MCOLN2 (NM 153259) Human Tagged ORF Clone Product Data

Total Page:16

File Type:pdf, Size:1020Kb

Load more

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC211195L3 MCOLN2 (NM_153259) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MCOLN2 (NM_153259) Human Tagged ORF Clone Tag: Myc-DDK Symbol: MCOLN2 Synonyms: TRP-ML2; TRPML2 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC211195). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_153259 ORF Size: 1698 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 MCOLN2 (NM_153259) Human Tagged ORF Clone – RC211195L3 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_153259.2 RefSeq Size: 3060 bp RefSeq ORF: 1701 bp Locus ID: 255231 UniProt ID: Q8IZK6 Protein Families: Druggable Genome, Ion Channels: Transient receptor potential, Transmembrane MW: 65.9 kDa Gene Summary: Mucolipins constitute a family of cation channel proteins with homology to the transient receptor potential superfamily. In mammals, the mucolipin family includes 3 members, MCOLN1 (MIM 605248), MCOLN2, and MCOLN3 (MIM 607400), that exhibit a common 6- membrane-spanning topology. Homologs of mammalian mucolipins exist in Drosophila and C. elegans. Mutations in the human MCOLN1 gene cause mucolipodosis IV (MIM 262650) (Karacsonyi et al., 2007 [PubMed 17662026]).[supplied by OMIM, Sep 2009] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Recommended publications
  • The Intracellular Ca2+ Release Channel TRPML1 Regulates Lower Urinary Tract Smooth Muscle Contractility

    The Intracellular Ca2+ Release Channel TRPML1 Regulates Lower Urinary Tract Smooth Muscle Contractility

    The intracellular Ca2+ release channel TRPML1 regulates lower urinary tract smooth muscle contractility Caoimhin S. Griffina, Michael G. Alvaradoa, Evan Yamasakia, Bernard T. Drummb,c, Vivek Krishnana, Sher Alia, Eleanor M. Naglea, Kenton M. Sandersb, and Scott Earleya,1 aDepartment of Pharmacology, Center for Molecular and Cellular Signaling in the Cardiovascular System, Reno School of Medicine, University of Nevada, Reno, NV 89557-0318; bDepartment of Physiology and Cell Biology, Reno School of Medicine, University of Nevada, Reno, NV 89557-0318; and cDepartment of Life & Health Sciences, Dundalk Institute of Technology, Louth, Ireland A91 K584 Edited by Mark T. Nelson, University of Vermont, Burlington, VT, and approved October 13, 2020 (received for review August 12, 2020) TRPML1 (transient receptor potential mucolipin 1) is a Ca2+-perme- including dense granulomembranous storage bodies in neurons, able, nonselective cation channel that is predominantly localized to elevated plasma gastrin, vacuolization in the gastric mucosa, and the membranes of late endosomes and lysosomes (LELs). Intracellular retinal degeneration (14). Interestingly, however, an anatomical release of Ca2+ through TRPML1 is thought to be pivotal for mainte- examination of these mice reveals dramatically distended bladders nance of intravesicular acidic pH as well as the maturation, fusion, and (14), leading us to question how TRPML1, an intracellular Ca2+-re- trafficking of LELs. Interestingly, genetic ablation of TRPML1 in mice lease channel important in LEL function, affects bladder physiology. −/− (Mcoln1 ) induces a hyperdistended/hypertrophic bladder phenotype. The lower urinary tract (LUT) is composed of the urinary Here, we investigated this phenomenon further by exploring an un- bladder and urethra—structures that serve the simple, reciprocal conventional role for TRPML1 channels in the regulation of Ca2+-signal- functions of storing and voiding urine (15).
  • The Intracellular Ca2+ Release Channel TRPML1 Regulates Lower Urinary Tract Smooth Muscle Contractility

    The Intracellular Ca2+ Release Channel TRPML1 Regulates Lower Urinary Tract Smooth Muscle Contractility

    The intracellular Ca2+ release channel TRPML1 regulates lower urinary tract smooth muscle contractility Caoimhin S. Griffina, Michael G. Alvaradoa, Evan Yamasakia, Bernard T. Drummb,c, Vivek Krishnana, Sher Alia, Eleanor M. Naglea, Kenton M. Sandersb, and Scott Earleya,1 aDepartment of Pharmacology, Center for Molecular and Cellular Signaling in the Cardiovascular System, Reno School of Medicine, University of Nevada, Reno, NV 89557-0318; bDepartment of Physiology and Cell Biology, Reno School of Medicine, University of Nevada, Reno, NV 89557-0318; and cDepartment of Life & Health Sciences, Dundalk Institute of Technology, Louth, Ireland A91 K584 Edited by Mark T. Nelson, University of Vermont, Burlington, VT, and approved October 13, 2020 (received for review August 12, 2020) TRPML1 (transient receptor potential mucolipin 1) is a Ca2+-perme- including dense granulomembranous storage bodies in neurons, able, nonselective cation channel that is predominantly localized to elevated plasma gastrin, vacuolization in the gastric mucosa, and the membranes of late endosomes and lysosomes (LELs). Intracellular retinal degeneration (14). Interestingly, however, an anatomical release of Ca2+ through TRPML1 is thought to be pivotal for mainte- examination of these mice reveals dramatically distended bladders nance of intravesicular acidic pH as well as the maturation, fusion, and (14), leading us to question how TRPML1, an intracellular Ca2+- trafficking of LELs. Interestingly, genetic ablation of TRPML1 in mice release channel important in LEL function, affects bladder −/− (Mcoln1 ) induces a hyperdistended/hypertrophic bladder phenotype. physiology. Here, we investigated this phenomenon further by exploring an un- The lower urinary tract (LUT) is composed of the urinary conventional role for TRPML1 channels in the regulation of Ca2+-signal- bladder and urethra—structures that serve the simple, reciprocal ing activity and contractility in bladder and urethral smooth muscle cells functions of storing and voiding urine (15).
  • Note: the Letters 'F' and 'T' Following the Locators Refers to Figures and Tables

    Note: the Letters 'F' and 'T' Following the Locators Refers to Figures and Tables

    Index Note: The letters ‘f’ and ‘t’ following the locators refers to figures and tables cited in the text. A Acyl-lipid desaturas, 455 AA, see Arachidonic acid (AA) Adenophostin A, 71, 72t aa, see Amino acid (aa) Adenosine 5-diphosphoribose, 65, 789 AACOCF3, see Arachidonyl trifluoromethyl Adlea, 651 ketone (AACOCF3) ADP, 4t, 10, 155, 597, 598f, 599, 602, 669, α1A-adrenoceptor antagonist prazosin, 711t, 814–815, 890 553 ADPKD, see Autosomal dominant polycystic aa 723–928 fragment, 19 kidney disease (ADPKD) aa 839–873 fragment, 17, 19 ADPKD-causing mutations Aβ, see Amyloid β-peptide (Aβ) PKD1 ABC protein, see ATP-binding cassette protein L4224P, 17 (ABC transporter) R4227X, 17 Abeele, F. V., 715 TRPP2 Abbott Laboratories, 645 E837X, 17 ACA, see N-(p-amylcinnamoyl)anthranilic R742X, 17 acid (ACA) R807X, 17 Acetaldehyde, 68t, 69 R872X, 17 Acetic acid-induced nociceptive response, ADPR, see ADP-ribose (ADPR) 50 ADP-ribose (ADPR), 99, 112–113, 113f, Acetylcholine-secreting sympathetic neuron, 380–382, 464, 534–536, 535f, 179 537f, 538, 711t, 712–713, Acetylsalicylic acid, 49t, 55 717, 770, 784, 789, 816–820, Acrolein, 67t, 69, 867, 971–972 885 Acrosome reaction, 125, 130, 301, 325, β-Adrenergic agonists, 740 578, 881–882, 885, 888–889, α2 Adrenoreceptor, 49t, 55, 188 891–895 Adult polycystic kidney disease (ADPKD), Actinopterigy, 223 1023 Activation gate, 485–486 Aframomum daniellii (aframodial), 46t, 52 Leu681, amino acid residue, 485–486 Aframomum melegueta (Melegueta pepper), Tyr671, ion pathway, 486 45t, 51, 70 Acute myeloid leukaemia and myelodysplastic Agelenopsis aperta (American funnel web syndrome (AML/MDS), 949 spider), 48t, 54 Acylated phloroglucinol hyperforin, 71 Agonist-dependent vasorelaxation, 378 Acylation, 96 Ahern, G.
  • Snapshot: Mammalian TRP Channels David E

    Snapshot: Mammalian TRP Channels David E

    SnapShot: Mammalian TRP Channels David E. Clapham HHMI, Children’s Hospital, Department of Neurobiology, Harvard Medical School, Boston, MA 02115, USA TRP Activators Inhibitors Putative Interacting Proteins Proposed Functions Activation potentiated by PLC pathways Gd, La TRPC4, TRPC5, calmodulin, TRPC3, Homodimer is a purported stretch-sensitive ion channel; form C1 TRPP1, IP3Rs, caveolin-1, PMCA heteromeric ion channels with TRPC4 or TRPC5 in neurons -/- Pheromone receptor mechanism? Calmodulin, IP3R3, Enkurin, TRPC6 TRPC2 mice respond abnormally to urine-based olfactory C2 cues; pheromone sensing 2+ Diacylglycerol, [Ca ]I, activation potentiated BTP2, flufenamate, Gd, La TRPC1, calmodulin, PLCβ, PLCγ, IP3R, Potential role in vasoregulation and airway regulation C3 by PLC pathways RyR, SERCA, caveolin-1, αSNAP, NCX1 La (100 µM), calmidazolium, activation [Ca2+] , 2-APB, niflumic acid, TRPC1, TRPC5, calmodulin, PLCβ, TRPC4-/- mice have abnormalities in endothelial-based vessel C4 i potentiated by PLC pathways DIDS, La (mM) NHERF1, IP3R permeability La (100 µM), activation potentiated by PLC 2-APB, flufenamate, La (mM) TRPC1, TRPC4, calmodulin, PLCβ, No phenotype yet reported in TRPC5-/- mice; potentially C5 pathways, nitric oxide NHERF1/2, ZO-1, IP3R regulates growth cones and neurite extension 2+ Diacylglycerol, [Ca ]I, 20-HETE, activation 2-APB, amiloride, Cd, La, Gd Calmodulin, TRPC3, TRPC7, FKBP12 Missense mutation in human focal segmental glomerulo- C6 potentiated by PLC pathways sclerosis (FSGS); abnormal vasoregulation in TRPC6-/-
  • Neuropathophysiology, Genetic Profile, and Clinical Manifestation of Mucolipidosis IV—A Review and Case Series

    Neuropathophysiology, Genetic Profile, and Clinical Manifestation of Mucolipidosis IV—A Review and Case Series

    International Journal of Molecular Sciences Review Neuropathophysiology, Genetic Profile, and Clinical Manifestation of Mucolipidosis IV—A Review and Case Series 1, 2, 3, , Aleksandra Jezela-Stanek y , El˙zbietaCiara y and Karolina M. Stepien * y 1 Department of Genetics and Clinical Immunology, National Institute of Tuberculosis and Lung Diseases, 01-138 Warsaw, Poland; [email protected] 2 Department of Medical Genetics, The Children’s Memorial Heath Institute, 04-730 Warsaw, Poland; [email protected] 3 Adult Inherited Metabolic Diseases, Salford Royal NHS Foundation Trust, Salford M6 8HD, UK * Correspondence: [email protected] These authors contributed equally to this work. y Received: 31 May 2020; Accepted: 23 June 2020; Published: 26 June 2020 Abstract: Mucolipidosis type IV (MLIV) is an ultra-rare lysosomal storage disorder caused by biallelic mutations in MCOLN1 gene encoding the transient receptor potential channel mucolipin-1. So far, 35 pathogenic or likely pathogenic MLIV-related variants have been described. Clinical manifestations include severe intellectual disability, speech deficit, progressive visual impairment leading to blindness, and myopathy. The severity of the condition may vary, including less severe psychomotor delay and/or ocular findings. As no striking recognizable facial dysmorphism, skeletal anomalies, organomegaly, or lysosomal enzyme abnormalities in serum are common features of MLIV, the clinical diagnosis may be significantly improved because of characteristic ophthalmological anomalies. This review aims to outline the pathophysiology and genetic defects of this condition with a focus on the genotype–phenotype correlation amongst cases published in the literature. The authors will present their own clinical observations and long-term outcomes in adult MLIV cases.
  • Ion Channels

    Ion Channels

    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
  • Permeation, Regulation and Control of Expression of TRP Channels by Trace Metal Ions

    Permeation, Regulation and Control of Expression of TRP Channels by Trace Metal Ions

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Crossref Pflugers Arch - Eur J Physiol (2015) 467:1143–1164 DOI 10.1007/s00424-014-1590-3 INVITED REVIEW Permeation, regulation and control of expression of TRP channels by trace metal ions Alexandre Bouron & Kirill Kiselyov & Johannes Oberwinkler Received: 15 April 2014 /Revised: 10 July 2014 /Accepted: 13 July 2014 /Published online: 10 August 2014 # The Author(s) 2014. This article is published with open access at Springerlink.com Abstract Transient receptor potential (TRP) channels form a TRPML channels . Channel regulation . Transition metals . diverse family of cation channels comprising 28 members in Zinc .Cadmium .Copper .Magnesium .Nickel .Iron .Lead . mammals. Although some TRP proteins can only be found on Barium . Strontium . Manganese . Lanthanum . Gadolinium intracellular membranes, most of the TRP protein isoforms reach the plasma membrane where they form ion channels and control a wide number of biological processes. There, their Introduction involvement in the transport of cations such as calcium and sodium has been well documented. However, a growing num- Some trace metals like zinc (Zn2+), iron (Fe2+/Fe3+)orcopper ber of studies have started to expand our understanding of (Cu+/Cu2+) are involved in a wide diversity of biological these proteins by showing that they also transport other bio- processes. Other metal ions like cadmium (Cd2+) or lead logically relevant metal ions like zinc, magnesium, manga- (Pb2+) have only toxic properties, at least in vertebrate cells. nese and cobalt. In addition to this newly recognized property, The molecular mechanisms by which these cations enter into the activity and expression of TRP channels can be regulated cells are still not fully understood.
  • Characterization and Expression Analysis of Mcoln1.1 and Mcoln1.2, the Putative Zebrafish Co-Orthologs of the Gene Responsible F

    Characterization and Expression Analysis of Mcoln1.1 and Mcoln1.2, the Putative Zebrafish Co-Orthologs of the Gene Responsible F

    Int. J. Dev. Biol. 57: 85-93 (2013) doi: 10.1387/ijdb.120033gb www.intjdevbiol.com Characterization and expression analysis of mcoln1.1 and mcoln1.2, the putative zebrafish co-orthologs of the gene responsible for human mucolipidosis type IV ANNA BENINI1, ANDREA BOZZATO1, SILVIA MANTOVANELLI1, LAURA CALVARINI1, EDOARDO GIACOPUZZI1, ROBERTO BRESCIANI1, SILVIA MOLERI2, DANIELA ZIZIOLI1, MONICA BELTRAME2 and GIUSEPPE BORSANI*,1 1Dipartimento di Scienze Biomediche e Biotecnologie, Universita' degli Studi di Brescia, Italy and 2Dipartimento di BioScienze, Universita' degli Studi di Milano, Milano, Italy ABSTRACT Mucolipidosis type IV (MLIV) is an autosomal recessive lysosomal storage disorder caused by mutations in the MCOLN1 gene coding for mucolipin-1 (TRPML1). TRPML1 belongs to a transient receptor potential channels (TRP) subfamily, which in mammals includes two other members: mucolipin-2 (TRPML2) and mucolipin-3 (TRPML3). Bioinformatic analysis of the Danio rerio (zebrafish) genome and trascriptome revealed the presence of five different genes related to human mucolipins: mcoln1.1, mcoln1.2, mcoln2, mcoln3.1 and mcoln3.2. We focused our efforts on the characterization of the two putative zebrafish MCOLN1 co-orthologs. Transient-expression experiments in human HeLa cells demonstrated that fish Mcoln1.1 and Mcoln1.2, similarly to TRPML1, localize to late endosomal/lysosomal compartments. Real-Time PCR (RT-PCR) experi- ments showed that both genes are maternally expressed and transcribed at different levels during embryogenesis. RT-PCR analysis in different zebrafish tissues displayed ubiquitary expression for mcoln1.1 and a more tissue-specific pattern for mcoln1.2. Spatial and temporal expression studies using whole-mount in situ hybridization confirmed that both genes are maternally expressed and ubiquitously transcribed during gastrulation and early somitogenesis.
  • MCOLN2 (NM 153259) Human Tagged ORF Clone – RC211195

    MCOLN2 (NM 153259) Human Tagged ORF Clone – RC211195

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC211195 MCOLN2 (NM_153259) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MCOLN2 (NM_153259) Human Tagged ORF Clone Tag: Myc-DDK Symbol: MCOLN2 Synonyms: TRP-ML2; TRPML2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 MCOLN2 (NM_153259) Human Tagged ORF Clone – RC211195 ORF Nucleotide >RC211195 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCGGCAGCCTTATCGTTTTCCCCAGGCAAGGATTCCGGAGAGAGGATCAGGTGTTTTCAGGTTAA CCGTCAGAAATGCAATGGCACATCGTGATTCTGAGATGAAAGAAGAATGTCTAAGGGAAGACCTGAAGTT TTACTTCATGAGCCCTTGTGAAAAATACCGAGCCAGACGCCAGATTCCGTGGAAACTGGGTTTGCAGATT TTGAAGATAGTCATGGTCACCACACAGCTTGTTCGTTTTGGTTTAAGTAACCAGCTGGTGGTTGCTTTCA AAGAAGATAACACTGTTGCTTTTAAGCACTTGTTTTTGAAAGGATATTCTGGTACAGATGAAGATGACTA CAGCTGCAGTGTATATACTCAAGAGGATGCCTATGAGAGCATCTTTTTTGCTATTAATCAGTATCATCAG CTAAAGGACATTACCCTGGGGACCCTTGGTTATGGAGAAAATGAAGACAATAGAATTGGCTTAAAAGTCT GTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGA GCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCATTC
  • Ion Channels in the P14 Rat Brain

    Ion Channels in the P14 Rat Brain

    A Digital Atlas of Ion Channel Expression Patterns in the Two-Week-Old Rat Brain Volodymyr Shcherbatyy1, James Carson2, Murat Yaylaoglu1, Katharina Jäckle1, Frauke Grabbe1, Maren Brockmeyer 1, Halenur Yavuz 1, and Gregor Eichele1* 1 Department of Genes and Behavior, Max Plank Institute for Biophysical Chemistry, Göttingen, Germany 2 Life Sciences Computing, Texas Advanced Computing Center, Austin, TX, USA * Correspondence to: Gregor Eichele, Department of Genes and Behavior, Max Planck Institute for Biophysical Chemistry, Am Fassberg 11, 37077 Göttingen, Germany E-mail address: [email protected] Online Resource 1 ESM_1. List of ion channels examined in the P14 rat brain. ISH data are viewable using the entry interface of Genepaint.org (http://www.genepaint.org/) by entering the gene symbol or Genepaint set ID (a database internal ID). In the Genepaint.org database, images of individual sections can be viewed at full resolution by using the virtual microscope tools. Additionally, the full template sequence, specimen properties, gene accession number and Entrez Gene ID can be retrieved and images can be downloaded as described in the Manual of Genepaint under “Zoom Viewer” on the Genepaint.org home page [see also (Geffers et al. 2012)]. Supplemental references Geffers, L., Herrmann, B., & Eichele, G. (2012). Web-based digital gene expression atlases for the mouse. Mamm Genome, 23(9-10), 525-538, doi:10.1007/s00335-012-9413-3. Page 1 of 16 ESM_1. List of ion channels examined in the P14 rat brain qPCR Analysis Rat Gene Genepaint
  • Molecular Regulations and Functions of the Transient Receptor Potential Channels of the Islets of Langerhans and Insulinoma Cells

    Molecular Regulations and Functions of the Transient Receptor Potential Channels of the Islets of Langerhans and Insulinoma Cells

    cells Review Molecular Regulations and Functions of the Transient Receptor Potential Channels of the Islets of Langerhans and Insulinoma Cells Md. Shahidul Islam 1,2 1 Karolinska Institutet, Department of Clinical Science and Education, Södersjukhuset, Research Center, 5th floor, SE-118 83 Stockholm, Sweden; [email protected] 2 Department of Emergency Care and Internal Medicine, Uppsala University Hospital, Uppsala University, SE-751 85 Uppsala, Sweden Received: 2 February 2020; Accepted: 8 March 2020; Published: 11 March 2020 Abstract: Insulin secretion from the β-cells of the islets of Langerhans is triggered mainly by nutrients such as glucose, and incretin hormones such as glucagon-like peptide-1 (GLP-1). The mechanisms of the stimulus-secretion coupling involve the participation of the key enzymes that metabolize the nutrients, and numerous ion channels that mediate the electrical activity. Several members of the transient receptor potential (TRP) channels participate in the processes that mediate the electrical activities and Ca2+ oscillations in these cells. Human β-cells express TRPC1, TRPM2, TRPM3, TRPM4, TRPM7, TRPP1, TRPML1, and TRPML3 channels. Some of these channels have been reported to mediate background depolarizing currents, store-operated Ca2+ entry (SOCE), electrical activity, Ca2+ oscillations, gene transcription, cell-death, and insulin secretion in response to stimulation by glucose and GLP1. Different channels of the TRP family are regulated by one or more of the following mechanisms: activation of G protein-coupled receptors, the filling state of the endoplasmic reticulum Ca2+ store, heat, oxidative stress, or some second messengers. This review briefly compiles our current knowledge about the molecular mechanisms of regulations, and functions of the TRP channels in the β-cells, the α-cells, and some insulinoma cell lines.
  • TRP Channels As Cellular Sensors

    TRP Channels As Cellular Sensors

    review article TRP channels as cellular sensors David E. Clapham Howard Hughes Medical Institute, Pediatric Cardiology, Children’s Hospital of Boston, Department of Neurobiology, Harvard Medical School, Enders 1309, 320 Longwood Avenue, Children’s Hospital, Boston, Massachusetts 02115, USA ........................................................................................................................................................................................................................... TRP channels are the vanguard of our sensory systems, responding to temperature, touch, pain, osmolarity, pheromones, taste and other stimuli. But their role is much broader than classical sensory transduction. They are an ancient sensory apparatus for the cell, not just the multicellular organism, and they have been adapted to respond to all manner of stimuli, from both within and outside the cell. he human genome encodes hundreds of channels that perceive and respond to hypertonicity4,5. Nematodes use TRP broker the passage of charged ions across impermeable channels at the tips of neuronal dendrites in their ‘noses’ to detect lipid bilayers1. While energy-requiring pumps labour to and avoid noxious chemicals6. Male mice use a pheromone-sensing build charge and concentration gradients across the TRP channel to tell males from females7. Humans use TRP channels membrane, ion channels spend this stored energy, to appreciate sweet, bitter and umami (amino acid) tastes8, and to Tmuch as a switch releases the electrical energy of a battery. Small discriminate warmth, heat and cold. In each of these cases, TRPs conformational changes cause channels to open, allowing over ten mediate sensory transduction, not only in a classical sense, for the million ions to flow per second through each channel. Ca2þ ions are entire multicellular organism, but also at the level of single cells. particularly important in cellular homeostasis and activity, and the Almost all mammalian TRP channel genes are now known.