages and from human proerythroblasts to orthochromatic or polychromatic erythroblasts. Among these genes, PHOSPHO1 is the only one directly related to phosphatidylcholine metabolism. We thus examined PHOSPHO1 mRNA expression by

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

real time reverse transcription quantitative PCR (qRT-PCR) to confirm the temporal increase of PHOSPHO1 expression during terminal erythropoiesis (Figure 1E).

PHOSPHO1 is required for fetal erythropoiesis and stress erythropoiesis

To investigate the role of PHOSPHO1 in terminal erythropoiesis, we first abrogated

PHOSPHO1 expression using short hairpin RNAs (shRNA) in mouse fetal erythroid progenitors. Relative to control cells, the cell proliferation rate was lower in PHOSPHO1- depleted cells during the two days of differentiation (Figure 1F and H). PHOSPHO1 depleted cells also exhibited a lower extent of enucleation compared to control cells

(Figure 1G).

To further validate the role of PHOSPHO1 in terminal erythropoiesis, we examined many phenotypes of the PHOSPHO1 loss-of-function (KO) mice. We first analyzed the population of terminal erythrocytes in fetal livers; we lysed mature red cells and analyzed the remaining cells in E14.5 fetal livers (Figure 2A) by staining with CD71 and Ter119 antibodies. PHOSPHO1 knockout mice (KO) fetal livers had a small but significantly lower percentage of CD71 and Ter119 double positive cells, indicating fewer erythroblasts at a terminal differentiation stage. Moreover, E14.5 KO embryos were slightly smaller and paler (Figure 2B), and half day-old KO newborn neonates had a higher percentage of reticulocytes and lower red cell counts and hematocrit, implying an anemia in KO fetuses (Figure 2C).

We next isolated E14.5 lineage negative fetal liver cells from KO mice and differentiated them into reticulocytes in vitro. Erythroblasts from KO mice showed lower proliferation rates in differentiation medium (Figure 2D), reduced expression of genes that are

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

normally up-regulated in terminal erythropoiesis (Figure 2E), and decreased enucleation after 2 days of differentiation (Figure 2F). Consistent with the results from shRNA- treated cells (Figure 1F-H), these data establish that PHOSPHO1 is required for fetal terminal erythropoiesis and that its function is cell autonomous.

To our surprise, the numbers and the MCV of red cells in PHOSPHO1 KO mice at different ages were mostly normal (Figure 3A). However, the hematocrit was slightly lower in seven-week-old KO mice, likely due to a slightly lower number of red cells

(Figure 3A) and there was a lower percentage of CD71+, Ter119+ erythroblasts in bone marrow of seven-week-old mice (Figure 3B). The number of reticulocytes in five-week- old PHOSPHO1 KO mice was significantly increased above normal and this explained the slightly higher MCV of red cells in five-week-old KO mice. Moreover, spleens of five-week-old KO mice were also larger than normal, suggesting KO mice suffer from a partially compensated anemia (Figure 3C) and that stress erythropoiesis was occurring in these KO mice to compensate for the defects in terminal erythropoiesis. To test this hypothesis we induced stress erythropoiesis by injecting phenylhydrazine into seven- week-old mice. After five days of phenylhydrazine treatment, KO mice had a lower hematocrit, red cell count, and mean corpuscular volume compared to WT mice (Figure

3D). These KO mice also showed splenomegaly (Figure 3E) and enriched populations of early (Figure 3F) and terminal erythroid cells (Figure 3G) in their spleens, indicating a high erythropoietic demand and stress erythropoiesis in these mice. Taken together, these data indicate that PHOSPHO1 is required for both normal and stress erythropoiesis in adult mice.

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Given that phosphocholine is the hydrolyzed product of phosphatidylcholine, we postulated that the lipid composition would be changed in red cells and their progenitors depleted of PHOSPHO1. Comparison of the lipid composition in mature normal and KO red cells showed that there were indeed several differences, including increases in ceramide, triglyceride, and lysophosphatidylcholine and decreases in phosphatidic acid and phosphatidylinositol in KO red cells (Supplementary Figure1A). Since abnormal lipid compositions in mature red cells cause some rare red cell hemolytic diseases, 15 16

17we hypothesized that KO red cells would be more fragile compared to WT red cells.

However, we did not observe changes in the cell morphology, the half- life, or the osmotic fragility of KO red cells from adult mice (Supplementary Figures 1B-D), suggesting the absence of a hemolytic anemia. These results suggest that despite their lipid abnormalities mature KO red cells circulate normally.

Lower oxidative phosphorylation, higher glycolysis, and ATP deficiency in

PHOSPHO1 KO erythroblasts

To understand the function of PHOSPHO1 in terminal erythropoiesis, we compared metabolomic data from developing WT and KO fetal liver cells. The amount of lipid per cell drops 80% from R2 to R4 stage in WT cells, whereas in KO embryos the drop in lipid per cell is only 20% (Figure 4A). The sizes of WT and KO fetal liver erythroid R2,

R3, and R4 populations, gated according to the expression levels of CD71 and Ter119, were similar; as expected the cell size decreased from the R2 to the R4 stage. (Figure

4B). Instead, this accumulation of lipid led us to suspect that fatty acid oxidation is impaired in KO cells, as fatty acid metabolism can be used to provide energy for cellular processes through oxidative phosphorylation.18,19 Supporting this contention, we found

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

that, as measured by AMP/ATP ratios, energy levels were reduced in KO erythroblasts

(Figure 4C). Concomitantly, the level of active phospho-T172-AMPKα increased in

PHOSPHO1-depleted fetal liver erythroblasts at one day of differentiation, indicating

AMPK activation by the elevated AMP levels (Figure 4D).

We therefore compared oxidative phosphorylation activity between WT and KO fetal liver erythroblasts at one day of differentiation. Both basal and maximal respiration were lower in KO cells, compared with WT cells (Figure 4E), and the glycolytic activity of

KO cells was higher (Figure 4F). These results indicate that KO cells experience a greater dependence on glycolysis and a concurrent inhibition of oxidative phosphorylation.

PHOSPHO1 KO erythroblasts increase glycolysis to produce serine/glycine

The function of PHOSPHO1 is to convert phosphocholine to choline; indeed, there existed a much higher amount of choline and a higher ratio of phosphocholine to choline in KO cells (Figure 5A). Given that the intersection between choline metabolism and the glycolytic pathway is the production of glycine and serine (Figure 5B),20 21 22 we hypothesized that the increased glycolysis of KO cells could result from the lack of glycine or serine, metabolites that can be produced both from choline and from 3- phosphoglycerate, an intermediate of glycolysis. We therefore compared the expressions of genes encoding enzymes involved in glycolysis and serine/glycine production in WT and KO fetal liver cells at one day of differentiation. Many of these genes, especially phosphoserine phosphatase (psph1) and serine hydroxymethyltransferase 1(shmt1), were highly overexpressed in KO cells (Figure 5C), indicating increased shunting of glycolysis intermediates to serine and glycine. As all these induced enzymes are in the cytosol,

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

except for serine hydroxymethyltransferase 2 (shmt2), which serves the same function as shmt1, interconverting glycine and serine but in the mitochondria, we conclude that production of glycine and serine occurs mainly in the cytosol, where glycolysis occurs.

This metabolic switch would lead to the observed loss of ATP production from phosphoenolpyruvate to pyruvate during glycolysis in KO cells (Figure 4E-F).

The reduction in ATP production in KO cells was reversed by differentiation in medium containing excess glycine or serine, as indicated by reduced phospho-T172-AMPKα signal (Figure 5D). Glycine or serine supplementation also restored almost normal proliferation and enucleation of KO cells (Figure 5D-G). Taken together, our data show that PHOSPHO1 activity is essential for maintaining oxidative phosphorylation during mouse terminal erythropoiesis via the production of glycine and serine downstream of the phosphocholine catabolic pathway.

PHOSPHO1 depletion impairs human erythropoiesis

In order to strengthen our findings, we studied aspects of metabolism during the 23-day period of differentiation in vitro of human mobilized bone marrow CD34+ stem/progenitor cells into enucleated erythrocytes.6 The culture system comprises five stages and differentiation is highly synchronized. We analyzed metabolites from cells at the end of each of the differentiation stages (Diff1-Diff5). The up-regulation of choline and down-regulation of phosphocholine levels during the course of differentiation mirrors our metabolic analysis of mouse erythropoiesis (Figure 6A). PHOSPHO1 gene expression was also continuously increased from the Diff1 to Diff4 stages, when the cells begin to enucleate (Figure 6B). As in mouse erythroblasts, reduction of PHOSPHO1

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

increased levels of phospho-T172-AMPK, indicating an energy crisis (Figure 6C). Cell proliferation was dramatically impaired after PHOSPHO1 knock down (Figure 6D) and fewer PHOSPHO1-knockdown cells were enucleated at the end of differentiation (Figure

6E). Importantly, proliferation of PHOSPHO1-knockdown cells was increased to normal in medium supplemented with glycine or serine (Figure 6F-G). Collectively, these data show that the role of PHOSPHO1 in terminal erythropoiesis is conserved in mice and humans.

Discussion

PHOSPHO1 has been extensively characterized as the phosphocholine and phosphoethanolamine phosphatase in bone, where the released phosphate group is important for bone mineralization.7 23 Moreover, genetic variations in PHOSPHO1 combined with other genetic mutations may be important in β-thalassemia and abnormal mean corpuscular volume (MCV), since single nucleotide mutations associated with these abnormalities have been reported to correspond to altered PHOSPHO1 expression levels in trans-expression quantitative trait locus (eQTL) meta-analysis.24

Our results show that PHOSPHO1 affects key aspects both of phospholipid biogenesis and intermediary metabolism during terminal erythropoiesis in both mice and humans.

We observed a decrease in phosphatidylcholine (PC) and an increase in sphingomyelin

(SM) levels in erythroblast lipid composition during terminal erythropoiesis (Figure 1C)

The decline of PC may be indicative of organelle membrane re-organization or shedding within erythroblasts, given the higher proportion of PC in the membranes of the endoplasmic reticulum (ER) and the Golgi as compared to the plasma membrane.25 26

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Also, lipid composition affects membrane structure. PCs have a large polar head group and tend to form a nearly cylindrical structure whereas phosphatidylethanolamines (PEs) have a smaller head group and form a conical molecule. SMs have a narrower fatty acid tail and are able to form taller and narrower cylinders than PCs of the same chain length and pack more tightly.25 Thus, diminishing the proportion of PC and increasing that of

SM would alter the curvature of the membrane and cause the membrane to tighten and condense, reducing erythroblast size during terminal erythropoiesis as these cells undergo morphologic changes, organelle removal, and enucleation. Therefore, changes in the lipid composition may be important for synchronizing the major changes in subcellular organelles that occur during in terminal erythropoiesis.

We identified PHOSPHO1 as one of the regulators that coordinate the change of lipid composition during erythroblasts differentiation; depletion of PHOSPHO1 impairs the terminal differentiation of both mouse and human erythroblasts (Figures 1F-G, 2, 3, 6D-

E). Although we observed changes in lipid composition in PHOSPHO1 KO red cells, the changes in amounts of PC and SM in PHOSPHO1 KO red cells were negligible (Figure

S1A). This is consistent with the seemingly normal size of PHOSPHO1 KO red cells and erythroblasts (Figure S1B and Figure 4B). Phospho1-KO red cells showed an increased lysophosphatidylcholine ratio (Figure S1); however, hemolytic anemia was not observed in adult KO mice under laboratory conditions. This indicates that a loss of PHOSPHO1 is irrelevant to hemolysis induced by unbalanced lipid composition and that the function of

PHOSPHO1 extends beyond simply affecting the phospholipid composition. Indeed, we found that PHOSPHO1 is important in energy and glycine metabolism during erythropoiesis.

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Metabolic reprogramming regulates the differentiation of hematopoietic cells.27 28

Normal hematopoietic stem cells rely on fatty acid oxidation for self-renewal and switch to oxidative phosphorylation to promote lineage commitment.29 30 Following commitment, glutamine metabolism stimulates the differentiation of erythrocytes, and oxidative phosphorylation becomes the dominant source of ATP. Expression of mitochondrial proteins is up-regulated to facilitate this increase in oxidative phosphorylation and to meet the nutrient and energy demands of the cell.31 32 33 In agreement with this, our findings show that oxidative phosphorylation is important during normal erythropoiesis. PHOSPHO1 KO cells, in contrast, demonstrated a reduced oxidative phosphorylation capacity and a concomitant reduction in their proliferation rate

(Figure 2D and 4D). Although we did not determine which energy fuel is favored in cells during terminal erythropoiesis, we did observe that lipid accumulates in oxidative phosphorylation impaired PHOSPHO1 KO cells (Figure 4A), suggesting that lipids are a fuel utilized by erythroblasts at that stage.

Glycolysis replaced oxidative phosphorylation in PHOSPHO1 KO erythroid progenitors

(Figure 4D-E) and the increase in glycolysis (the Embden–Meyerhof–Parnas pathway) in

KO erythroid progenitors was used for the production of serine and glycine at the expense of ATP production (Figure 5C-G). Many cancers shunt their energy metabolism to glycolysis to produce serine and glycine for sustaining rapid proliferation, and it seems that PHOSPHO1 KO cells utilize this same pathway for cell survival.21 34

We hypothesize that glycine and serine are essential for protein synthesis in terminal erythroblasts, and that this is especially true for hemoglobin, since the first step in producing heme depends upon the condensation of glycine and succinyl-CoA.35 36 In

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

order to obtain the needed glycine, normal erythroblasts rely upon both de novo glycine synthesis and extracellular glycine.37 While proteins such as Glycine Transporter 1

(GlyT1) and Band3 have known glycine transporting properties, the mechanism by which de novo glycine synthesis contributes to the glycine supply is unclear.38 Our results demonstrate that PHOSPHO1 and the glycolytic pathway both contribute to de novo glycine synthesis. Interestingly, 2-deoxy-D-glucose (2-DG) has also been reported to promote erythropoiesis by shunting glycolysis to the pentose phosphate pathway (PPP),31 illustrating the flexibility of glycolysis and the importance of the phosphocholine hydrolysis pathway as an alternative glycine source during erythropoiesis.

Acknowledgments

This work was sponsored by the Defense Advanced Research Projects Agency contract

HR0011-14-2-0005 and by grant NIH/NHLBI 2 P01 HL032262-25 We thank members of Lodish lab for fruitful discussions, Tony Chavarria and Ferenc Reinhardt for mouse husbandry.

Author Contributions

N.-J.H. designed and performed most experiments and analyzed the data. N.-J. H. and

H.F.L. wrote the manuscript. Y.-C.L isolated bone marrow and spleen from the mice and performed complete blood counts measurement. C.-Y.L performed mouse genotyping and prepared experiment materials. C.L. and E.F. performed LC/MS-based metabolomics. N.P. measured half-lives of red cells. C.F. and J.L. M provided the

PHOSPHO1 KO mice for rederivation.

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Declaration of Interests

The authors declare no competing interests.

References:

1. An X, Mohandas N. Disorders of red cell membrane. Br J Haematol. 2008;141:367-375. 2. Yawata Y, Kanzaki A, Inoue T, et al. Red cell membrane disorders in the Japanese population: clinical, biochemical, electron microscopic, and genetic studies. Int J Hematol. 1994;60:23-38. 3. Saraya AK, Pati HP. Red cell membrane disorders. J Assoc Physicians India. 1994;42:142- 147. 4. Kuypers FA. Red cell membrane lipids in hemoglobinopathies. Curr Mol Med. 2008;8:633-638. 5. Kuypers FA. Membrane lipid alterations in hemoglobinopathies. Hematology Am Soc Hematol Educ Program. 2007:68-73. 6. Huang NJ, Pishesha N, Mukherjee J, et al. Genetically engineered red cells expressing single domain camelid antibodies confer long-term protection against botulinum neurotoxin. Nat Commun. 2017;8:423. 7. Yadav MC, Simao AM, Narisawa S, et al. Loss of skeletal mineralization by the simultaneous ablation of PHOSPHO1 and alkaline phosphatase function: a unified model of the mechanisms of initiation of skeletal calcification. J Bone Miner Res. 2011;26:286-297. 8. Xia J, Mandal R, Sinelnikov IV, Broadhurst D, Wishart DS. MetaboAnalyst 2.0--a comprehensive server for metabolomic data analysis. Nucleic Acids Res. 2012;40:W127-133. 9. Xia J, Wishart DS. Using MetaboAnalyst 3.0 for Comprehensive Metabolomics Data Analysis. Curr Protoc Bioinformatics. 2016;55:14 10 11-14 10 91. 10. Ji P, Murata-Hori M, Lodish HF. Formation of mammalian erythrocytes: chromatin condensation and enucleation. Trends Cell Biol. 2011;21:409-415. 11. Chen K, Liu J, Heck S, Chasis JA, An X, Mohandas N. Resolving the distinct stages in erythroid differentiation based on dynamic changes in membrane protein expression during erythropoiesis. Proc Natl Acad Sci U S A. 2009;106:17413-17418. 12. Gnanapragasam MN, Bieker JJ. Orchestration of late events in erythropoiesis by KLF1/EKLF. Curr Opin Hematol. 2017;24:183-190. 13. Wong P, Hattangadi SM, Cheng AW, Frampton GM, Young RA, Lodish HF. Gene induction and repression during terminal erythropoiesis are mediated by distinct epigenetic changes. Blood. 2011;118:e128-138. 14. Hu J, Liu J, Xue F, et al. Isolation and functional characterization of human erythroblasts at distinct stages: implications for understanding of normal and disordered erythropoiesis in vivo. Blood. 2013;121:3246-3253. 15. Allen DW, Manning N. Abnormal phospholipid metabolism in spur cell anemia: decreased fatty acid incorporation into phosphatidylethanolamine and increased incorporation into acylcarnitine in spur cell anemia erythrocytes. Blood. 1994;84:1283-1287. 16. Yawata Y. [Characteristics of red cell membrane disorders in the Japanese population]. Rinsho Byori. 1997;45:367-376. 17. de Oliveira S, Saldanha C. An overview about erythrocyte membrane. Clin Hemorheol Microcirc. 2010;44:63-74.

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

18. Nsiah-Sefaa A, McKenzie M. Combined defects in oxidative phosphorylation and fatty acid beta-oxidation in mitochondrial disease. Biosci Rep. 2016;36. 19. Wang Y, Mohsen AW, Mihalik SJ, Goetzman ES, Vockley J. Evidence for physical association of mitochondrial fatty acid oxidation and oxidative phosphorylation complexes. J Biol Chem. 2010;285:29834-29841. 20. Amelio I, Cutruzzola F, Antonov A, Agostini M, Melino G. Serine and glycine metabolism in cancer. Trends Biochem Sci. 2014;39:191-198. 21. Tedeschi PM, Markert EK, Gounder M, et al. Contribution of serine, folate and glycine metabolism to the ATP, NADPH and purine requirements of cancer cells. Cell Death Dis. 2013;4:e877. 22. Jain M, Nilsson R, Sharma S, et al. Metabolite profiling identifies a key role for glycine in rapid cancer cell proliferation. Science. 2012;336:1040-1044. 23. Macrae VE, Davey MG, McTeir L, et al. Inhibition of PHOSPHO1 activity results in impaired skeletal mineralization during limb development of the chick. Bone. 2010;46:1146- 1155. 24. Westra HJ, Peters MJ, Esko T, et al. Systematic identification of trans eQTLs as putative drivers of known disease associations. Nat Genet. 2013;45:1238-1243. 25. van Meer G, Voelker DR, Feigenson GW. Membrane lipids: where they are and how they behave. Nature Reviews Molecular Cell Biology. 2008;9:112-124. 26. van Meer G, de Kroon AIPM. Lipid map of the mammalian cell. Journal of Cell Science. 2011;124:5-8. 27. Oburoglu L, Romano M, Taylor N, Kinet S. Metabolic regulation of hematopoietic stem cell commitment and erythroid differentiation. Curr Opin Hematol. 2016;23:198-205. 28. Schell JC, Rutter J. Mitochondria link metabolism and epigenetics in haematopoiesis. Nat Cell Biol. 2017;19:589-591. 29. Yusuf RZ, Scadden DT. Fate through fat: lipid metabolism determines stem cell division outcome. Cell Metab. 2012;16:411-413. 30. Ito K, Carracedo A, Weiss D, et al. A PML-PPAR-delta pathway for fatty acid oxidation regulates hematopoietic stem cell maintenance. Nat Med. 2012;18:1350-1358. 31. Oburoglu L, Tardito S, Fritz V, et al. Glucose and glutamine metabolism regulate human hematopoietic stem cell lineage specification. Cell Stem Cell. 2014;15:169-184. 32. Anso E, Weinberg SE, Diebold LP, et al. The mitochondrial respiratory chain is essential for haematopoietic stem cell function. Nat Cell Biol. 2017;19:614-625. 33. Liu X, Zhang Y, Ni M, et al. Regulation of mitochondrial biogenesis in erythropoiesis by mTORC1-mediated protein translation. Nat Cell Biol. 2017;19:626-638. 34. Sun WY, Kim HM, Jung WH, Koo JS. Expression of serine/glycine metabolism-related proteins is different according to the thyroid cancer subtype. J Transl Med. 2016;14:168. 35. Wittenberg J, Shemin D. The location in protoporphyrin of the carbon atoms derived from the alpha-carbon atom of glycine. J Biol Chem. 1950;185:103-116. 36. Shemin D, London IM, Rittenberg D. The in vitro synthesis of heme from glycine by the nucleated red blood cell. J Biol Chem. 1948;173:799. 37. Ellory JC, Jones SE, Young JD. Glycine transport in human erythrocytes. J Physiol. 1981;320:403-422. 38. Garcia-Santos D, Schranzhofer M, Bergeron R, Sheftel AD, Ponka P. Extracellular glycine is necessary for optimal hemoglobinization of erythroid cells. Haematologica. 2017;102:1314- 1323.

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Figure legends

Figure 1. Increased phosphocholine metabolism during terminal mouse fetal erythropoiesis

(A) FACS plot of R1-R5 populations. E14.5 mouse fetal liver cells were sorted into four groups (R2: CD71 high, Ter119-; R3: CD71 high, Ter119+; R4: CD71 low, Ter119+;

R5: CD71-, Ter119+). (B) Lipids from R2-R5 groups were analyzed and total negative and positive ion abundances were retrieved from LC/MS and plotted. One million cells per group were used for metabolite extraction. A.U.: arbitrary unit (n=3). (C) The lipid composition of mouse R2-R5 cells was analyzed by partial least squares discriminant analysis (PLS). The signal of each class of lipids was normalized by total lipid abundance from the LC/MS results and the results are shown as colored boxes (from high to low: red to green) and plotted with variable importance in the projection (VIP) score (VIP>1: significant). Phosphatidylcholine (PC) is bolded and shows its expression from high (red) in R2 cells to low (green) in R5 cells. Lipid class abbreviation: TG: triglyceride; PC: phosphatidylcholine; PE: phosphatidylethanolamine; SM: sphingomyelin; LPC: lysophosphatidylcholine; ChE: Cholesteryl Ester; CerG1: Glycosphingolipid; PI: phosphatidylinositol; DG: diglyceride; So: Sphingosine; PG: phosphatidylglycerol; PA: phosphatidic acid; LPE: lysophosphatidylethanolamine; Co: Coenzyme. (D) Polar metabolites from R2-R5 cells were analyzed. Each metabolite signal is normalized to total lipid abundance. Polar metabolites differentiating between the four groups are shown as colored boxes and plotted with variable importance in the projection (VIP) score (VIP>1: significant). Phosphocholine and choline are labeled in bold font. Relative metabolite abundance is indicated in the bar, with red representing metabolite accumulation. (n=3/group) (E) Left: PHOSPHO1 hydrolyzes phosphocholine to choline.

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Right: Mouse PHOSPHO1 gene expression in each group of cells normalized to 18S rRNA. (n=3/group, mean+s.e.m.) (F) Knocking down mPHOSPHO1 in cultures of lineage negative E14.5 mouse fetal liver erythroblasts using three different shRNAs reduces cell proliferation in differentiation medium. (n=3/group, mean±s.e.m.) Cells were expanded in maintenance medium for 1 day and differentiated in differentiation medium for 2 days. (G) Knocking down mPHOSPHO1 in lineage negative E14.5 mouse fetal liver using three shRNAs impairs enucleation after 2 days of in vitro differentiation.

(n=3/group, mean+s.e.m.) (H) mPHOSPHO1 gene expression of cells assayed in Figure

1F and G. mRNA was extracted from cells differentiated for 1 day.

Figure 2. mPHOSPHO1 is essential for fetal erythropoiesis

(A) Smaller percentages of CD71+ Ter119+ erythroblasts in E14.5 KO mouse livers.

Mature red cells in fetal livers were lysed and cells were stained with anti-CD71 and anti-

Ter119 antibody. (n=9 fetal livers from 3 mice/group, mean±s.e.m.) (B) Photographs of

E14.5 WT and KO embryos. (C) Complete blood counts of 0.5 day WT and KO neonates. (n=7/group, mean+s.e.m.) (D) Lower growth rate in erythroblasts depleted of mPHOSPHO1. E14.5 fetal liver lineage- negative cells were isolated from wild type

(WT) and PHOSPHO1-knockout (KO) mice, expanded in maintenance medium for 1 day, and cultured in differentiation medium for 2 days. (n=3/group, mean±s.e.m.) Cells were counted during the 2 days of differentiation. (E) Gene expression of WT and KO erythroblasts after one day differentiation. (n=3/group, mean+s.e.m.) mRNA expression is plotted relative to expression of 18s rRNA. (F) Enucleation is lower in KO erythroblasts after two days differentiation. (n=3/group, mean+s.e.m)

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Figure 3. mPHOSPHO1 is essential for stress erythropoiesis

(A) Measurements of complete blood counts from mice at indicated ages are plotted.

(n=4/group, mean+s.e.m.) RBC: red cell; HCT: hematocrit; MCV: Mean corpuscular volume. (C) Elevated ratio of spleen to body weight of five-week-old KO mice.

(n=4/group, mean+s.e.m.) (B) Fewer Ter119+, CD71+ cells in the bone marrow of seven- week old KO mice relative to WT mice. (n=3/group, mean+s.e.m.) Bone marrow cells were isolated and mature red cells were lysed before nucleated cells were stained with

CD71 and Ter119 antibodies. (D) Complete blood count measurements of seven-week old WT and KO mice were performed during phenylhydrazine-induced anemia. Lower hematocrit of KO mice shows slower recovery of red blood cells. (n=5/group, mean±s.e.m. ANOVA used for statistics) (E) Higher ratio of spleen to body weight of seven-week-old KO mice following four days of phenylhydrazine-induced stress erythropoiesis. (n=5/group, mean+s.e.m. two-way ANOVA were used to calculate the statistic significance) (F) Higher numbers of c-Kit+ CD71+ cells in the spleens of KO mice at days 3 and 13 post phenylhydrazine injection. (n=3/group, mean+s.e.m.). (G)

Higher numbers of CD71+, Ter119+ cells in the spleens of KO mice at days 3 and 13 post phenylhydrazine injection. (n=3/group, mean+s.e.m.)

Figure 4. Lower oxidative phosphorylation, higher glycolysis, and ATP deficiency in

PHOSPHO1-KO erythroblasts

(A) Erythroid progenitors from KO mice lost less lipid during the transition from the R2 to the R4 state than do cells from WT mice. Total lipid signals of R2 and R4 cells from lipidomic data shown in Figure 1B were used to calculate the ratios. (n=3/group,

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

mean+s.e.m.) (B) WT and KO erythroblasts have similar sizes at the same differentiation stages. Representative forward scatter (FSC) and cell count of R2, R3 and R4 populations from WT and KO E14.5 fetal liver were plotted. Cells were gated as shown in Figure 1A.

(n=3/group) (C) AMP to ATP ratio is higher in KO 1-day differentiated erythroblasts.

(n=3/group, mean+s.e.m) (D) Increased phospho-T172-AMPKα in 1-day in vitro differentiated KO erythroblasts compared with WT. Ratio of phospho-AMPK to AMPK signal is indicated below, normalized to WT cells. Cells were isolated from E14.5 WT or

KO fetal livers and expanded in maintenance medium for 1 day and cultured in differentiation medium for one day. (E) Basal and maximal oxygen consumption rate of

1-day differentiated KO fetal liver erythroblasts is lower than that of WT erythroblasts. 1

μM oligomycin and FCCP, 0.5 μM rotenone and antimycin were used. (n=5/group, mean±s.e.m.) (F) Higher basal glycolysis in KO erythroblasts. Extracellular acidification rate (ECAR) of 1-day in vitro differentiated WT and KO erythroblasts was measured. 25 mM glucose, 1 μM oligomycin, and 50 mM 2-Deoxy-Glucose were sequentially added to the culture medium. (n=4/group, mean±s.e.m.)

Figure 5. PHOSPHO1 KO erythroblasts are deficient in choline and increase glycolysis to produce serine and/or glycine

(A) Left: Choline abundance is higher in WT 1-day differentiated erythroblasts. Right: the phosphocholine to choline ratio is higher in R2, R3, and R4 groups of KO erythroblasts compared to WT cells. Metabolites were normalized to total lipid.

(n=3/group, mean+s.e.m) (B) Crosstalk of phosphocholine catabolism and glycolysis.

Production of serine and glycine links the two pathways. PPP: pentose phosphate

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

pathway; 3P glycerate: 3-phosphoglycerate; 3P pyruvate: 3-phosphohydroxypyruvate; PE pyruvate: phosphoenolpyruvate; GSH: glutathione; TCA cycle: tricarboxylic acid cycle.

Enzymes involved in the steps are labeled. (C) Increased mRNA expression of genes encoding proteins involved in glycolysis and serine/glycine production in 1-day differentiated KO erythroblasts. Lineage negative cells from WT and KO E14.5 fetal livers were isolated and cultured in maintenance medium for 1 day and differentiation medium for 1 day prior to RNA analysis; mRNA levels are normalized to that of 18s rRNA. (D) phospho-T172-AMPKα signal is higher in 1-day differentiated KO erythroblasts than in WT cells, and the signal is reduced in cells treated with 0.1 mM serine or 0.1 mM glycine. Relative phospho-AMPK to AMPK signal ratio is depicted below. (E) Proliferation is increased to normal in KO erythroblasts cultured in differentiation medium containing 0.2 mM serine. (n=3/group, mean+s.e.m.) (F)

Proliferation is increased to normal in KO erythroblasts cultured in differentiation medium containing 0.1 mM glycine. (n=3/group, mean+s.e.m.) (G) Increased enucleation at day 2 of differentiation of KO erythroblasts cultured in 0.1 mM serine or glycine containing differentiation medium. (n=3/group, mean+s.e.m.)

Figure 6. PHOSPHO1 depletion impairs human erythropoiesis in vitro

(A) Human CD34+ cells were differentiated using a five-stage in vitro culture system and metabolites were extracted and analyzed at the end of the indicated stages of differentiation. Relative amounts of polar metabolites in the five groups of cells are shown in colored boxes on the right and their VIP scores are shown on the bottom.

Phosphocholine and choline are labeled in bold on the left. (n=3/group) (B) Human

From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

PHOSPHO1 gene expression at each differentiation stage normalized to 18S rRNA.

(n=3/group, mean+s.e.m.) (C) Increased phospho-T172-AMPKα signal in PHOSPHO1 depleted human erythroblasts after 20 days of in vitro culture. Relative phospho-AMPK to AMPK signal ratio is depicted below. (D) Lower terminal proliferation rate in human erythroblasts depleted of PHOSPHO1 by transfection with two shRNAs. Cell number was counted after GFP positive cells were sorted at day 11 and at the end of Diff3, Diff4, and Diff5. (n=3/group, mean±s.e.m.) (E) Lower percentages of enucleation in

PHOSPHO1 depleted human erythroblasts after 20 days of in vitro culture. CD34+ cells were expanded and differentiated as described in Materials and Methods. Enucleation as judged by Hoechst staining and glycophorin A surface expression was measured at day

20. (F) Control and PHOSPHO1-depleted human erythroblasts were cultured in medium supplemented with addition of 0.1 mM glycine or 0.2 mM serine at day 12. Cell numbers were counted at day 12 and day 16 and fold cell expansion is shown. (G) hPHOSPHO1

RNA expression in control and shRNA knocked down cells that were assayed in (D)-(F).

(n=3/ group, mean+s.e.m)

Figure 1

A B

From www.bloodjournal.org byNegative guest on ion May 1, 2018. For personal use only.Positive ion 9 3×10 6 ×1010 **** ****

9 2×10 4 ×1010

9 CD71 1×10 2 ×1010 Abundance (A.U.) Abundance (A.U.)

0 0 2 3 4 5 R R R R 2 3 4 5 R R R R Ter119

C D Negative ion Positive ion PC phosphocholine PE TG proline PE SM choline SM LPC creatine LPC PC CerG1 arginine PS PS taurine Co PI malate Cer PG betaine PG LPE DG valine PA ChE glutamate PI glutamine So

E mPhospho1 F Phosphatidylcholine 200 *** 150 ctrl 150 shphos1-1 Phosphocholine 100 shphos1-6 Phospho1 100 shphos1-7 **** Choline 50 50 cell number (10^5) Relative mRNA expression mRNA Relative 0 0 0 1 2 2 5 Days R R3 R4 R G H **** mPhospho1 **** 30 **** **** **** 1.0 **** 20

10 0.5 Enucleation (%)

0 Relative mRNA expression rl 0.0 ct trl hos1-1 hos1-6 hos1-7 c shp shp shp shphos1-1 shphos1-6 shphos1-7 From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Figure 2

A B E14.5 liver CD71+Ter119+ WT KO 100 * 80 60 (%) 40 20 1 cm 0

WT KO C Retics RBC HCT MCV 20 ** 6 50 * 150 * 15 40 100 NS 4 30 fL cells/ul (%) 10 6

HCT(%) 20 50 10 2 5 10 0 0 0 0 KO WT KO WT KO WT KO WT D E 1.5 F WT 15 NS KO WT *** 60 ** KO 1.0 10 40 **** 5 0.5 20 Enucleation(%) cell number (10^5) 0 0

0 1 2 expression mRNA Relative 0.0 Days t WT KO 3a ch 41 ki e bbb c alas2 f h pb slc4a foxo e From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Figure 3

A Retics RBC HCT MCV 15 80 8 ** 60 NS NS WT * NS NS * 6 60 KO NS 10 40

fL 40

4 NS ul cells/ (%) (%) 6

10 5 20 2 20

0 0 0 0 k k k wk wk wk wk w k wk wk 5 7 12 w 5 7 2 wk wk 5 7 12 w 1 5 7 12 w B C bone marrow CD71+ and Ter119+ spleen/body weight *** 40 0.0020 * 30 0.0015

(%) 20

(g/g) 0.0010 10 0.0005 0 0.0000

WT KO WT KO D HCT RBC MCV 10 70 WT 80 WT WT 9 KO 60 KO * 70 KO 8 *** ****

50 fL 60

(%) 7 10^6 cells/ul 10^6 40 6 50

1 3 5 8 12 1 3 5 8 12 1 3 5 8 12 Days Days Days

E F G spleen/body weight spleen c-kit+ and CD71+ spleen CD71+ and Ter119+ 0.008 ** 30 WT 8 WT * WT KO KO KO 0.006 6 * 20 * 0.004 (%) (%) (g/g) NS 4 10 0.002 2 * 0.000 0 0 0 4 1 3 13 1 3 13 Days Days Days Figure 4

A Negative ion R4/R2 Positive ion R4/R2 From www.bloodjournal.org by guest on May 1, 2018. For personal use only. 1.0 1.0 *** WT ** WT 0.8 KO 0.8 KO 0.6 0.6 Ratio Ratio 0.4 0.4

0.2 0.2

0.0 0.0 T O T O W K W K

B R2 R3 R4

WT KO Count

FSC

C AMP/ATP D 8 WT KO *** WT 62 kD 6 pT172-AMPK KO NS 62 kD 4 AMPK Ratio

37 kD 2 GAPDH

0 1.00 2.33 2 3 4 5 2 3 4 5 R R R R R R R R

E F 2-DG FCCP 100 Rotenone WT 5 Oligomycin WT 80 *** KO Glucose * 4 KO Oligomycin 60 ** 3 *** 40 2 20 1

OCR (pmol/min/ug protein) OCR 0

0 50 100 (mpH/min/ug protein) ECAR 0 0 20 40 60 80 Time (minutes) Time (minutes) Figure 5

B A From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

phosphocholine/choline 15 50 WT 40 * WT KO 10 KO 30 Ratio 5 ** 20 * ** 10 * ** NS Choline abundance (A.U) 0 0 2 3 4 5 2 3 4 5 R R R R R R R R 2 3 4 5 2 3 4 5 R R R R R R R R

C D E

**** Ctrl glycine serine 10 WT WT + - + - + -

) 10

KO 5 KO - + - + - + *** WT 8 KO 62 kD pT172-AMPK 6 WT+serine 5 KO+serine 62 kD AMPK 4 2 NS 37 kD Cell number (10 GAPDH 0 RelativemRNA expression 0 0 1 2 2 i1 1 1 t1 1 t2 1.00 1.58 0.07 0.28 0.86 1.40 k1 k p fkl m1 a h Days h h g fkm p ldoa gk no ldha s p a p ga e hgdhp sp hmt1hm p p p s s G F 60 * **

) 10 * 5 *** WT 8 KO 40 WT+glycine 6 KO+glycine 4 20

2 (%) Enucleation Cell number (10 0 0 1 2 0 T O Days W K

T+serine T+glycine O+glycineO+serine W W K K From www.bloodjournal.org by guest on May 1, 2018. For personal use only. Figure 6 A B C

choline phosphocholine hPhospho1 ctrl p1-3 shRNAp1-4 shRNA creatine 40 proline 62 kD * pT172-AMPK GSH 30 arginine * 62 kD AMPK pantothenic acid glutamate 20 Phospho1 malate 28 kD threonine 10 citrate 38 kD GAPDH histidine Relative mRNA expression mRNA Relative 0 glutamine 1.00 14.90 7.42 1 2 3 4 5 lactate iff iff iff iff iff D D D D D carnitine

D E ctrl p1-3 shRNA p1-4 shRNA

25 ctrl

20 p1-3 **** p1-4

15 Hoechst **** 10

5 Cell number (10^6)

0 15 20 25 Days CD235A

F G 10 * * * * 8 hPhospho1 1.5 6 **** **** 4 1.0

Fold expansion 2 0.5 Relative mRNA expression 0 0.0 trl A A c ine ine ctrl 1-3 1-4 r r rine p p +se +glycineA +glycine+se trl+glycinetrl+se1-3shRNA 1-4shRNA A c c p p

1-3shRN1-3shRN 1-4shRN1-4shRN p p p p From www.bloodjournal.org by guest on May 1, 2018. For personal use only.

Prepublished online April 30, 2018; doi:10.1182/blood-2018-03-838516

Enhanced phosphocholine metabolism is essential for terminal erythropoiesis

Nai-Jia Huang, Ying-Cing Lin, Chung-Yueh Lin, Novalia Pishesha, Caroline A. Lewis, Elizaveta Freinkman, Colin Farquharson, José Luis Millán and Harvey Lodish

Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml

Advance online articles have been peer reviewed and accepted for publication but have not yet appeared in the paper journal (edited, typeset versions may be posted when available prior to final publication). Advance online articles are citable and establish publication priority; they are indexed by PubMed from initial publication. Citations to Advance online articles must include digital object identifier (DOIs) and date of initial publication.

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.

View publication stats