C/EBP ∆Uorf Mice – a Genetic Model for Uorf-Mediated Translational Control in Mammals

Aus dem Max-Delbrück-Centrum für molekulare Medizin

C/EBP uORF mice – a genetic model for uORF-mediated translational control in mammals

Dissertation

zur Erlangung des akademischen Grades

doctor rerum naturalium (Dr. rer. nat.)

im Fach Biologie

eingereicht an der

Mathematisch-Naturwissenschaftlichen Fakultät I

der Humboldt-Universität zu Berlin

von

Dr. med. Klaus Wethmar

Präsident der Humboldt-Universität zu Berlin

Prof. Dr. Dr. h.c. Christoph Markschies

Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I

Prof. Dr. Andreas Herrmann

Gutachter: 1. Prof. Dr. Achim Leutz

2. Prof. Dr. Claus Scheidereit

3. Prof. Dr. Thomas Sommer

Tag der mündlichen Prüfung: 28. März 2011

Table of contents

Table of contents 2 Zusammenfassung 4 Abstract 5 Dedication 7 List of abbreviations 8

1 Introduction 11 1.1 Translational regulation of protein expression 11 1.1.1 Mechanisms of translational control 11 1.1.2 Translational control by upstream open reading frames 14 1.1.2.1 Variable presence of uORFs in alternative transcripts 15 1.1.2.2 Length, position and initiation codon context 15 1.1.2.3 Upstream ORFs integrate the general translational status of a cell 17 1.1.2.4 Upstream ORF-encoded peptides 18 1.1.2.5 Nonsense-mediated mRNA decay 19 1.1.2.6 Variables affecting the degree of uORF-mediated MCS repression 20 1.2 CCAAT/enhancer binding proteins 21 1.2.1 Family overview 21 1.2.2 Isoform-specific functions of C/EBP transcription factors 24 1.2.3 Upstream ORF-mediated control of C/EBP isoform expression 26 1.3 Aims of the thesis 29

2 Materials and Methods 31 2.1 Mice 31 2.1.1 Generation of C/EBPuORF and C/EBPWT mice 31 2.1.2 Genotyping 32 2.1.3 Peripheral blood glucose test 33 2.1.4 Whole mount staining of mouse mammary glands 33 2.1.5 Blood counts 33 2.1.6 Fluorescence activated cell sorting (FACS) 34 2.1.7 Mouse lipopolysaccharid treatment 35 2.1.8 Mouse embryonic fibroblast (MEF) preparation and proliferation assay 35 2.1.9 Osteoclast cultures and TRACP staining 35 2.1.10 Bone histology and histomorphometry 36 2.1.11 Partial hepatectomy and BrdU labeling 36 2.1.12 Liver histomorphometry 37 2.2 Protein analysis 37 2.2.1 Cell lysis, tissue lysis and immunoblotting 37 2.2.2 Enzyme linked immuno sorbent assay (ELISA) 39 2.3 RNA analysis 39 2.3.1 Real-time polymerase chain reaction (real-time PCR) 39 2.3.2 Microarray expression analysis 41

2 Table of contents

2.4 Various methods 41 2.4.1 Chromatin immunoprecipitation 41 2.4.2 Luciferase reporter assays 43 2.4.3 Statistical analysis 45

3 Results 47 3.1 Basic characterization of C/EBP uORF mice 47 3.2 Loss of uORF-mediated LIP expression in C/EBP uORF mice 51 3.3 Defective osteoclast differentiation and altered bone homeostasis in C/EBP uORF mice 53 3.4 Superactivated acute phase gene expression in C/EBP uORF mice 56 3.5 Proliferative defects during liver regeneration in C/EBP uORF mice 58 3.6 Isoform-specific co-regulation of E2F-controlled cell cycle genes 62

4 Discussion 65 4.1 Proof of principle: uORF-mediated translational control in the mouse 65 4.2 C/EBP translational control – exception or paradigm? 66 4.2.1 Mechanisms of uORF-mediated translational control of C/EBP 68 4.3 Do uORFs control the translation of C/EBP? 71 4.4 Physiological relevance of the C/EBP isoform expression ratio 72 4.4.1 LAP and LIP opposingly regulate the differentiation of osteoclasts 73 4.4.2 Increased C/EBP LAP over LIP isoform ratio alters acute phase response gene expression 75 4.4.3 Isoform-specific cell cycle regulation by C/EBPs 78 4.4.4 The function of C/EBP isoforms during liver regeneration 80 4.5 Concluding remarks and future directions 82 4.5.1 Resolving the bipartite functions of C/EBP transcription factors 82 4.5.2 Defining the role of uORFs in the etiology of disease 84

Supplement 87

Acknowledgements 105

References 106

Erklärung 117

Publikationsliste 118

Zusammenfassung

Evolutionär konservierte, kleine offene Leserahmen (upstream open reading frames, uORFs) sind translational aktive Kontrollelemente, die bevorzugt in Boten-Ribonukleinsäuren von Schlüsselgenen zur Regulation von Zellwachstum, Proliferation und Differenzierung anzutref- fen sind. Man nimmt an, dass uORFs die Proteinexpression von betroffenen Transkripten durch die Regulierung der ribosomalen Reinitiation an 3´ gelegenen alternativen Initiations- codons kontrollieren. Obwohl die physiologische Relevanz uORF-vermittelter translationaler Kontrolle durch humangenetische Studien nahe gelegt wird, existiert bislang kein experimen- telles Wirbeltiermodel, das diese Vermutung belegt. In dieser Arbeit wurden Mäuse analysiert, die defizient für das uORF Initiationscodon des Transkriptionsfaktors CCAAT/enhancer binding protein (C/EBPuORF) sind. Protein- analysen verschiedener Gewebe zeigten, dass C/EBPuORF Mäuse im Gegensatz zu Wildtyp- tieren nicht in der Lage sind, die kurze, auto-antagonistische C/EBP LIP Isoform zu induzie- ren. Die verminderte LIP Expression verursachte eine gestörte Differenzierung knochen- abbauender Osteoklasten und ging mit einer Zunahme von mineralisiertem Knochengewebe in C/EBPuORF Mäusen einher. Nach partieller Hepatektomie führte der Verlust der uORF- vermittelten Induktion von LIP in regenerierenden C/EBPuORF Lebern zu einer Überaktivie- rung C/EBP-regulierter Akute Phase Gene. Im Vergleich zum Wildtyp wiesen Hepatozyten von C/EBPuORF Tieren zudem einen verzögerten und abgeschwächten Wiedereintritt in die S-Phase des Zellzyklus auf. Genomweite Genexpressionsanalysen zeigten, dass die verminderte S-Phase Aktivität in regenerierenden C/EBPuORF Lebern mit einer persistierenden Repression von Zellzyklusgenen korrelierte, wobei insbesondere die verminderte Expression zahlreicher E2F-regulierter Gene auffällig wurde. Chromatinimmunpräzipitations- und Repor- tergenexperimente führten zur Entwicklung eines mechanistischen Modells, das eine iso- formspezifische C/EBP-Koregulation E2F-kontrollierter Zellzyklusgene vorschlägt. Die Analyse der C/EBPuORF Mäuse belegt erstmals die Funktionalität der uORF-gesteuerten translationalen Kontrolle im Säugetier. Zusammen mit Sequenzanalysen, welche die weite Verbreitung von uORFs im menschlichen Transkriptom belegen, weisen die hier vorgestellten experimentellen Daten auf eine entscheidende Bedeutung dieses Kontrollmechanismus bei zahlreichen physiologischen und pathopysiologischen Prozessen hin.

Abstract

Evolutionary conserved small upstream open reading frames (uORFs) are translational control elements predominantly prevalent in the 5’ mRNA regions of key regulatory genes of growth, proliferation, and differentiation. Small uORFs are considered to regulate protein expression by controlling translation re-initiation at downstream initiation codons. Although the physiological relevance of uORF-mediated translational control is implied by human genetic studies, no experimental vertebrate model exists to prove this assumption. This thesis comprises the evaluation of mice deficient for the uORF initiation codon of the transcription factor CCAAT/enhancer binding protein (C/EBPuORF). Protein analysis of various tissues demonstrated that C/EBPuORF mice, in contrast to wildtype control animals (C/EBPWT), fail to induce translation of the truncated, auto-antagonistic C/EBP LIP isoform. The reduced expression of LIP was associated with impaired differentiation of bone resorbing osteclasts and resulted in an increased bone volume of C/EBPuORF mice. After partial hepatectomy the loss of uORF-mediated LIP induction resulted in super activation of acute phase response genes in regenerating livers. Furthermore, C/EBPuORF hepatocytes showed a delayed and blunted re-entry into the cell cycle after partial hepatectomy as compared to C/EBPWT animals. Genome-wide transcript expression analyses revealed that the reduced S-phase activity in regenerating C/EBPuORF livers correlated with a persistent repression of cell cycle regulatory genes and showed a remarkable underrepresentation of genes regulated by the E2F family of transcription factors. Chromatinimmunoprecipitations and luciferase reporter gene assays allowed the development of a mechanistic model that suggests C/EBP isoform-specific co-regulation of E2F-controled cell cycle genes. The analysis of C/EBPuORF mice validates the functionality of uORF-mediated translational control in vertebrates. Together with sequence analyses that demonstrate the widespread prevalence of uORFs in the human transcriptome, the experimental data presented in this thesis suggest a comprehensive role of uORF regulation in physiology and the etiology of disease.

Dedication for Anne, Klaus, Christine and Lauren.

7 List of abbreviations1

°C degree Celsius A adenosine AML acute myeloid leukemia APR acute phase response APS ammonium persulphate ATP adenosinetriphosphate BCR-ABL breakpoint cluster region - Abelson murine leukemia viral oncogene 1 BMM bone marrow derived macrophage precursors BrdU 5-Bromo-2-deoxy-Uridine bZIP basic leucine zipper C cytosine C. elegans Caenorhabditis elegans C/EBP CCAAT/enhancer-binding protein CD cluster of differentiation CDDO 2-Cyano-3,12-dioxooleana-1,9-dien-28-oic acid cDNA copy DNA ChIP chromatin immunoprecipitation cm centimeter CPE cytoplasmic polyadenylation element d day DAPI 4',6-diamidino-2-phenylindole ddwater double-distilled deionized water DMEM Dulbecco´s modiﬁed Eagles medium DMSO dimethylsulphoxide DNA deoxyribonucelicacid dNTP deoxyribonucleotide DTT dithiothreitol E. coli Escherichia coli ECL enhanced chemiluminescence EDTA ethylenediaminetetraacetate ELISA enzyme linked immunosorbent assay ext extended FACS fluorescence activated cell sorting FCS fetal calf serum Fig. figure g gram G guanine GTP Guanosine-5'-triphosphate h hour HCl hydrogen chloride HE hematoxylin eosin

1 Gene symbols were omitted from this list. Full gene names are given at first appearance in the main text.

8 List of abbreviations

HEPES 4-(2-hydroxyethyl-) 1piperazine-ehtanesylphic acid HRP horseradish peroxidase i.p. intra peritoneal Ig immunoglobulin IL interleukin IP immune precipitation IRE iron response element IRES internal ribosomal entry sites KCl potassium chloride k.o. knockout LAP liver activating protein LiCl lithium chloride LIP liver inhibitory protein LPS lipopolysaccharid M molar m7G 7-methyl-guanosine mA milliampere MCS main coding sequence M-CSF macrophage - colony stimulating factor MDC Max-Delbrueck-Center for Molecular Medicine, Berlin MEF mouse embryonic fibroblasts MgCl2 magnesium chloride miRNA micro RNA MM multiple myeloma mm millimeter mM millimolar mRNA messenger RNA mTOR mammalian target of rapamycin kinase g microgram l microliter m micrometer N arbitrary base NaCl sodium cholride NaHCO3 sodium hydrogen carbonate ng nanogram NMD nonsense-mediated mRNA decay NP-40 nonyl phenoxypolyethoxylethanol nt nucleotides PAGE polyacrylamide gelelectrophoresis PBS phosphate buffered saline PCR polymerase chain reaction pH potentia hydrogenii PH partial hepatectomy PIC proteinase inhibitor cocktail PMSF phenylmethylsulfonyl fluoride R purine base

9 List of abbreviations r radius RBC red blood cell RIPA radioimmunoprecipitation assay RNA ribonucleicacid rpm rounds per minute RR regulatory region RT room temperature s second SC sucrose control sd standard deviation SDS sodiumdodecyl sulfate sem standard error of the mean SNP single nucleotide polymorphism T thymidine TAE Tris/ acetate/ EDTA buffer Taq thermostable carboxypeptidase TEMED tetramethylethylenediamine Tris 2-amino-2-hydroxy-methylpropanol-1,3-diol Met tRNAi methionine-coupled initiator tRNA U uracil uAUG upstream AUG codon uORF upstream Open Reading Frame v volume W Watt WAT white adipose tissue WBC white blood cells WT wild type w/v weigth per volume zip code specific localization element

10 Introduction

1 Introduction

Accurate regulation of protein expression from a finite set of genes is of fundamental importance to any biological function in living cells. Regulation may occur at each level of the biogenesis of a given protein, i. e. the level of gene transcription, when genomic DNA is transcribed into messenger RNA (mRNA), the post-transcriptional level, when mRNA is modified and prepared for ribosomal translation, the level of translation itself, when the nucleotide sequence of mRNA is translated into the primary amino-acid sequence of the encoded protein, or at the post-translational level, when structural and chemical modifications finally produce a functional protein. During recent years, a number of elaborate regulatory mechanisms acting at the level of translation have been discovered. For example, the destabi- lization of transcripts by micro RNAs or the regulation of global translational conditions by the mammalian target of rapamycin (mTOR) proved to have important physiological and biomedical implications. A growing number of human diseases is currently being linked to deregulated translational control of protein expression. Thus, the detailed investigation of translational control mechanisms is an urgent and challenging task, ultimately aiming to identify crucial targets for therapeutic intervention.

1.1 Translational regulation of protein expression

1.1.1 Mechanisms of translational control

Translation of eukaryotic transcripts follows a coordinated sequence of events, as summarized in the ribosomal scanning model of translation (Kozak, 2002). Initially, a 43S pre-initiation Met complex, consisting of the 40S ribosomal subunit, the eIF2 – GTP – Met-tRNAi ternary complex and additional eukaryotic initiation factors, engages with the 7-methyl-guanosine (m7G) mRNA cap structure located at the 5´-end of a transcript (Jackson, et al., 2010). The Met pre-initiation complex scans the mRNA towards the 3´-end until the Met-tRNAi anti-codon matches a functional AUG codon. Joining with the 60S ribosomal subunit completes the assembly of a fully functional ribosome and permits initiation of translation. In the subsequent elongation process, the ribosome strings together single amino acids according to the genetic code memorized in the nucleotide sequence of the mRNA. Upon recognition of a termination codon the 60S subunit disengages from the complex and the nascent protein is released.

11 Introduction

Rapid adjustment of protein production to the changing requirements of environmental alterations is essential to sustain cellular functions. The global translational status of a cell is determined by multiple variables, including external stimuli, the activity of signaling pathways, the nutritional status, and the availability of indispensable co-factors required for translational initiation and elongation. Apart from being regulated by trans-acting factors, translation efficiency is also highly dependent on a variety of structural elements comprised within the mRNA itself (Chatterjee and Pal, 2009; Mignone, et al., 2002; Pickering and Willis, 2005; Wilkie, et al., 2003). Messenger RNA consists of the main protein coding sequence (MCS) flanked by upstream and downstream sequences of variable lengths.1 In the upstream or 5´-regulatory region (5´- RR) multiple cis-acting elements, such as hairpins (synonymously called stem-loops), protein interaction sites, upstream open reading frames (uORFs) or internal ribosomal initiation sites (IRESs) affect predominantly the efficiency of ribosomal scanning or the translational initiation process (Figure 1.1). Hairpin structures can either sterically impede the tethering of the pre-initiation complex to the m7G-cap or inhibit unwinding of the mRNA chain, resulting in impaired ribosomal scanning (Kozak, 1989). Other stem-loop elements contain structural or sequential recognition motifs for trans-acting regulatory proteins. For example, the translation of several proteins involved in iron-homeostasis, including the iron binding protein ferritin, is throttled by the interaction of iron regulatory proteins (IRP) with a stem-loop iron response element (IRE) located in the 5´-leaders of the respective transcripts (Allerson, et al., 1999). Inherited mutations in the ferritin IRE lead to decreased IRP binding and de-repressed translation of the ferritin protein. The resulting increase in iron deposition ultimately causes the hereditary hyperferritinemia-cataract syndrome (Girelli, et al., 1995). More than one third of mammalian transcripts contain upstream open reading frames in their 5´-regulatory regions, which are considered to affect translation rates from downstream initiation codons (Calvo, et al., 2009). As the focus of this thesis lies on uORF biology, the structure and function of uORFs will be introduced in detail in the following paragraph 1.1.2.

1 Originally, these MCS flanking regions were termed 5´- or 3´-untranslated regions (UTRs), respectively. These designations turn out to be misnomers, because the flanking regions may frequently contain translated sequence elements, as will bill explained in section 1.1.2. Thus, for the remainder of this thesis, the transcript sequences upstream and downstream of the MCS will be termed 5´- and 3´-regulatory region (RR), respectively.

12 Introduction

For a number of transcripts a cap-independent mechanism of translational initiation, facili- tated by internal ribosomal entry sites, has been described. IRESs were initially discovered in poliovirus RNA (Pelletier and Sonenberg, 1988) and were subsequently found also in eukaryotic transcripts, as first shown for BiP heavy-chain immunoglobulin protein (Macejak and Sarnow, 1991). A prominent example for the pathophysiological relevance of IRES-mediated translational control is the c-myc oncogene. A point mutation that significantly increases the c-myc IRES activity was first discovered in multiple myeloma (MM) cell lines and subsequently identified in 42% of primary MM cases (Chappell, et al., 2000). To date, a list of experimentally validated IRES-bearing transcripts is monitored in a public database, which currently includes more than 100 eukaryotic mRNA entries (http://iresite.org). Despite this growing body of evidence, the overall importance of IRES-mediated, cap-independent translational initiation is still controversially discussed. Additional cis-regulatory elements located in the 3´-portion of the transcript, such as micro RNA target sequences, protein complexes binding sites, ZIP codes or polyadenylation signals, predominantly affect RNA stability and subcellular localization. In addition, 3´-RR interacting proteins, such as the poly-A-binding protein (PABP), can support translational initiation of the MCS by a mechanism involving circularization of the respective transcript.

Figure 1.1 Messenger RNA contains a variety of cis-regulatory elements upstream (5´) and downstream (3´) of the main coding sequence. m7G, 7-methyl-guanosine cap; hairpin, hairpin-like secondary structures; uORF, upstream open reading frame; IRES, internal ribosome entry site; miRNA, micro RNA; CPE, cytoplasmic polyadenylation element; AAUAAA, polyadenylation signal; PABP, poly-A-binding protein. Figure adopted from (Mignone, et al., 2002).

13 Introduction

1.1.2 Translational control by upstream open reading frames

Initially, it was assumed that scanning ribosomes would generally initiate translation at the m7G-cap proximal AUG initiation codon (Kozak, 1978), but subsequently an increasing number of genes was identified that differed from this “first AUG rule”. Predominantly transcripts with long and presumably structured 5´-regulatory regions were found to frequently contain functional AUG codons upstream of the MCS (uAUGs), creating the initiation site of upstream open reading frames (uORFs)1 (Kozak, 1987). On the basis of the ribosomal scanning model, uORFs are considered to regulate protein production mainly by interfering with the undisturbed progression of scanning ribosomes towards the initiation codon of the main protein coding sequence (Kozak, 2002). Recent bioinformatic surveys identified uORFs in 35-49% of human and rodent transcripts, correlating with an overall reduction of translation of the respective proteins (Calvo, et al., 2009; Iacono, et al., 2005; Matsui, et al., 2007; Mignone, et al., 2002). Despite this high inci- dence, uORFs are less frequent than could be expected by chance (Iacono, et al., 2005). If present, they tend to be conserved among species (Neafsey and Galagan, 2007), suggesting an evolutionary selection of functional uORFs. Upstream ORFs may serve as rapid response elements, allowing the cell to immediately adopt protein production to altered environmental conditions at the level of translation. Upstream ORFs are highly diverse in both, structural features and regulatory functions. In humans, uORFs vary in length (average of 48 nt), number (0 to 13 uORFs per transcript), position (close or distant from the mRNAs m7G-cap, terminating upstream or downstream of the main coding sequence initiation site), and sequence (no common uORF sequence motif has been identified). Experimental validation for uORF- mediated translational control has been obtained for approximately 175 eukaryotic transcripts (Table S1) and several human diseases are linked to mutations affecting uORFs (Calvo, et al., 2009). Those studies revealed that the mechanism of uORF-mediated translational control is highly context-specific and depends on a variety of individual features of a given transcript.

1 To date, no standardized definition of a uORF exists. Depending on the literature, a uAUG defines a uORF if an in-frame termination codon precedes the initiation codon (Mignone et al. 2002; Iacono et al. 2005) or the termination codon (Calvo et al. 2009) of the main coding sequence. Although the regulatory effect of a uORF overlapping the MCS start site may be stronger, the distinction is rather academic, because multiple other potent variables influence the functionality of a uORF, as will be introduced below. In our view, every uAUG that allows initiation of translation starts an open reading frame independently of where translation terminates. Thus, in this thesis the term uORF will be used irrespective of the position of in-frame STOP codons.

14 Introduction

1.1.2.1 Variable presence of uORFs in alternative transcripts

The length of eukaryotic 5´-leader sequences is highly variable, reaching from 18 to 2803 nucleotides (nt) (Mignone, et al., 2002) with an average length of about 170 nt (Calvo, et al., 2009). Transcripts of key regulatory genes of growth, differentiation, and proliferation tend to have longer 5´-leader sequences with more complex secondary structures and a higher number of uORF initiation codons as compared to the average (Kozak, 1987). Certain genes are transcribed into transcript-variants with variable length of the 5´-RR, either due to alternative promoter usage or due to alternative splicing of the primary message. In these cases, the activity of uORF-mediated translational control is simply determined by the presence or absence of uORF start codons in the alternative transcripts. For example, two alternative promoters drive the transcription of the gene for the growth inhibitory protein BRCA1 (breast cancer 1). The longer transcript displays a more stable secondary structure of its 5´-RR and bears a number of uORFs, resulting in significantly reduced translation of BRCA1 as compared to the shorter transcript (Sobczak and Krzyzosiak, 2002). In breast cancer tissue the predominant expression of the extended transcript and the associated decrease in BRCA1 protein production accounts for a de-repression of cellular growth. In addition to alternative promoter usage, differential splicing alters the number of uORFs and the translation rate of several transcripts, including the RNA processing protein DICER (Irvin-Wilson and Chaudhuri, 2005), the hereditary thrombocythaemia-related growth factor thrombopoietin (TPO) (Wiestner, et al., 1998) and other examples listed in Table S1.

1.1.2.2 Length, position and initiation codon context

As introduced in paragraph 1.1.1, translational initiation requires the availability of a functional preinitiation complex. Whenever initiation occurs at a uORF, a functional preinitiation complex is consumed and thus cannot serve to initiate at the main protein coding sequence unless indispensable initiation factors have been reloaded. Downstream reinitiation efficiency was found to decrease with increasing uORF length and increasing complexity of secondary structures, suggesting that essential initiation factors dissociate from the ribosomal complex during elongation (Kozak, 2001). In turn, longer intercistronic distances between the uORF termination codon and the subsequent downstream initiation codon correlated with more efficient reinitiation, which was attributed to better reloading of the preinitiation complex over time (Abastado, et al., 1991; Kozak, 1987). Together, these data suggested a dynamic model,

15 Introduction where indispensable initiation cofactors detach from ribosomes during the elongation phase of translation, which need to be reassembled to allow reinitiation to occur (Kozak, 2002). Whether or not the ternary preinitiation complex recognizes an AUG triplet as a translational start codon is strongly influenced by the nucleotide context surrounding it. Extensive sequence analyses (Iacono, et al., 2005; Pesole, et al., 2000) as well as mutational analysis (Kozak, 1986) identified crucial nucleotide residues in the context of an AUG triplet, which create favorable or unfavorable surroundings for translational initiation. If the nucleotides at the most important positions -3 and +4 in respect to the adenine base of the AUG triplet contain purine bases A or G, the context for ribosomal initiation is good, while pyrimidine bases C or T at these sites decrease initiation efficiency (Kozak, 1986). The optimal surrounding sequence for initiation (also called optimal Kozak consensus sequence) is CCRCCAUGG, with R representing a purine base (Figure 1.2). Subsequent studies extended the regulatory context further upstream, demonstrating an initiation supporting function for G in positions -6 and -9 (Kozak, 1987).

Figure 1.2 Kozak consensus sequence. Sequence logo representing the conservation of nucleotides surrounding the AUG translational start site of human MCS. Figure adopted from (Iacono, et al., 2005).

Initiation sequence contexts are frequently classified as strong (both critical residues match the consensus sequence), as adequate/intermediate (either residue -3 or +4 matches) or as weak (both residues do not match) (Meijer and Thomas, 2002). If the AUG codon is surrounded by a strong context, virtually all scanning ribosomes will stop and initiate translation. In an adequate or weak surrounding, an increasing number of ribosomes scans through the

16 Introduction initiation site, ready to recognize a subsequent AUG located further downstream. Thus, leaky scanning allows initiation at alternative start codons in the same mRNA molecule, which has been documented for numerous transcripts (Kozak, 2002). Since the quality of the Kozak consensus sequence is not the only determinant of translation initiation efficiency, the mere evaluation of the surrounding nucleotides does not allow a precise prediction whether initiation will occur on a specific codon or not.

1.1.2.3 Upstream ORFs integrate the general translational status of a cell

Another interesting feature of uORF-mediated regulation is to adjust the translation rate of important regulatory proteins by integrating the general translational status of a cell. This was first described in a famous series of experiments on the yeast transcription factor GCN4 (general control nondepressible 4) (Hinnebusch, 1984; Hinnebusch, 2005; Hinnebusch, 1997; Mueller and Hinnebusch, 1986). Yeast GCN4 is the best-studied example of uORF-mediated translational control and illustrates how uORFs can facilitate the paradoxical induction of GCN4 protein expression under conditions of reduced global translation (Hinnebusch, 2005; Mueller and Hinnebusch, 1986). The first of four subsequent uORFs within the GCN4 5´- leader is efficiently translated under both good nutritional and starvation conditions and establishes a `reinitiation mode of translation´ (Kozak, 1987) for all downstream initiation codons (Hinnebusch, 2005; Mueller and Hinnebusch, 1986). In non-stressed cells, rapid reconstitu- Met tion of post-termination ribosomes with the eIF2–GTP–Met-tRNAi ternary complex allows immediate reinitiation at the proximal initiation sites of uORFs 2 to 4 (Figure 1.3).

Figure 1.3 Upstream ORFs control the translation of GCN4 by integrating general translational conditions. At high levels of the eIF2–GTP–Met-tRNAiMet ternary complex (left panel) reinitiation after translation of uORF1 occurs at the inhibitory uORF4, resulting in detachment of the ribosomal subunits from the GCN4 mRNA. Under starving conditions, the reduced availability of the ternary complex causes delayed restoration of a functional preinitiation complex, resulting in leaky scanning across the uORF4 initiation codon and allowing translation of the GCN4 coding sequence. Upstream ORF2 and 3 were omitted for simplicity, as they are functionally redundant to uORF4. Figure taken from (Hinnebusch, 1997).

17 Introduction

These uORFs exhibit specific inhibitory features, rendering the translating ribosomes incapa- ble of reinitiating at the MCS. During amino acid starvation, eIF2 is phosphorylated by the activated GCN2 kinase and, in its modified form, does not serve to form the ternary complex. Thus, the availability of initiation cofactors decreases and global translational conditions are impaired. In respect to GCN4 translation, the decelerated reloading of ribosomes that translated uORF1 results in leaky scanning across the inhibitory uORF start sites. Only after prolonged progression of post-termination ribosomes, a functional initiation complex can be reassembled, allowing the initiation at the MCS start codon and the induction of GCN4 protein under stress conditions. Due to their spatial and contextual organization, the four uORFs of the GCN4 transcript serve as a translational switchboard that allows the cell to rapidly respond to nutritional stress. Ul- timately, the translational induction of GCN4 and the subsequent activation of GCN4 target genes quickly adjust the cell’s molecular repertoire to environmental needs. The expression of GCN4 is thus determined by the combinatorial effect of leaky scanning and reinitiation events imposed by the four uORFs. GCN4 represents one of the best-studied examples, how the length of a uORF, the sequence context adjacent to its termination codon and the distance to the downstream initiation codon modulate the inhibitory effect on ribosomal reinitiation (Hinnebusch, 2005; Mueller and Hinnebusch, 1986). Similar mechanisms, depending on the translational status of a cell, have been described for the mammalian transcription factors ATF4 (Harding, et al., 2000), C/EBP and - (Calkhoven, et al., 2000), the macrophage receptor protein CD36 (Griffin, et al., 2001) as well as additional examples summarized in Table S1.

1.1.2.4 Upstream ORF-encoded peptides

In few cases, uORF-encoded peptides may interact with the translation machinery and repress translation of the MCS or reduce mRNA stability in response to trans-acting molecular regulators. For example, the translational repression of the Arabidopsis transcription factor bZIP11 by sucrose is dependent on the translation of a uORF-encoded sucrose control peptide (SC- peptide) (Rahmani, et al., 2009). Sucrose induces specific peptide-ribosome interactions that cause stalling of ribosomes at the uORF termination codon, resulting in decreased translational initiation at the bZIP11 start site. Additional examples of ribosome stalling induced by the interaction of uORF-encoded peptides with regulatory small molecules implicated the repression of translation of mammalian S-Adenosylmethionine decarboxylase (AdoMetDC)

18 Introduction by polyamines (Hanfrey, et al., 2005; Raney, et al., 2000) or of yeast carbamyl phosphate synthetase A (CPA1) by arginine (Gaba, et al., 2005). For other transcripts, including the cy- tomegalovirus UL4 mRNA (Janzen, et al., 2002), the DNA damage-inducible transcript 3 (DDIT3/CHOP/CEBP) (Jousse, et al., 2001) or the vasopressin V1b receptor (Rabadan- Diehl, et al., 2007) translational repression by uORF-encoded peptides has been decribed without detailed analysis of the mechanism involved. A number of novel, potentially functional uORF-encoded peptides in human cells were revealed by mass spectrometry (Oyama, et al., 2004; Oyama, et al., 2007) and computational analyses (Crowe, et al., 2006). In total, a subset of approximately 200 human uORFs were suggested to encode unique functional peptides, as no conforming peptide motif among different transcripts could be identified (Crowe, et al., 2006).

1.1.2.5 Nonsense-mediated mRNA decay

Nonsense-mediated decay (NMD) of mRNA is activated when specific surveillance mechanisms of eukaryotic cells detect premature termination of protein translation (Isken and Ma- quat, 2007). Such premature termination events mostly result from the use of nonsense codons that occur in mature transcripts due to mutations, incorrect splicing or aberrant initiation site selection. Upstream ORFs have been suggested to induce NMD by conferring additional termination codons to the 5´-leader sequence of certain transcripts. Expression profiling in mammalian cells (Mendell, et al., 2004), Caenorhabditis elegans (C. elegans) (Ramani, et al., 2009) and yeast (He, et al., 2003) revealed an enrichment of uORF-containing transcripts in the fraction of mRNAs that were targeted by NMD. In plants it was shown that a long uORF (50 aa), but not similar but shorter uORFs of 31 and 15 aa length, respectively, triggered the activation of NMD (Nyiko, et al., 2009). Analysis of individual mRNAs demonstrated uORF- induced NMD in transcripts of glucosamine phosphate N-acetyl transferase (gna-2) in C. elegans (Lee and Schedl, 2004) or CPA1 in yeast (Gaba, et al., 2005; Messenguy, et al., 2002; Ruiz-Echevarria and Peltz, 2000). In other cases, such as GCN4 and yeast activator protein 1 (YAP1), stabilizer elements were identified downstream of the respective uORF that prevented NMD (Ruiz-Echevarria and Peltz, 2000). In humans, the transcript of uORF-regulated thrombopoietin (TPO) was found to be independent of NMD (Stockklausner, et al., 2006), suggesting that the mere presence of a uORF does not predict whether a transcript is targeted by NMD or not.

19 Introduction

1.1.2.6 Variables affecting the degree of uORF-mediated MCS repression

Upstream ORFs repress the translation of the subsequent initiation codon or of the MCS by various mechanisms described above. The level of MCS repression depends on the structural characteristics of the transcript and of the uORF itself, with strong repression correlating with long m7G-cap to uORF distance, proximity of the uORF to the MCS initiation site, length of the uORF, multiplicity of uORFs, conservation among species, and initiation sequence context (Figure 1.4) (Calvo, et al., 2009; Child, et al., 1999; Kozak, 2001; Rajkowitsch, et al., 2004).

Figure 1.4 Variables affecting the degree of uORF-mediated MCS repression. The enhancement of MCS repression correlates with increasing m7G to uORF distance, uORF to MCS proximity, uORF length, number and conservation among species, and an increasingly favourable uORF initiation context. *These features apply to individual transcripts but have not been validated in a bioinformatic survey (Calvo, et al., 2009; Child, et al., 1999; Kozak, 2001; Rajkowitsch, et al., 2004). m7G: 5´-mRNA-cap structure, uORF: upstream open reading frame, MCS: main coding sequence.

20 Introduction

1.2 CCAAT/enhancer binding proteins

Evolutionary conserved uORFs have been identified in transcripts of many key regulatory genes (Calkhoven, et al., 2002; Kozak, 1991), implying an important physiological role for these uORFs. In the majority of transcripts, uORF-mediated translational control may serve to regulate the overall amount of one specific protein that is produced from one downstream MCS. Another intriguing regulatory function of uORFs is observed in transcripts harboring alternative downstream initiation sites within their coding sequence, allowing the translation of alternative protein isoforms from the same mRNA. Using cellular and ectopic expression assays, uORF-dependent regulation of isoform expression has been identified for a number of transcripts summarized in Table S1. Among such uORF-bearing transcripts with alternative initiation codons are those of the transcription factors CCAAT/enhancer binding protein (C/EBP) and , which regulate the proliferation and differentiation of multiple cell types of ectodermal (e.g. mammary epithelial cells), mesodermal (hematopoietic cells) and endoder- mal (e.g. hepatocytes) origin. C/EBP proteins are important regulators of various (patho)physiological processes including metabolism, immune response and malignant transformation (Johnson, 2005; Nerlov, 2007; Ramji and Foka, 2002; Zahnow, 2009). In C/EBP and transcripts, uORFs control the differential expression of N-terminally distinct protein isoforms, each exerting unique biological functions, rather than serving as on/off switches of protein translation (Calkhoven, et al., 2000; Kozak, 2002).

1.2.1 Family overview

The six members of the C/EBP family (, , , , and ) share highly conserved C-terminal basic regions and leucine zipper domains (bZIP), which are involved in DNA-binding and homo- or heterodimerization, respectively (Ramji and Foka, 2002). The N-terminal parts of the C/EBPs are diverse in length and structure, contain trans-activating and regulatory domains, and can interact with transcriptional co-activators, co-repressors or the basal transcription machinery (Erickson, et al., 2001; Mink, et al., 1997; Nerlov and Ziff, 1995) (Figure 1.5).

21 Introduction

Figure 1.5 CCAAT/enhancer binding proteins (C/EBPs). Graphic overview of C/EBP transcripts (open bars) and proteins (colored bars). All C/EBP proteins share a highly conserved C-terminus, consisting of a basic DNA-binding domain (orange) and a leucine zipper domain (purple) mediating dimerization. The N-terminal parts are more diverse and contain variable amounts of transactivating (green) and regulatory (red) domains. The transcripts of C/EBP, and are translated from subsequent in-frame initiation codons (black arrows) into N-terminal truncated isoforms. Small upstream open reading frames (uORFs, blue) preceding the initiation codons of C/EBP p42, C/EBP LAP and C/EBP were shown to affect translation of protein expression. The positions and sizes of indicated domains are derived from published data (Bedi, et al., 2009; Cooper, et al., 1995; Johnson, 2005; Kowenz-Leutz, et al., 1994; Lee, et al.; Pei and Shih, 1991; Ramji and Foka, 2002; Williams, et al., 1995). C/EBP: CCAAT/enhancer binding protein, ext: extended, LAP: liver activating protein, LIP: liver inhibitory protein.

22 Introduction

Important physiological functions of C/EBP transcription factors have been characterized by the analysis of targeted knockout mouse models for each of the C/EBP proteins (Table 1). The in vivo functions of C/EBP, representing the founding member of the family, and of C/EBP, which is highly expressed in multiple tissues were analyzed in greatest detail. C/EBP knockout (k.o.) mice die from perinatal hypoglycemia caused by defects in liver gly- cogen production and gluconeogenesis (Wang, et al., 1995). Furthermore, C/EBP k.o. animals do not develop mature granulocytes, but show an accumulation of myeloid blasts, indicating that the transcription factor is required for terminal granulocyte differentiation (Zhang, et al., 1997). In C/EBP null mice, defects in energy homeostasis result in partial perinatal lethality of approximately 50% of newborn animals. The surviving animals show immunological phenotypes, defects in macrophage function and acute phase response, impaired adipose tissue function and liver regeneration as well as female sterility (Greenbaum, et al., 1998; Screpanti, et al., 1995; Sterneck, et al., 1997; Tanaka, et al., 1995).

Table 1 Targeted knockout mouse models of C/EBP family members.

gene phenotype reference

C/EBP • fatal perinatal hypoglycemia (Wang, et al., 1995) • hyperproliferation in lung and liver (Flodby, et al., 1996) • defective adipocyte/granulocyte differentia- (Zhang, et al., 1997) tion

C/EBP • defective macrophage bacteria killing (Tanaka, et al., 1995) • lymphoproliferative disorder (Screpanti, et al., 1995) • hypoglycemia (Croniger, et al., 1997) • ovarial defect / female sterility (Sterneck, et al., 1997) • defective mammary gland development and (Robinson, et al., 1998; function Seagroves, et al., 1998) • retarded liver regeneration (Greenbaum, et al., 1998)

C/EBP • perinatal lethality (Kaisho, et al., 1999) • defective NK-cell maturation/function

C/EBP • defective adipocyte differentiation (Tanaka, et al., 1997) • enhanced contextual fear (Sterneck, et al., 1998)

C/EBP • defective granulocyte differentiation (Yamanaka, et al., 1997) • defective immune response (Lekstrom-Himes and Xanthopoulos, 1999)

C/EBP • mediates ER-stress induced apoptosis (Zinszner, et al., 1998) • mediates pancreatic beta-cell apoptosis (Oyadomari, et al., 2001)

23 Introduction

Cellular and mouse model analyses demonstrated that C/EBP proteins are implicated in the control of cellular proliferation versus differentiation in multiple cell types. Both, C/EBP and can block cell cycle progression in G1-phase by the repression of cell cycle-associated genes controlled by E2F transcription factors and can simultaneously induce terminal differentiation by the transactivation of specific target genes. Several mechanisms of C/EBP- mediated cell cycle repression have been proposed. C/EBP was suggested to repress E2F- regulated cell cycle genes by the sequestration of cyclin-dependent kinase (cdk) 2 and 4 (Harris, et al., 2001; Wang, et al., 2001), the induction of the cdk-inhibitor p21 (Timchenko, et al., 1996) or by direct interaction and inhibition of E2F-family members (Porse, et al., 2001; Slomiany, et al., 2000). Ectopic expression of C/EBP resulted in a block of cell cycle progression at the G1 to S-phase transition in the hepatocellular carcinoma cell line HepG2 (Buck, et al., 1994) or in cell cycle exit and differentiation of BCR-ABL-transformed myeloid cells (Guerzoni, et al., 2006). Interestingly, other cell types including hepatocytes, adipocytes, B lymphocytes, endometrial or mammary epithelial cells displayed proliferation defects in the absence of C/EBP (Chen, et al., 1997; Greenbaum, et al., 1998; Mantena, et al., 2006; Sea- groves, et al., 1998; Tang, et al., 2003). Chemical treatment that induces activating ras mutations transformed murine keratinocytes in C/EBP WT but not in C/EBP null animals, suggesting a role for C/EBP in tumorigenesis (Sterneck, et al., 2006; Zhu, et al., 2002). Similarly, myc/raf-transformed bone marrow and NPM-ALK-transformed MEF displayed markedly reduced tumour growth in a C/EBP null versus C/EBP WT background (Piva, et al., 2006; Wessells, et al., 2004), also suggesting a pro-oncogenic role of C/EBP. It emerges that the molecular mechanisms by which C/EBP proteins block cell cycle progression and promote terminal differentiation are complex and highly specific to individual cell types and target genes.

1.2.2 Isoform-specific functions of C/EBP transcription factors

In addition to the N-terminal divergence between family members, C/EBP, and are produced in N-terminally truncated isoforms (Figure 1.5). The transcript of C/EBP is derived from the intronless c/ebp gene and encodes a recently characterized extended protein isoform (Muller, et al., 2010), a full-length p42 isoform, and a truncated p30 isoform from subsequent in-frame translational initiation codons. Similarly, the transcript of C/EBP encodes two long protein isoforms, LAP* and LAP (liver activating protein), and a truncated isoform LIP (liver inhibitory protein) (Calkhoven, et al., 2000; Descombes and Schibler, 1991; Lin-

24 Introduction coln, et al., 1998). The gene of c/ebp, a third member of the C/EBP family that is expressed in more than one protein isoform, differs structurally from C/EBP and in that it contains introns and transcription is driven by alternative promoters. Thus, the expression of four alternative C/EBP isoforms (p32, p30, p27 and p14) is attributed to differential promoter usage, alternative splicing and alternative translational initiation (Bedi, et al., 2009; Lekstrom- Himes, 2001; Yamanaka, et al., 1997). All truncated C/EBP protein isoforms, i.e. -p30, - LIP and -p14, lack most of the trans-activating and regulatory domains, but retain the ability to bind to DNA and to dimerize with other C/EBP homomers. Due to these structural features the truncated proteins were suggested to act as trans-dominant repressors of long C/EBP isoforms (Descombes and Schibler, 1991). Unique and overlapping biological functions of the different C/EBP and protein isoforms were characterized by numerous cell biological studies. The short isoforms p30 and LIP are sufficient to induce lineage commitment of adipocytes (Calkhoven, et al., 2000), hepatocytes (Buck, et al., 1994), and eosinophils (Nerlov and Graf, 1998). In addition, p30 is sufficient to commit cells to the granulocytic lineage (Nerlov and Graf, 1998), and LIP is sufficient to commit cells to the macrophage (Nerlov and Graf, 1998), the osteoclast (Smink, et al., 2009), and the osteoblast lineages (Hata, et al., 2005). However, the long isoforms are required to arrest the cell cycle of progenitors and to induce terminal differentiation by transactivation of cell type-specific target genes (Buck, et al., 1994; Calkhoven, et al., 1994; Calkhoven, et al., 2000; Calkhoven, et al., 1997; Descombes and Schibler, 1991; Freytag, et al., 1994; Johnson, 2005; Kowenz-Leutz and Leutz, 1999; Lin, et al., 1993; Nerlov and Graf, 1998; Nerlov, 2007; Ossipow, et al., 1993; Sears and Sealy, 1994). Similarly, the alternative isoforms of C/EBP individually affect granulocytic lineage commitment and differentiation pathways (Bedi, et al., 2009). Due to the differential and sometimes opposing effects of C/EBP isoforms in a variety of biological processes, the balanced expression of C/EBP isoforms was suggested to be important in determining the transcriptional activity of C/EBPs (Johnson, 2005; Nerlov, 2008; Ramji and Foka, 2002; Zahnow, 2009). For C/EBP, this assumption was confirmed by the analysis of human diseases and by targeted mouse genetics. Full-length C/EBP is an inducer of terminal differentiation in granulocytes and couples induction of cell type-specific genes to cell cycle arrest (Johnson, 2005; Nerlov, 2007; Zhang, et al., 1997). Mutations in the gene of C/EBP are found in about 10% of cases of acute myeloid leukaemia (AML). The most common mutation results in the loss of p42 expression while the production of p30 is preserved (Leroy, et al., 2005; Nerlov, 2004;

25 Introduction

Sellick, et al., 2005; Smith, et al., 2004). C/EBP p42 blocks cell cycle progression by the repression of cell cycle promoting genes, while the truncated p30 isoform is not capable to mediate cell cycle exit. In a knock-in mouse strain that expressed p30 only (Kirstetter, et al., 2008), the exclusive presence of p30 was sufficient for progenitor commitment to the granulocyte-macrophage cell lineage, however, the lack of p42 expression allowed unrestrained proliferation of these myeloid progenitors. It was shown that the increased p30/p42 expression ratio in mutant cells caused sustained proliferation, prevented terminal differentiation and ultimately drove malignant transformation (D'Alo, et al., 2003; Johansen, et al., 2001; Porse, et al., 2001). Overall, the disturbed granulopoiesis and the premature death of C/EBP p30 mice indicated that the loss of p42 expression is the pathogenic event in a number of human AML cases (Kirstetter, et al., 2008). For C/EBP an increased LIP/LAP isoform ratio was observed in several malignancies including Hodgkin- and anaplastic large cell lymphoma (Jundt, et al., 2005), ovarial (Sundfeldt, et al., 1999) and colorectal cancer (Rask, et al., 2000) and aggressive forms of breast cancer (Zahnow, 2002; Zahnow, 2009). Furthermore, transgenic expression of LIP in mammary glands resulted in hyperplasia and tumorigenesis in mice, confirming a pro-proliferative and tumorigenic potential of the LIP isoform (Zahnow, et al., 2001).

1.2.3 Upstream ORF-mediated control of C/EBP isoform expression

In the transcripts of C/EBP and a conserved uORF is located out of frame between the initiation codons of the extended (-ext and LAP*) and the full-length isoforms (p42 and LAP) (Calkhoven, et al., 1994) (Figure 1.6). In most tissues, p42 and LAP are the most abundant C/EBP and protein isoforms, despite of the presence of the two preceding translational initiation codons (extended isoform and uORF) and despite of a suboptimal initiation codon context. As introduced in paragraph 1.1.2.2, an optimal initiation sequence that sup- ports initiation of virtually all scanning ribosomes is defined as CCRCCAUGG (Kozak consensus sequence), with a purine base (R) in position -3 and a guanine base in position +4 being most important for initiation (Kozak, 1986; Kozak, 1987). Placing the initiation codons of the extended isoforms of C/EBP (intermediate) and (weak) in optimal Kozak consensus sequences resulted in loss of translation from downstream initiation codons (Calkhoven, et al., 2000) and showed that the endogenous sequence contexts at the -ext and the LAP* AUG codons allow leaky scanning across these sites.

26 Introduction

Figure 1.6 Nucleotide sequence surrounding the C/EBP and uORFs. C/EBP and transcripts of human (homo), cow (bos), and mouse (mus) contain experimentally validated uORFs (gray background color) terminating 7 and 4 nucleotides in front of the p42 and LAP initiation codon, respectively. Initiation codons of protein isoforms are highlighted by green background color, initiation and termination codons of uORFs are in red bold face, favorable residues of the core Kozak context (residues at -3 or +4) are underlined.

Optimizing the Kozak context of the C/EBP uORF start site mildly reduced translation of p42 and enhanced the expression of p30, indicating that a fraction of post-termination ribosomes, which had translated the uORF, reinitiated at the proximal p42 initiation codon and another fraction initiated at the downstream p30 start site (Calkhoven, et al., 2000). The rela- tively high proportion of ribosomes that reinitiated at the p42 start site after translating the uORF was surprising, as the C/EBP uORF terminates only seven bases upstream of the p42 AUG codon and intercistronic sequences of that size were known to greatly impede reinitiation rates in other transcripts (Kozak, 1987). While strengthening of the uORF initiation sites in C/EBP or resulted in an increased p30 over p42 and LIP over LAP expression ratio, respectively, deletion of the uORF initiation codon enhanced expression of p42 or LAP (Lincoln, et al., 1998) and almost completely abolished translation of the truncated isoforms (Calkhoven, et al., 2000). Thus, the `intermediate´ initiation context of p42 and LAP appeared to be sufficiently strong to support initiation of most of the scanning ribosomes in the absence, but not in the presence of uORF translation. Together, these mutational analyses and tissue culture experiments suggested that translation of the out-of-frame C/EBP and uORF restrains initiation of the full-length isoform and causes resumption of ribosomal scanning and re-initiation at the downstream initiation codon of the truncated isoform, as shown for C/EBP in Figure 1.7 (Calkhoven, et al., 2000; Lin- coln, et al., 1998; Raught, et al., 1996).

27 Introduction

Figure 1.7 Upstream ORF-directed isoform expression of C/EBP. (A) Three protein isoforms LAP* (Liver Activating Protein*, 38 kD), LAP (35 kD) and LIP (Liver Inhibitory Protein, 20 kD) are translated from consecutive in-frame initiation codons in the same transcript (Descombes and Schibler, 1991). The C/EBP mRNA contains a conserved cis-regulatory small uORF (30 bp, orange) terminating 4 bp upstream of the LAP initiation site in a different reading frame. (B) Translation of the uORF serves to strip ribosomes from their initiating Met-tRNAiMet (green to white) and prevents initiation at the proximate LAP initiation codon. Upon reloading of ribosomes with the ternary eIF2-GTP-Met-tRNAiMet complex (white to green), translation re-initiation from the downstream AUG codon generates LIP. Introduction of an A to U point mutation abro- gates ribosomal initiation at the uORF start codon and was found to result in increased translation of LAP and decreased translation of LIP (Calkhoven, et al., 2000). The display of LAP* translation was omitted for simplicity. bd: binding, pA: poly-A tail.

Several lines of evidence showed that the C/EBP and uORFs integrate the signaling status of the cell to modulate the expression ratio of isoforms. One key component in adjusting the activity of the translational machinery to environmental changes is the mammalian target of rapamycin kinase (mTOR). Many nutritional and signaling pathways downstream of growth factor-, cytokine- or hormone receptors alter the activity of the mTOR kinase. Activated mTOR signaling is associated with enhanced global translational conditions and increased activity of important eukaryotic initiation factors (eIFs), including eIF4E (Corradetti and Guan, 2006). Mimicking favorable translational conditions by overexpression of eIF4E induced the expression of truncated C/EBP isoforms p30 and LIP and was associated with increased initiation at the uORF start site (Calkhoven, et al., 2000). Importantly, mutation of the uORF initiation codon abolished the eIF4E-mediated induction of short C/EBP isoforms, con-

28 Introduction firming that indeed translation of the uORF was required to shift initiation towards the distal initiation codons (Calkhoven, et al., 2000). In turn, inhibition of mTOR kinase activity by the macrolide antibiotic rapamycin, by protein folding stress or by nutrient depletion decreased global translational activity and was associated with the predominant production of p42 and LAP isoforms (Calkhoven, et al., 2000). In response to rapamycin treatment, a shift of expression towards the full-length C/EBP protein isoform was also observed for endogenous transcripts and was shown to affect cellular fates, as it inhibited the differentiation of osteoclasts (Smink, et al., 2009) or reduced the proliferation of malignant cells (Jundt, et al., 2005). Fur- thermore, the rapamycin-mediated inhibition of mTOR altered the isoform ratio in favor of LAP and resulted in a decrease in tumor cell proliferation in several other model systems (Berenson and Yellin, 2008; Chan, et al., 2005). Together, these data suggested that the uORF initiation codon may serve as a physiologically important translational regulator, shifting the isoform expression ratio towards the truncated isoforms under favorable conditions and to the full-length isoforms under unfavorable conditions.

1.3 Aims of the thesis

Deregulated translational control of protein expression is increasingly implicated in the etiology of human diseases, including cancer, metabolic disorders or complex heritable syndromes. The frequency of evolutionary conserved upstream open reading frames (uORFs) and the predominant prevalence of uORFs in transcripts of key regulatory genes suggest an important function of uORF-mediated translational control in mammals. Nevertheless, no mammalian genetic model exists to validate the functionality and physiological relevance of uORF- regulated translation initiation. This study was designed to analyze the phenotype of a recombinant mouse strain that lacks the uORF initiation codon within the transcript of the transcription factor CCAAT/enhancer binding protein (C/EBPuORF mice). Since previous studies suggested an important regulatory function of the C/EBP uORF for balanced isoform expression in vitro, three major questions should be addressed by the evaluation of the C/EBPuORF mouse strain:

Is C/EBP uORF-mediated translational control active in transcripts derived from the endogenous c/ebp gene locus of a mammalian organism?

29 Introduction

What are the physiological consequences brought about by the deletion of the C/EBP uORF start codon?

Does the C/EBPuORF mutation cause transcriptional deregulation of C/EBP target genes and how does this deregulation relate to the phenotypes observed?

We assumed that the answers to these questions would not only contribute to a better understanding of C/EBP expression regulation and function, but would also provide valuable experimental data to estimate the physiological relevance of uORF-mediated translational control in general. Due to the high prevalence of evolutionary conserved uORFs in human and rodent transcriptomes, physiological defects observed in C/EBPuORF mice, could indicate a comprehensive regulatory function of uORFs in mammals.

30 Materials and Methods

2 Materials and Methods

2.1 Mice

2.1.1 Generation of C/EBPuORF and C/EBPWT mice

Mutant C/EBPuORF and control C/EBPWT mice were generated by V. Wiesenthal and V. Bégay following a standard protocol for homologous recombination (Figure 2.1) (Wiesenthal, 2005). The neomycin cassette was removed by crossing C/EBPuORF and C/EBPWT mice to the Cre-deleter strain (Schwenk, et al., 1995) and the new strains were kept in 129Ola x C57Bl/6 background.

Figure 2.1 Generation of C/EBP uORF and C/EBPWT mice. The diagram depicts the c/ebp wild type locus (+), the C/EBPuORF targeting vector (TV) and the recombinant c/ebp allele (). C/EBPWT mice (WT), which served as control strain throughout this study, were generated alike, using a targeting vector that contained the wild type c/ebp gene (not shown). An XbaI-EcoRI fragment containing the C/EBP coding sequence and 5´-region was cloned into a pTV-flox targeting vector, flanked by a thymidine kinase cassette at its 5´-end and a neomycin cassette at its 3´-end. The 3´-portion of the c/ebp locus was subcloned as an EcoRI-BamHI fragment downstream of the Neo cassette of the pTV-flox vector. Site directed mutagenesis was employed to introduce an EcoRI site (EcoRI*, primer: 5´-gggacgcagcggagcccgaattcgggccccgcg- ttcatg-3´) and to mutate the C/EBP uORF initiation site (Kunkel primer: 5´-ggcctgggacgcagcttgcctcccgccgccgccc- 3´), respectively. Recombinant ES cell clones (E14.1, 129 Ola strain) were identified by Southern blot analysis after selection with G418/gancyclovir and two clones were microinjected into C57Bl/6 blastocysts to generate chimeras that transmitted the mutant allele. The intronless C/EBP gene is depicted as filled black box, while the selection genes are shown as white boxes with flipped letters to indicate reverse direction of transcription (TK = thymidine kinase gene; Neo = neomycin resistance gene). The ATG to TTG point mutation within the C/EBP uORF is indicated by the small white box within the c/ebp gene. Filled triangles represent LoxP sites flanking the neomycin resistance gene. Black lines show the expected fragment sizes after EcoRI or BamHI digestion of genomic DNA for the wild type locus and the recombinant allele. P5´: 5´-probe, P3´: 3´-probe. Figure adopted from (Wiesenthal, 2005).

31 Materials and Methods

Female and male mice showed the same phenotype and were analyzed as one group. Mice were provided with standard mouse diet and water ad libitum on a 12 hours light-dark cycle. All procedures and animal experiments were conducted in compliance with protocols ap- proved by the institutional Animal Care and Use Committee.

2.1.2 Genotyping

Tailtips of 2 to 5 mm length were lysed in 50 l Proteinase K buffer (100 mM Tris pH8.0, 0,2% SDS, 200 mM NaCl, 5 mM EDTA, 30g/ml Proteinase K) overnight at 55°C in a horizontal shaker at 550 rpm. Subsequently, the digested tailcuts were incubated at 95°C for 10 min, diluted with 150 l ddwater and centrifuged for 5 min at RT at 14000 rpm. For the genotyping PCR reactions, 1 l of the resulting supernatant was used as DNA template. PCR reactions were run on a Mastercycler epgradient S (Eppendorf) and product sizes were revealed by agarose gel electrophoresis and ethidium bromide staining .

uORF LIP C/EBP PCR reactions C/EBP C/EBP k.o. water 13,5 l 13,5 l 13,1 l 10x PCR buffer 2,0 l 2,0 l 2,0 l DMSO 2,0 l 2,0 l 2,0 l dNTP (10mM) 0,5 l 0,5 l 0,5 l MgCl2 (50mM) 0,6 l 0,6 l 0,6 l primer-fw (50M) 0,2 l 0,2 l 0,2 + 0,2 l primer-rev (50M) 0,2 l 0,2 l 0,2 + 0,2 l Taq-polymerase 0,1 l 0,1 l 0,1 l template 1,0 l 1,0 l 1,0 l program: 94°C 5´ 5´ 5´ 94°C 30´´ 30´´ 30´´ annealing 1´ (63,5°C) 1´ (63,5°C) 30´´ (55°C) 72°C 2´ 2´ 1´ 72°C 2´ 2´ 2´ 4°C HOLD HOLD HOLD cycles 35 35 35 products: WT 301 bp 301 bp 293 bp mutant ~1500 bp ~1500 bp 351 bp

Agarose gel 1.5% agarose (w/v) in TAE buffer

32 Materials and Methods

TAE 80 mM Tris base 1mM EDTA 0.11% acetic acid in dd water

Genotyping primers strain primer name sequence C/EBPuORF CbdU+1652 gcatctgggcttttctcttc C/EBPLIP CbdU-1952 acacagggacacagacacca

C/EBP k.o. C/EBPbWT-F agcccctacctggagccgctcgcg C/EBPbWT-R gcgcagggcgaacgggaaaccg C/EBPbKO-F gctccagactgcctgggaaaag C/EBPbKO-R ggcccggctagacagttacacg

2.1.3 Peripheral blood glucose test

After 16 hours of fasting, one drop of peripheral blood was collected from a minimal incision of a tail vein of mice of 3 to 5 months of age and blood glucose levels were determined using an Ascensia elite glucometer (Bayer) according to the instructions of the manufacturer. For the glucose tolerance test, mice were injected i.p. with 5 l/g body weight of a 40% glucose (w/v) solution in physiological saline and blood glucose levels were determined at 20, 40, 60 and 120 min after injection as described above.

2.1.4 Whole mount staining of mouse mammary glands

Inguinal mammary glands were excised, spread onto a glass slides, fixed for 2-4 hours in 25% glacial acetic acid (Roth) in pure ethanol (Roth) at RT, washed with 70% ethanol, washed twice with ddwater and stained in carmine alum (Carmine 0.2% w/v and Aluminium Potas- sium Sulfate 0.5% w/v in ddwater) overnight, as previously described (Jones, et al., 1996). Whole mounts were then dehydrated, cleared with xylene, and mounted. The pictures were taken on a stereomicroscope.

2.1.5 Blood counts

Approximately 50 l of peripheral blood were collected into EDTA-precoated tubes (Sarstedt) from a minimal incision at the tail vein of adult mice of either 2 to 3 or 6 to 8

33 Materials and Methods months of age. Blood cell counts, hemoglobin (HB), and hematocrit (HTC) were determined by an automated blood analyzer (scil Vet abc, scil diagnostics).

2.1.6 Fluorescence activated cell sorting (FACS)

Single cell suspensions of spleen and bone marrow were prepared by gentle disruption of isolated tissues in FACS buffer at 4°C, followed by erythrocyte lysis and filtering through a 70 m nylon mesh (Miltenyi Biotec). 2 x 105 cells were incubated with fluorescently labelled antibodies directed against hematopoietic cell surface markers (all antibodies were obtained from BD biosciences). Lineage depletion (lin-), allowing the identification of phenotypic hematopoietic stem cells (HSC) or progenitor cells, was performed by using FITC-coupled antibodies directed against CD3 (145-2C11), CD4 (H129.19), CD8 (53-6.7), CD11b (M1/70), CD19 (1D3), B220 (RA3-6B2), Ter119 (Ter119) and Gr-1 (RB6-8C5) or biotinylated antibodies against CD3 (145-2C11), CD11b (M1/70), B220 (RA3-6B2), Ter119 (Ter119), Gr-1 (RB6-8C5) and Sca-1 (E13-161.7), respectively. The code given in parentheses represents the designation of the clone each antibody is derived from. Biotin-labeled cells were detected by PerCP-coupled streptavidin (BD) and dead cells were excluded by staining with propidium iodide. Cell type-specific staining was performed by four-colour flow cytometry:

FITC PE FL3 APC B-cells B220 CD43 (S7) Propidium io- IgM (II/41) (RA3- dide (PI) 6B2) B-/T-/myeloid cells B220 CD11b (M1/70) PI CD3 (145- (RA3- 2C11) 6B2) HSC lin- Sca-1 (E13- PI c-kit (2B8) 161.7) progenitors CD34 FcRII/III lin-bio./PI c-kit (2B8) (RAM34) (2.4G2)

All samples were measured on a FACSCalibur flow cytometer (BD) and analyzed by CellQuest software (BD).

FACS buffer 2% FCS 0.1 mM EDTA in PBS

34 Materials and Methods

Erythrocyte lysis buffer

4.15 g NH4Cl 0.5 g KHCO3 0.1 mM EDTA in 500 ml ddwater

2.1.7 Mouse lipopolysaccharid treatment

To induce C/EBP expression, mice were injected i.p. with 1 g/g body weight lipopolysaccharid (LPS, E. coli 0111:B4, Sigma) in 200 l sterile physiological saline.

2.1.8 Mouse embryonic fibroblast (MEF) preparation and proliferation assay

Mouse embryonic fibroblasts (MEF) were isolated from embryos at embryonic day 13.5 following standard protocols (Humbert, et al., 2000). Briefly, the embryonic trunk, excluding the head and inner organs, was subjected to a trypsin/EDTA digest at 1°C overnight. The digested embryo was homogenized by pipetting until a single-cell suspension was achieved and sent through a 70 m nylon mesh (Miltenyi Biotec). Cells were then seeded into cell culture dishes and incubated at 37°C and 5% CO2 in culture medium (DMEM+Glutamax, 10% FCS, 0.1% Penicillin-Streptomycin and 0.1% HEPES, all reagents purchased from Invitrogen, Germany). After 48 hours in culture the cells were detached and singularized by brief trypsinization (Trypsin/EDTA, Invitrogen) and cell number was determined by counting three independent aliquots per embryo. For growth assays 5 x 104 MEF were seeded into 6-well plates containing 3 ml of culture medium (triplicats per embryo and timepoint). One, three or five days after seeding, cells were collected by trypsinization and duplicate counts of living cells were per- fomed per well using an improved Neubauer counting chamber and Trypan Blue (Invitrogen) staining.

2.1.9 Osteoclast cultures and TRACP staining

For primary osteoclast cultures, mouse bone marrow cells were isolated as described before (Takayanagi, et al., 2002; Takayanagi, et al., 2002) and cultured in plastic cell culture dishes (Techno plastic products AG) in MEM+Glutamax, 5% FCS and 0.1% Penicillin- Streptomycin (all reagents purchased from Invitrogen). Osteoclast differentiation was induced by adding 30 ng/ml recombinant M-CSF (R&D Systems) and 20 ng/ml recombinant murine RANK-L-TEC (R&D Systems) for 6 days. After washing of cells with PBS, cells were fixed for 10 min at RT in 4% paraformaldehyde in PBS (pH 7.4). Subsequently, TRACP (tartrate

35 Materials and Methods resistant acid phosphatase) staining (Ida-Yonemochi, et al., 2004) was performed using the leukocyte acid phosphatase kit (Sigma).

2.1.10 Bone histology and histomorphometry

For histological analyses, mice were killed at 8 weeks of age and tibiae were fixed overnight at 4°C in phosphate buffered 4% formaldehyde (pH 7.4), subsequently decalcified for 3 days in 0.45 M phosphate-buffered EDTA (pH8.0) and processed for paraffin embedding. Sections (10 m) were cut using a MH 355 S microtome (Microm) and stained with hematoxylin-eosin or TRACP staining (Ida-Yonemochi, et al., 2004), using the leukocyte acid phosphatase kit (Sigma). Histomorphometric analyses were performed according to standard criteria (Parfitt, et al., 1987). All counting and histomorphometric measurements were performed in a standard zone, excluding the trabeculae connected to the cortical bone using the Zeiss AxioVision Software program (version 4.2). Osteoclast size was determined by measuring the outline of each single TRACP-positive osteoclast and calculating its surface.

2.1.11 Partial hepatectomy and BrdU labeling

Partial hepatectomy and in vivo BrdU labeling of proliferating hepatocytes was performed as previously described (Greenbaum, et al., 1998). In brief, mice of four to five months of age were anaesthetized by i.p. injection of a mixture of ketaminhydrochloride (125 g/g body weight, bw) and xylazinhydrochloride (37.5 g/g bw) and kept on a warm pad throughout and until three hours after the procedure to prevent hypothermia. Skin and peritoneum were opened by a median transection of 1 cm right below Os xyphoideum, two thirds of the liver were removed by ligation of three individual lobes and wounds were closed. The weight of regenerating livers was determined at day 3, day 6 and day 9 after surgery and is expressed relative to the total body weight (%). Two hours prior to euthanasia at 24, 36, 48 and 72 hours after partial hepatectomy, mice were injected i.p. with 5-Bromo-2-deoxy-Uridine (BrdU, 75 g/g body weight, Sigma). Livers were fixed overnight at 4°C in phosphate buffered 4% formaldehyde (pH 7.4) and subsequently processed for paraffin embedding. Incorporated BrdU was detected by immunohisto- chemistry as previously described (Greenbaum, et al., 1998) in tissue sections of 4 m, cut on a MH 355 S microtome (Microm). Briefly, sections were re-hydrated, pre-treated with 2.4 M HCl in ddwater for 30 min at 37°C, washed with PBS, incubated with 20 g/ml Proteinase K in PBS for 30 min, washed with PBS, blocked in 5% goat serum/0.1% Triton-X100 in PBS,

36 Materials and Methods and incubated with primary BrdU-specific antibody (BU-33, 1:200, Sigma) in staining buffer (1% goat serum/0.02% Tween in PBS) at 4°C overnight. Antigen-bound primary antibodies were detected by Alexa-Fluor-555-conjugated secondary antibody (1:800 in staining buffer, Invitrogen) and DAPI (0,1 g/ml dd water, Sigma) staining was performed to visualize all nuclei, independent of their cell cycle phase. Per animal, five randomly chosen fields were captured at 200 x magnification with an AxioCam Hr camera on an AxioPlan-2 microscope (Zeiss). The number of BrdU positive hepatocyte nuclei was divided by the total number of hepatocyte nuclei visualized by the DAPI staining and is expressed as percent BrdU positive nuclei. For each section, a negative control was prepared omitting the primary antibody and no staining of nuclei was observed.

2.1.12 Liver histomorphometry

The average volume of hepatocytes was determined as described previously (Minamishima and Nakayama, 2002). Briefly, 150 hepatocytes in HE stained liver sections were outlined at 400x magnification, and radius (r) and volume (v=4r3/3) of cells were calculated using the Zeiss AxioVision Software program (version 4.2).

2.2 Protein analysis

2.2.1 Cell lysis, tissue lysis and immunoblotting

Liver, spleen, lung and white adipose tissue lysates were prepared using denaturating Urea lysis buffer to prevent enzymatic proteolytic cleavage of long C/EBP isoforms. MEF were lysed in luciferase assay lysis buffer (Hampf and Gossen, 2006) and osteoclasts were lysed in RIPA buffer on day 2 of culture. Total protein concentration of individual samples were ad- justed according to the results obtained from photometric analysis at 595 nM wavelength using Bradford reagent (Sigma) and a microplate reader (Spectra Max 250, Molecular Devices). Proteins were separated on 15% SDS-polyacrylamide gels (run at 20 mA) and transferred onto nitrocellulose membranes (Schleicher & Schuell) or onto methanol-activated PVDF membranes (Amersham Biosciences) in wet-blotting protein electrophoresis chambers (Bio- Rad). Unspecific binding of immunoglobulin was reduced by incubating PVDF membranes in 5% non-fat milk/0.02% Tween in PBS for 1 hour at RT. Subsequently, membranes were probed with specific antibodies directed against C/EBP (clone 14AA), C/EBP (C-19), CcnA2 (H432), CcnB1 (H433), Mcm3 (G-19), Pcna (PC10), Rbl1 (C18), and -tubulin (B7),

37 Materials and Methods all from Santa Cruz Biotechnology Inc., or anti-MafB (66506, Abcam) using standard procedures. Appropriate horseradish peroxidase-conjugated secondary antibodies were used for chemiluminescence detection (Amersham Biosciences). X-Omat AR Films (Kodak) were developed on an X-ray film processor (Fuji).

Urea lysis buffer 8 M Urea 50 mM Tris pH8.0 0.2 mM PMSF 1 mM DTT proteinase inhibitor coctail (Complete EDTA free, Roche) in dd water

Luciferase assay lysis buffer (pH7.8)

90.8 ml K2HPO4 0,2M 9.2 ml KH2PO4 0,2M 4 ml TritonX-100 (10%) 96 ml dd water

Ripa buffer 1% NP-40 0.5% Deoxycholate acid 0.1% SDS 50 mM Tris HCl pH7.5 150 mM NaCl 0.2 mM PMSF 1 mM DTT proteinase inhibitor coctail (Complete EDTA free, Roche) in dd water

Polyacrylamid gels separation gel (ml) stacking gel (ml) ddwater 3.4 2.7 30% acrylamid mix (BioRad) 7.5 0.67 1,5 M Tris pH8.8 3.8 0.5 10% SDS 0.15 0.04 10% APS (Sigma) 0.15 0.04 TEMED (Roth) 0.006 0.004

SDS loading buffer (6x) 600 mM DTT 350 mM Tris pH6.8 10% SDS

38 Materials and Methods

10% glycerol 0,1 mg/ml bromphenol blue in ddwater

Running buffer 25 mM Tris base 200 mM glycine 3,5 mM SDS in ddwater

Transfer buffer 25 mM Tris base 200 mM glycine 20% methanol in ddwater

2.2.2 Enzyme linked immuno sorbent assay (ELISA)

Serum IL-6 levels of six mice per genotype (3 to 5 months of age) were determined using a Mouse IL-6 ELISA Kit (Becton Dickinson) according to the manufacturer´s instructions.

2.3 RNA analysis

2.3.1 Real-time polymerase chain reaction (real-time PCR)

Total liver RNA was prepared using Tripure Isolation Reagent (Roche) or the RNeasy Mini kit plus (Qiagen). For gene expression analyses of osteoclasts RNA was isolated on day 2 of osteoclast cultures using the RNeasy mini kit (Qiagen). RNA purity was checked by agarose gel electophoresis and photometric analysis prior to the transcription of RNA into cDNA by SuperScript-II reverse transcriptase and random primers as described by the manufacturer (Invitrogen). Quantitative real-time PCR analysis was performed on an ABI PRISM 7300 using Power SYBR Green PCR master mix (Applied Biosystems) and expression levels were normalized to Gapdh and Hprt, or Gapdh and -actin. For simplicity, all data presented in this thesis show values of the normalization to Gapdh only. The sequences of gene-specific primer pairs are as follows:

39 Materials and Methods

fragment size target PubMed accession sequence 5´-3´ 101 mC/EBPa+1734 NM_007678.2 tgtcctcacccccagcta mC/EBPa-1834 ctggcctgttgtaagctgagt 81 mC/EBPb+251 NM_009883.3 acgacttcctctccgacctc mC/EBPb-331 ggctcacgtaaccgtagtcg 91 mC/EBPd+295 NM_007679.2 ttcaacagcaaccacaaagc mC/EBPd-385 ctagcgacagaccccacac 146 mCcnA1+629 NM_007628.1 gctaccttccagaagctgaagt mCcnA1-774 cagggtctctgtgcgaagtt 236 mCcnA2+801 NM_009828.2 gaggtgggagaagaatataa mCcnA2-1036 actaggtgctccattctcag 119 mCcnB1+5 NM_172301.2 cggctgttagtgtttagctgtg mCcnB1-123 tgcgttaattttcgtgttcct 66 mCcnE1+1244 NM_007633 gcagcgagcaggagacaga mCcnE1-1309 gctgcttccacaccactgtctt 65 mCcnE2+10 NM_009830 cgcagccgtttacaagctaag mCcnE2-74 tgggtttcttgcggagagtct 138 mPcna+453 NM_011045.2 cgaagcaccaaatcaagaga mPcna-590 cggcatatacgtgcaaattc 103 mAat+1020 NM_026535.1 tcctgacaatggcaagctg mAat-1102 acccacacatccaccactct 98 mHp+8 NM_017370.2 ccctgggagctgttgtca mHp-105 ctttgggcagctgtcatctt 70 mHpxn+811 NM_017371.2 gccacctatgccttcactg mHpxn-880 gccagctatgccatccat 121 mSaa1+29 NM_009117.3 ccaggatgaagctactcacca mSaa1-149 taggctcgccacatgtcc 151 mAtp6v0d2+331 NM_175406.3 cattccttggagcccctgag mAtp6v0d2-481 tctctgtgaaacggcccagt 185 mFos+1377 NM_010234.2 cccgtagacctagggaggac mFos-1535 caatacactccatgcggttg 101 mDC-STAMP+999 NM_029422.3 tgtatcggctcatctcctccat mDC-STAMP+1099 gactccttgggttccttgctt 188 mMafb+1163 NM_010658.3 aacgcgtccagcagaaacat mMafb-1349 ctcaggagaggaggggctgt 130 mNfatc1+1594 NM_016791.4 catgcgagccatcatcga mNfatc1-1723 tgggatgtgaactcggaagac 154 mOscar+305 NM_175632.2 gtccgttgagctggctgagt mOscar-458 tctggggagctgatccgtta 158 mTRACP+387 NM_001102405.1 gacaagaggttccaggagacc mTRACP-544 gggctggggaagttccag 65 mActb+810 NM_007393 gacggccaggtcatcactattg mActb-874 aggaaggctggaaaagagcc 86 mHprt1+725 NM_013556.2 cctaagatgagcgcaagttgaa mHprt1+810 ccacaggactagaacacctgctaa 83 mGapdh+759 NM_008084.2 aatgtgtccgtcgtggatctga mGapdh-841 gatgcctgcttcaccaccttct

40 Materials and Methods

2.3.2 Microarray expression analysis

Total liver RNA of six C/EBPWT and six C/EBPuORF animals was isolated 36 hours after PH using RNeasy Mini Plus isolation kit (Roche). Three independent samples per genotype (3x2 pooled animals) were hybridized on a 4x44K whole genome mouse microarray (Agilent) and analyzed by ImaGenes (Berlin, Germany).

2.4 Various methods

2.4.1 Chromatin immunoprecipitation

Chromatin immunoprecipitation assays (ChIP) were performed similar as described previously (Friedman, et al., 2004). Briefly, fixation of liver tissue at RT in 10 ml phosphate buffered 4% paraformaldehyde was stopped after 15 min by adding 1.25 ml 1M Glycine. After washing twice with PBS/PMSF, liver tissue was homogenized by 15 strokes in a glass dounce homogenizer and the nuclei of hepatocytes were prepared by centrifugation after 10 min incubation in swelling buffer. Nuclei were lysed in sonication buffer, DNA was fragmented to pieces of 200 to 1000 bp using a Biouptor sonicator (Diagenode) and samples were centrifuged for 60 min at 16.000g. The supernatant was pre-cleared from unspecific binding to the beads by incubation with BSA/sonicated salmon sperm (sss) DNA-blocked Dynabeads Pro- tein G (Invitrogen) for 2 hours. Liver chromatin samples were then incubated with 3 g of E2F3- (clone C18), C/EBP- (14AA) or C/EBP- (C19) specific antibody (Santa Cruz) or non-specific rabbit IgG (Sigma) overnight. On the next day, samples were incubated with BSA/sssDNA-blocked Dynabeads Protein G for 2 hours at 4°C and subsequently beads were washed twice with sonication buffer, high salt buffer, LiCl buffer and TE buffer. Finally, chromatin was eluted from the beads by incubating each sample twice with elution buffer at 65°C and 900 rpm on a horizontal shaker. After de-crosslinking in the presence of 200 mM NaCl at 65°C for 5 hours, DNA was purified by phenol/chloroform extraction and precipitated by ethanol at -20°C overnight. Hypothetical binding sites of E2F and C/EBP transcription factors were identified by using an online application provided at the evolutionary conserved region (ECR) browser webpage (http://ecrbrowser.dcode.org/). Primer sequences to analyze the enrichment of target gene promoters by PCR are as follows:

41 Materials and Methods

fragment size target sequence 195 mCdc25+276 ChIP gcggggtcgtgtttgtgtttgac mCdc25-470 ChIP gtggggctgcaagcgaagaacag 166 mCcnA2-fw ChIP cattcagatccatacgctcctgcc mCcnA2-rev ChIP ctgctgctcagtggatctgtagcc 353 mE2F1-fw ChIP ggacgtgcagaaccgagtacgaag mE2F1-rev ChIP ctgcaaagtccgggccacttttac 137 mCcnE1-fw ChIP tgaaggattctgagcgtgcg mCcnE1-rev ChIP acgggttcttaactccgggc 155 mCdc2-fw ChIP acagagctcaagagtcagttggc mCdc2-rev ChIP cgccaatccgattgcacgtaga 183 mPLK1-fw ChIP gccggcaagatcggagttta mPLK1-rev ChIP agtcggtgcagagggtcctg 230 mP107-fw ChIP atcttcttatcccattccgggagacg mP107-rev ChIP gggctcgtcctcgaacatatcc 179 mMcm3-fw ChIP tgcttcctccaccataaacttccg mMcm3-rev ChIP aggaagtccaagtagtctctctgcg 133 mMcm6-fw ChIP agcttcatggcgtatgcttt mMcm6-rev ChIP ccctctcacctcagccaata

PBS/formaldehyde PBS formaldehyde (37%) 1.0%

Swelling buffer final conc. H2O Hepes pH7.9 (1M) 25 mM MgCl2 (150 mM) 1.5 mM KCl (1M) 10 mM NP-40 (10%) 0.1% DTT (1M) 1 mM PMSF (200 mM) 0.5 mM PIC

Sonication buffer H2O Hepes pH7.9 (1M) 50 mM NaCl (5M) 140 mM EDTA (0.1 M) 1 mM Triton-X (10%) 1.0% Na-deoxycholate (5%) 0.1% SDS (10%) 0.1% PMSF (200 mM) 0.5 mM PIC

42 Materials and Methods

High salt buffer H2O Hepes pH7.9 (1M) 50 mM NaCl (5M) 500 mM EDTA (0.1 M) 1 mM Triton-X (10%) 1.0% Na-deoxycholate (5%) 0.1% SDS (10%) 0.1% PMSF (200 mM) 0.5 mM PIC

LiCl buffer H2O Tris-HCl pH8.0 (1M) 20 mM LiCl (2.5M) 250 mM EDTA (0.1 M) 1 mM NP-40 (10%) 0.5% Na-deoxycholate (5%) 0.1% PMSF (200 mM) 0.5 mM PIC

TE buffer H2O Tris-HCl pH8.0 (1M) 10 mM EDTA (0.1 M) 1 mM

Elution buffer H2O Tris-HCl pH8.0 (1M) 50 mM EDTA (0.1 M) 1 mM SDS (10%) 1.0%

NaHCO3 (500 mM) 50 mM

2.4.2 Luciferase reporter assays

After brief trypsinization, triplicates of 2.5 x 104 cells were seeded into 24 well plates and cultured for 24 hours in DMEM+Glutamax, 10% FCS, 0.1% Penicillin-Streptomycin and 0.1% HEPES (all reagents purchased from Invitrogen). Subsequently, MEF were transiently transfected with 500 ng of the CEBP-responsive firefly-luciferase reporter construct pM82 (Sterneck, et al., 1992) and a 100 ng of control-renilla-luciferase reporter construct (pRL-null, Promega) using TransIT transfection reagent (Mirus). Prior to lysis at 48 hours after transfec-

43 Materials and Methods tion, MEF were treated for 1, 4 and 8 hours with lipopolysaccharid (LPS, 100 ng/ml, E. coli 0111:B4, Sigma). Firefly and Renilla luciferase activity was determined with a Centro luminometer (Berthold) following a published protocol (Hampf and Gossen, 2006).

Photinus luciferase (Pluc) solution

15 mM MgSO4 0.1 mM EDTA 25 mM DTT 1 mM ATP 0.2 mM coenzyme A (PJK GmbH) 200 M luciferin (PJK GmbH) 200 mM Tris–HCl final pH 8.0

Renilla luciferase (Rluc) solution (for quenching of Pluc activity and measurement of Rluc activity) 10 mM NaAc 15 mM EDTA 500 mM NaCl 50 M phenyl-benzothiazole (pref. CAS 92-36-4, APMBT, AppliChem) 4 M benzyl-coelenterazine (PJK GmbH) 500 mM Na2SO4 25 mM Na4PPi final pH 5.0

The pGL3TATAbasic-6xE2F reporter construct (Muller, et al., 1997) was co-transfected together with constant amounts of pcDNA3-HA-hE2F1 (S. Gaubatz), pCMV-HA-hDP1 (K. Helin) and either constant or increasing amounts of carboxy-terminally FLAG-tagged pcDNA3-rC/EBP-p42, -p30 or pcDNA3-rC/EBP-LAP*, -LAP, -LIP (E. Kowenz-Leutz) into HEK293T cells using Metafectene reagent (Biontex). Total DNA amounts were equal- ized among samples by adding empty pcDNA3 vector where required. 48 hours after transfection, cells were lysed in Triton lysis buffer, cleared by centrifugation (12000 rpm, 10 min, 4°C) and luciferase values were determined after automated addition of reaction buffer using a Centro luminometer (Berthold). Luciferase values were normalized to protein levels, as determined from fluorescence-based evaluation of immunoblots, using secondary antibodies coupled to IRDye, an Odyssey scanner and the Odyssey analysis software (all obtained from Li-Cor Biosciences). For flourochrome detection of proteins, membranes were blocked and incubated with antibodies in Roti-block solution (Roth).

44 Materials and Methods

Triton lysis buffer 50 mM Tris HCl pH7.5 150 mM NaCl 1 mM EDTA 1% Triton X-100 PIC (Roche) in ddwater

Reaction buffer 375 l Luciferin (Sigma, 10 mg/35.7 ml dd water) 250 l ATP (Serva, 20 mM) 50 l MgSO4 (1 M) 4.3 ml Gly-Gly (Sigma, 25 mM pH7.8)

2.4.3 Statistical analysis

The data was analyzed by the Student´s t-test or the non-parametric two-tailed Mann-Whitney test using Prism 5 (GraphPad Software). Groups were considered to be significantly different if the p-value was less than 0.05.

Results

3 Results

To allow the examination of uORF-mediated translational control in mammals two recombinant mouse strains had been generated by homologous recombination, carrying a point mutation in the initiation codon of C/EBP (C/EBPuORF mice) or C/EBP (C/EBPuORF mice), respectively (Wiesenthal, 2005). The mutations were designed to abrogate uORF initiation in the C/EBP or C/EBP transcript, without altering the amino acid sequence of the extended C/EBP protein isoforms. Only the C/EBPuORF mouse strain produced viable, homozygous mutant offspring, which served as experimental model for this thesis1. As depicted in Figure 1.7 B, the C/EBPuORF GCAUG to GCUUG point mutation replaces the methionine encoding triplet at the C/EBP uORF translational initiation site with a leucine encoding triplet, which does not serve to initiate translation. At the same time the mutation does not change the C/EBP-LAP* protein sequence, because both, the native GCA and the mutant GCU triplet encode an alanine residue. Additionally, a control knock-in mouse strain had been generated, which carried the wild type c/ebp gene introduced by homologous recombination (C/EBPWT, V. Bégay, MDC). The recombinant C/EBPWT strain served to ascertain that potential phenotypes were caused by the point mutation within the C/EBP uORF, but not by any other genetic or epigenetic difference brought about by the gene targeting approach (e.g. by the newly introduced EcoRI* or LoxP sites, respectively). In none of the experiments, differences between the C/EBPWT strain and the parental wild type (+/+) mice were detected.

3.1 Basic characterization of C/EBP uORF mice

It has been reported that about 50% of newborn C/EBP knockout mice die shortly after birth due to metabolic dysfunctions resulting in fatal hypoglycemia (Croniger, et al., 1997; Screp- anti, et al., 1995). To investigate whether the C/EBPuORF mutation had an effect on embryonic development or perinatal survival we analyzed the offspring of heterozygous C/EBPuORF matings at the age of weaning. The distribution of genotypes among newborn animals of the C/EBPuORF strain (n=443) was close to the expected Mendelian ratio of 1:2:1 (Figure 3.1 A). Peripheral blood glucose levels after 16 hours of fasting were not signifi-

1 In an independent attempt to generate C/EBPuORF mice, it was recently found that the ablation of translational initiation at the C/EBP uORF is embryonically lethal (A. Bremer and C.F. Calkhoven, personal commu- nication).

47 Results cantly different in adult C/EBPuORF mice of three to five months of age as compared to control animals, while C/EBP knockout mice displayed hypoglycemia (Figure 3.1 B), as observed by others before (Liu, et al., 1999). In a glucose tolerance test, where mice were challenged with an i.p. injection of glucose, C/EBPuORF mice displayed a tendency towards lower glucose levels at 20, 40 and 60 minutes after injection as compared to wild type animals, but again, only for C/EBP knockout animals the differences reached statistical significance (data not shown). Homozygous C/EBPuORF mice showed normal gain of weight (Figure 3.1 C), suggesting that no severe metabolic disorders were caused by the ablation of C/EBP uORF translation.

Figure 3.1 Mendelian ratio, blood glucose and gain of body weight. (A) The Mendelian ratio of litters of heterozygous C/EBPuORF matings was close to the expected ratio of 1:2:1. The table depicts the absolute number of animals and the calculated Mendelian ratio of wild type (+/+), heterozygous (+/) and homozygous (/) C/EBPuORF mice. (B) Glucose levels in the peripheral blood of wild type (+/+, n=7), C/EBPuORF (/, n=7) and C/EBP knockout mice (-/-, n=4) after 16 hours of fasting. Error bars show s.e.m., level of significance shown in respect to C/EBPuORF value, *p<0.05. (C) The body weight of female C/EBPuORF (/, n=8) and wild type (+/+, n=8) littermates was monitored at indicated times. The normal gain of weight of C/EBPuORF mice that were born and fed by homozygous C/EBPuORF mothers (/°, n=10) indicated the intact functionality of the mammary glands of C/EBPuORF females. Error bars show s.d.

48 Results

Female C/EBP knockout mice are sterile due to an ovarial defect (Sterneck, et al., 1997). Instead, 8 out of 8 homozygous C/EBPuORF females gave birth to normal size litters (data not shown). Furthermore, all homozygous C/EBPuORF males that were used in matings (n>5) proved to be fertile. C/EBP also plays an important role in mammary gland development and function, where the transcription factor directs both, morphological integrity and the production of essential milk proteins (Robinson, et al., 1998; Seagroves, et al., 1998). In cooperation with V. Bégay (MDC), the mammary glands of virgin C/EBPWT, C/EBPuORF and C/EBP knockout mice were analyzed histologically at 21 to 22 weeks of age. Carmine stained mammary gland whole mounts of C/EBP knockout animals showed a smaller size of the ductal tree and an associated reduction of secondary branching (Figure 3.2 E and F, respectively) as compared to wild type controls (Figure 3.2 A and B), confirming data obtained in previous publications (Robinson, et al., 1998; Seagroves, et al., 1998).

Figure 3.2 Mammary gland development. Representative carmine staining of mammary gland whole mounts showing normal ductal development in virgin C/EBPuORF mice, as compared to C/EBPWT and C/EBP knockout animals. At 21-22 weeks of age, the ductal tree in C/EBPWT (A) and C/EBPuORF glands (C) is larger as compared to C/EBP knockout mice (E). C/EBPWT and C/EBPuORF glands show similar branching (B and D, respectively), while branching is impaired in C/EBP knockout animals (F). Black scale bars represent 5 mm in A, C and E, and 500 μm in B, D and F. Asterisk: lymph node. (from V. Bégay)

49 Results

In C/EBPuORF mammary glands no overt morphological changes were observed, as both, size (Figure 3.2 C) and secondary branching (Figure 3.2 D) of the gland was similar as compared to C/EBPWT animals. The functionality of C/EBPuORF mammary glands was indirectly assessed by monitoring the gain of weight of litters born and fed by homozygous mutant mothers (Figure 3.1 C). Such progeny showed normal gain of weight as compared to litters fed by heterozygous mothers. Together, these data suggested a normal development and intact lactational function of C/EBPuORF mammary glands.

Figure 3.3 Hematopoietic analysis and survival. (A) Peripheral blood of C/EBPWT (WT, n=10) and C/EBPuORF mice (uORF, n=8) at six to eight months of age was analyzed using an automated blood cell analyzer. RBC: red blood cells, HB: hemoglobin, HCT: hematocrit, PLT: platelets, WBC: white blood cells, Lym: lymphocytes, Mon: monocytes, Gra: granulocytes. (B) FACS analysis of WT and uORF bone marrow (1-4) or spleenocytes (5). 1, gated on lineage negative (lin-) cells: hematopoietic stem cells (cKIT+, Sca1+). 2, gated on lin-/Sca1-/c-KIT+ cells: megacaryocytic/erythroid progenitors (MEP), common myeloid progenitors (CMP), granulocytic/monocytic progenitors (GMP). 3: T-lymphocytes (CD3+) and myeloid cells (CD11+). 4: progenitor (prog), immature (im) and recirculating (rec) B-lymphocytes. 5: spleno- cyte sample, demonstrating intact reactivity of the CD3 antibody. (C) Survival of parental wild type mice (+/+, n=24), C/EBPWT (WT, n=38, V. Bégay) and C/EBPuORF mice (uORF, n=19) was monitored during a 14 months observation period.

50 Results

C/EBP knockout animals suffer from a lymphoproliferative disorder resembling human Cas- tleman´s disease and ultimately die from an increased susceptibility to infections (Screpanti, et al., 1995). Thus, we analyzed the cellular composition of blood, spleen and bone marrow as well as the overall survival of C/EBPuORF mice. Differential blood cell counts at six to eight months of age (Figure 3.3 A) and at two to three months of age (data not shown) were not altered as compared to control animals. Similarly, no change in blood cell lineage distribution in spleen or bone marrow was detected by FACS analysis, using specific antibodies to identify hematopoietic stem cells, progenitor cells, B and T lymphoid cells or myeloid cells (Figure 3.3 B). C/EBPuORF mice did not display overt developmental defects as analyzed for liver, pancreas, spleen, lung and white adipose tissue (WAT) by macroscopic examination, histological staining and comparison of tissue-weigth to body-weight ratios (data not shown). Monitoring of the survival of C/EBPuORF mice did not reveal premature death as compared to WT animals during a 14-month observation period (Figure 3.3 C). In summary, the C/EBPuORF mutation proved to be viable and rescued several phenotypes observed in C/EBP knockout mice.

3.2 Loss of uORF-mediated LIP expression in C/EBP uORF mice

Bacterial lipopolysaccharid (LPS) elicits a strong induction of C/EBP expression in various tissues (Poli, 1998) and has been suggested to predominantly enhance the expression of the truncated C/EBP isoform LIP in the liver (An, et al., 1996; Timchenko, et al., 2005).

Figure 3.4 Impaired LIP expression in C/EBP uORF tissues. Representative immunoblot analyses of liver, spleen, lung and white adipose tissue (WAT) showing reduced expression of LIP in C/EBPuORF () as compared to C/EBPWT (WT) mice. Tissue lysates were prepared four hours after i.p. injection of either PBS (-) or lipopolysaccharid (LPS, 1 μg/g body weight). -tub.: -tubulin.

51 Results

To analyze the effect of the disabled translational initiation at the C/EBP uORF, protein lysates of liver, lung, spleen and white adipose tissue (WAT) were prepared from C/EBPuORF and WT mice, and were probed for LAP*, LAP and LIP isoform expression (Figure 3.4). Under steady state conditions, LIP expression was readily detected in liver, spleen and lung of WT animals, but markedly reduced or absent in tissues derived from C/EBPuORF mice. In livers of C/EBPWT mice, LIP was strongly induced 4 hours after LPS administration, whereas C/EBPuORF mice failed to express high levels of LIP. Likewise, lung, spleen and white adipose tissue of C/EBPuORF mice displayed reduced expression of LIP after LPS treatment as compared to C/EBPWT tissues. Hence, the genetic ablation of the translational start site of the C/EBP uORF in mice reduced LIP expression under steady state conditions and virtually abolished the inducible expression of LIP by LPS treatment. These data validated the functional importance of the C/EBP uORF as a translational cis-regulatory element in the animal. Failure to induce LIP was also observed in LPS-treated C/EBPuORF mouse embryo fibroblasts (MEF). In C/EBPWT MEF the LPS treatment induced an increasing expression of LIP at 1, 4, and most prominently at 8 hours after stimulation, while in C/EBPuORF cells LIP remained barely detectable at any time (Figure 3.5 A). As LIP had previously been reported to act as a trans-dominant repressor of the long C/EBP isoforms, we tested whether the absence of LIP in LPS-activated MEF may affect C/EBP target gene regulation. MEF were transfected with a LAP*/LAP-responsive firefly luciferase-

Figure 3.5 Impaired LIP induction and reporter gene activation in C/EBP uORF MEF. (A) LPS treatment induces LIP expression in C/EBPWT but not in C/EBPuORF MEF. (B) Representative luciferase reporter assay (n=3) demonstrating increased activity of an LAP*/LAP-responsive reporter construct in C/EBPuORF (open triangles) as compared to C/EBPWT MEF (black squares) at indicated times after LPS treatment. Error bars show s.e.m.

52 Results reporter construct, together with an empty renilla luciferase control reporter plasmid. Follow- ing LPS treatment a superactivation of the LAP*/LAP -responsive luciferase reporter was observed in C/EBPuORF as compared to WT MEF (Figure 3.5 B). As judged from the isoform expression pattern in the corresponding lysates, this superactivation may be a combined effect of elevated LAP expression and a lack of the trans-repressive function of LIP in C/EBPuORF MEF.

3.3 Defective osteoclast differentiation and altered bone homeostasis in C/EBP uORF mice

Bone homeostasis is the result of a tight regulatory interplay between bone forming osteoblasts and bone resorbing osteclasts. Initially, an important function of C/EBP in bone biology was attributed to its ability to enhance the differentiation and function of bone forming osteoblasts. Acting as a scaffold protein, C/EBP was found to facilitate the assembly of osteogenic transcription factors, including ATF4 and RUNX2, on relevant target gene promoters (Hata, et al., 2005; Tominaga, et al., 2008). The absence of C/EBP expression in C/EBP knockout animals was associated with defective osteoblastogenesis and reduced bone mass. Only recently, the role of C/EBP in bone resorption and osteoclast differentiation has been addressed in detail. The analysis of the bone phenotypes of C/EBP knockout mice and of a novel C/EBP mutant strain that exclusively expressed the truncated isoform LIP from the endogenous c/ebp locus (C/EBPLIP) showed that the C/EBP LAP vs. LIP isoforms opposingly regulate the differentiation of bone-resorbing osteoclasts (Smink, et al., 2009). Bones of C/EBPLIP mice were found to contain more and larger multinucleated osteoclasts as compared to WT animals. Conversely, the ectopic expression of LAP or a rapamycin-induced switch to the predominant expression of long C/EBP isoforms inhibited osteoclast differentiation. These data implied that the general increase of the LAP/LIP isoform ratio in C/EBPuORF mice may also be associated with inhibition of osteoclastogenesis. In cooperation with J. Smink (MDC) we analyzed the bone phenotype and the differentiation properties of osteoclasts in C/EBPuORF and C/EBPWT mice. Histomorphometric measurements performed on tibia sections of C/EBPuORF mice revealed a reduction in osteoclast size and number as compared to WT animals (Figure 3.6 A-C). Bones of C/EBPuORF mice contained approximately 14% less osteoclasts (11.08 ± 0.22 vs. 12.90 ± 0.69 osteoclasts/mm, n=6, p<0.05) and individual osteoclasts were more than 40% smaller (167.9 ± 14.0 vs. 291.6

53 Results

Figure 3.6 C/EBPuORF mice have fewer and smaller osteoclasts, and more bone mass. (A) Tibia sections showing tartrate resistant acid phosphatase (TRACP) stained osteoclasts (red staining, light- green counterstain) in C/EBPuORF as compared to C/EBPWT mice. Arrowheads: multinucleated osteoclasts, scale bars: 50 μm. (B) The bar graph displays average osteoclast sizes as determined by histomorphometric analysis. (C) Quantification of osteoclast counts in tibiae of C/EBPWT and C/EBPuORF mice. N.Oc/BPm: number of osteoclast / bone perimeter. (D) Trabecular thickness (Tb. Th.) is increased in C/EBPuORF as compared to C/EBPWT mice. (E) Bone volume is increased in C/EBPuORF as compared to C/EBPWT mice. BV/TV: bone volume / total volume. For all measurements the average values of 6 animals per genotype at the age of 8 weeks are displayed. Error bars show s.e.m., *p<0.05, ***p<0.001. (in cooperation with J. Smink)

± 13.7, n=6, p<0.001). This was accompanied by an increase in thickness of bone trabeculae (36.8 ± 2.3 vs. 29.6 ± 1.7 m, n=6, p<0.05) and bone volume (23.1 ± 1.4 vs. 18.5 ± 0.8% of total volume, n=6, p<0.05), indicating that the observed morphological changes were also associated with functional defects in C/EBPuORF osteoclasts (Figure 3.6 D and E). These in vivo observations were further analyzed using cellular differentiation assays. Whole bone marrow cell cultures were propagated in the presence of the pro-osteoclastic cytokines macrophage-colony stimulating factor (M-CSF) and receptor activator of nuclear factor kappa B-ligand (RANK-L) for six days to induce osteoclast differentiation. After fixation and osteoclast-specific tartrate resistant acid phosphatase (TRACP) staining, the number and size of generated osteoclasts were determined. Similar to the situation in vivo, bone marrow derived cells from C/EBPuORF mice formed fewer and smaller osteoclasts as compared to C/EBPWT cells (Figure 3.7 A). The total number of C/EBPuORF osteoclasts was approximately 45% lower (64.2 ± 13.7 vs. 116.0 ± 2.7 osteoclasts/well, n=3 experiments, p<0.05), with large (6 to 10 nuclei) and very large osteoclasts (>10 nuclei) being most drastically reduced in number (Figure 3.7 A and B). Protein lysates prepared from C/EBPuORF osteoclast cultures demonstrated absence of LIP expression in these cells, resulting in a shift of the isoform expression ratio in favor of LAP (Figure 3.7 C). Previous work identified the transcription factor MafB as a target of LAP and demonstrated its function as an inhibitor of osteoclastogenesis. Mechanistically, LAP induces MafB expression, which in turn acts as a trans-repressor of pro-osteoclastic genes (Kim, et al., 2007; Kim,

54 Results et al., 2008; Smink, et al., 2009). C/EBPuORF osteoclasts showed increased protein levels of MafB as compared to C/EBPWT cells (Figure 3.7 D). This overexpression was associated with reduced transcript levels of MafB-regulated osteoclast marker genes, including Nfatc1, Oscar, Atp6v0d2, DC-STAMP and TRACP (Figure 3.7 E). In the same cells, expression of the MafB independent c-Fos gene (Kim, et al., 2007) was not affected. These phenotypic and mechanistic data obtained from the C/EBPuORF mice confirmed a crucial role of the C/EBP isoform ratio for osteoclast differentiation and function. Ablation of the translational initiation at the C/EBP uORF increased the LAP over LIP isoform expression ratio in C/EBPuORF cells, resulted in enhanced expression of MafB and thereby constraining osteoclast differentiation in vivo and in vitro. In summary, our observations validate the previously established mechanism of LIP-enhanced and LAP-restricted osteoclast differentiation in an independent experimental model system.

Figure 3.7 The C/EBPuORF mutation impairs osteoclast differentiation. (A) TRACP staining (red) showing osteoclast differentiation of bone marrow derived precursors of C/EBPuORF and C/EBPWT mice after 6 days in culture with M-CSF and RANK-L (n=6). Arrowheads: multinucleated osteoclasts. (B) The bar graph displays the differential quantification of osteoclasts by the number of nuclei (n) per cell. (C) Immunoblot analysis showing LIP expression in C/EBPWT but not in C/EBPuORF osteoclasts at day 2 of culture. (D) Immunoblot analysis showing increased MafB protein in C/EBPuORF as compared to C/EBPWT osteoclasts. (E) Real time PCR analysis showing decreased expression of MafB-regulated osteoclast markers in C/EBPuORF (open bars) as compared to C/EBPWT osteoclasts (black bars). Normalized to Gapdh and presented relative to C/EBPWT (set to 1, dashed line). Error bars show s.e.m., *p<0.05, ***p<0.001. (in cooperation with J. Smink)

55 Results

3.4 Superactivated acute phase gene expression in C/EBP uORF mice

The initial reporter gene studies in MEF and the enhanced expression of MafB in C/EBPuORF osteoclasts indicated that direct C/EBP target genes may be superactivated due to the loss of inhibitory LIP function in C/EBPuORF mice. Previous reports have described numerous individual C/EBP targets related to a variety of biological functions, including osteoclast, adipocyte or granulocyte differentiation. In addition to those, acute phase response (APR) genes of the liver represent a group of particularly well-characterized C/EBP target genes (Poli, 1998). C/EBP regulates APR gene expression together with transcription factors of the NFB (nuclear factor of kappa light polypeptide gene enhancer in B-cells) and STAT (signal transducer and activator of transcription) families. The associated clusters of transcription factor binding sites in the promoters of APR genes were originally characterized as interleukin-6-response elements (IL-6RE), reflecting the regulatory function of upstream signals elicited by IL-6. APR genes serve as marker proteins to indicate infections or tissue injury in a clinical setting. Due to their highly variable expression upon inflammatory signals, we assumed that APR genes may be suitable targets to test the above-mentioned model of C/EBP isoform ratio-dependent target gene regulation in a physiological context. We implemented partial hepatectomy (PH) to analyze the effect of the C/EBPuORF mutation on APR gene expression in vivo, as liver regeneration is associated with the induction of APR genes and interleukin-6 (IL-6) expression (Michalopoulos and DeFrances, 1997; Poli, 1998; Screpanti, et al., 1995). First, we monitored C/EBP protein expression at various times after PH. Similar to what was observed in previous studies, LIP expression was transiently induced in C/EBPWT livers, reaching maximum expression levels around 6 to 12 hours after surgery, which declined to almost starting levels around at 24 hours (Figure 3.8 A). Interestingly, we repeatedly observed a second peak of LIP expression around 48 hours after PH, suggesting consecutive functions of LIP in the course of liver regeneration. C/EBPuORF mice failed to induce expression of LIP throughout the 72-hour observation period, while the expression of LAP* and LAP followed a similar kinetic as observed in WT animals. IL-6 is one of the central cytokines in the early phase of liver regeneration and a known activator of C/EBP and of many APR genes. In a mutual regulatory relation, IL-6 is also a target of C/EBP-mediated regulation (Akira, et al., 1990; Kuilman, et al., 2008). In C/EBPuORF mice IL-6 serum levels rose higher as compared to control animals (Figure 3.8 B), reaching a

56 Results

4.7-fold difference after three hours (1254 ± 265 vs. 263 ± 49 pg/ml, n=6, p<0.01) and a 3.3- fold difference at the peak of WT expression six hours after surgery (1578 ± 132 vs. 472 ± 93 pg/ml, n=6, p<0.01). These data suggested that the induction of IL-6 in WT animals is restricted by the repressive function of simultaneously induced LIP, which is virtually absent in C/EBPuORF animals. IL-6 signaling is known to rapidly confer activating phosphomodifica- tions to both C/EBP and STAT3 transcription factors (Akira, 1997), resulting in synergistic induction of type I acute phase response genes (Alonzi, et al., 2001). Real-time PCR analysis of known acute phase response C/EBP target genes at 0, 3, 6, 12 and 24 hours after PH revealed consistently increased transcript levels of serum amyloid A1 (Saa1), alpha-1 antitrypsin (Aat), haptoglobin (Hp), and hemopexin (Hpx), ranging from 1.2- to 8-fold in hepatec-

Figure 3.8 The C/EBPuORF mutation causes superinduction of C/EBP target genes. (A) Induction of LIP in C/EBPWT livers upon partial hepatectomy (PH) is abolished in C/EBPuORF animals. (B) ELISA showing elevated average levels of serum Interleukin-6 (IL-6) at three and six hours after PH in C/EBPuORF (open triangles) as compared to C/EBPWT animals (black squares, n=6, **p<0.01). (C) Real-time PCR analysis demonstrating elevated mRNA contents of acute phase response genes in C/EBPuORF (open bars) as compared to C/EBPWT livers (black bars) at indicated times after PH (n=6, *p<0.05, **p<0.01). Saa1: serum amyloid A1, Aat: alpha-1-antitrypsin, Hp: haptoglobin, Hpx: hemopexin, Gapdh: glyceraldehyde-3- phosphate-dehydrogenase. Error bars show s.e.m.

57 Results tomized C/EBPuORF as compared to C/EBPWT mice (Figure 3.8 C). Maxima of enhanced expression of Saa1, Aat, and Hp in C/EBPuORF mice correlated with the peak of LAP expression at 6 hours after surgery (Figure 3.8 A), suggesting that the lack of trans-repressive LIP unleashed the induction of early acute phase response genes. In addition to the observed superactivation of the C/EBP-responsive reporter construct in C/EBPuORF MEF and the enhanced expression of MafB in C/EBPuORF osteoclast cultures, these data obtained in the context of a living animal contributed further support to a model, where uORF-mediated induction of LIP is required to restrict the transactivation of C/EBP target genes.

3.5 Proliferative defects during liver regeneration in C/EBP uORF mice

C/EBP is a known regulator of liver regeneration induced by PH (Greenbaum, et al., 1998). The observation of a second peak of LIP induction around 48 hours after PH implied that LIP might play an important role in the proliferative phase of liver regeneration, as in mice, this is the time of highest S-phase activity of regenerating hepatocytes. Other indications for a function of the LAP/LIP isoform ratio in dividing cells came from an in vitro proliferation assay, where a reduced expansion of C/EBPuORF MEF cultures was observed as compared to C/EBPWT cells (Figure 3.9 A). The retardation of C/EBPuORF MEF proliferation became evident at day three of the experiment and resulted in significantly lower cell numbers at day five (9.2 ± 0.2 vs. 11.9 ± 0.5 x 105/well, n=5, p<0.01). To examine whether the C/EBPuORF mutation also affected cell proliferation in mice, we compared liver regeneration properties of C/EBPuORF and C/EBPWT animals. We also in- cluded C/EBPLIP animals in the analysis to elucidate potential LIP-specific functions. Hepa- tocytes in regenerating livers of C/EBPuORF mice entered the cell cycle later and at lower frequency as compared to C/EBPWT animals (Figure 3.9 B and C). S-phase labeling of liver cells by 5-Bromo-2-deoxy-Uridine (BrdU) revealed a 9.3-fold reduction in the proportion of BrdU-positive C/EBPuORF hepatocytes at 36 hours (1.2 ± 0.5% vs. 11.6 ± 2.8%, n=8, p<0.01) and a 1.9-fold reduction at 48 hours after surgery (28.9 ± 4.0% vs. 54.9 ± 3.8%, n=7, p<0.01). Virtually no BrdU incorporation was observed in hepatocytes of sham-operated animals at 48 hours after PH (n=3, data not shown). Thus, the strongest reduction of BrdU- labeled hepatocytes was observed at 36 hours, a time when WT livers started to replicate their DNA. Together with the sustained but less pronounced reduction in S-phase labeling at 48h hours, these data implied that the increased LAP over LIP isoform ratio in C/EBPuORF livers

58 Results caused a delay but not a complete block of S-phase entry. Regenerating livers of C/EBPLIP animals contained similar numbers of BrdU-positive hepatocytes as compared to C/EBPWT mice at any time (36 h: 11.5 ± 0.4%, n=5, and 48 h: 56.9 ± 2.1%, n=4; Figure 3.9 B and C). Immunoblot analysis of C/EBPLIP liver lysates confirmed the expected exclusive expression of the truncated C/EBP isoform in C/EBPLIP livers (Figure 3.9 D). Together, these observations suggested that LIP, but not the long C/EBP isoforms, has a crucial regulatory function for accurate re-entry of hepatocytes into the cell cycle.

Figure 3.9 Cell proliferation defect in C/EBP uORF mice. (A) In vitro proliferation assay demonstrating reduced expansion of C/EBPuORF (open triangles) as compared to C/EBPWT MEF cultures (black squares, n=5 independent embryos per genotype, **p<0.01). (B) Quantification of BrdU-labeled hepatocyte nuclei (2 hours pulse labeling) in liver sections showing a reduced proportion of hepatocytes in S-phase in C/EBPuORF (open bars) as compared to C/EBPWT (black bars) and C/EBPLIP livers (grey bars) at 36 and 48 hours after PH (n=8, ***p<0.001 and n=7, *p<0.05 vs. WT, respectively; error bars show s.e.m.). (C) BrdU immunofluorescence stainings of C/EBPWT, C/EBPuORF and C/EBPLIP liver sections 36 hours after PH. Scale bars: 100 μm. (D) Immunoblot showing C/EBP isoform expression in regenerating livers of C/EBPLIP mice at indicated times after PH. Only the truncated C/EBP isoform LIP but neither LAP* nor LAP isoforms are expressed in C/EBPLIP livers. (h): hours, -tub.: -tubulin.

59 Results

A delay in cell cycle entry of regenerating C/EBPuORF hepatocytes was also reflected in the transcript levels of several cell cycle-associated genes. When we compared the expression of cyclin A1, A2, B1, E1, E2, and proliferating cell nuclear antigen (Pcna) at 24 and 36 hours after PH, these transcripts were induced differentially in the three genotypes. While the induction from 24 to 36 hours was strong and similarly high in C/EBPWT and C/EBPLIP livers, it was less pronounced in C/EBPuORF animals and expression levels remained significantly lower (Figure 3.10). Twelve hours later, the expression of the cyclins and Pcna in C/EBPuORF livers reached similar levels as compared to both, C/EBPWT and C/EBPLIP animals (data not shown), again suggesting that re-entry of C/EBPuORF hepatocytes into the cell cycle was impaired but not abolished by the compromised induction of LIP.

Figure 3.10 Impaired induction of cell cycle genes in regenerating C/EBPuORF livers. Real-time PCR analysis showing reduced mRNA contents of cyclins (Ccn) A1, A2, B1, E1, E2 and proliferating cell nuclear antigen (Pcna) in C/EBPuORF (open bars) as compared to C/EBPWT (black bars) and C/EBPLIP livers (grey bars) at indicated times after PH. (n=6, *p<0.05, **p<0.01 vs. WT). n.d.: not determined, error bars show s.e.m.

To further characterize the altered dynamics of cell cycle entry in regenerating C/EBPuORF livers, we performed a genome-wide microarray expression analysis at 36 hours after PH. A total number of 546 underrepresented transcripts (392 annotated genes) and 266 overrepre- sented transcripts (161 annotated genes) were identified in regenerating C/EBPuORF as compared to C/EBPWT livers (Figure 3.11 A and Table S2). Comparison of all deregulated transcripts to a database of cell cycle-associated genes (www.geneontology.org) resulted in

60 Results

191 matches, of which 99% (189 matches) grouped to the underrepresented fraction (Figure 3.11 A and Table S3). Among the underrepresented transcripts CcnA2, B1, B2, E1, E2 and Pcna were rediscovered, validating previous data obtained by real-time PCR analysis. Fur- thermore, immunoblot analyses for a selection of underrepresented genes showed that the reduced transcript levels, as revealed by the microarray, were associated with a reduction in protein expression (Figure 3.11 B). In addition to the reduced protein expression of CcnA2, B1 and Pcna, lower protein amounts of Rbl1 and Mcm3 were observed. In summary, the high proportion of underrepresented cell cycle genes at 36 hours after PH verified the immunohis- tochemically detected reduction in hepatocyte S-phase entry in C/EBPuORF mice on a transcriptional level.

Figure 3.11 E2F target genes are underrepresented in regenerating C/EBP uORF livers. (A) Graphic representation of a genome-wide microarray expression analysis comparing transcript levels in C/EBPWT and C/EBPuORF liver at 36 hours after PH. (B) Immunoblot analyses showing reduced expression of selected cell cycle regulatory proteins in C/EBPuORF () as compared to C/EBPWT (WT) liver at 36 hours after PH. Pcna: Proliferating cell nuclear antigen, -tub.: -tubulin, Rbl1: Retinoblastoma-Like 1, CcnB1: Cyclin B1, Mcm3: Minichromosome maintenance deficient 3, CcnA2: Cyclin A2.

The sustained reduction of replicating C/EBPuORF hepatocytes at 48 hours and the lack of a compensatory relative increase of labeled cells at 72 hours after PH indicated that the proliferative response was not only delayed, but that a lower total number of C/EBPuORF hepatocytes re-entered the cell cycle. To further investigate the altered regenerative response in C/EBPuORF mice, liver weight was monitored at day 3, 6 and 9 after PH. Surprisingly, despite the observed changes in hepatocyte S-phase entry, both, C/EBPWT and C/EBPuORF mice displayed similar recovery of liver weight after PH (Figure 3.12 A). Histomorphometric analysis of liver sections revealed that the gain of weight of C/EBPuORF livers was accom-

61 Results panied by a stronger increase of hepatocyte volume in C/EBPuORF as compared to WT livers (Figure 3.12 B and C). This suggested that enhanced hepatocyte hypertrophy compen- sated for the blunted S-phase entry to restore adequate liver/body weight ratios in C/EBPuORF mice.

Figure 3.12 Hepatocyte hypertrophy in regenerating C/EBPuORF livers. (A) Bar graph depicting the average weight of regenerating livers of C/EBPWT (black bars) and C/EBPuORF mice (open bars) at indicated times after partial hepatectomy (n=4 to 6 mice per genotype). (B) Drawing of outlined perimeters of individual hepatocytes (upper panels) as determined from HE stained liver sections (lower panels) of C/EBPWT and C/EBPuORF mice at day six after surgery. (C) Bar graph showing the average hepatocyte volume in regenerating C/EBPuORF as compared to C/EBPWT livers, as determined from histomorphometric measurements as shown in B. (n=3 mice per genotype). **p<0.01, error bars show s.e.m.

3.6 Isoform-specific co-regulation of E2F-controlled cell cycle genes

C/EBP transcription factors are known to affect the expression of cell cycle regulatory genes controlled by E2F transcription factors (Nerlov, 2007; Sebastian and Johnson, 2006). The expression array analysis had identified a substantial number of underrepresented cell cycle genes in regenerating C/EBPuORF as compared to WT livers (Figure 3.11). A comparison of these deregulated transcripts to previously identified E2F targets (Bracken, et al., 2004; Ishida, et al., 2001; Ren, et al., 2002) revealed that at least 42% of them were known E2F target genes. To test, whether C/EBP is associated with the promoters of E2F-regulated genes, we performed chromatin immunoprecipitation analysis (ChIP) at 36 hours after PH. The am- plification of specific promoter fragments from chromatin, precipitated by antibodies specific to E2F3 or C/EBP, showed that both transcription factors were associated with promoters of underrepresented E2F target genes in regenerating liver (E2F1, Rbl1, CcnA2, CcnE1, Cdc2, Cdc25, Mcm3, Mcm6 and Plk1; Figure 3.13).

62 Results

Figure 3.13 C/EBP is associated with E2F-regulated target gene promoters. Representative ChIP assay on C/EBPWT liver chromatin showing the association of E2F3, C/EBP and - to indicated gene promoters in regenerating liver at 36 hours after PH (n=2). IgG: immunoglobulin G, E2F1/3: E2F transcription factor 1/3, Rbl1: Retinoblastoma-Like 1, CcnA2: Cyclin A2, CcnE1: Cyclin E1, Cdc2: Cell division cycle-associated 2, Cdc25: Cell division cycle 25 homolog, Mcm3: Minichromosome maintenance deficient 3, Mcm6: Minichromosome maintenance deficient 6, Plk1: Polo-like kinase 1.

At the same time C/EBP showed little or no association with these E2F target gene promoters. Furthermore, transient downregulation of transcript and protein levels of C/EBP after PH (Figure 3.14) suggested a predominant role for C/EBP in the co-regulation of E2F target genes in cycling hepatocytes.

Figure 3.14 Transient decrease of C/EBP mRNA and protein in regenerating livers. (A) Real-time PCR analysis showing the relative C/EBP mRNA content in livers of C/EBPuORF (open triangles) and C/EBPWT animals (black squares) at indicated times after PH (n=6), normalized to Gapdh (glyceraldehyde-3- phosphate-dehydrogenase). Error bars show s.e.m. (B) Immunoblot showing a similar transient decrease of C/EBP protein in both C/EBPuORF and C/EBPWT livers at indicated times after PH. Lysates and -tubulin input control (-tub.) are the same as shown in Figure 3.8 A.

63 Results

Finally, the co-regulatory effect of individual C/EBP and isoforms on E2F-mediated gene activation was examined in cooperation with K. Zaragoza (MDC). An E2F-responsive luciferase reporter construct that has previously been employed to address the mechanism of C/EBP-mediated E2F repression (Porse, et al., 2001) was transduced into HEK293T cells. As expected, luciferase activity was strongly induced by ectopic expression of the transcription factors E2F1 and DP1 (dimerization partner 1, conferring full activity to E2F1). This activity was proportionally repressed by increasing amounts of co-expressed p42, LAP* or LAP, but remained unaffected by co-expression of p30 or LIP (Figure 3.15 A). To further analyze the co-regulatory effect of individual C/EBP isoforms we expressed increasing amounts of LAP*, LAP or LIP in the presence of constant amounts of C/EBP p42 that conferred approximately 50% repression to the luciferase activity induced by E2F1 and DP1 alone. In this setting, the p42-mediated inhibition of E2F activity was effectively relieved in a dose dependent manner by co-expression of LIP, whereas increasing amounts of LAP* or LAP further repressed reporter activity (Figure 3.15 B). These data suggest that the impaired expression of LIP in C/EBPuORF cells and tissues may allow a persistent repression of E2F-regulated cell cycle genes by long C/EBP isoforms, resulting in the observed proliferative defects in MEF and regenerating livers.

Figure 3.15 Co-regulatory effect of C/EBP and isoforms on E2F-mediated gene activation. (A) Luciferase reporter assay demonstrating the repressive function of long (black bars), but not of truncated C/EBP and - isoforms (open bars) on the pGL3TATAbasic-6xE2F reporter construct (n=3). DP1: dimerization partner 1 of E2F, luc: luciferase activity, p42 and p30: long and truncated C/EBP isoforms. (B) Luciferase reporter assay with constant, intermediately repressive C/EBP p42 expression (luciferase activity set to 0.5) showing the co-repressive function of LAP* and LAP (black bars) and the de-repressive function of LIP (open bars) on the same E2F-responsive reporter construct as used in A (n=3). Error bars show s.e.m. (in cooperation with K. Zaragoza)

64 Discussion

4 Discussion

4.1 Proof of principle: uORF-mediated translational control in the mouse

This study on C/EBPuORF mice is the first to experimentally show that uORF-mediated translational control is an active and physiologically relevant mechanism of protein expression regulation in the mouse. As such, it adds a new level of evidence to previous studies, which were either correlative, were performed in lower organisms, or were based on data obtained from the transduction of expression- or reporter-plasmids into cultured cells. Instead, the C/EBPuORF mouse strain constitutes a mammalian model organism validating the mechanism of uORF-mediated translational control from endogenous transcripts in the living animal. The introduction of a single A>T nucleotide exchange within the uORF initiation codon of the c/ebp gene is the minimal experimental interference that allows ablation of translational initiation at the C/EBP uORF without altering the amino acid sequence of the extended isoform LAP*. The data obtained from the analysis of C/EBPuORF mice confirm the previously established model, where ribosomal initiation at this regulatory site is of crucial importance for the balanced expression of C/EBP isoforms. The C/EBP uORF was originally reported to suppress initiation from the proximate LAP initiation codon, which follows 4 base pairs downstream of the uORF termination site (Lincoln, et al., 1998). Subsequent plasmid based experiments had demonstrated that translation of the truncated C/EBP isoform LIP was dependent on the integrity of the uORF initiation codon (Calkhoven, et al., 2000; Xiong, et al., 2001). Both of these previously described effects of the C/EBP uORF on LAP and LIP expression were now validated in C/EBPuORF animals. Most strikingly, the induction of LIP in response to lipopolysaccharide treatment or partial hepatectomy in WT animals was virtually abolished in C/EBPuORF livers. Especially, the absence of LIP induction in LPS-activated C/EBPuORF cells or organs demonstrated that translational initiation at the uORF is crucially required to decode extracellular signals into adequate expression of LIP. These data underlined the function of the the uORF as molecular switch directing the production of long versus truncated C/EBP isoforms. The loss of uORF regulation caused an increased LAP over LIP isoform ratio under both, steady state and activated conditions, and was observed in all cell types analyzed, including ex vivo cell cultures of C/EBPuORF derived MEF and osteoclasts, as well as in a variety of mouse organs, includ-

65 Discussion ing liver, lung, spleen, white adipose tissue, and others. Together, these data suggest that uORF-mediated translational control of C/EBP isoform expression is a generally active regulatory mechanism in mouse tissues. The C/EBPuORF mice may serve as paradigm organisms, suggesting that uORF regulatory functions observed in vitro may frequently apply to the living animal as well. Our data imply that uORF-mediated translational control could be active in other transcripts and that the widespread prevalence of uORFs in human and rodent transcriptomes (Calvo, et al., 2009; Iacono, et al., 2005) reflects the presence of a comprehensive yet mostly neglected mechanism of gene expression control. A review of publications listed in the PubMed literature database, provided by the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/sites/entrez), revealed a total number of 356 articles on uORF-mediated translational control in eukaryotic or viral transcripts (Boolean search for "upstream open reading" OR "uORF" OR "upstream initiation" OR "uAUG" OR "small open reading" OR "sORF" OR "upORF"). Table S1 summa- rizes all literature on individual uORF bearing transcripts found by this query, and wherever possible states the transcript, taxon and regulatory mechanism involved. The table is intended be continued and refined along with future studies on the function of upstream open reading frames, in order to allow a structured and targeted view on the complex field of uORF biology. It will help to quickly review the literature on either a specific transcript of interest or on one of the highly diverse alternative functional mechanisms involved in uORF regulation, as introduced in chapter 1.1.2.

4.2 C/EBP translational control – exception or paradigm?

Although paradigmatic in terms of constituting proof of principle to the general concept of uORF-mediated translational control in mammals, the case of C/EBPuORF mice is exceptional in two respects: First, the uORF of C/EBP regulates the balance of expression of alternative proteins derived from subsequent initiation sites within the same mRNA molecule, while in the majority of transcripts uORF regulation rather influences translation of just a single downstream MCS (Table S1). Only few other genes have been reported to produce mRNAs encoding more than one N-terminally distinct protein isoforms from subsequent initiation codons, including transcription factors (e.g. C/EBP, Scl/Tal1, GATA-1), receptor molecules (e.g. Gcr) or kinases (e.g. S6) (Kozak, 2002). Secondly, C/EBP belongs to the group of intronless genes, which comprise about 6% and 8% of human and mouse protein coding genes, respectively (Hill and Sorscher, 2006; Sakharkar, et al., 2006). Especially the

66 Discussion presence of conserved uORFs in such intronless genes may indicate an ancient regulatory mechanism of protein expression control, which may have been complemented in evolutionary younger genes by other mechanisms, including alternative promoter usage or alternative splicing. Other indications of an evolutionary old mechanism are derived from reports de- scribing the presence of uORF-mediated translational control in yeast (Hinnebusch, 2005) and green algae (Hanfrey, et al., 2005). It is clear though that uORF-regulated isoform expression is not restricted to intronless genes, as shown for example for the intron-containing mRNA of the transcription factor SCL/TAL-1 (Calkhoven, et al., 2003) and multiple other examples (Table S1). Nevertheless, it would be interesting to find out, whether uORFs are preferentially found in intronless or poly-ORF genes, and how many of them are actually regulated by uORFs.

The multitude of mechanisms by which individual uORFs affect translation (paragraph 1.1.2) implies that being exceptional could be considered as a rule in uORF biology. A requirement of translational initiation at the uORF start codon appears to be the only unifying event. How- ever, it is not known, whether any nucleotide consensus sequence (apart from the Kozak sequence) is enriched upstream or downstream of uORF initiation codons to regulate translational initiation specifically at uORF start sites. A search for structural or sequential similarities in the mRNA context, rather than in the uORF sequence itself, might reveal common features indicative of a regulatory function, such as a recurrent motif for a specific RNA binding protein for example. Furthermore, a combination of current methods to analyze sequence data in relation to proteomic data may help to identify clusters of transcripts, where one or a specific arrangement of several uORFs fulfill highly similar regulatory functions. In addition to cis-acting sequence elements, the composition of the ribosomal complex appears to be crucially important for the regulation of initiation at the uORF versus reinitiation at downstream start codons, as ribosomal reinitiation was found to be mechanistically different from the first, 5´-proximal initiation event (Roy, et al., 2010). Subunit h of eIF3 is required to maintain reinitiation-competence of ribosomes during the elongation phase of uORF translation, while it has no major effect on the initial start site selection (Roy, et al., 2010). Although recent years have seen great progress in understanding the molecular composition of the ribosomal complex (Jackson, et al., 2010), much remains to be learned about the functional contributions of individual protein subunits to allow predictions on their regulatory role in uORF-mediated translational control.

67 Discussion

4.2.1 Mechanisms of uORF-mediated translational control of C/EBP

The immunoblot analyses of activated MEF or lung tissue of C/EBPWT animals showed that LIP is occasionally more strongly induced in response to external stimuli as compared to the LAP isoform. In analogy to what was shown before for C/EBP in vitro (Calkhoven, et al., 2000), this predominant induction of LIP expression may be due to a uORF-specific increase of ribosomal initiation under favorable translational conditions. Although the molecular mechanism of uORF-mediated translational control was not addressed in detail in the present study, in depth analysis of the transcript sequences surrounding the C/EBP and initiation codons support and extend the model introduced in Figure 1.7. The predominant benefit of the uORF start site under favorable translational conditions may be explained by the distinct qualities of the Kozak context surrounding each of the C/EBP initiation codons. According to the experimentally acquired criteria defining the strength of initiation support by various Kozak contexts (Kozak, 1986; Kozak, 1987) it could be assumed that initiation efficiency gradually increases along the four initiation codons of the C/EBP transcript (Figure 4.1): When looking only at the core Kozak consensus sites at -3 and +4 of each initiation site, the LAP* start site lacks both most important purine bases at -3 and +4 (weak context). The uORF surrounding sequence solely displays one initiation-supportive A at position -3 (intermediate), which most likely allows some leaky scanning as observed for the similarly surrounded uORF initiation codon of C/EBP (Figure 1.6) (Calkhoven, et al., 2000).

Figure 4.1 Kozak consensus sequences at the C/EBP translation initiation codons. According to its position and the intermediate quality of its Kozak consensus sequence, the initiation codon of the C/EBP uORF (organge) may represent the first “adjustable” translational start site and may function as a sensor of changes in global translational conditions.

The LAP Kozak context is the first containing a G at +4, which was shown to be the most efficient enhancer of initiation in the absence of a purine base at -3 (Kozak, 1986; Kozak, 1987). Observations during this and previous studies (Calkhoven, et al., 2000) suggested that the LAP initiation codon is recognized by scanning ribosomes with high efficiency. It may also facilitate reinitiation of a fraction of post-termination ribosomes that translated the uORF, in analogy to the similarly surrounded C/EBP p42 site (Calkhoven, et al., 2000). Finally, the

68 Discussion

LIP initiation site is surrounded by a strong Kozak context with guanine bases at both of the core consensus sites, which efficiently support translational initiation. We hypothesize that changes in the overall translational status might predominantly affect the uORF initiation codon because it is the first initiation site surrounded by an intermediate context. As such it may be more sensitive to altered translational conditions in comparison to those sites that may not be adjustable due to their `always weak´ or `always strong´ support for initiation, respectively. A simple analogy to illustrate this assumption is that only the hearing-impaired (uORF), but neither the deaf (LAP*) nor the healthy (LAP and LIP) would benefit from a hearing aid. Thus, the positions and the specific qualities of Kozak contexts at the C/EBP initiation codons may explain, how a better translational status of the cell predominantly increases initiation efficiency at the uORF start codon, increases the number of post- uORF-termination ribosomes and thereby renders more ribosomes unable to immediately re- initiate at the LAP start site. Instead, those ribosomes may be recharged for reinitiation along their way scanning towards the LIP initiation codon and start translation at this downstream site.

Despite the simplicity of a linear ribosomal scanning/reinitiation model as an explanation for altered isoform ratios and defective LIP induction in C/EBPuORF mice, the translational regulation of C/EBP transcription factors may be more complex. Three dimensional stem loop structures (Xiong, et al., 2001), regulatory trans-acting factors including CUGBP1 (Timchenko, et al., 1999) as well as hnRNP-miRNA interactions (Eiring, et al., 2010) were implicated in the regulation of C/EBP translation. Furthermore proteolysis of the long isoforms was suggested to contribute to the generation of LIP (Baer and Johnson, 2000). It remains to be analyzed whether one of these mechanisms accounts for the low amounts of LIP that were occasionally detected in C/EBPuORF derived cells or tissues. Alternatively, resid- ual LIP expression could be explained by leaky ribosomal scanning over both, the LAP* and LAP start codons or from minimal uORF-initiating activity of an alternative CUG initiation codon located 12 nucleotides upstream in respect to the uORF AUG codon (Wiesenthal, 2005) (Figure 1.6). Data obtained from other groups indicate that the classical GCN4-model of more efficient reinitiation after prolonged ribosomal scanning towards a distal initiation site may not be the predominant mechanism of uORF-mediated isoform expression control in C/EBP. Length- ening of the intercistronic sequence between the uORF and p42 (Lincoln, et al., 1998) or be-

69 Discussion tween the uORF and C/EBP (CHOP/DDIT3) (Jousse, et al., 2001) did not confer increased initiation rates at the p42 or C/EBP start sites in vitro. Instead, single nucleotide deletions in the 7 bp intercistronic sequence of C/EBP were associated with enhanced p42 expression, indicating that the spacer region might mediate the repressive effect of the uORF. Spacer- dependent inhibition of downstream translation has been described in other transcripts and could be due to a release of ribosomes from RNA after translation of the uORF, to the induction of ribosomal stalling at the uORF termination codon or to shunting of ribosomes accross the proximal initiation codon (Sonenberg and Hinnebusch, 2009). For C/EBP it was shown that the uORF-encoded peptide acts in cis to repress downstream translation (Jousse, et al., 2001). However, C/EBP was the only member of the C/EBP family recovered in a computational screen that revealed a high conservation of the coding sequences of about 200 uORFs in human and mouse genomes (Crowe, et al., 2006). Whether uORF-mediated translational control in C/EBP and is sensitive to changes in the peptide sequence of the uORF has not been described, but appears to be unlikely, as only the amino acid sequences of the C/EBPs, but not the ones of the uORFs are conserved among species. In any way, peptide-dependent translational control would still require translational initiation at the uORF start codon in the first place. The data obtained from C/EBPuORF mice and cellular assays suggest that translation of the C/EBP uORF represents the major determinant in regulating the isoform expression ratio of C/EBP. LIP levels in C/EBPuORF mice were consistently reduced as compared to C/EBPWT specimens and the lack of a functional C/EBP uORF initiation codon clearly resulted in the inability to induce LIP expression under inflammatory conditions, as well as during differentiation and regeneration processes. It remains to be tested, whether our model of preferential uORF translation in response to good translational conditions holds true and which of the alternative mechanisms significantly contribute to the regulation of isoform ratios in vivo. How exactly ribosomal initiation rates change in different conditions has to be tested in a quantitative way by monitoring the actual amount of ribosomes that initiate at each individual start codon. Only recently, such detailed analysis at nucleotide resolution has be- come possible by ribosomal profiling (Ingolia, et al., 2009). Applying this novel method in combination with introducing changes in the transcript sequence or the environmental conditions could possibly help to solve many of the open questions on uORF-mediated start site selection in C/EBP and other transcripts.

70 Discussion

4.3 Do uORFs control the translation of C/EBP?

C/EBP, and constitute the three members of the C/EBP transcription factor family that have been reported to be produced in alternative, N-terminally truncated isoforms, yet the presence and conservation of in-frame initiation codons in C/EBP, and may suggest that the production of truncated isoforms could be common to all C/EBPs. The C/EBP gene differs structurally from C/EBP and in that it contains introns. In addition to alternative translational initiation, the expression of four alternative C/EBP isoforms (p32, p30, p27 and p14) was attributed to differential promoter usage and alternative splicing (Bedi, et al., 2009; Lek- strom-Himes, 2001; Yamanaka, et al., 1997). Similar to the short C/EBP and isoforms, the short C/EBP isoforms display less transactivation potential, with the shortest isoform (p14) lacking most of the trans-activating domains (Figure 1.5). C/EBP is expressed in hematopoietic cells of the granulocytic lineage and is required for the terminal differentiation of granulocytes into eosinophils and neutrophils (Lekstrom-Himes, 2001; Yamanaka, et al., 1997; Yamanaka, et al., 1997). Recent studies showed that the isoforms of C/EBP differentially affect granulocytic lineage commitment and differentiation pathways (Bedi, et al., 2009). Due to such structural and functional similarities between C/EBP, , and , we searched for indications of uORF-mediated translational control in the C/EBP transcript. Sequence analysis of the C/EBP mRNA of several species revealed that only the murine and rat transcripts contain an out-of-frame uAUG codon between the p32 and the p30 translational start site (Figure 4.2). Nevertheless, as many as three conserved hypothetical C/EBP uORFs may initiate from alternative out-of-frame initiation codons in the human transcript. Initially, translational initiation at alternative initiation codons in eukaryotes was described for only few transcripts and found to occur predominantly on ACG, CUG and GUG codons (Kozak, 1991; Touriol, et al., 2003). To date, additional non-AUG initiation sites have been identified and were shown to account for a substantial number of alternatively initiated proteins in mammalian cells (Oyama, et al., 2007; Wegrzyn, et al., 2008). Similarly, the extended isoform of C/EBP proved to originate from a CUG codon in mouse and rat, and from a GUG codon in human transcripts (Muller, et al., 2010). In the transcript of C/EBP an ACG codon is located 89 and 77 nucleotides upstream of the adenine base of the C/EBP p30 initiation codon, and a GUG codon is found at -59 nt. The ACG codon at -77 nt corresponds to the mouse and rat uAUG. All three hypothetical uORF start sites (uORFhyp) are conserved, but only in humans the uORFhyp terminates 5 bases upstream of the p30 initiation codon, while in

71 Discussion cow and mouse it overlaps the p30 coding sequence by 85 nucleotides. Given that all three potential C/EBP uORF start sites are surrounded by intermediate or favorable Kozak consensus sequences, it appears to be worthwhile to test experimentally, whether uORF-mediated translational control might be implicated in the regulation of C/EBP isoform expression.

Figure 4.2 Hypothetical uORFs in the C/EBP transcript. The most abundant C/EBP transcript variant (Yamanaka, et al., 1997) contains three subsequent hypothetical uORF initiation codons (uORFhyp), followed by in-frame termination codons upstream (homo) or downstream (bos and mus) of the p30 start site. The rat C/EBP sequence is not displayed, as it is 100% homologous to the mouse sequence shown in this alignment. Initiation codons of protein isoforms are highlighted by green background color, initiation and termination codons of uORFs and uORFshyp are in red bold face, favorable residues of the core Kozak context (residues at -3 or +4) are underlined.

4.4 Physiological relevance of the C/EBP isoform expression ratio

The importance of the balanced expression of C/EBP isoforms for adequate transcriptional gene regulation during physiological processes has long been anticipated from both, cellular assays and correlative expression analyses (Calkhoven, et al., 2000; Duong, et al., 2002; Jundt, et al., 2005; Shao, et al., 2005; Zahnow, et al., 2001; Zahnow, et al., 1997). Neverthe- less, no previous study addressed the consequences of reduced or impaired LIP expression in an experimental animal model system. The data presented in this thesis now contribute to a deeper understanding of how changes in the isoform ratio of the C/EBP transcription factor affect mammalian physiology. The consistently increased LAP over LIP isoform expression ratio in C/EBPuORF mice results in osteopetrosis due to impaired osteoclast differentiation, enhanced acute phase response gene expression, prolonged repression of cell cycle genes and altered liver regeneration due to an impaired cell cycle entry of hepatocytes after partial hepatectomy. Of note, this list of physiological effects of the uORF mutation might be extended to other C/EBP-related biological functions that were not addressed in this study. Some of these, including metabolic regulation, osteoblast differentiation and function, and tumor development are currently under investigation.

72 Discussion

4.4.1 LAP and LIP opposingly regulate the differentiation of osteoclasts

The analysis of the bone phenotype of C/EBPuORF mice was inspired by the concomitant work of J. Smink (MDC), who identified crucial regulatory functions of C/EBP isoforms in bone homeostasis by investigating C/EBP knockout and C/EBPLIP knockin mice (Smink, et al., 2009). As opposed to an enhanced osteoclast differentiation and function observed in C/EBPLIP mice (Smink, et al., 2009), the elevation of the LAP over LIP isoform ratio in C/EBPuORF mice resulted in the formation of less and smaller osteoclasts in vitro and in vivo. In tibiae of C/EBPuORF animals, the number and size of osteclasts were reduced, while trabecular thickness and bone volume were increased, suggesting that the lack of LIP expression results in decreased bone resorption, causing osteopetrosis. Furthermore, the previously proposed regulatory sequence of LAP inducing MafB expression, which results in the repression of osteoclastogenic transcription factors leading to impaired osteoclast differentiation (Smink, et al., 2009), is validated in this thesis by an independent set of experiments comparing C/EBPuORF and C/EBPWT animals (Figure 4.3). C/EBP transcription factors have long been implicated in lineage commitment and differentiation of hematopoietic cells, predominantly of the granulocytic and macrophage lineage (Hirai, et al., 2006; Johansen, et al., 2001; Kirstetter, et al., 2008; Tanaka, et al., 1995; Uematsu, et al., 2007). Osteoclasts and macrophages are derived from a common monocytic progenitor cell population, suggesting that specific signals at this precursor level may decide, which of the two cell types is ultimately formed. While the work presented here validated LAP as an inhibitor of osteoclast differentiation, it may be an essential upstream factor of MafB-driven macrophage differentiation and/or function (Bakri, et al., 2005; Kelly, et al., 2000). In genome wide expression analyses, comparing transcript amounts in monocytic cells after stable transfection of a LAP expression-vector, we observed strong overrepresentation of macrophage marker genes (F4/80 and Lysozym M) in association with a decrease in osteoclast differentiation (J. Smink, unpublished data). Furthermore, we detected a moderate increase of the proportion of macrophages within cell populations isolated from peritoneal cavities of C/EBPuORF mice as compared to WT animals (data not shown). Together, these observations indicate that the C/EBP isoform ratio may be crucial in lineage decisions between osteoclasts and macrophages (Figure 4.3) (Smink and Leutz, 2010).

73 Discussion

Figure 4.3 Model of uORF-directed lineage decision between macrophages and osteoclasts. For details on the mechanism please refer to the main text. Figure extended from (Smink and Leutz, 2010).

Although the increase in bone mass of C/EBPuORF mice could be explained by the reduction of osteoclast activity alone, a similar increase in bone mass in C/EBPLIP mice (Smink, et al., 2009) indicates that the actual regulation of bone homeostasis by C/EBP isoforms is more complex. Tominaga et al. showed that C/EBP knockout mice have a defect in osteoblast differentiation (Tominaga, et al., 2008). In C/EBPLIP mice, the enhanced osteoclast function is exceeded by an overriding activity of osteoblasts, resulting in an increase of bone mass despite of the presence of more and larger osteoclasts. The enhancing effect of LIP on osteoblast differentiation was found to be cell autonomous (Smink, et al., 2009). Possibly, LIP coactivates the transcription factor Runx2, a key regulator of osteoblast differentiation, as described before in another experimental setting (Hata, et al., 2005). In contrast to the opposing effects of LAP and LIP on osteoclast differentiation, both isoforms promote the formation of osteoblasts (Hata, et al., 2005). This could explain, how a sustained or enhanced osteoblast

74 Discussion activity in C/EBPuORF or C/EBPLIP mice, respectively, contributes to an overall increase in bone mass, despite of a low vs. high osteoclast activity. In addition to cell autonomous mechanisms, cytokine and growth-factor signals from stromal cells are critically involved to control the balance of bone resorption vs. bone formation and are currently under investigation in all three genotypes. Despite several unresolved questions, the LAP over LIP isoform ratio clearly is a major determinant of osteoclast differentiation and bone homeostasis in mice. The data presented here further support the idea that the C/EBP isoform ratio might be a good target for therapeutic intervention to treat bone loss caused by estrogen deficiency or chronic corticosteroid treatment (Boyce, et al., 2006). Everolimus, a derivative of the classical mTOR inhibitor rapamycin, proved to protect ovariectomized rats from the development of osteoporosis (Kneissel, et al., 2004), however patient data on this topic has not been published. We assume that the bone protective effect of rapamycin and its analogs may be mediated through a reduction of translational initiation at the C/EBP uORF, resulting in enhanced expression of the osteoclast inhibitory isoform LAP (Smink, et al., 2009; Smink and Leutz, 2010).

4.4.2 Increased C/EBP LAP over LIP isoform ratio alters acute phase response gene expression

Together with other members of the C/EBP transcription factor family, C/EBP has been implicated in the regulation of liver development and function, reflected by the nomenclature of its isoforms (liver activating or liver inhibitory protein) and by a wealth of data on this topic (Buck and Chojkier, 2003; Buck, et al., 1994; Cereghini, 1996; Descombes and Schibler, 1991; Diehl, 1998; Friedman, et al., 2004; Greenbaum, et al., 1995; Greenbaum, et al., 1998; Iakova, et al., 2003; Lin, et al., 1993; Luedde, et al., 2004; Mischoulon, et al., 1992; Ossipow, et al., 1993; Qiao, et al., 2006; Sato, et al., 2006; Schrem, et al., 2002; Timchenko, et al., 1997; Timchenko, et al., 1999; Wang, et al., 2001; Wang, et al., 1995; Westmacott, et al., 2006; Zaret and Grompe, 2008). Furthermore, the synonymous designation `nuclear factor of IL-6´ (NF-IL6) indicates an important function of C/EBP as downstream effector-molecule in IL-6 regulated physiological processes, including APR and liver regeneration (Akira, et al., 1990; Michalopoulos and DeFrances, 1997; Poli, 1998). Although long and truncated C/EBP isoforms were shown to differentially affect the transcriptional activation of C/EBP target genes in vitro (Ossipow, et al., 1993; Shao, et al., 2005), in vivo data on this isoform-specific gene regulation is scarce. Here, we analyzed the effect of the C/EBPuORF mutation on the

75 Discussion expression of previously characterized C/EBP targets in a model of liver regeneration and found that several acute phase response genes, including serum amyloid A1 (Jensen and Whitehead, 1998), alpha-1-antitrypsin (Alonzi, et al., 2001), haptoglobin, and hemopexin (Ramji, et al., 1993), as well as IL-6 were more strongly induced in hepatectomized C/EBPuORF mice as compared to WT animals. As IL-6 is a key regulatory cytokine during the early phase of liver regeneration (Michalopoulos and DeFrances, 1997) and as it is an activator of the APR, our data on the isoform-specific regulation of IL-6 expression is an important observation, adding up to several other reports on the complex interdependency between C/EBP, IL-6 and APR genes: A study by Akira et al. almost 20 years ago suggested a positive feedback regulation between C/EBP and IL-6, with IL-6 signaling increasing the expression and trans-activating activity of C/EBP, which in turn enhances the transcription of IL-6 (Akira et al. 1990). Subsequent studies showed that IL-6 induces C/EBP activity at both, the transcriptional (Niehof, et al., 2001) and at the post-transcriptional level (Ramji, et al., 1993), yet transcript levels of C/EBP were not affected in IL-6 deficient mice (Cressman, et al., 1996). Trautwein et al. demonstrated that cytokine signaling confers activating phospho-modifications to C/EBP, which increase its trans-activating potential (Trautwein, et al., 1993). Surprisingly, C/EBP knockout mice showed constitutively increased levels of serum IL-6 (Screpanti et al. 1995), suggesting that C/EBP would act as a repressor of IL-6 expression. Underlining the importance of the C/EBP/IL-6 regulatory network, the lymphoproliferative phenotype of C/EBP knockout mice, which was attributed to the elevated IL-6 levels, was rescued in C/EBP/IL-6 compound knockout mice (Screpanti, et al., 1996). In contrast to the data obtained from C/EBP k.o. mice, C/EBP was shown to enhance IL-6 expression in murine macrophages in two independent studies (Gorgoni, et al., 2002; Su, et al., 2003). Furthermore, a recent report revisited the topic of mutual regulation between C/EBP and IL-6 in the context of oncogene induced senescence and clearly demonstrated a trans-activating function of C/EBP on IL-6 gene expression at the endogenous level (Kuil- man et al. 2008). This study once more suggests that C/EBP is both, upstream and downstream of IL-6 expression and IL-6 signaling, respectively. Isoform-specific investigations also produced controversial results: In one study, not only full-length C/EBP, but also the N-terminally truncated isoform LIP activated IL-6 expression induced by LPS activation (Hu, et al., 2000). These observations were based on ectopic

76 Discussion expression of the truncated LIP isoform in a lymphoblastic cell line that does not express endogenous C/EBP. The described activation of IL-6 by LIP was co-dependent on LPS signaling and occurred through an indirect effect, requiring NFB. In contrast, Takayuki et al. demonstrated that ectopic expression of LIP in the presence of full-length C/EBP impaired IL-6 promoter activity, while sequestration of LIP activated the IL-6 promoter in human melanoma cells (Takayuki, et al., 2003). Similarly, the IL-6 promoter was synergistically activated by AP1 and full-length C/EBP, and transcription factors in mouse B lymphocytes, while a dominant negative C/EBP protein reduced promoter activity (Baccam, et al., 2003). Together, the regulation of IL-6 expression by C/EBP appears to be cell type- specific, to depend on the C/EBP isoform ratio and to be influenced by co-regulatory transcription factors like NFB, STAT proteins or AP1. The data presented in this thesis reflect serum IL-6 levels during liver regeneration in the complexity of the animal. The elevation of IL-6 expression, together with the enhanced expression of APR genes in C/EBPuORF mice, suggests that the previously described positive feedback loop between IL-6 and C/EBP is mediated exclusively by the LAP isoforms. In- stead, the early induction of LIP in C/EBPWT animals may serve to provide a limiting signal to the self-activating potential of IL-6 signaling, the positive auto-regulation of C/EBP itself (Niehof, et al., 2001), and the transcription of APR genes. Clearly, a multitude of signaling factors and intracellular pathways induced by partial hepatectomy contribute to the regulatory network governing the acute phase response. These include for example tumor necrosis factor or hepatocyte growth factor, which are both induced concomitantly to IL-6 and exert important functions during the initial `priming-phase´ of liver regeneration, when quiescent hepatocytes are recruited to G1-phase to allow re-entry into the cell cycle (Michalopoulos and DeFrances, 1997). Priming and APR are also dependent on major signaling pathways including the direct phosphorylation of STAT proteins mediated by Janus kinases (Alonzi, et al., 2001) or the activation and nuclear transloctaion of NFB transcription factors. On many target genes STAT, NFB and C/EBP act synergistically, as reflected by their concommitant transcriptional induction, by direct physical interactions (Stein, et al., 1993) or by co- activating transcriptional activity via adjacent binding sites in specific target gene promoters (Poli, 1998). Well studied examples are serum amyloid A (Jensen and Whitehead, 1998; Ray and Ray, 1994) or C-reactive protein, the prototypical APR protein in humans but not in mice (Pepys and Hirschfield, 2003), which is induced by NFB, STAT3 and C/EBP in response to IL-1 and IL-6 signaling (Agrawal, et al., 2003).

77 Discussion

4.4.3 Isoform-specific cell cycle regulation by C/EBPs

A major finding of this study is the observation of altered liver regeneration properties in C/EBPuORF mice, caused by a prolonged repression of cell cycle regulatory genes and a delayed re-entry of hepatocytes into the cell cycle. Interestingly, this phenotype is rescued in C/EBPLIP mice, where the endogenous C/EBP gene locus is replaced by the coding sequence of the LIP isoform only. Here the exclusive expression of LIP is sufficient to drive the induction of cell cycle genes and the entry of hepatocytes into S-phase with similar dynamics as observed in C/EBPWT animals. These data suggest that ribosomal initiation at the C/EBP uORF is required to drive the expression of LIP, which appears to be an important mediator of appropriate cellular responses to regenerative stress signals, as elicited by partial hepatectomy. Furthermore, our data imply that long C/EBP isoforms are dispensable for accurate re- entry of hepatocytes into S-phase, and rather exert repressive effects on the transcription of cell cycle regulatory genes and on cell cycle progression in vivo. Several previous studies demonstrated cell cycle regulatory functions of C/EBP and transcription factors, but the molecular mechanisms involved are not yet fully understood. In general, C/EBP appears to be the more potent factor to drive cell cycle exit, while C/EBP can function as both, driver and inhibitor of cell cycle progression dependent on the cellular context. For C/EBP both, “off-DNA” and DNA binding-dependent mechanisms have been described (Johnson, 2005). Most of these mechanisms directly or indirectly target on the regulation of cell cycle genes controlled by Rb/E2F complexes: Ectopic expression of C/EBP in human fibrosarcoma cells resulted in strongly increased activity of p21, which reduces cell cycle progression by inhibiting cyclin/cdk-mediated phosphorylation of Rb. This effect was attributed in part to enhanced p21 expression and to post-translational stabilization of p21 in a C/EBP-containing complex (Timchenko, et al., 1996). However, the significance of this observation remains questionable, as subsequent work demonstrated that C/EBP is capable to induce cell cycle arrest in p21 deficient MEF (Muller, et al., 1999). Similarly, the physical interaction between C/EBP and cdk2 and 4 was suggested to inhibit cell cycle progression by abolishing the cyclin-dependent phosphorylation of Rb proteins, thereby preventing the associated derepression of E2F-regulated genes (Wang, et al., 2001). Again, later studies raised doubts about the relevance of cdk-repressive functions of C/EBP, as a mouse model expressing C/EBP without the cdk-interacting sequence did not display overt phenotypes (Nerlov, 2004). C/EBP was also reported to disrupt pro-proliferative E2F-p107 com-

78 Discussion plexes while stabilizing E2F-p130 complexes associated with resting cells (Timchenko, et al., 1999; Timchenko, et al., 1999). The groups of Kurtz and Nerlov reported that both, the N- terminal trans-activating domains as well as specific residues in the C-terminus of C/EBP are required for the repression of E2F-function and physical interaction with E2F, respectively (Porse, et al., 2001; Slomiany, et al., 2000). The direct repression of E2F by C/EBP appears to be a major mechanism of C/EBP induced cell cycle exit, as mouse mutants expressing an E2F-interaction defective mutant of C/EBP (basic region mutant 2) showed hyperproliferation and eventual transformation of myeloid cells in vivo (Porse, et al., 2005). The multitude of physical interactions between C/EBP and cell cycle-associated proteins, and the divergence of mechanisms implicated in the antiproliferative function of C/EBP reflect the complexity of the regulatory network involved. Until now, it remains largely un- known, which of the mechanisms described above also apply to C/EBP and/or other members of the C/EBP family. C/EBP was identified as a critical target of oncogenic Ras signaling to induce cell cycle arrest and premature senescence in MEF (Sebastian, et al., 2005). This function was clearly dependent on an interaction between C/EBP and Rb/E2F complexes and was associated with downregulation of E2F-regulated genes, including c-Myc, PCNA, and Cyclin A2. Similarly, C/EBP was described to mediate E2F gene repression by direct interaction with E2F1 in human and mouse granulocytic cells (Gery, et al., 2004). The degree of complexity in C/EBP-mediated cell cycle regulation is further increased by taking into account several isoform-specific observations: The full length, but not the truncated isoforms of C/EBP and were found to induce growth arrest in many cell types, including K562 cells and HepG2 cells, respectively (Buck, et al., 1994; D'Alo, et al., 2003). Instead, a lack of p42 expression together with sustained or increased expression of p30 was frequently observed in human acute myeloid leukemia (AML) samples and suggested a pro- proliferative and transforming function of truncated C/EBP (Pabst, et al., 2001). The deregulated isoform ratio in AML was found to be due to recurrent mutations in the C/EBP gene (Nerlov, 2004). Subsequently, the pro-oncogenic properties of C/EBP p30 were validated in a mouse model, where the lack of p42 expression resulted in a block of terminal granulocyte differentiation and induced a myeloproliferative disease resembling human AML (Kirstetter, et al., 2008). Similarly, several human malignancies are associated with decreased LAP over LIP isoform ratios (Jundt, et al., 2005; Rask, et al., 2000; Sundfeldt, et al., 1999; Zahnow, 2002; Zahnow, 2009) and recent data obtained from C/EBPLIP mice further support an oncogenic effect of elevated LIP expression (V. Bégay and A. Leutz, unpublished data).

79 Discussion

4.4.4 The function of C/EBP isoforms during liver regeneration

In this thesis, timecourse-monitoring of C/EBP protein expression in response to partial hepatectomy repeatedly revealed a two-wave kinetic with maxima at 6 to 12 and at 48 hours after surgery. The early peak of C/EBP expression and the subsequent decline to almost starting levels at 24 hours, has been described before (Greenbaum et al. 1995; Greenbaum et al. 1998). This first maximum of C/EBP expression correlated with the strongest enhancement of APR gene expression in C/EBPuORF mice, suggesting an important function for C/EBP LIP during the priming phase of regenerating hepatocytes, as discussed in paragraph 4.4.2. Although the work of other groups implicated C/EBP in the proliferative phase of liver regeneration before (Greenbaum, et al., 1995; Greenbaum, et al., 1998; Luedde, et al., 2004), none of the previous publications contained data on a second maximum of LIP expression around 48 hours after PH. The prolonged repression of E2F target genes in regenerating C/EBPuORF livers suggested that the second wave of LIP induction may be required to mediate derepression of E2F-regulated target genes. Interestingly, similar to our observations in C/EBPuORF mice, a delayed and blunted cell cycle entry of regenerating hepatocytes has been described for C/EBP knockout animals (Greenbaum, et al., 1998). However, the proliferative defects were attributed to a lack of CBP/p300 co-activator recruitment by C/EBP to E2F target promoters (Wang, et al., 2007). Although CBP/p300 displays strong co-activating functions on C/EBP target genes (Mink, et al., 1997; Schwartz, et al., 2003) the proposed activating function of C/EBP on E2F target gene expression and cell cycle progression remained only vaguely defined by the study of Wang. The constitutive association of C/EBP with selected E2F target gene promoters increased two to three-fold at 40 hours after PH for only two of four promoters analyzed (Mcm3 and Cdc6). Furthermore, the recruitment of CBP or p300 to the four E2F-target gene promoters was not consistently impaired in C/EBP deficient livers and was unchanged for the Mcm3 promoter that showed the most prominent increase of C/EBP binding. It also remained questionable whether the proposed co-activator recruitment function is conferred by C/EBP at all, as the antibody used throughout that study (Sc-50, http://www.scbt.com/datasheet-50-rb-c-15-antibody.html) recognizes Rb protein but not C/EBP, or is mislabeled in 2 manuscripts. The data presented in this thesis are based on the validated underrepresentation of E2F- regulated transcripts in a genome-wide expression analysis of regenerating C/EBPuORF livers and on the consistent association of C/EBP with the promoters of a number of function-

80 Discussion ally important and well-characterized cell cycle regulatory genes controlled by E2F. Further- more, isoform-specific reporter gene studies demonstrated repressive functions of long C/EBP and isoforms on E2F/DP1-mediated gene activation, which was relieved by LIP. Our observations are in favor of a model where uORF-mediated induction of LIP is required to overcome repression of E2F targets by long C/EBP and - isoforms, allowing the rapid re-entry of hepatocytes into the cell cycle during liver regeneration. To accurately analyze the functional implications of C/EBP isoforms in the regulation of E2F-controlled promoters, isoform-specific ChIP analyses could solve many open questions. To date, such experiments cannot be performed because LIP-specific antibodies have not been generated. LIP shares an identical amino acid sequence with the C-termini of LAP* and LAP and consequently, a LIP- specific antibody would have to discriminate between a free LIP N-terminus versus the same amino acid sequence integrated in the LAP isoform. Nevertheless, our model is consistent with earlier data showing that the cell cycle inhibitory function of C/EBPs is restricted to the long isoforms (D'Alo, et al., 2003; Sebastian, et al., 2005; Slomiany, et al., 2000). It is also in agreement with previous mouse model observations, where adenoviral overexpression of LAP in mouse livers resulted in the retardation of hepatocyte cell cycle entry after PH and a similar delay of the induction of PCNA, cyclin A and E (Luedde, et al., 2004) as observed in C/EBPuORF animals. Overexpression of LIP in that model induced premature expression of cell cycle genes, but, similar to the C/EBPLIP situation, did not change the temporal dynamics of hepatocyte cell cycle entry. The fact that both C/EBPuORF and knockout animals show comparable phenotypes in respect to liver regeneration, and the rescue of such alterations by the exclusive expression of LIP in C/EBPLIP mice, imply that LIP is required to mediate pro-proliferative functions of C/EBP. Whether the LIP-mediated derepression of cell cycle genes is brought about by de- pleting the repressive effects of long C/EBP isoforms, or whether LIP actively recruits co- activators to E2F-regulated promoters remains to be addressed by future studies. Despite the defects in hepatocyte proliferation, liver mass was restored normally in C/EBPuORF mice due to a compensatory increase in hepatocyte volume. A similar phenotype has been described for Skp2 deficient mice. Skp2 is an F-box protein of the SCF ubiquitin ligase complex that targets p27Kip1, an inhibitor of cdk-driven E2F gene activation, for degradation (Minamishima and Nakayama, 2002; Nakayama, et al., 2000). In hepatecomized Skp2-deficient animals, increased levels of p27Kip1 were associated with reduced hepatocyte proliferation and increased hepatocyte size and polyploidy (Minamishima and Nakayama,

81 Discussion

2002). Since Skp2 transcript levels were reduced in C/EBPuORF mice after PH (Table S3) it may be interesting to investigate, whether protein levels of p27Kip1 and the ploidy-status of C/EBPuORF hepatocytes are elevated and whether Skp2 is a direct target of C/EBP. Recently, the extended isoform of C/EBP was suggested to cause an increase in cell growth by activating the biogenesis of ribosomes (Muller, et al., 2010). In analogy to most other C/EBP-mediated functions, the truncated isoforms may be antagonistic in this context, too. As expression of C/EBP-ext could not be detected in regenerating livers, possibly a similar function of LAP* - that is not counteracted by LIP in regenerating C/EBPuORF mice - may provoke hepatocyte hypertrophy.

4.5 Concluding remarks and future directions

4.5.1 Resolving the bipartite functions of C/EBP transcription factors

In respect of the crucial role for isoform-specific regulation of cellular differentiation, the development of AML and potentially other malignancies, it is of fundamental importance to better understand how C/EBP transcription factors control proliferation vs. differentiation processes. The availability of drugs like rapamycin that efficiently modulate C/EBP isoform expression ratios suggests a high potential for targeted therapeutic intervention. Our data on C/EBPuORF mice once more indicate two major functional implications of C/EBP transcription factors: On the one hand, long C/EBP isoforms activate direct target genes involved in specified functional programs (APR genes) or cell differentiation (MafB), while the truncated version of the transcription factor appears to have trans-repressive effects on these genes. On the other hand, long isoforms inhibit the transcription of cell cycle promoting genes regulated by E2F transcription factors, where truncated C/EBPs mediate transactivation, despite of being devoid of intrinsic trans-activating potential (Figure 4.4). The simplest explanation for these observations is that the regulation of classical C/EBP target genes involves DNA binding and is directly dependent on the trans-activating potential of C/EBP itself. In contrast, the inhibitory effect of C/EBP on E2F/DP-mediated gene expression depends on both, N-terminal domains of p42 and on individual C-terminal amino acid residues (Porse, et al., 2001; Porse, et al., 2005), but appears to be independent of the DNA- binding capacity (Johansen, et al., 2001). This suggests that the repression of E2F-function by C/EBP is brought about via DNA-binding independent protein-protein interactions of C/EBP with cdks, E2F, DP or Rb, as discussed above. Consistent with these ideas, recent

82 Discussion

Figure 4.4 Upstream ORF-mediated translational control affects cell fate decisions by balancing the opposing functional programs of long and truncated C/EBP and isoforms. Figure adopted from (Calkhoven, et al., 2000).

data on increased proliferation and defective differentiation of keratinocytes in skin-specific C/EBP/ compound knockout mice confirmed that induction of differentiation genes requires DNA binding of C/EBP, while cell cycle inhibitory function is mediated indirectly via the repression of E2F activity (Lopez, et al., 2009). Interestingly, the regulatory relation between C/EBPs and E2F/DP appears to be mutually repressive, as increasing levels of E2F1 and/or DP1 inhibited the trans-activating potential of C/EBP in fibroblasts (Zaragoza, et al., 2010). Although the de-repressive functions of p30 and LIP was repeatedly explained by a model, where the truncated C/EBP isoforms displace the longer versions of the protein from E2F-complexes (Johansen, et al., 2001; Nerlov, 2010; Porse, et al., 2001; Sebastian, et al., 2005), the specific differences in co-activator or co-repressor recruitment by long vs. truncated isoforms are insufficiently defined. The protein family of cyclin-dependent kinases may represent interesting candidates in this respect, as only the long but not the truncated C/EBP isoforms interact with cdk2 and 4, preventing cyclin-dependent phosphorylation of Rb proteins (Harris, et al., 2001; Wang, et al., 2001). Cdks may not only be implicated in E2F co-regulation, but also affect DNA-binding-dependent C/EBP targets: Cdk6 was shown to prevent binding of Runx1 to C/EBP-regulated promoters, thereby inhibiting the co-activating

83 Discussion cooperation of both factors and preventing terminal differentiation of myeloid cells (Fujimoto, et al., 2007). Together, these observations show that the classical model of p30 or LIP being dominant repressors of p42 or LAP (and most likely other trans-activating C/EBP-isoforms), respectively, may hold true only for DNA-binding-dependent regulation of C/EBPs. However, even this hypothesis may be over-simplified, as several studies indicate that the trans-activating function of LIP sometimes does involve DNA binding: Dependent on the presence of a C/EBP recognition motif, Cyclin D1 responsive promoters were mutually activated by either LIP or cyclin D1, but were repressed by LAP (Lamb, et al., 2003). In another report LIP increased the trans-activating potential of Runx2 on the osteocalcin promoter, which also contains a C/EBP recognition motif (Hata, et al., 2005). Another long-known (Alam, et al., 1992; Isshiki, et al., 1991) but still puzzling observation is that the protein expression levels of C/EBP and are opposingly regulated in response to inflammatory signals, with C/EBP being strongly induced, while C/EBP expression rapidly decreases. This is surprising, since C/EBP and share many highly homologous regions and are functionally redundant in many respects. For example, C/EBP expressed from the genomic locus of C/EBP can rescue some of the phenotypes displayed by C/EBP knockout mice (Chen, et al., 2000). Thus, future work is required to address whether the differential regulation of expression is mediated by a post-transcriptional mechanism or if specific regulatory features in the genomic loci are responsible for the inverse expression pattern of both proteins. Furthermore, it would be of great interest to dissect individual from common functions of C/EBP and . To this extent, a systematic analysis of interacting partners of each of the conserved homology regions by proteomic screens would be of great help to assign specific functional implications. An ultimate goal in this respect may be to identify crucial amino acid residues and signal-dependent protein modifications that control the biological activity of C/EBPs.

4.5.2 Defining the role of uORFs in the etiology of disease

Aberrant protein expression caused by defective translational control is increasingly recognized as a patho-physiological mechanism in the etiology of human diseases (Scheper, et al., 2007). It is a major cause for the development of a wide range of pathologies, including blood-clotting disorders, accumulation diseases or cancer. In analogy to the experimentally deleted C/EBP uORF initiation codon in C/EBPuORF mice, naturally occurring uORF mu-

84 Discussion tations in other genes may cause physiological alterations by deregulating translation of the affected transcript. Such mutations can result for example in loss or gain of uAUGs in a given transcript, can alter the length of a specific uORF or may affect initiation efficiency by causing alterations within the uORF Kozak consensus sequence. Highlighting the potential physiological implications of uORF-mediated translational control, more than 500 single nucleotide polymorphisms (SNPs) have been identified in humans that either create or delete uORFs (Calvo, et al., 2009). This variability in the presence of uORFs suggests a substantial contribution of uORF-mediated regulation to individual phenotypes and/or the pre-disposition to distinct diseases. Consistent with these expectations, the etiology of several human diseases has been linked to mutations affecting translational control by uORFs. Three well- documented and thoroughly analyzed examples have been identified: (I) Hereditary thrombocythaemia is caused by a mutation that eliminates a uORF due to the generation of alternatively spliced mRNA, resulting in increased production of thrombopoietin protein (Wiestner, et al., 1998). (II) Reduced production of Cyclin-dependent kinase inhibitor 2A caused by the mutational introduction of a uORF in the 5´-leader sequence of the CDKN2A transcript results in the familial predisposition to melanoma development (Liu, et al., 1999). (III) Only recently, Marie Unna hereditary hair loss was shown to be caused by a variety of mutations altering a uORF within the hairless homolog (HR) transcript, resulting in increased expression of hairless homolg protein (Wen, et al., 2009). This list was recently extended by additional 11 disease-related genes, where uORF altering mutations were identified by computational analysis of the Human Gene Mutation Database (Calvo, et al., 2009). Diseases with a confirmed implication of uORF mutations include the van der Woude syndrome (IRF6), hereditary pancreatitis (SPINK1), familial hypercholesterolemia (LDLR) and others (Calvo, et al., 2009). Additionally, the expression of the beta secretase BACE1, related to Alzheimer´s disease (Zhou and Song, 2006), or the transmembrane receptor tyrosin kinase ERBB2, related to breast cancer (Spevak, et al., 2006), is at least partially controlled by uORFs. Whether deregulated uORF-mediated translational control is the crucial pathogenic event in these latter cases remains to be established, but even with only a few unequivocal cases at this time, it is evident that uORF mutations may be involved in a wide variety of diseases including malignancies, metabolic or neurologic disorders, as well as inherited syndromes. As many important regulatory proteins, including cell surface receptors, tyrosine kinases, and transcription factors act in a dose-dependent fashion, uORF mutations that affect expression levels of these genes might be responsible for a number of as yet unexplained pathologies.

85 Discussion

This thesis establishes the transcription factor C/EBP as a paradigmatic example demonstrating how translational control by uORFs may affect cell fate decisions. Accumulating evidence obtained from individual transcripts, bio-informatic surveys and array-based screens increasingly suggest that deregulation of uORF-mediated translational control might be a widespread mechanism underlying the development of human diseases. The rapid progress in advanced sequencing technologies will permit screening approaches to identify causative uORF mutations in primary material derived from patients. Malignancies of the blood might be among the most suitable types of diseases to start with, as cell samples are readily accessible. For example, one would expect to uncover loss of uORF-function mutations in proto-oncogenes, causing ectopic and transformation inducing over-expression, and gain of uORF-function mutations in tumor suppressor genes, resulting in decreased production of the protective protein (Figure 4.5). Given the high number of human transcripts carrying at least one uORF, the in depth analysis of 5´-leader sequence mutations has the potential to substantially widen the spectrum of diseases with molecularly resolved etiology. Uncovering disease-related uORF mutations will inspire extensive subsequent research, aiming to target the misexpressed proteins for therapeutic intervention.

Figure 4.5 How uORF mutations may drive malignant transformation. Mutations (lightning arrows) which eliminate uORFs may activate the translation of transforming proto-oncogenes. Mutations which create uORFs in front of tumor suppressor genes may decrease translation of the encoded protective protein, as has been shown for CDKN2A (Liu, et al., 1999). In either way, uORF affecting mutations may result in malignant transformation of cells.

86 Supplement

Supplement

Table S1 Summary of literature on individual uORF bearing transcripts. Boolean search of the PubMed literature database for "upstream open reading" OR "uORF" OR "upstream initiation" OR "uAUG" OR "small open reading" OR "sORF" OR "upORF". The grey shaded columns contain information about the overall function of uORF regulation, the adjacent columns show, which mechanism was tested/is involved.

taxon gene numberuORFs of repressionMCS induction MCS start site selection stability mRNA NMD alternative promoter alternative splicing uORF number cap to uORF length uORF uORF to MCS overlapMCS Kozak context termination (context) translational status sequence / peptide ribosome stalling ribosome pausing shunting ribosome load ribosome mutation / SNP PubMed ID 3188393;8500171 ;9452497;955770 5;10496216;1076 Virus 35S RNA 9 x x x x x 6738;10747993;1 0973961;1115856 5 Drosophila Ace >1 3024971 Yeast Act1 x x 14659741 Human Acyp2 1 x x 9395090 ADAM10 x 20348102 Human ADH5 2 x 11368338 Human AdoMetDC 1/2 x x 1400498 8416975;8027046 ;8939886;982998 Hu- 3;10570962;1082 man/Mous 9027;11139406;1 AdoMetDC 1 x no x x x x x x x e/Plant/Ye 1333018;1148990 ast 3;11741992;1220 5086;16176926;1 9522702 Rat Adora2a 1 x 10537036 Human Adrb2 1 x x 8308019 Human alpha-TTP 1 x x 10896705 AP-1 19167516 7565672;8770589 ;8636015;981943 8;10608810;1081 Fungus arg2 >1 x no x x 8103;12054887;1 6979358;1196725 9;15851478 Human AT1R 2 x x x 16504375 15548739;194037 Plant AtbZIP11 4 x x x 31;20179149 Plant AtbZIP2 1 x 15208401 8920955;1110674 Mouse ATF4 2 x x x x 9;15479734 18055463;181950 ATF5 2 x x x 13 15710632;197545 Plant AtMHX 1 x x x no no 18 Plant AtNMT1 1 x 16960350 14981268;166119 Human BACE1 6 x x x 80;17439957 Bckd 1 15302860 8649841;9645350 Human Bcl2 1 x x ;17252199

87 Supplement

taxon gene numberuORFs of repressionMCS induction MCS selection site start stability mRNA NMD promoter alternative alternative splicing uORF number cap to uORF length uORF uORF to MCS overlapMCS Kozak context termination (context) translational status sequence / peptide ribosome stalling ribosome pausing shunting ribosome load ribosome mutation / SNP PubMed ID Xenopus BDNF >1 x 19008311 Human Bim 1 x 16153157 Human BTEB 10 x 8051167 Macaque CA1 1 x x 1528895 Virus CaM/RTB x x 18286203 11684693;127577 Mammal cat-1 1 x 12 Yeast CBS1 1 x 2550765 Human CD36 1 x x 11433350 11122857;991680 CDKN2A 1 x x x 6 Hu- 17671235;954528 man/Rode CEBPa 1 x x no x x x 5;10921906 nt/Chicken Hu- 10536163;114520 man/Rode CEBPb 1 x x x 34;20047998 nt/Chicken 14754881;151784 Human CFTR >1 x x x 22 Yeast C-GCN4 3 x x 15039451 11691921;199342 Mammal CHOP 1 x x x x 53 18577757;181950 Human cIAP2 64 x x 37 Yeast CLN3 1 x x 9334317 Mouse c-mos 4 x x x 8891345 8394459;7975210 ;7815480;855208 Virus CMV gpU4 3 x x x x 8;8943366;95703 17;10482583;114 35600;12446775 Human c-myc >1 x? x 9032273 Mouse Connexins >1 x x 15676282 Yeast COX4 >1 x 3033605 3555844;8139542 Yeast CPA1 1 x x x x x x ;12172963;16285 926 Fungus cpcA 2 x 11553722 Plant CPPHY2 1 x x 9680964 Fungus CprA 1 x 10852481 Human CRHR1 1 x 11179443 Rat Cryab >1 x x 2176207 Human CTNND2 1 x? 18978817 10896676;127994 Xenopus Cx41 3 x x x 45 Yeast cyc1 1 x x 1327957 Human CYP1B1 1 x 19908239 CYP27 6 x x x 12909643 Mouse Cytochrome 6 x 7984407 Rodent Cytochrome 1 2834389 Human DBP >1 8786133 Human Dicer >1 x x x 15987463 Virus DnaPol 1 x 2841474;1691312 Xenopus DRD2 4 1826663 Human Drd3 1 x 10670776 eIF4GI 1 x x 15755734

88 Supplement

taxon gene numberuORFs of repressionMCS induction MCS selection site start stability mRNA NMD promoter alternative alternative splicing uORF number cap to uORF length uORF uORF to MCS overlapMCS Kozak context termination (context) translational status sequence / peptide ribosome stalling ribosome pausing shunting ribosome load ribosome mutation / SNP PubMed ID Plant enod40 2 x 11113209 12147702;156075 Human ER alpha 6 x x x 32 Human ER beta >1 x x 19656239 Plant Esi47 1 x 11244122 15270688;162274 Plant ETT and MP >1 x x 52 Human eya2 >1 12039049 Human FGF-5 1 x 2005884 Fli-1 2 x 10757781 Fungus FRQ 6 x 16107616 Human GADD34 2 x x 19131336 Human Gata-6 1 no 15173203 2187295;2207139 ;17913621;63877 04;3915540;3516 411;3088566;306 5626;3050993;30 61799;3072481;2 676723;2196452; 1986242;2038326 Yeast GCN4 4 x x no x x x x x x x ;2038327;833673 7;8264629;75426 16;7479046;8654 378;9539420;981 4754;11356835;1 4976554;1583809 8;15964804;1610 0380;17548477;1 1707416 Mouse GDNF 1 x x 11457495 Fungus Gla66 4 x x 15948964 Rat GLT-1 >1 x x 15661376 gna-2 2 x 15105376 Virus gp64 2 x 9311824 Mouse GR 5 x 11180405 Human H2BFWT x 19583817 Fungus HAC1 1 x 12581366 Virus HBV core >1 x 15731337 Plant HCS1 1 x 18156294 Virus HCV 1 x 1280383 10216954;104462 Human Her-2 1 x x 11;16598037;170 45969 Human Hiap2 1 x 12867997 Human HIC >1 19582149 Virus HIV-1 vpu 1 x 17331561 Human HKalpha2 8 x 9446555 Yeast HL1 1 x 8955402 Hu- 19122663;195137 man/Mous HR x x 91;20055871 e Human HTR3A 2 x x x 11505217 Human Huntingtin 1 x 12466534 Human IFRD1 1 x x x no x x 20080976 Xenopus IGF-I 1 2330002

89 Supplement

taxon gene numberuORFs of repressionMCS induction MCS selection site start stability mRNA NMD promoter alternative alternative splicing uORF number cap to uORF length uORF uORF to MCS overlapMCS Kozak context termination (context) translational status sequence / peptide ribosome stalling ribosome pausing shunting ribosome load ribosome mutation / SNP PubMed ID Hu- 8547330;1120632 man/Xeno IGF-II 1 x x 5 pus Human IGF-IR 1 18452152 Yeast Ino2 1 x 11251853 Virus large RNA >1 x 3419922 La-SS/B 3 x no 9115276;9545582 Gonyaulax lbp 1 x 9271214 8367489;1124411 Plant Lc 1 x x 7 Plant LP6 6 8790302 Photinus Luc 1 x 3821727 Plant Maize R 1 x x x 9761799 Hu- 17170082 man/Mous Mc2R 3 x e 10523842;127302 Human Mdm2 2 x x 02 Human MeCP2 1 x x 15034150 Human Ms 2 x x 17683808 Virus MHV-JHM 1 3838338 Virus MNV 1 x 20027307 Human Mona x 12487779 17065236;198900 Rat/Human MRP2 3/7 x x 61 MRPS29 1 x 20079882 Plant MtHAP2-1 1 x x 18519645 Mouse Mu opioid R 3 x no 17284463 Human MVP 1 x x 11297743 Plant Myb7 1 x x x 11855732 Human Mycn 1 x 20017904 Human Myeov >1 x x 16275643 Human Myf6 3 x 11368338 Human MYH 1 x x x 12056405 Human NOD2 3 x x x 18096043 Yeast Nuc1 3 x 2836792 Hu- 2318872;2365701 1/> man/Rat/Pl ODC x no ;8764119;112665 1 ant/Yeast 83;18626014 Plant Opaque-2 3 x x 8439744 Human OPRM1 4 x 19438807 Human OR 1 x x 2015052 p27 1 x no no 12837699 Virus P38 1 x 2542586 Virus PF Virus 3 x 19638424 Human PKC 2 x x 19797084 Mammal PKCepsilon 1 x 11355884 Human PlGF 2 x 8466755 Plant Pma3 1 x no no 1530935;9670558 Human PR-39 1 12213322 Plant PvALF 3 x 15159632 Mouse Rar beta-2 5 x x x 7962071;8769409 11470798;128241 Mammal Rbm3 >1 x 75 Human RPMS12 1 x x 10542210

90 Supplement

taxon gene numberuORFs of repressionMCS induction MCS selection site start stability mRNA NMD promoter alternative alternative splicing uORF number cap to uORF length uORF uORF to MCS overlapMCS Kozak context termination (context) translational status sequence / peptide ribosome stalling ribosome pausing shunting ribosome load ribosome mutation / SNP PubMed ID Virus RSV 3 x x x x 1327749;7708504 Rat Rtdpoz-T1 19630990 Plant SAC51 1 16936072 Plant SAMDC 2 x x 15821146 Yeast SCH9 >1 8442384 SCL 1 x 12704079 Human Separase 2 x 10644713 Sept9_v4 1 x x x x 17468182 Human sGC beta2 >1 x 18565106 Rabbit SHMT 1 x 7677757 Plant Sn 3 x 11999378 SOCS-1 1 x 10679190 Sp3 1 x 15247228 Virus SV40 >1 x 3029425 Virus tat 1 x x x 7769666 Human TGF-beta3 11 x x x 1875922 15802272;164578 Tie2 5 x x 19 Mouse TIMP 1 x x x 2180930 Virus Tk >1 3023681 Human TPO >1 no x x x 16679454 Human TRB3 1 x x 19505541 Fungus TubB >1 x 8299946 11098051;110980 Mouse/Yea UCP2 1 x x 51;16845607;175 st 14359 12683934;173553 Rat V1bR 2/5 x x x 21;11287361 Plasmo- VAR2CSA 1 x 19119419 dium Virus Va-tat 1 x x 9261187 VEGF-A 1 x 18304943 Vib 15240381 Hu- 8681952;1450465 man/Mous Vigilin 1 x x x 8 e Wnt 13 x 18155664 Yeast Yap1 1 x x x 9469820 9469820;1035782 Yeast Yap2 2 x x x x x 5;10892745 artificial >1 x no x x 8995256 artificial >1 x x x 9271370 artificial 1 x x 1508670 artificial 1 x 7721802 artificial x x 10938098 artificial >1 x x x x 14990743 artificial x x 16473846 artificial 1 x 3110776 artificial x x x 11812856

91 Supplement

Table S2 Differentially expressed transcripts in C/EBPuORF livers (1-3) as compared to C/EBPWT livers (WT1-3) at 36 hours after PH. Note that the WT- and -colums show fluorescence values obtained from the hybridization of pooled liver RNA isolated from two animals.

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change C330011K17Rik -6.46 0.006 219.5 367.9 213.7 3.0 3.0 3.1 NM_177712 NAP062699-1 -6.44 0.005 386.3 349.2 205.7 4.1 3.4 3.3 NAP062699-1 Cml5 -5.47 0.036 1175.1 1310.5 356.5 29.8 23.8 10.3 NM_023493 Tmc5 -4.90 0.016 72.5 119.7 53.1 2.8 2.7 2.8 NM_028930 Susd4 -4.43 0.024 1807.9 1293.9 644.9 102.8 14.1 57.5 NM_144796 LOC666185 -4.34 0.021 108.9 76.5 41.7 2.9 5.4 2.8 XM_982175 D17H6S56E-5 -4.14 0.010 2565.7 4680.3 5532.8 157.8 189.7 377.7 L78788 Cyp4a12 -4.10 0.002 7734.3 6492.1 4981.5 341.5 275.8 501.0 NM_177406 BI555125 -4.00 0.008 2642.4 4663.1 5298.1 190.7 196.6 402.9 BI555125 3000004C01Rik -3.90 0.010 50.6 81.0 105.0 3.7 3.1 9.0 NM_197959 Esco2 -3.90 0.000 287.5 318.3 253.1 10.4 6.9 40.2 NM_028039 Ccnb2 -3.87 0.024 1058.2 2945.4 2373.9 142.2 165.7 127.9 NM_007630 Eda2r -3.78 0.008 37.8 74.7 63.5 3.3 3.3 6.2 AK029268 NAP102625-1 -3.74 0.031 279.6 654.8 856.9 35.1 50.6 48.0 NAP102625-1 Ccnb1 -3.67 0.012 171.2 366.4 352.4 14.3 28.8 26.6 NM_172301 Cdkn3 -3.63 0.036 307.1 1004.0 771.7 52.7 46.2 69.3 BC049694 Plk1 -3.57 0.028 1999.2 3478.0 5372.8 254.1 276.5 385.2 NM_011121 1190002F15Rik -3.52 0.032 254.1 779.1 683.1 28.3 60.3 61.3 AK138072 Prc1 -3.50 0.030 1296.6 2497.1 3694.3 161.2 212.5 288.3 NM_145150 NAP104453-1 -3.47 0.000 884.3 1181.4 1107.0 61.1 87.6 137.2 NAP104453-1 Casc5 -3.46 0.003 33.4 55.0 48.7 3.2 3.0 6.2 NM_029617 Srd5a1 -3.43 0.018 42.9 49.1 20.3 3.4 3.5 3.6 AK082819 Cdc20 -3.42 0.016 4658.2 8722.1 10919.0 629.1 631.7 1016.1 NM_023223 Cdca3 -3.41 0.018 598.3 1354.5 1426.7 78.9 106.4 131.8 NM_013538 Cdca2 -3.41 0.010 274.3 325.7 509.7 25.7 24.5 54.0 NM_175384 Nusap1 -3.39 0.024 323.6 579.0 832.2 46.6 52.6 65.9 NM_133851 Spag5 -3.39 0.002 137.0 150.6 100.6 10.1 7.1 19.9 NM_017407 E130306D19Rik -3.37 0.022 53.7 82.6 129.3 5.4 7.9 12.4 NM_001013377 Pbk -3.33 0.005 698.8 939.5 1205.4 72.3 65.8 144.7 NM_023209 Depdc1a -3.31 0.018 22.0 49.8 52.0 3.4 3.4 5.6 NM_029523 2610002D18Rik -3.30 0.006 623.3 870.0 1077.2 34.5 28.5 197.2 NM_001081099 Kif20a -3.30 0.014 1228.3 2584.7 2635.4 182.5 226.3 246.1 Y09632 Iqgap3 -3.27 0.028 145.5 230.9 370.6 9.1 31.3 37.1 NM_001033484 D2Ertd750e -3.27 0.009 111.1 171.4 216.9 11.3 12.2 28.4 NM_026412 Neil3 -3.26 0.037 49.9 72.7 132.7 5.7 6.7 14.2 NM_146208 Kif20a -3.24 0.012 728.1 1365.5 1549.7 107.4 118.4 159.4 NM_009004 Sgol2 -3.24 0.010 54.3 67.3 101.4 6.4 4.3 13.0 NM_199007 Ttk -3.22 0.008 43.2 50.8 76.2 3.6 2.6 12.0 NM_009445 Ankrd41 -3.21 0.009 81.7 61.9 116.5 7.5 5.6 15.0 AK083552 Aurka -3.19 0.007 4371.3 6356.6 8116.4 478.6 545.4 1043.0 NM_011497 C230078M08Rik -3.17 0.024 1399.8 3050.7 3636.8 222.0 222.1 455.8 NM_176995 Ckap2 -3.15 0.011 105.4 204.1 206.2 12.0 11.4 34.7 NM_001004140 Racgap1 -3.13 0.040 51.1 75.5 138.2 7.9 8.8 13.5 NM_012025 3110070M22Rik -3.12 0.040 15.8 36.9 50.8 3.0 4.7 4.2 NM_026084 Birc5 -3.11 0.015 4586.4 8790.9 10324.7 770.3 731.4 1247.2 NM_009689 Cyp7b1 -3.10 0.008 56829.2 56229.1 30869.9 9189.1 3412.0 4198.9 NM_007825 Aurkb -3.09 0.001 307.5 423.2 381.3 29.1 33.6 67.9 NM_011496 Ccna2 -3.09 0.020 823.9 1426.3 1967.4 131.6 120.2 243.6 NM_009828 Espl1 -3.07 0.007 126.0 173.6 226.8 13.3 16.1 33.5 NM_001014976 Melk -3.05 0.008 292.0 425.8 546.8 28.7 30.1 94.0 NM_010790 Nuf2 -3.02 0.015 465.1 713.5 997.7 64.1 73.0 130.4 NM_023284 Stmn1 -3.02 0.032 2815.6 4883.8 7586.7 492.0 448.3 940.0 NM_019641 Hmmr -3.00 0.013 44.0 53.2 84.9 9.5 4.5 8.7 NM_013552 Foxm1 -3.00 0.016 255.0 339.2 528.4 24.7 49.0 66.4 NM_008021 Kif22 -2.99 0.035 1416.9 2290.0 3784.6 324.8 210.5 409.4 NM_145588 Ube2c -2.98 0.020 1114.8 2027.5 2655.5 210.4 217.4 308.3 NM_026785 AV323315 -2.96 0.028 23.3 51.8 28.5 2.6 2.8 7.9 AV323315 Mki67 -2.96 0.031 776.1 1417.9 2079.6 153.3 134.5 263.3 X82786 Gtse1 -2.94 0.010 95.5 143.6 84.3 3.3 6.0 32.8 NM_013882 Cep55 -2.93 0.017 121.0 135.3 230.9 7.3 14.5 42.0 NM_028760 F630043A04Rik -2.93 0.046 61.0 52.6 128.7 5.6 5.8 20.5 NM_198605 4930547N16Rik -2.92 0.001 60.9 66.5 80.1 6.4 4.5 16.5 NM_029249 2010317E24Rik -2.92 0.002 198.6 301.2 279.1 37.7 17.7 47.7 NM_001081085 2700099C18Rik -2.90 0.001 33.7 33.9 43.4 3.5 3.2 8.1 AK012623 C79407 -2.89 0.008 21.2 19.9 33.6 3.4 3.3 3.3 NM_172578 Cdca5 -2.89 0.004 421.9 376.2 578.0 31.8 45.1 109.2 NM_026410 Cyp2c55 -2.88 0.037 1067.8 1933.9 778.9 282.7 158.1 71.7 NM_028089 C6 -2.88 0.030 4063.4 2532.4 1627.7 602.5 229.3 287.1 NM_016704 2610016C23Rik -2.85 0.004 84.7 117.9 130.2 6.8 6.0 33.3 NM_027930 Shcbp1 -2.83 0.001 921.9 1277.1 1248.3 120.8 100.6 262.6 NM_011369 2310007D09Rik -2.81 0.007 59.7 94.6 108.7 12.3 8.6 16.5 NM_027975 Psrc1 -2.81 0.003 43.5 58.4 69.0 7.2 4.8 12.4 NM_019976 EG634881 -2.80 0.005 72.7 66.4 94.5 3.2 3.0 27.3 XM_909745 Ccne2 -2.80 0.037 119.6 93.6 224.3 15.8 10.4 36.7 NM_009830 Rrm2 -2.80 0.003 2037.3 2724.0 3135.0 280.0 270.9 586.0 NM_009104 Kif2c -2.79 0.022 91.4 132.4 205.5 25.6 13.0 23.3 NM_134471 Cenpm -2.79 0.006 165.7 270.8 284.6 23.2 35.9 45.0 NM_178269 Kif4 -2.78 0.007 297.3 414.1 531.6 54.5 44.6 82.1 NM_008446 Sgol1 -2.77 0.013 499.8 662.6 975.0 85.2 70.7 156.4 NM_028232

92 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change A630055G03Rik -2.77 0.022 37.4 48.5 80.1 9.4 3.4 11.6 AK143588 Ckap2l -2.76 0.012 113.5 95.3 176.1 10.5 15.8 30.4 NM_181589 Bub1 -2.76 0.006 82.2 142.3 111.1 23.1 9.0 17.6 NM_009772 Asns -2.75 0.014 7625.3 3713.2 7476.9 1098.1 809.1 893.1 NM_012055 NAP045842-1 -2.74 0.001 146.7 117.3 121.0 19.2 29.6 8.9 NAP045842-1 Fancd2 -2.71 0.032 44.3 34.2 79.3 5.4 7.0 11.8 NM_001033244 Tpx2 -2.69 0.003 265.8 349.3 424.5 48.8 35.4 76.5 NM_028109 Top2a -2.68 0.003 84.7 110.4 129.4 10.3 16.5 23.8 NM_011623 Depdc1b -2.61 0.018 318.4 578.8 712.6 67.3 80.5 115.4 NM_178683 BC004022 -2.59 0.009 58.8 54.8 32.3 8.3 4.0 11.9 AK053991 Bub1b -2.58 0.008 141.5 189.2 251.0 24.5 23.6 49.2 NM_009773 Phlda3 -2.58 0.038 1014.3 2712.1 2866.8 278.5 286.5 537.9 NM_013750 Ncapg -2.57 0.008 138.6 250.7 211.4 23.6 23.9 53.7 AJ237585 AK017340 -2.56 0.008 47.7 78.9 67.6 3.5 6.9 22.6 AK017340 Polq -2.56 0.039 35.9 58.1 93.5 9.7 4.3 17.8 NM_029977 Dnahc1 -2.55 0.003 37.4 26.8 35.4 2.7 11.7 2.7 BC023155 Cdca8 -2.54 0.005 474.1 556.6 752.5 76.4 59.6 170.3 NM_026560 Kif23 -2.54 0.037 23.3 32.8 57.0 6.3 4.1 9.0 NM_024245 Ccdc37 -2.54 0.015 9.2 18.4 18.6 2.7 2.6 2.7 AK021139 Mphosph1 -2.52 0.001 54.1 70.2 61.4 7.0 8.5 16.9 NM_183046 TC1755975 -2.50 0.027 59168.0 59168.0 25034.0 10585.2 4788.9 9945.7 TC1755975 Ube2t -2.50 0.002 533.3 738.5 708.8 99.3 60.2 191.0 NM_026024 Mlf1ip -2.49 0.003 136.4 174.8 192.0 21.1 13.3 54.9 NM_027973 AK076567 -2.49 0.002 87.6 71.4 82.0 11.1 3.2 28.6 AK076567 Nek2 -2.49 0.015 904.2 1329.5 1832.1 207.2 185.0 333.3 NM_010892 Mtnr1a -2.48 0.012 201.6 141.8 269.3 19.5 33.7 56.5 NM_008639 AK085462 -2.48 0.029 167.0 157.3 66.3 24.5 24.5 20.9 AK085462 D830007F02Rik -2.47 0.036 38.2 14.4 29.8 2.9 9.1 2.9 AK052858 A_51_P305138 -2.45 0.003 1094.2 1645.3 1422.5 167.9 405.3 188.1 A_51_P305138 Ndc80 -2.44 0.005 62.1 73.0 90.1 4.9 9.0 27.6 NM_023294 Chtf18 -2.43 0.006 953.3 1162.8 1499.7 162.9 109.1 398.7 NM_145409 Cenpp -2.43 0.008 101.7 145.0 183.2 30.9 16.6 32.4 NM_025495 Bmp7 -2.43 0.000 176.1 180.5 167.2 34.9 32.2 30.2 NM_007557 Hmgb2 -2.42 0.010 1383.4 1412.5 2231.7 251.1 199.4 488.6 NM_008252 Rad54l -2.42 0.011 159.0 184.9 278.5 33.6 22.1 60.7 NM_009015 Ppil5 -2.41 0.002 264.3 346.4 353.8 39.4 30.9 110.6 NM_001081406 Prdm16 -2.41 0.009 34.1 24.2 19.5 3.0 4.4 7.3 NM_027504 TC1639221 -2.41 0.019 38.5 24.6 49.7 4.3 3.0 14.0 TC1639221 Dpy19l3 -2.41 0.018 718.9 479.2 351.1 103.4 96.6 92.4 NM_178704 Tacc3 -2.39 0.001 343.8 425.7 459.8 64.3 48.4 122.4 NM_001040435 Fbxo5 -2.38 0.005 312.3 320.7 447.8 48.5 33.8 125.0 NM_025995 Gsta2 -2.38 0.011 1801.6 2843.6 1673.5 308.4 568.5 339.2 NM_008182 Rad51ap1 -2.36 0.019 267.4 210.6 409.9 45.2 31.2 96.2 NM_009013 Uhrf1 -2.36 0.013 2136.7 1567.1 2865.7 326.9 180.3 770.1 NM_010931 Ncapd2 -2.36 0.016 1090.3 1519.7 2164.0 282.6 233.5 414.3 NM_146171 Dsn1 -2.36 0.002 385.4 365.0 466.9 53.5 41.0 143.2 NM_025853 Nbeal2 -2.35 0.003 34.6 44.2 52.9 9.0 9.2 7.6 AK003694 Incenp -2.34 0.010 3173.9 3701.3 5495.5 830.4 589.3 1018.1 NM_016692 C330027C09Rik -2.34 0.013 49.7 95.4 76.3 13.4 8.3 22.1 NM_172616 Myo15b -2.33 0.007 57.2 82.5 55.9 3.5 21.4 13.9 XM_989678 Cenph -2.33 0.001 401.5 457.2 513.9 75.0 49.3 148.7 NM_021886 RP23-480B19.10 -2.32 0.032 11455.2 21159.9 28919.1 4713.0 2852.5 4792.1 BC090402 Acsbg1 -2.30 0.020 16.7 31.3 20.3 2.7 8.6 2.6 NM_053178 2810417H13Rik -2.29 0.011 476.0 581.2 840.4 105.7 87.0 195.3 NM_026515 Olig1 -2.28 0.003 298.1 229.4 246.9 19.9 36.4 103.3 NM_016968 Fancd2 -2.28 0.001 141.9 186.0 179.9 40.4 15.3 49.1 ENSMUST00000101051 Trim59 -2.27 0.017 20.3 42.6 34.9 7.7 5.2 7.4 NM_025863 Wfdc12 -2.24 0.000 15.9 19.5 18.1 3.7 3.1 4.5 NM_138684 Cenpk -2.24 0.001 420.4 493.7 387.5 77.5 50.6 148.1 NM_021790 BC024137 -2.23 0.049 2229.3 3290.7 1127.2 465.6 449.8 499.8 BC024137 Serinc2 -2.23 0.001 823.0 833.4 987.0 172.4 76.8 315.0 NM_172702 9430037G07Rik -2.21 0.000 50.2 48.5 52.7 10.7 10.0 12.1 AK050253 Kif18a -2.21 0.016 49.4 81.6 46.3 10.8 10.0 17.5 NM_139303 Clspn -2.21 0.003 55.6 43.9 56.2 7.0 5.6 21.1 NM_175554 Ncaph -2.20 0.021 374.4 339.4 621.8 74.2 59.9 156.4 NM_144818 ENSMUST00000062754 -2.20 0.038 9.0 11.5 20.6 3.0 2.8 3.2 ENSMUST00000062754 Ect2 -2.19 0.010 104.7 124.9 179.2 28.7 20.6 40.1 NM_007900 Cenpi -2.19 0.000 402.1 449.8 426.1 76.2 60.7 142.9 NM_145924 Traip -2.19 0.001 676.3 668.6 759.8 121.3 76.9 264.0 NM_011634 Kntc1 -2.19 0.017 263.5 476.5 488.6 65.7 46.0 158.4 NM_001042421 Tcf19 -2.18 0.030 5657.1 7460.3 11986.9 1416.9 1087.3 3024.5 NM_025674 2600005O03Rik -2.18 0.009 305.5 208.0 341.9 60.9 23.7 104.3 NM_183089 Rad51 -2.15 0.001 1356.2 1512.0 1548.8 280.8 169.5 542.9 NM_011234 TC1671308 -2.15 0.002 188.8 179.2 198.2 30.4 18.7 78.4 TC1671308 Nsl1 -2.15 0.002 363.0 319.4 361.4 44.8 44.0 146.6 NM_198654 Arhgap11a -2.15 0.004 80.9 109.8 120.5 23.6 13.1 33.6 NM_181416 Cep72 -2.14 0.001 13.3 16.5 18.4 3.2 4.7 3.0 AK034892 TC1706721 -2.14 0.002 15.3 10.5 12.3 2.9 2.8 2.9 TC1706721 Exo1 -2.13 0.006 747.3 581.9 598.7 99.2 43.2 296.6 NM_012012 Pask -2.13 0.004 551.2 518.2 675.2 100.2 47.2 250.5 NM_080850 Pkmyt1 -2.13 0.048 306.3 675.2 870.7 106.9 104.1 212.2 ENSMUST00000024701 Oip5 -2.13 0.001 251.0 259.7 289.3 51.5 33.0 98.3 NM_001042653 4930427A07Rik -2.13 0.001 80.7 83.6 65.2 16.7 11.0 24.9 NM_134041 4632434I11Rik -2.12 0.004 198.5 217.9 266.7 36.4 23.6 96.6 NM_001080995 Zwilch -2.12 0.003 526.6 614.8 686.6 99.7 76.6 243.1 NM_026507 E2f7 -2.12 0.015 91.7 173.4 155.8 26.9 20.7 49.1 NM_178609 Kcnk1 -2.11 0.017 77.2 48.1 42.4 9.3 14.5 15.2 NM_008430 Hist1h2ab -2.10 0.042 103.5 233.1 129.1 26.8 31.3 50.2 NM_175660 NAP057198-1 -2.08 0.013 22.1 16.7 12.7 2.7 6.8 2.7 NAP057198-1

93 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change AK032599 -2.08 0.002 55.4 64.5 52.5 8.5 8.5 23.7 AK032599 Mc1r -2.08 0.015 42.6 38.6 22.8 11.6 3.3 9.7 NM_008559 AK041006 -2.08 0.007 14.4 8.7 10.9 2.7 2.7 2.7 AK041006 AK083569 -2.07 0.022 17.8 33.4 28.0 3.3 3.0 12.5 AK083569 Asf1b -2.07 0.010 1481.2 1519.3 2294.5 228.6 405.0 624.1 NM_024184 Cdc25c -2.07 0.037 12.2 19.8 29.6 6.3 3.8 4.6 NM_009860 Cdkn2c -2.06 0.046 1182.5 1892.2 3033.4 418.3 427.0 614.5 U19596 2610021K21Rik -2.06 0.037 19.0 15.6 7.4 3.4 3.2 3.5 NM_030172 Ncapg2 -2.04 0.018 717.8 944.4 1333.2 197.3 148.3 384.3 NM_133762 Cdkn2d -2.03 0.007 1125.2 1743.7 1849.0 304.1 377.7 470.1 NM_009878 Mastl -2.03 0.002 22.4 21.9 28.4 7.6 3.7 6.5 BC086483 Smc2 -2.03 0.006 124.2 156.2 192.6 30.0 25.9 60.2 NM_008017 E2f8 -2.02 0.011 238.9 209.8 150.5 24.6 31.7 91.1 NM_001013368 Ptcd3 -2.02 0.038 16.9 27.6 12.2 2.8 5.2 6.0 AK032831 1700054N08Rik -2.02 0.003 22.7 33.6 28.1 5.2 7.2 8.4 NM_028536 Kif24 -2.00 0.011 19.8 26.6 30.0 2.6 4.1 12.5 NM_024241 Lig1 -1.99 0.019 4044.2 4811.6 7099.7 756.5 891.1 2360.3 NM_010715 Plk4 -1.99 0.001 52.0 60.4 65.3 10.9 11.6 22.2 NM_011495 Gsg2 -1.99 0.004 148.6 180.8 217.5 41.0 31.7 65.3 NM_010353 Fignl1 -1.99 0.009 797.2 723.4 980.9 132.5 81.9 416.6 NM_021891 Sytl1 -1.97 0.002 129.3 105.1 94.3 26.6 21.1 36.0 NM_031393 Mad2l1 -1.97 0.005 244.7 360.6 316.0 49.8 63.4 122.5 U83902 Hmga2-ps1 -1.96 0.033 7.7 13.3 18.2 3.4 2.8 4.0 AK033703 2610510J17Rik -1.96 0.007 196.5 194.8 283.4 54.0 33.9 85.7 NM_028131 BC030867 -1.94 0.005 168.4 204.8 247.8 49.1 33.1 79.1 NM_153544 Mad2l1 -1.94 0.022 295.4 456.3 601.7 102.4 82.8 167.1 NM_019499 Amn -1.93 0.009 99.8 169.4 165.4 40.5 35.5 37.7 NM_033603 Pole -1.93 0.009 1680.4 2203.5 2701.7 495.3 317.4 912.9 NM_011132 Cdc2a -1.92 0.040 75.9 96.0 163.6 21.2 24.3 43.0 NM_007659 Spc25 -1.92 0.015 932.9 1465.2 1769.3 304.7 307.5 490.6 NM_025565 BC055324 -1.91 0.002 638.5 684.8 685.7 129.3 97.6 305.9 NM_201364 Wfdc15b -1.90 0.002 45.5 37.0 46.3 18.2 8.5 7.8 NM_138685 H2afx -1.90 0.008 7343.9 9410.1 12249.2 2545.2 2129.1 3110.0 NM_010436 Dtl -1.89 0.016 120.5 76.6 99.1 18.0 10.4 51.4 NM_029766 Trip13 -1.89 0.003 1204.7 1292.2 1567.1 316.4 197.5 583.8 NM_027182 Gpc1 -1.89 0.002 1472.7 1722.5 1209.6 470.9 311.8 407.6 NM_016696 Nox4 -1.88 0.045 123.2 74.2 61.1 44.9 11.9 13.4 NM_015760 Ccne1 -1.88 0.011 627.3 794.7 1071.0 162.5 204.7 310.4 NM_007633 Capsl -1.88 0.017 15.7 15.4 8.3 3.1 4.1 3.5 NM_029341 5133400G04Rik -1.87 0.000 384.2 340.0 405.3 90.4 98.6 119.0 NM_027733 Cdc6 -1.87 0.020 258.4 194.0 192.7 29.5 16.5 129.9 NM_011799 9530077C05Rik -1.87 0.019 36.2 69.0 47.2 11.8 13.7 16.1 NM_026739 1810007P19Rik -1.87 0.004 85.3 128.5 112.8 37.0 19.6 32.7 NM_172701 4833427B12Rik -1.87 0.008 684.6 899.7 1069.8 161.0 191.8 374.1 NM_178856 Hells -1.87 0.013 327.8 287.2 444.9 92.3 35.0 163.6 NM_008234 Nudt7 -1.85 0.004 21479.6 17987.7 14033.7 5341.4 4694.7 4783.4 NM_024437 Mcm3 -1.85 0.005 14542.2 11156.1 11038.5 3150.4 1560.6 5499.9 AK088142 Tube1 -1.84 0.004 298.0 328.9 404.6 92.1 53.0 143.0 NM_028006 TC1643773 -1.83 0.033 170.6 92.3 91.9 27.6 41.4 30.6 TC1643773 Rab6b -1.82 0.020 13.6 11.4 21.0 3.5 4.1 5.4 NM_173781 Dlg7 -1.82 0.010 45.7 45.8 70.1 11.9 14.0 20.0 NM_144553 Smc4 -1.82 0.000 109.7 113.3 126.3 28.0 26.3 44.7 AK048650 NAP027343-1 -1.82 0.003 32.1 32.0 40.3 8.2 5.9 15.5 NAP027343-1 4833420G17Rik -1.81 0.000 257.5 259.5 235.7 72.1 70.0 71.9 NM_026127 Fancb -1.81 0.001 566.7 583.5 571.9 149.5 86.2 255.7 NM_175027 Wdhd1 -1.80 0.013 269.0 187.1 282.9 55.0 30.5 126.4 NM_172598 6720463M24Rik -1.80 0.009 26.7 43.1 32.0 9.6 7.2 12.5 NM_175265 4930422G04Rik -1.79 0.012 167.6 120.2 156.4 27.1 19.4 81.8 BC030185 Kif14 -1.78 0.006 8.8 14.1 12.0 3.0 3.0 4.1 NM_001081258 Apitd1 -1.78 0.024 193.0 212.4 335.6 66.5 37.6 112.1 NM_027263 Smc4 -1.77 0.005 2737.3 3567.4 4045.9 928.2 726.8 1375.5 NM_133786 F730047E07Rik -1.77 0.008 62.0 70.6 93.1 15.3 17.2 33.5 BC094429 Mcm6 -1.76 0.008 26746.8 24959.6 33582.5 6855.0 3875.2 14374.3 NM_008567 Mthfd2 -1.76 0.002 162.3 202.7 164.7 36.6 43.3 76.6 NM_008638 Ccdc18 -1.76 0.000 9.1 8.7 9.5 2.8 2.6 2.7 NM_028481 Mastl -1.76 0.048 16.9 12.3 27.8 3.7 7.6 5.5 NM_025979 5730590G19Rik -1.76 0.014 8.9 14.5 15.1 3.1 2.8 5.5 NM_029835 Ccdc34 -1.76 0.010 319.8 488.3 338.9 108.7 76.6 154.4 NM_026613 Armc2 -1.75 0.025 8.5 14.0 7.5 2.9 3.1 3.0 AK011447 Chaf1a -1.75 0.018 1465.2 1283.7 2024.2 383.6 204.5 830.4 NM_013733 Cyp2u1 -1.75 0.006 288.1 274.3 183.0 71.1 73.3 77.2 NM_027816 Sorl1 -1.75 0.005 28.5 31.8 24.3 3.0 13.0 9.2 AF031816 Ccne2 -1.75 0.034 74.7 54.6 100.1 41.8 5.1 21.4 NM_001037134 Fen1 -1.74 0.020 1641.2 1572.0 2539.3 415.2 378.9 922.1 NM_007999 ENSMUST00000093911 -1.74 0.011 23.6 32.1 34.7 3.1 14.3 9.5 ENSMUST00000093911 Egr3 -1.74 0.017 21.7 15.5 13.5 8.4 3.0 3.7 NM_018781 Mup3 -1.73 0.007 148701.0 134354.3 93652.0 39295.1 27637.7 46469.3 NM_001039544 Spc24 -1.73 0.004 1374.3 1436.7 1896.9 527.3 339.4 557.2 NM_026282 Pcna -1.72 0.032 9887.4 11077.9 18450.2 3738.9 2555.8 5699.9 NM_011045 E130303B06Rik -1.72 0.001 170.3 162.9 176.3 43.6 36.0 75.5 NM_198299 Mogat2 -1.71 0.042 336.2 180.1 174.3 78.8 47.2 84.9 NM_177448 Rad18 -1.71 0.021 85.2 81.1 54.7 13.3 11.8 42.4 AK028505 Psmc3ip -1.71 0.002 374.1 393.6 393.3 105.8 59.1 190.1 NM_008949 2700094K13Rik -1.71 0.009 3241.6 4796.3 5224.2 1088.0 1149.7 1827.3 NM_001037279 Rpa2 -1.70 0.012 1662.2 1188.4 1813.5 373.3 272.4 785.5 D00812 D430020J02Rik -1.70 0.008 17.5 23.1 23.8 6.2 2.8 10.7 AK084974 AK039475 -1.70 0.008 9.5 15.3 12.6 3.5 3.2 4.8 AK039475 Rfc4 -1.70 0.001 4386.1 4386.1 4692.1 1262.0 893.8 1992.3 NM_145480 Cnfn -1.69 0.046 22.8 12.0 11.4 5.0 4.7 4.7 NM_001081375

94 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change Cenpe -1.69 0.027 16.4 26.4 26.0 13.7 3.1 4.5 NM_173762 BC025462 -1.68 0.006 46.2 65.7 65.2 17.6 12.4 25.3 NM_145946 Lmnb1 -1.68 0.012 678.5 459.3 678.7 142.8 112.9 312.9 NM_010721 Zfp367 -1.68 0.005 278.0 293.2 319.1 59.5 58.4 160.8 NM_175494 Cenpl -1.67 0.048 341.4 381.6 694.3 89.0 177.0 179.0 NM_027429 Atp11a -1.66 0.018 618.3 491.9 334.3 112.4 148.5 194.7 AK147497 6030408C04Rik -1.66 0.023 27.2 29.3 21.9 4.0 3.6 17.2 AK129332 Skp2 -1.66 0.049 45.8 31.0 66.6 9.3 10.1 26.1 NM_013787 Gins3 -1.66 0.009 141.8 128.4 146.3 23.5 26.3 82.5 NM_030198 Pim1 -1.65 0.001 10.8 12.5 9.6 3.4 3.7 3.3 AK047301 1700112E06Rik -1.64 0.016 169.5 213.1 124.6 58.3 74.7 29.3 AK007175 Tubb2b -1.64 0.025 41.9 45.0 25.9 20.2 5.7 10.3 NM_023716 Ezh2 -1.64 0.013 334.8 342.7 510.6 108.9 95.4 176.6 NM_007971 Cenpq -1.63 0.009 1561.1 1741.7 2324.9 613.6 357.6 851.1 NM_031863 BC032265 -1.62 0.000 57.1 63.0 60.2 16.1 23.7 18.6 NM_181420 A130023I24Rik -1.62 0.030 14.4 7.4 14.7 3.5 3.0 5.3 NM_177194 2210408K08 -1.62 0.006 34.5 39.8 49.7 9.5 12.0 18.8 2210408K08 Pole2 -1.62 0.022 162.3 133.4 169.1 22.4 25.6 103.1 NM_011133 E2f1 -1.62 0.029 254.7 223.1 385.2 77.0 51.5 152.7 NM_007891 Rpa2 -1.62 0.006 1059.5 883.1 1132.2 271.7 187.0 543.6 NM_011284 Chaf1b -1.62 0.021 2251.7 2737.3 3817.2 1022.3 450.1 1402.0 NM_028083 2410004L22Rik -1.61 0.015 1512.9 2245.1 2021.6 482.6 316.0 1088.6 NM_029621 Atad2 -1.60 0.036 51.0 46.2 77.8 15.3 7.8 34.5 NM_027435 Nup107 -1.60 0.004 111.9 94.2 125.2 26.3 28.9 54.0 NM_134010 Cdc45l -1.59 0.015 357.5 250.1 324.3 91.9 40.9 175.6 NM_009862 Myh10 -1.59 0.003 318.8 243.1 309.0 129.5 59.0 99.8 NM_175260 NAP097631-001 -1.58 0.047 20.5 18.9 9.2 3.4 4.8 8.1 NAP097631-001 Gas2l3 -1.58 0.011 138.1 213.4 192.2 52.0 39.5 90.8 NM_001079876 TC1666016 -1.57 0.021 73.3 95.2 50.0 26.2 25.1 22.3 TC1666016 Cspg5 -1.57 0.041 45.8 68.7 94.1 33.5 10.7 26.1 NM_013884 Bmp8b -1.57 0.011 136.5 104.3 94.7 18.4 40.1 54.7 NM_007559 Fmn2 -1.56 0.010 32.8 23.9 21.3 10.9 6.4 9.1 NM_019445 Rrm1 -1.56 0.001 3707.4 4182.3 3939.3 1392.3 851.8 1772.8 NM_009103 Prim1 -1.55 0.004 2712.1 3509.3 3229.7 992.9 656.2 1572.6 NM_008921 Dbf4 -1.55 0.004 170.3 167.3 227.1 58.5 59.2 75.0 NM_013726 2810439F02Rik -1.55 0.035 462.1 346.6 226.7 169.2 85.9 99.2 AK077971 Mcm5 -1.54 0.021 5629.4 4690.1 7240.4 1753.7 902.0 3362.2 NM_008566 4732456N10Rik -1.54 0.006 9.6 14.3 11.5 3.1 4.7 4.3 NM_177717 Grm8 -1.54 0.018 17.1 13.0 12.7 8.9 3.0 2.9 NM_008174 Mcm7 -1.54 0.006 10023.8 9158.2 11644.4 3535.5 1803.0 5298.1 NM_008568 Dck -1.53 0.003 73.8 89.1 92.4 27.5 19.6 41.2 NM_007832 Syce2 -1.53 0.029 464.0 864.2 864.6 223.6 181.2 356.0 NM_027954 Blm -1.53 0.003 467.8 415.1 504.6 154.7 95.5 231.8 NM_007550 Tmem54 -1.52 0.030 18.8 12.5 11.7 3.9 2.7 8.3 NM_025452 Chek1 -1.52 0.006 248.5 212.7 234.6 77.3 37.4 128.4 NM_007691 Cep72 -1.52 0.008 54.2 49.6 72.7 14.3 21.3 26.2 NM_028959 Tmem45b -1.52 0.004 22.1 32.0 29.0 10.6 8.8 9.7 NM_144936 Mcm3 -1.51 0.020 2527.9 1861.0 2911.3 785.1 381.0 1388.7 NM_008563 Cdca7l -1.51 0.018 8.3 10.2 13.9 3.1 2.9 5.2 NM_146040 C80638 -1.51 0.009 13.1 15.2 11.8 3.3 7.8 3.0 NM_178877 6030408C04Rik -1.51 0.021 10.7 17.5 19.2 5.7 3.6 7.3 NM_001015099 Gsta1 -1.51 0.002 6353.7 8704.2 7291.7 2492.1 2737.3 2609.1 NM_008181 Lrrc8b -1.51 0.010 29.9 27.8 32.1 6.6 6.3 18.5 AK054249 Tk1 -1.51 0.034 1713.6 2748.6 3501.7 1219.2 620.0 954.2 NM_009387 Mutyh -1.51 0.009 30.9 20.6 27.3 6.6 8.1 13.1 NM_133250 TC1615264 -1.51 0.007 64.9 96.3 91.4 29.4 22.4 37.2 TC1615264 Fbxo44 -1.50 0.005 10.2 8.8 6.9 2.7 3.6 2.8 NM_173401 Lrdd -1.50 0.017 193.4 159.4 254.1 56.7 50.6 106.9 NM_022654 Tnfrsf10b -1.50 0.049 16.3 21.2 32.8 9.0 3.9 12.0 NM_020275 Rbl1 -1.50 0.046 309.7 341.6 577.8 145.4 79.2 210.7 NM_011249 Dut -1.50 0.005 2870.1 3868.5 3619.6 1068.6 841.8 1759.1 NM_023595 Smpd3 -1.50 0.001 386.1 350.4 342.9 99.4 116.8 166.2 NM_021491 NAP029525-1 -1.50 0.040 16.5 33.5 28.6 9.0 13.9 5.1 NAP029525-1 AU020206 -1.49 0.010 996.9 1495.1 1356.2 543.6 246.1 576.0 AK049415 Aaas -1.48 0.015 645.6 1069.8 1048.7 276.1 287.1 424.5 NM_153416 Hapln1 -1.48 0.003 74.7 66.9 54.4 28.9 20.1 21.2 NM_013500 F730047E07Rik -1.48 0.011 279.0 242.9 348.8 108.4 53.7 150.2 NM_199467 C9 -1.48 0.020 3469.4 3110.8 1915.5 1242.3 828.8 979.0 NM_013485 Pik3c2b -1.48 0.039 6.7 13.8 12.1 5.6 3.1 3.0 XM_001001599 Ccdc99 -1.48 0.042 45.4 37.3 69.7 25.0 7.9 21.9 NM_027411 Casz1 -1.48 0.003 48.0 48.6 52.9 8.9 20.0 24.9 NM_027195 Cdk5rap2 -1.47 0.005 36.1 39.8 43.9 8.6 12.6 22.0 NM_145990 Xrcc2 -1.47 0.008 86.5 97.2 107.2 30.9 18.2 55.9 NM_020570 Slc2a4 -1.47 0.037 44.8 92.4 72.2 33.9 21.1 20.8 NM_009204 Ivl -1.46 0.015 9.2 7.1 12.0 3.1 4.0 3.2 NM_008412 Olfr1378 -1.46 0.013 9.6 10.6 14.0 3.2 3.0 6.2 NM_146910 Myef2 -1.46 0.004 54.9 40.5 49.0 13.2 15.7 23.7 NM_010852 Rad18 -1.44 0.007 432.6 336.0 428.0 139.0 84.3 217.3 NM_021385 Myef2 -1.44 0.003 537.1 735.5 670.3 234.8 201.4 280.1 AK129336 OTTMUSG00000002196 -1.44 0.006 32.8 34.7 29.4 4.9 16.6 14.3 NM_001013823 Cenpa -1.43 0.003 225.7 268.4 255.7 134.3 63.3 80.1 NM_007681 AI323028 -1.43 0.046 154.8 270.6 346.0 91.6 77.7 116.8 AI323028 Slfn10 -1.43 0.028 40.3 65.3 76.4 24.1 15.1 28.4 NM_181542 Slc46a3 -1.43 0.007 9342.5 7850.3 6353.7 3705.1 2224.9 2820.5 NM_027872 Slc22a13 -1.43 0.023 8.3 12.5 7.2 3.7 3.3 3.4 NM_133980 Rhebl1 -1.42 0.003 76.4 70.1 58.4 28.7 16.8 30.9 NM_026967 ENSMUST00000098050 -1.42 0.026 7245.7 4194.0 4788.9 1435.1 2149.0 2467.5 ENSMUST00000098050 Mcm8 -1.42 0.009 104.8 151.1 121.4 47.4 30.1 63.6 NM_025676 Dnmt1 -1.41 0.035 881.1 768.9 1368.9 423.8 223.7 484.7 NM_010066

95 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change Bmyc -1.41 0.042 281.1 191.5 136.4 92.8 61.0 74.7 NM_023326 TC1666890 -1.41 0.006 73.7 59.1 53.1 24.1 29.3 16.4 TC1666890 Mesp2 -1.40 0.009 48.9 52.0 58.2 11.6 16.1 32.5 NM_008589 Nfkbil2 -1.40 0.028 687.9 669.0 1041.7 305.0 159.3 444.2 NM_183091 Ush1c -1.40 0.014 11.4 17.6 13.0 3.5 6.6 5.8 NM_153677 Lbxcor1 -1.40 0.006 5.4 7.6 7.8 2.6 2.7 2.6 NM_172446 1700113H08Rik -1.39 0.022 29.6 49.4 32.3 13.0 13.0 16.4 AK007195 B230120H23Rik -1.39 0.019 19.7 27.3 20.0 9.1 3.7 12.8 NM_178084 BC030440 -1.39 0.001 229.2 205.7 203.0 74.7 65.4 103.5 AK129110 Psmb9 -1.38 0.000 3279.8 3548.1 3748.5 1618.6 1082.9 1349.8 NM_013585 2310022K01Rik -1.38 0.001 716.2 687.0 796.8 233.2 232.8 377.2 AK009476 2700049P18Rik -1.38 0.005 434.8 380.3 530.8 147.7 157.9 210.4 NM_175382 Ela1 -1.38 0.024 94.3 56.3 105.3 36.1 31.1 31.1 NM_033612 Hirip3 -1.38 0.042 862.1 1034.3 1614.1 371.6 352.2 628.0 NM_172746 6720457D02Rik -1.37 0.037 5.4 6.2 10.1 2.8 2.9 2.8 NM_175252 Gmnn -1.37 0.002 8973.8 8031.1 8857.9 3024.5 2425.5 4587.7 NM_020567 Suv39h1 -1.36 0.006 326.4 386.1 447.1 153.2 100.5 197.0 NM_011514 Brca2 -1.36 0.005 117.4 95.6 95.4 33.8 30.0 56.2 NM_009765 Zbtb8os -1.36 0.007 2337.2 1896.9 2041.3 453.2 789.3 1201.8 NM_025970 4933433K01Rik -1.36 0.049 71.1 137.2 156.6 43.5 40.6 58.2 NM_183139 Vrk1 -1.36 0.015 195.9 222.0 307.5 91.3 75.5 116.8 NM_011705 Cdt1 -1.35 0.030 10623.5 8826.0 8128.5 2791.2 1497.6 6554.0 NM_026014 Ttll9 -1.35 0.021 8.9 9.3 14.4 4.1 4.8 3.9 NM_029064 Hmgb3 -1.35 0.033 1864.2 1874.1 3161.9 802.1 893.5 1018.5 NM_008253 Sorcs2 -1.34 0.017 12.9 15.9 18.7 8.5 2.8 7.4 NM_030889 Fancg -1.34 0.007 849.7 1215.6 1080.0 369.4 339.8 532.1 BC050890 Cep78 -1.34 0.018 24.6 18.7 20.2 3.4 8.7 12.9 NM_198019 Tyms -1.34 0.018 3458.0 5439.1 5641.3 1490.5 1805.9 2452.5 NM_021288 AI428936 -1.34 0.002 239.3 255.7 207.0 119.6 78.3 80.0 NM_153577 Dnajc9 -1.33 0.018 1125.7 1229.6 1691.4 481.7 364.0 760.0 NM_134081 Wdr51a -1.33 0.012 202.4 298.4 285.2 89.5 78.9 144.6 NM_027354 Impg2 -1.32 0.002 58.4 52.9 46.6 16.5 26.2 20.5 NM_174876 A930004D18Rik -1.32 0.002 92.0 103.7 116.5 41.4 33.6 50.2 AK044329 Kif11 -1.32 0.002 11.5 13.0 14.0 5.3 3.8 6.3 NM_010615 Timeless -1.31 0.015 714.0 678.8 551.0 253.1 123.8 404.6 NM_011589 Mcm4 -1.31 0.038 8080.7 6397.2 8799.8 2499.8 1174.8 5684.7 NM_008565 2300002D11Rik -1.31 0.017 38.4 25.1 30.3 13.1 7.6 17.1 NM_001081156 NAP029013-1 -1.31 0.007 98.0 75.4 103.2 32.3 29.3 49.8 NAP029013-1 Tyms-ps -1.30 0.015 1406.5 2087.8 2217.5 628.9 693.9 990.7 M30774 9830123M21Rik -1.30 0.004 8.9 6.4 8.3 3.1 3.7 2.9 BC107027 Olfr1402 -1.30 0.028 16.3 13.5 9.3 3.5 5.1 7.2 NM_146275 BC030440 -1.30 0.000 109.0 118.2 103.7 50.8 40.6 42.9 NM_173732 Donson -1.30 0.005 130.6 153.8 128.0 52.0 37.6 77.9 NM_021720 Kif26b -1.29 0.038 127.1 75.6 73.0 32.2 41.7 38.5 NM_177757 Slbp -1.29 0.002 2669.3 3021.4 3157.3 1005.8 1010.3 1592.7 NM_009193 C530036F05Rik -1.29 0.020 69.3 43.0 66.4 17.4 23.6 32.1 AK083039 Brip1 -1.29 0.002 185.8 189.5 196.0 65.5 59.5 108.9 NM_178309 Mthfd1l -1.29 0.010 628.4 858.8 823.6 372.1 180.2 394.8 NM_172308 Pola1 -1.29 0.029 583.5 809.9 996.9 292.3 216.3 471.5 NM_008892 Cmtm2a -1.29 0.007 29.3 39.7 35.6 11.1 12.0 19.8 NM_027022 Mybphl -1.28 0.017 8.5 8.2 5.3 2.6 3.8 2.6 NM_026831 Arhgef16 -1.27 0.009 171.7 139.8 118.3 58.5 74.5 44.6 BC044805 Btg3 -1.26 0.000 1007.8 985.7 1075.3 437.5 456.0 386.8 NM_009770 Zik1 -1.26 0.022 13.5 21.7 23.1 7.6 7.2 9.6 NM_009577 Olfm3 -1.26 0.041 106.1 121.8 63.2 52.0 42.6 27.0 NM_153157 D14Ertd500e -1.26 0.004 6492.1 8088.1 7229.1 2457.3 2529.9 4141.7 NM_145462 C730043O17 -1.26 0.022 8752.8 7734.3 5287.3 3127.8 3924.2 2066.6 AK050399 Siva1 -1.25 0.001 3088.9 3447.1 2952.6 1288.1 1033.1 1666.9 NM_013929 9530053A07Rik -1.25 0.046 9.5 8.6 4.7 2.7 2.7 4.2 NM_176924 Gins1 -1.25 0.035 427.5 425.5 693.4 217.2 159.1 275.3 BC027537 Cilp2 -1.25 0.029 9.2 10.0 5.5 3.2 3.2 4.0 AK004006 BC048355 -1.24 0.028 1476.2 1779.2 2549.1 855.8 640.5 952.9 NM_207161 Nfatc2ip -1.24 0.023 111.6 102.1 161.2 39.1 51.9 67.5 NM_010900 Rfc5 -1.24 0.008 2269.7 3065.5 2335.0 1058.9 816.9 1374.3 NM_028128 Nup43 -1.24 0.027 129.1 84.8 92.0 33.3 32.3 64.1 NM_145706 Scn5a -1.24 0.027 46.0 55.4 31.0 14.9 18.8 22.5 NM_021544 Ttf2 -1.23 0.007 929.8 988.2 1278.7 396.3 411.9 550.3 NM_001013026 Cks1b -1.23 0.020 2879.9 2929.9 2086.3 751.2 899.7 1713.0 NM_016904 Nudt11 -1.23 0.045 4.8 9.8 7.2 3.1 3.1 3.1 NM_021431 1810015A11Rik -1.23 0.003 57.5 43.7 54.9 24.4 19.6 22.5 NM_026940 Zfp131 -1.23 0.002 914.8 778.7 716.7 323.8 393.9 309.9 NM_028245 Alas2 -1.22 0.029 5993.6 3515.6 4456.2 1687.5 1624.5 2672.4 NM_009653 Rfc3 -1.22 0.019 298.6 213.8 215.0 102.5 64.6 145.5 NM_027009 Whsc1 -1.22 0.018 124.7 127.1 161.8 52.2 35.2 90.5 AK050869 Dock6 -1.22 0.018 10.7 11.4 14.4 2.8 7.6 5.4 AK080190 Cchcr1 -1.22 0.019 137.3 211.8 180.9 57.5 64.3 106.3 NM_146248 NAP057037-1 -1.21 0.046 11.8 8.8 5.8 3.4 3.6 4.4 NAP057037-1 Naip2 -1.21 0.004 112.4 133.6 112.0 69.5 39.3 45.7 NM_010872 Hunk -1.21 0.009 449.5 565.9 436.5 201.8 141.0 283.6 NM_015755 E130016E03Rik -1.21 0.022 64.4 42.3 62.6 19.4 18.9 34.9 NM_001039556 Ube2s -1.21 0.016 5175.0 6978.2 8473.0 2905.0 2746.9 3279.8 AK003078 ENSMUST00000046903 -1.21 0.002 9.6 8.3 7.8 2.9 3.7 4.5 ENSMUST00000046903 Pold1 -1.20 0.011 1806.2 1750.1 1713.6 670.9 432.6 1183.2 NM_011131 Nup43 -1.20 0.007 53.9 38.2 44.4 20.4 15.5 23.5 AK011422 AK048577 -1.20 0.038 8.3 5.8 4.4 2.6 2.7 2.7 AK048577 Mdm1 -1.20 0.003 21.6 24.8 26.0 7.3 11.7 12.4 NM_010785 Centb1 -1.20 0.006 32.4 40.7 29.1 16.2 15.1 13.2 AK133473 Tle3 -1.20 0.009 109.5 125.7 96.4 35.8 40.3 68.4 NM_001083927 Mfap2 -1.19 0.006 21.0 23.3 25.4 9.5 14.0 7.0 NM_008546

96 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change Mtbp -1.19 0.007 303.3 244.3 294.5 110.4 87.9 171.1 NM_134092 Zranb3 -1.19 0.004 50.5 54.1 66.7 25.3 21.2 28.6 NM_027678 Lama3 -1.18 0.018 17.7 14.0 19.8 10.7 4.4 7.6 XM_140451 Brca1 -1.18 0.016 199.2 134.3 174.9 73.0 50.9 100.1 NM_009764 Whsc1 -1.18 0.014 193.1 205.4 275.5 81.9 84.1 131.5 NM_001081102 Wdr62 -1.18 0.012 94.7 86.4 128.3 45.8 39.0 51.9 BC054747 Heatr5b -1.17 0.018 46.1 75.4 70.6 25.7 31.9 27.5 AK090188 Lsm11 -1.17 0.009 141.5 109.2 151.7 47.2 55.1 76.4 NM_028185 4932415G12Rik -1.17 0.001 10.5 9.2 9.5 3.5 4.7 4.9 BC067070 9130409I23Rik -1.17 0.034 54.2 34.6 34.0 12.9 21.7 20.0 NM_001033819 Ercc6l -1.17 0.023 10.9 7.5 8.9 3.1 3.0 6.1 NM_146235 AW455994 -1.17 0.018 20.7 22.2 13.5 8.0 8.2 8.9 AW455994 A_52_P641123 -1.16 0.046 7.6 10.5 5.4 2.9 3.7 3.8 A_52_P641123 Calml4 -1.16 0.005 380.5 440.1 486.2 213.6 137.2 233.8 NM_138304 Ccdc15 -1.16 0.021 89.2 111.0 125.5 37.5 35.5 73.0 NM_001081429 Foxo3a -1.16 0.007 22.8 23.1 19.5 5.8 12.6 10.9 NM_019740 Rpa1 -1.16 0.008 2330.8 3041.0 3055.9 1056.0 1069.4 1654.5 NM_026653 Hkdc1 -1.16 0.041 52.1 61.4 32.1 17.5 25.8 22.0 NM_145419 AW108044 -1.15 0.040 72.3 43.5 44.6 24.1 19.2 28.8 AW108044 Map3k12 -1.15 0.009 9.4 7.2 6.5 3.1 3.7 3.6 U09541 Lypd5 -1.15 0.000 6.5 6.1 6.9 2.8 3.2 2.8 AK008654 Nkpd1 -1.15 0.038 15.7 20.1 24.6 5.3 13.9 8.0 AK009357 LOC672434 -1.15 0.010 898.8 665.2 987.8 327.9 388.7 433.2 XR_003860 6330503C03Rik -1.15 0.000 8.3 7.9 8.9 4.3 3.3 3.8 NM_029528 C330046G03Rik -1.14 0.050 6.8 9.9 5.1 3.1 3.6 3.1 NM_145855 Cul7 -1.14 0.007 6.8 7.0 5.0 2.8 2.8 2.9 AK082134 Ccdc5 -1.14 0.009 2766.0 3235.3 3809.7 1333.7 1194.4 1922.9 NM_146089 Tmem71 -1.14 0.037 12.5 8.1 7.8 3.0 4.4 5.5 NM_172514 Cdc25b -1.14 0.004 97.6 116.1 113.0 42.4 40.1 65.8 NM_023117 TC1652077 -1.14 0.004 2369.2 3044.8 2797.3 1227.7 978.0 1527.1 TC1652077 AK038464 -1.14 0.027 104.3 94.2 59.4 39.4 36.9 41.1 AK038464 Olfr708 -1.14 0.037 8.5 8.3 4.9 2.7 4.4 2.8 NM_001011542 Cep192 -1.13 0.016 113.8 102.7 92.3 28.2 41.5 71.0 BC064462 Golph2 -1.13 0.004 750.3 946.2 1007.1 451.7 381.8 399.8 NM_027307 B230359F08Rik -1.13 0.012 7.3 5.3 8.0 3.6 2.9 2.8 AK046242 Skp2 -1.13 0.008 74.8 84.3 92.0 36.2 25.9 52.5 AF083215 Mcph1 -1.13 0.021 77.0 55.4 64.0 19.6 25.9 44.2 NM_173189 2410089E03Rik -1.13 0.010 113.6 125.0 83.8 49.0 53.6 45.1 BC058107 NAP045236-1 -1.13 0.005 7.3 5.3 6.5 3.0 2.9 2.9 NAP045236-1 Msh6 -1.12 0.018 4507.8 3650.8 3575.0 1525.6 1169.9 2691.3 NM_010830 Hat1 -1.12 0.013 1076.4 1200.3 1496.6 542.6 429.8 762.0 NM_026115 Slfn9 -1.12 0.042 4.3 7.2 8.5 3.1 3.1 3.1 NM_172796 NAP102507-1 -1.12 0.045 60432.8 42693.6 32214.0 17386.1 21567.9 23410.7 NAP102507-1 Pms2 -1.12 0.003 138.9 128.2 122.3 50.8 48.5 80.1 NM_008886 Mthfs -1.12 0.011 5.7 8.4 6.4 3.3 3.0 3.2 AK081946 Exod1 -1.12 0.020 109.8 87.9 143.1 45.8 54.6 56.9 NM_027698 Ncapd3 -1.11 0.002 280.3 298.2 267.6 126.7 101.7 162.3 NM_178113 Recql4 -1.11 0.008 150.8 190.1 203.7 89.0 60.5 102.3 NM_058214 1700040I03Rik -1.11 0.001 629.1 709.8 646.9 260.1 304.7 356.6 NM_028505 Cep76 -1.11 0.008 33.9 44.6 42.4 13.4 19.1 23.7 NM_001081073 H2afz -1.10 0.020 12249.2 20173.2 16497.0 7213.1 7041.1 8504.8 NM_016750 Cep290 -1.10 0.017 15.9 15.6 15.0 3.6 7.3 10.8 AK172940 Ccdc14 -1.10 0.015 13.3 14.6 19.8 6.6 7.0 8.6 BC031204 Sass6 -1.10 0.001 55.6 53.3 55.3 21.7 22.3 32.8 NM_028349 Etv2 -1.09 0.003 8.6 7.4 9.4 3.4 3.9 4.6 NM_007959 Mrgpra3 -1.09 0.028 5.2 9.2 7.3 3.4 3.2 3.6 NM_153067 Pkn3 -1.09 0.010 28.1 19.2 22.6 9.8 11.8 11.2 NM_153805 Fxyd6 -1.09 0.014 81.9 60.0 80.5 38.2 23.0 43.7 NM_022004 Olfr1384 -1.08 0.009 33.8 28.9 23.5 11.0 14.8 14.8 NM_146472 Ppp1r14a -1.08 0.031 817.1 577.3 619.0 269.6 209.0 471.2 NM_026731 Polh -1.08 0.010 275.3 375.7 290.6 129.2 129.7 185.3 BC049159 9530039L23Rik -1.08 0.015 42.7 31.9 28.6 15.1 19.0 14.7 AK020592 Anapc1 -1.08 0.001 6.2 6.4 7.5 2.9 3.6 3.0 AK053383 Lsm8 -1.08 0.010 1829.4 2283.1 2254.8 862.1 759.1 1392.9 NM_133939 NAP123523-1 -1.08 0.022 17.3 14.7 14.8 3.2 9.6 9.4 NAP123523-1 Reep4 -1.08 0.025 276.6 343.0 456.0 181.5 146.5 182.0 NM_180588 9230114K14Rik -1.08 0.013 137.2 187.5 144.2 57.3 71.1 94.1 AK136375 6530411M01Rik -1.08 0.024 9.2 12.4 8.6 3.7 6.6 4.0 AK035915 4922503N01Rik -1.07 0.044 431.5 665.9 417.6 297.8 155.7 265.8 NM_153392 Ela1 -1.07 0.037 54.3 34.8 57.9 31.6 17.5 20.7 AK007931 Ccdc46 -1.07 0.019 11.0 13.5 9.4 3.5 5.7 6.9 NM_029586 1500016O10Rik -1.07 0.033 11.0 18.8 15.0 5.6 8.9 6.8 BC093505 2610039C10Rik -1.07 0.010 176.0 158.6 157.3 76.1 48.8 109.8 NM_025642 4933404O12Rik -1.07 0.040 19.6 30.9 18.5 10.6 10.6 11.8 AK169739 Ube2s -1.07 0.031 3575.0 4968.9 6326.4 2411.6 2344.3 2350.6 NM_133777 H2-Q8 -1.06 0.001 2732.5 2549.9 2312.4 1394.8 1038.2 1197.9 NM_023124 6530402F18Rik -1.06 0.011 13.6 20.0 17.4 8.1 6.9 9.4 AK220426 Hist1h1a -1.06 0.003 40.0 45.9 50.3 18.0 21.5 25.6 NM_030609 Itgb2l -1.06 0.040 6.3 6.2 10.0 4.2 3.3 3.3 NM_008405 Tipin -1.06 0.011 3261.5 2693.8 3393.2 1191.5 1223.6 2073.0 NM_025372 Rnf32 -1.06 0.035 11.3 18.9 15.4 8.1 4.9 8.9 NM_021470 Gabrd -1.06 0.003 18.2 20.1 16.7 11.0 8.3 7.1 NM_008072 1500010J02Rik -1.05 0.007 880.5 1014.3 968.7 428.1 329.3 624.4 NM_026889 1110034A24Rik -1.05 0.012 892.6 758.1 909.3 331.0 316.5 590.1 ENSMUST00000021356 Gins1 -1.04 0.017 1097.5 1198.7 1597.5 702.7 476.7 711.0 AK013116 E2f2 -1.04 0.025 1150.9 1251.1 1750.1 597.3 581.9 837.5 NM_177733 Lonrf3 -1.04 0.013 217.6 326.8 307.6 144.4 125.9 143.7 NM_028894 Kif15 -1.04 0.003 7.5 8.2 9.1 4.1 3.2 4.7 NM_010620 Ankrd32 -1.04 0.023 54.3 45.1 62.6 22.0 19.2 37.8 BC009101

97 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change Ptpru -1.04 0.036 9.7 15.8 12.9 8.5 4.5 5.7 NM_011214 1110001A07Rik -1.04 0.040 19.5 13.3 20.5 12.3 5.1 8.6 NM_025377 D030056L22Rik -1.04 0.009 1138.8 1477.3 1488.2 631.2 528.4 842.9 NM_177640 1110034A24Rik -1.04 0.008 644.4 623.5 795.9 328.2 255.6 423.2 NM_027269 EG629689 -1.03 0.022 14.3 15.7 11.7 3.8 7.6 9.1 XM_894604 AK039524 -1.03 0.034 34.3 46.5 32.6 13.9 14.5 27.1 AK039524 AK033738 -1.03 0.004 5495.5 5080.8 4145.6 2601.5 2162.3 2455.5 AK033738 1700011L22Rik -1.03 0.017 8.6 8.5 9.5 3.4 6.5 3.1 AK005876 2310047C04Rik -1.03 0.015 34.5 36.3 24.8 12.9 15.1 19.0 AK122344 2310005C01Rik -1.03 0.024 14.3 16.3 13.0 3.9 10.3 7.2 AK009163 Olfr114 -1.02 0.003 880.9 1059.9 1145.7 537.1 458.8 522.6 NM_146287 4930449E01Rik -1.02 0.007 13.5 18.1 16.9 8.2 6.5 9.3 AK015429 AW212856 -1.02 0.001 22.8 25.9 26.0 11.7 11.3 13.9 AW212856 Arsk -1.01 0.007 69.9 51.3 60.1 31.9 32.7 25.2 NM_029847 Lsm2 -1.01 0.019 234.9 260.5 346.5 125.8 122.6 168.9 NM_030597 Nup133 -1.01 0.013 2573.2 2457.3 3398.9 1423.0 1121.7 1641.2 NM_172288 BC003267 -1.01 0.002 143.8 135.2 117.6 64.7 58.8 73.4 NM_145591 9030607L20Rik -1.01 0.027 15.3 15.1 12.3 7.5 3.6 10.1 AK018542 3300001G02Rik -1.01 0.009 1592.7 2240.3 1865.1 975.3 814.3 1047.3 NM_030093 Crxos1 -1.01 0.014 22.8 21.8 15.6 11.0 10.7 8.3 NM_001033638 B230120H23Rik -1.00 0.011 306.3 320.0 418.9 161.7 152.6 207.2 NM_023057 Amd2 -1.00 0.002 2205.9 1873.3 2349.6 1043.0 1003.0 1165.6 NM_007444 Tek 1.01 0.037 6.3 6.7 9.9 19.8 13.5 12.8 AK053336 Zfp454 1.01 0.006 4.8 6.3 5.3 12.1 11.7 9.1 NM_172794 AK038199 1.01 0.012 4.1 3.5 3.5 6.6 6.6 9.0 AK038199 Defcr3 1.01 0.038 61.4 89.4 83.8 182.7 180.5 108.6 NM_007850 Zfp69 1.01 0.001 75.5 97.5 71.9 153.5 167.0 172.2 NM_001005788 0610042G04Rik 1.01 0.003 46.4 35.5 52.3 84.0 86.5 100.0 AK002909 Plagl1 1.01 0.003 24.3 21.4 34.4 53.0 51.3 57.5 BC065150 Chd6 1.01 0.003 15.8 14.0 10.6 30.2 26.2 25.2 BC059807 Pla2g4b 1.01 0.034 12.1 4.9 5.1 14.9 15.1 14.7 BC098210 Lnx1 1.02 0.027 125.3 110.6 123.8 277.3 171.5 279.6 NM_010727 Cd1d2 1.02 0.006 212.3 197.6 222.8 426.6 497.3 357.7 NM_007640 6430571L13Rik 1.02 0.005 12.8 6.8 10.6 19.9 21.6 19.9 NM_175486 Narg2 1.02 0.019 5.9 5.8 2.9 11.4 8.5 9.5 AK046121 Rtp3 1.02 0.020 177.9 212.7 108.1 304.6 405.1 301.7 NM_153100 1700018M17Rik 1.02 0.022 5.6 7.1 3.4 11.3 12.5 8.9 AK006094 Ints8 1.02 0.018 6.4 5.8 3.7 9.2 13.0 10.0 AK047035 Krba1 1.02 0.004 8.2 5.0 7.0 13.8 14.9 12.5 AK029235 DV075475 1.02 0.011 20.8 10.7 19.7 30.1 37.1 36.8 DV075475 Rint1 1.03 0.026 12.0 13.7 12.1 32.7 24.4 19.9 AK005284 Gcc1 1.03 0.004 99.2 104.0 96.8 197.2 237.4 177.4 NM_028900 1700012H05Rik 1.03 0.028 9.8 6.0 11.5 23.3 16.5 16.2 NM_029660 Mgl2 1.03 0.014 4.6 9.5 5.3 14.0 13.5 12.3 NM_145137 Tmie 1.03 0.027 157.6 168.2 86.2 217.3 295.4 329.8 NM_146260 Cyp1b1 1.03 0.047 10.4 5.1 3.9 13.0 15.6 11.1 NM_009994 BC020092 1.03 0.036 6.5 5.5 3.2 7.7 11.3 12.3 BC020092 Bcl9 1.04 0.016 17.5 9.7 20.6 37.9 32.0 28.7 AK133757 Tmem88 1.05 0.012 190.4 169.9 179.9 392.1 288.5 434.6 NM_025915 BC023892 1.05 0.011 209.9 339.6 416.0 758.3 606.2 629.5 XM_135029 Ssr1 1.05 0.019 62.6 40.4 29.8 91.9 104.9 77.5 AK078039 AK051199 1.05 0.017 22.5 9.3 19.4 38.2 30.6 37.3 AK051199 Lrp1 1.05 0.012 50.9 35.4 35.6 68.5 86.9 97.5 AK078273 9030409G11Rik 1.06 0.011 22.3 17.5 25.0 48.4 50.8 35.5 AK052809 BC037121 1.06 0.008 235.8 314.0 170.0 549.5 505.1 441.5 BC037121 Copg2as2 1.06 0.019 13.0 8.2 7.8 16.0 23.3 21.3 AF217545 Aytl1 1.06 0.026 24.9 27.3 33.6 69.9 42.5 66.0 NM_173014 Ugt1a1 1.06 0.022 597.5 625.6 914.8 1116.9 1698.1 1647.9 NM_201645 Tnfaip2 1.06 0.006 313.2 411.8 493.9 940.0 883.7 721.1 NM_009396 Cpeb4 1.06 0.024 17.9 7.9 13.9 27.3 32.7 22.9 NM_026252 Dscr1l1 1.06 0.010 125.6 253.1 259.6 398.9 445.0 489.2 NM_207649 Msi2 1.06 0.041 3.8 4.7 4.5 7.0 8.1 12.2 AK031365 Ar 1.06 0.007 19.5 38.4 37.6 65.5 71.6 62.7 NM_013476 2210010C17Rik 1.07 0.031 116.7 125.8 291.1 391.8 392.7 333.5 NM_027308 Il11 1.07 0.011 5.1 4.3 8.9 13.5 12.7 12.2 NM_008350 AK046811 1.07 0.026 3.4 7.3 3.5 10.7 10.8 8.3 AK046811 Ltb4r1 1.07 0.041 46.2 43.5 58.2 137.4 96.2 77.4 NM_008519 TC1639158 1.07 0.046 9.3 3.0 3.7 11.1 11.9 10.6 TC1639158 TC1659636 1.07 0.009 57.6 111.2 75.5 152.1 190.0 172.1 TC1659636 EG329070 1.08 0.016 7.4 3.7 3.4 10.6 10.5 9.5 NM_177833 Slc25a2 1.08 0.011 3.9 4.0 3.1 9.5 6.8 6.9 AK077159 AK042199 1.08 0.042 7.8 7.0 2.9 15.6 11.2 10.4 AK042199 Col20a1 1.08 0.006 12.5 9.5 14.6 29.4 22.3 25.6 BC030415 Adrb2 1.09 0.005 14.8 14.1 15.5 36.7 26.8 30.6 NM_007420 Klhdc2 1.09 0.014 15.3 9.9 10.1 27.1 28.2 19.7 AK078408 Elmo1 1.09 0.043 4.7 3.8 5.5 9.5 13.0 7.1 NM_198093 TC1605825 1.09 0.049 4.9 9.3 10.8 22.7 12.8 17.8 TC1605825 Rasl11a 1.09 0.008 10.3 7.3 12.5 18.3 24.2 21.4 NM_026864 Stra6 1.09 0.031 133.9 168.4 91.0 359.0 236.0 244.8 NM_009291 Abl2 1.10 0.003 5.0 5.5 3.2 9.5 10.6 9.2 U40827 DV053137 1.10 0.039 13.2 9.9 11.3 31.5 16.9 25.3 DV053137 Ctse 1.10 0.006 149.8 321.2 267.7 532.3 543.9 505.7 NM_007799 Spic 1.10 0.006 33.6 33.4 42.1 80.1 89.8 64.2 NM_011461 Crsp3 1.10 0.008 3.8 3.3 4.6 6.7 9.4 9.1 AK028545 Uqcrq 1.10 0.013 9.4 4.3 4.9 13.9 13.5 12.6 AK017907 8430406H22Rik 1.10 0.004 8.2 6.1 4.9 12.5 15.0 13.7 AK018386 NAP036221-1 1.10 0.030 4.2 2.9 8.9 11.6 11.7 11.0 NAP036221-1 Pde8b 1.11 0.003 4.4 4.5 2.7 9.1 7.7 8.1 NM_172263 Foxf1a 1.11 0.030 2.8 2.8 2.8 4.7 7.9 5.4 NM_010426

98 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change Npal1 1.11 0.021 207.3 295.0 445.9 823.4 630.3 595.7 NM_001081205 Il7r 1.12 0.027 4.2 2.9 3.1 9.4 5.6 7.1 NM_008372 TC1650039 1.12 0.009 2.9 3.1 3.0 7.4 7.1 5.0 TC1650039 Fn1 1.13 0.025 220.1 106.0 151.1 264.5 372.6 408.6 BC010335 Cdcp1 1.13 0.025 41.7 18.1 18.2 50.5 55.9 64.7 BC039753 Irg1 1.13 0.017 12.7 6.6 5.2 16.8 19.7 17.3 L38281 Zfp516 1.14 0.035 3.2 8.4 9.8 16.0 18.8 12.3 NM_183033 Tcstv1 1.14 0.022 5.9 5.1 9.4 12.8 13.5 18.7 NM_018756 Gyk 1.14 0.024 34.2 25.2 18.7 66.2 42.3 63.6 AK037633 9130206I24Rik 1.15 0.030 3.0 4.5 3.1 9.9 7.8 5.7 AK048089 AK037854 1.15 0.016 7.7 4.5 2.8 10.5 12.1 10.7 AK037854 Clpx 1.15 0.013 8.4 4.4 5.2 15.4 13.4 11.1 AK163034 NAP037603-1 1.16 0.027 4.5 2.8 2.9 5.5 8.3 9.1 NAP037603-1 AW125753 1.16 0.001 23.1 29.5 28.7 55.4 64.1 62.5 NM_029007 Itpr2 1.16 0.003 19.2 25.9 21.0 55.7 43.3 48.9 AK046210 TC1631866 1.16 0.026 3.3 2.9 3.4 5.9 6.2 9.5 TC1631866 AA874392 1.16 0.006 10.2 15.8 11.6 28.5 23.7 31.9 AA874392 Gab3 1.17 0.003 3.4 3.2 3.9 7.9 6.8 9.0 NM_181584 Nedd4l 1.17 0.023 17.1 10.8 9.7 23.7 35.7 25.3 AK122283 Tsix 1.17 0.012 3.9 8.7 10.2 15.2 19.1 17.2 AF138745 NAP038329-1 1.18 0.014 26.5 22.2 17.4 57.3 37.5 54.3 NAP038329-1 D330050I23Rik 1.18 0.039 211.6 701.5 506.8 1349.2 933.1 939.0 DV071613 Sell 1.18 0.034 12.0 10.4 11.4 30.2 16.6 30.1 NM_011346 AK041853 1.19 0.007 3.8 3.0 4.4 6.8 9.4 9.2 AK041853 BB051811 1.19 0.028 5.3 3.1 4.9 12.5 7.2 10.7 BB051811 AK086528 1.20 0.050 48.2 50.4 23.4 122.4 92.9 64.3 AK086528 Fyco1 1.20 0.001 13.1 17.7 15.4 31.9 35.1 38.9 AK013060 Tbc1d23 1.20 0.015 93.7 43.2 70.3 171.4 178.2 126.3 NM_026254 Ahdc1 1.20 0.001 56.2 56.1 43.2 108.0 116.5 133.4 AK134372 EG628916 1.20 0.004 17.5 15.9 9.5 32.4 36.3 30.0 XR_002713 Vsig2 1.21 0.026 14.9 12.2 11.2 34.7 33.4 20.1 NM_020518 TC1650817 1.21 0.002 17.6 18.2 16.8 35.8 46.8 38.8 TC1650817 Pla2g7 1.21 0.003 38.3 31.8 47.2 78.1 93.4 99.4 NM_013737 Lass6 1.21 0.026 16.2 25.1 16.0 40.7 57.1 34.9 NM_172856 1700010B13Rik 1.21 0.005 4.9 5.8 2.8 11.5 10.0 9.7 AK133430 BC030396 1.22 0.005 13.6 10.2 10.9 23.3 31.8 25.6 NM_173862 NAP028872-1 1.22 0.003 109.9 104.0 83.2 235.8 194.2 260.1 NAP028872-1 Chka 1.22 0.033 179.2 119.9 131.1 266.6 447.0 288.5 NM_013490 Arhgap6 1.22 0.017 116.1 186.7 124.8 414.3 311.0 271.9 NM_009707 Pde4b 1.22 0.003 25.6 29.4 17.7 49.0 59.3 61.5 AK171700 Prlr 1.23 0.002 222.6 196.1 155.9 393.4 472.3 478.3 BC096586 Prlr 1.23 0.002 84.4 68.1 62.1 191.7 160.4 150.2 AK083198 NAP101442-1 1.23 0.018 10.3 7.5 4.0 19.7 13.9 17.3 NAP101442-1 AK050242 1.23 0.002 4.9 6.9 4.0 13.3 11.6 12.0 AK050242 4632417D23Rik 1.23 0.031 2.9 4.2 3.0 7.7 10.2 5.6 NM_172934 Retnla 1.23 0.035 5.2 10.7 23.3 33.5 28.4 30.0 NM_020509 4930523C07Rik 1.23 0.047 2.9 7.0 6.5 16.8 9.0 12.8 AK040601 Pbx1 1.23 0.024 7.3 3.7 6.4 12.0 17.4 11.3 NM_008783 AI790298 1.23 0.048 12.5 6.2 8.1 28.3 15.5 19.0 BC023699 Mcam 1.23 0.000 51.4 41.4 37.2 100.8 103.5 100.9 NM_023061 Ndrg1 1.23 0.000 723.8 603.3 719.9 1551.8 1683.7 1576.4 NM_008681 AK081302 1.23 0.049 3.0 3.1 7.6 11.3 13.2 7.7 AK081302 E130014J05Rik 1.23 0.031 3.0 3.4 5.0 11.7 8.5 6.7 NM_001040400 2610036A22Rik 1.24 0.011 74.3 67.5 61.6 166.2 121.7 191.5 AK011687 BC033430 1.24 0.014 27.5 11.8 12.8 41.8 36.4 45.0 BC033430 ENSMUST00000065458 1.24 0.001 5.3 5.9 7.8 15.8 15.5 13.6 ENSMUST00000065458 Gm440 1.25 0.004 3.4 5.4 3.6 10.5 8.4 10.5 NM_198620 Nfkb1 1.25 0.003 17.7 12.2 16.2 41.5 36.7 31.4 BC050841 9030025P20Rik 1.25 0.003 42.3 32.5 22.7 83.9 78.8 69.9 AK089867 Pcsk7 1.25 0.009 130.1 132.8 112.6 347.6 318.8 228.9 U48830 Sparcl1 1.25 0.003 134.6 121.8 133.5 332.7 341.7 255.9 NM_010097 Igh-VJ558 1.26 0.049 23.7 15.2 11.5 46.8 25.1 48.4 U39781 NAP102495-1 1.26 0.010 130.7 99.0 86.3 279.3 194.4 281.7 NAP102495-1 Tgm3 1.26 0.025 3.1 3.2 4.0 5.9 8.3 10.5 NM_009374 Lpin2 1.26 0.006 5.9 7.0 3.1 14.3 12.2 11.8 AK085538 Cxcl11 1.26 0.007 24.6 17.6 19.2 40.2 57.9 49.4 NM_019494 OTTMUSG00000015946 1.27 0.032 3.7 7.1 2.9 8.1 11.4 13.3 AK039958 A430033K04Rik 1.28 0.030 12.2 10.2 5.7 24.0 16.0 28.0 NM_183025 Arrdc4 1.28 0.008 106.0 186.4 125.5 359.3 378.0 274.8 NM_001042592 D130095D21Rik 1.29 0.039 3.4 4.7 7.3 15.3 8.3 14.0 AK084110 1810046K07Rik 1.29 0.014 25.0 7.4 22.3 42.5 51.1 40.5 AK007796 4921531C22Rik 1.29 0.002 21.9 17.2 11.7 42.1 44.7 37.6 AK076601 Prlr 1.30 0.001 730.0 682.3 898.4 2087.8 1694.4 1898.9 NM_011169 D14Ertd581e 1.30 0.013 11.0 5.6 5.2 17.1 15.6 21.1 AK045133 Mefv 1.30 0.004 41.5 29.5 36.7 97.0 96.5 72.6 NM_019453 2610044O15Rik 1.31 0.004 15.0 18.9 14.7 46.3 33.3 40.8 NM_153780 Agxt2l2 1.32 0.013 5.8 10.0 10.9 27.6 19.4 19.8 AK085984 Tmeff2 1.33 0.023 4.1 5.1 6.2 13.9 8.9 15.9 NM_019790 AK051168 1.33 0.042 9.5 11.6 10.7 27.4 35.5 16.9 AK051168 D930028F11Rik 1.33 0.022 3.2 3.3 5.6 7.7 12.7 9.8 NM_172921 AK034355 1.33 0.039 10.6 5.2 7.1 17.6 14.0 25.7 AK034355 Hmgn3 1.33 0.002 16.0 11.5 7.7 29.6 27.8 31.3 NM_175074 Aprt 1.33 0.007 4.0 2.7 2.8 6.4 8.3 9.2 M11310 AK136384 1.33 0.020 8.5 3.1 3.2 11.4 11.6 14.4 AK136384 Cap1 1.33 0.004 268.6 222.9 310.3 647.0 795.0 578.0 NM_007598 Pard3 1.34 0.003 25.9 20.1 27.9 64.9 51.6 69.8 NM_033620 Trpm1 1.34 0.012 3.0 3.0 3.3 8.0 9.6 5.9 AK076406 Arid3a 1.34 0.038 43.9 33.9 44.6 70.3 100.3 140.1 NM_007880 Notch3 1.34 0.019 18.2 30.9 18.2 70.2 42.7 58.1 NM_008716

99 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change Snord22 1.35 0.047 12.2 2.8 3.3 17.3 16.4 12.9 AK051045 AK040896 1.36 0.041 1648.8 3590.0 1721.6 6694.0 7323.4 3903.4 AK040896 NAP056404-1 1.37 0.013 42.1 16.0 16.2 58.4 63.6 69.5 NAP056404-1 Acpp 1.37 0.013 2.9 3.7 5.3 11.4 11.5 7.7 NM_019807 P2ry12 1.37 0.005 3.7 5.8 3.4 12.8 10.9 9.5 NM_027571 9530076L18 1.38 0.007 10.4 9.5 5.9 18.0 23.1 25.8 AK035610 MGC7817 1.38 0.016 10.4 3.7 4.9 16.7 13.9 19.0 BC006653 Tbc1d9 1.38 0.042 4.0 2.7 2.8 6.0 11.6 7.4 AK134614 AK079313 1.38 0.011 3.8 7.4 6.5 12.3 15.1 18.6 AK079313 St3gal6 1.38 0.005 95.3 130.9 152.7 264.0 358.0 364.0 NM_018784 Pira1 1.38 0.000 5.0 7.8 7.2 16.8 16.7 18.5 NM_011087 AK036777 1.38 0.029 3.0 9.0 3.3 14.2 15.4 10.4 AK036777 Ace2 1.38 0.021 9.0 2.7 7.5 20.1 13.0 17.1 NM_027286 AK045942 1.39 0.000 30.7 22.9 27.7 67.0 74.9 70.4 AK045942 Ipo7 1.39 0.011 4.7 4.3 5.4 15.8 11.9 9.9 AK048477 Oaz3 1.39 0.013 2.8 2.8 6.4 9.0 10.2 12.1 NM_016901 Tgds 1.39 0.015 614.2 279.0 239.3 899.2 1171.0 904.9 NM_029578 Fmo2 1.39 0.037 25.9 41.9 40.1 113.0 112.6 57.8 NM_018881 AK037870 1.40 0.021 9.4 4.6 3.3 17.4 11.7 16.6 AK037870 BB128963 1.40 0.000 3.3 3.8 3.1 8.9 8.9 9.3 AK088715 C330006P03Rik 1.40 0.016 11.7 24.5 13.8 34.5 53.3 44.0 AK049142 Synj2bp 1.41 0.030 6.4 2.9 2.8 9.8 8.3 13.7 AY071903 Lbx1 1.41 0.044 6.1 6.1 2.8 13.7 8.5 17.6 X90829 Hist1h1e 1.42 0.021 3.5 6.2 2.9 14.1 10.9 8.6 BC032927 Ighv1-77 1.42 0.006 3.2 3.8 5.8 10.7 10.1 13.5 XM_138377 Gspt2 1.42 0.026 6.5 7.9 3.2 12.5 14.0 20.7 NM_008179 AI528035 1.42 0.032 11.0 9.3 16.8 41.7 21.6 36.0 AI528035 BQ944386 1.43 0.036 36.8 36.1 16.2 107.2 56.7 75.9 BQ944386 AK031960 1.43 0.005 8.2 3.8 6.6 14.3 16.8 19.2 AK031960 Nucb2 1.44 0.022 404.5 511.6 391.8 1165.6 1535.5 843.1 NM_016773 AK079436 1.44 0.007 4.2 3.0 2.7 8.9 10.7 7.1 AK079436 NAP107273-1 1.45 0.027 18.5 11.4 9.8 38.0 24.6 45.3 NAP107273-1 Bnip1 1.45 0.009 6.5 3.0 3.0 13.2 10.2 10.6 AK170908 Atp10d 1.46 0.017 77.2 57.1 66.6 236.6 134.9 180.7 NM_153389 Cyp2c38 1.46 0.004 52.3 136.3 151.3 307.1 295.1 333.9 NM_010002 Vgll4 1.47 0.012 11.2 8.9 4.4 17.8 23.1 26.9 NM_177683 Fmo4 1.47 0.039 45.2 45.3 42.7 161.0 135.2 73.3 NM_144878 Sh2d4a 1.49 0.012 14.6 23.0 14.0 61.4 42.8 41.1 AK008803 Cxcl13 1.50 0.015 32.1 91.9 35.4 122.6 160.9 166.6 NM_018866 TC1682954 1.50 0.004 58.2 32.1 23.8 111.3 96.4 115.0 TC1682954 AK082375 1.50 0.040 4.7 3.0 2.9 13.8 9.5 6.7 AK082375 Cyp17a1 1.50 0.016 457.0 1604.7 1761.6 4172.0 3840.4 2809.2 NM_007809 Clec2d 1.51 0.001 489.2 575.1 752.0 1548.8 1688.7 1942.4 NM_053109 Col4a5 1.51 0.003 2.9 2.8 3.0 9.4 6.6 8.9 NM_007736 TC1643908 1.52 0.030 8.5 3.7 5.3 13.1 14.4 22.8 TC1643908 A930010G16Rik 1.53 0.005 2.9 3.0 2.9 9.9 6.7 8.7 AK020843 ENSMUST00000103743 1.53 0.021 24.9 25.6 22.6 77.9 46.2 86.7 ENSMUST00000103743 Trim35 1.54 0.002 3.5 3.5 3.3 9.6 11.9 8.6 AK020775 AK080016 1.54 0.000 15.6 10.2 12.2 36.8 39.7 34.4 AK080016 AK051921 1.55 0.000 6.3 6.2 6.7 20.5 17.6 18.1 AK051921 1700008P20Rik 1.55 0.020 24.2 14.6 36.7 59.7 65.3 96.1 AK005787 Dixdc1 1.55 0.014 55.2 47.1 50.1 125.5 125.1 196.1 NM_178118 Etl4 1.55 0.042 2.9 2.9 3.0 6.0 12.3 7.3 BC050016 4432416J03Rik 1.56 0.002 179.5 210.3 234.5 708.5 610.8 524.0 NM_030069 A_51_P383950 1.56 0.013 3.4 3.5 3.4 11.8 6.9 11.4 A_51_P383950 A530041M06Rik 1.56 0.036 7.6 4.0 6.2 23.0 10.8 18.8 AK040901 5830428H23Rik 1.57 0.042 9.9 5.9 4.7 27.7 12.8 20.5 AK164548 D630002G06Rik 1.59 0.039 16.7 79.4 43.5 100.0 185.8 134.4 NM_172776 Cox7c 1.60 0.000 3124.7 3270.0 1871.7 8255.8 8440.3 8288.1 NM_007749 6330509M05Rik 1.62 0.011 3.1 13.2 15.9 38.0 27.3 33.4 AK031957 Mtap4 1.62 0.013 2.9 3.0 2.9 11.9 7.3 8.0 AK019079 Chka 1.63 0.014 6.4 4.8 4.1 11.4 20.0 16.2 NM_001025566 Extl1 1.65 0.002 69.3 61.8 39.3 169.7 207.2 157.1 NM_019578 TC1646920 1.65 0.043 3.4 2.8 2.9 13.8 6.2 8.8 TC1646920 Rexo2 1.66 0.020 7.4 8.7 3.2 26.4 19.0 15.3 AK090202 Slc30a10 1.66 0.019 159.1 162.3 146.5 373.0 667.8 440.6 NM_001033286 Gata3 1.67 0.031 3.1 12.5 3.2 17.1 25.4 17.0 NM_008091 EG624219 1.68 0.012 458.3 309.7 384.2 919.8 1572.0 1196.7 NM_001080940 Nr2f2 1.68 0.022 2.9 4.9 5.5 13.6 10.1 19.1 AK012573 AK042960 1.69 0.022 3.9 4.1 2.9 15.9 8.4 11.1 AK042960 Socs2 1.70 0.002 119.7 163.8 188.5 581.2 424.6 528.0 NM_007706 Ppp1r3c 1.71 0.026 150.3 126.9 78.2 245.9 503.7 415.3 NM_016854 AK033032 1.71 0.037 6.0 3.8 2.9 9.4 19.5 12.8 AK033032 Mapkapk3 1.74 0.002 51.9 39.6 50.2 128.2 170.8 174.7 NM_178907 Ddo 1.77 0.033 11.7 13.0 14.3 25.7 48.6 59.1 AK019898 Srgap3 1.80 0.015 6.1 5.6 13.7 33.4 34.5 20.7 AK122276 Nt5e 1.81 0.005 22.5 63.5 128.4 242.2 273.7 236.8 NM_011851 6430598A04Rik 1.83 0.034 7.3 3.6 9.7 20.6 17.8 34.7 NM_175521 Prf1 1.86 0.002 2.9 4.3 6.0 18.6 14.4 14.7 NM_011073 Igl-V1 1.88 0.043 3.2 2.9 3.8 18.0 7.9 10.5 AY151141 NAP030437-1 1.89 0.034 130.3 65.8 86.6 223.8 492.9 332.7 NAP030437-1 NAP056910-1 1.93 0.001 3.7 5.3 3.6 17.5 14.0 16.5 NAP056910-1 Slc14a1 1.94 0.041 2.8 2.8 2.7 15.2 6.0 10.9 NM_028122 5330417C22Rik 1.96 0.007 3.4 3.5 4.6 12.8 12.7 19.3 BC051424 5730410E15Rik 1.98 0.007 8.4 35.4 24.5 74.6 109.6 84.4 NM_178765 Iars2 2.00 0.033 3.1 3.0 3.4 18.5 8.7 10.7 XM_908122 Elovl7 2.02 0.011 10.1 14.2 12.0 37.0 64.5 45.3 NM_029001 Xist 2.02 0.021 2.7 11.1 10.8 30.4 24.1 45.3 NR_001463 Vldlr 2.08 0.010 12.1 26.0 95.9 156.7 218.7 192.0 AK036010

100 Supplement

log -fold gene symbol 2 p-value WT1 WT2 WT3 1 2 3 target ID change Vldlr 2.09 0.020 87.4 164.3 308.5 516.9 1019.9 841.8 NM_013703 3010033K07Rik 2.11 0.003 3.3 77.4 52.2 197.5 202.8 174.0 AK080070 2310014L17Rik 2.15 0.032 3.5 3.6 8.4 23.8 13.5 31.7 NM_029809 A1bg 2.29 0.050 15.4 41.7 276.2 791.0 489.9 346.5 NM_001081067 Xist 2.30 0.006 2.8 112.9 128.0 466.9 418.3 315.2 L04961 AK050066 2.33 0.020 15.8 8.5 4.9 30.0 63.5 53.5 AK050066 E130309F12Rik 2.36 0.009 3.1 4.4 11.9 27.8 42.7 28.9 NM_178756 Cyp3a44 2.36 0.008 1384.2 6888.2 14482.1 41415.2 45930.4 29261.2 NM_177380 4930418G15Rik 2.45 0.001 20.5 43.9 41.8 203.7 214.5 160.3 NM_145692 Abcd2 2.46 0.014 6.2 13.7 38.7 139.7 75.8 107.4 NM_011994 Abcb10 2.47 0.026 2.9 2.8 2.9 21.6 8.8 17.1 AK011569 Hao3 2.67 0.012 3.0 116.8 151.1 762.6 413.0 545.6 NM_019545 5330417C22Rik 2.68 0.008 18.2 60.6 49.3 194.0 273.0 353.6 NM_001033304 Derl3 3.19 0.031 145.6 397.2 358.7 1639.4 4165.9 2431.5 NM_024440 TC1686295 3.32 0.038 703.4 36.7 29.0 1157.4 3577.1 2960.8 TC1686295 Acpp 3.61 0.009 10.7 5.9 3.5 72.4 112.0 60.1 NM_207668 AI315523 4.09 0.004 2.9 91.8 112.7 1013.5 1533.2 988.7 AI315523 ENSMUST00000098809 4.09 0.021 2.9 60.9 109.4 570.3 1435.1 947.2 ENSMUST00000098809 C730007P19Rik 4.26 0.004 5.1 103.0 122.0 1903.9 1366.4 1130.6 NM_009286 4833416E15Rik 5.72 0.015 2.9 2.7 2.9 98.8 216.6 129.3 AK014707

101 Supplement

Table S3 Altered expression of cell cycle-associated genes in regenerating C/EBPuORF livers at 36 hours after PH.

gene log2-fold p-value full name target ID symbol change Anapc1 -1.08 0.002 Anaphase Promoting Complex Subunit 1 AK053383 Asns -2.75 0.014 Asparagine Synthetase NM_012055 Aurka -3.19 0.007 Aurora Kinase A NM_011497 Aurkb -3.09 0.001 Aurora Kinase B NM_011496 Birc5 -3.11 0.015 Baculoviral IAP Repeat-Containing 5 NM_009689 Blm -1.53 0.003 Bloom Syndrome Homolog NM_007550 Bmp7 -2.43 0.000 Bone Morphogenetic Protein 7 NM_007557 Bmp8b -1.57 0.011 Bone Morphogenetic Protein 8b NM_007559 Bmyc -1.41 0.042 Brain Expressed Myelocytomatosis Oncogene NM_023326 Brca1 -1.18 0.016 Breast Cancer 1 NM_009764 Brca2 -1.36 0.005 Breast Cancer 2 NM_009765 Btg3 -1.26 0.000 B-Cell Translocation Gene 3 NM_009770 Bub1 -2.76 0.006 Budding Uninhibited By Benzimidazoles 1 Homolog NM_009772 Bub1b -2.58 0.008 Budding Uninhibited By Benzimidazoles 1 Homolog beta NM_009773 Calml4 -1.16 0.005 Calmodulin-Like 4 NM_138304 Ccna2 -3.09 0.020 Cyclin A2 NM_009828 Ccnb1 -3.67 0.012 Cyclin B1 NM_172301 Ccnb2 -3.87 0.024 Cyclin B2 NM_007630 Ccne1 -1.88 0.011 Cyclin E1 NM_007633 Ccne2 -2.80 0.037 Cyclin E2 NM_009830 Cdc20 -3.42 0.016 Cell Division Cycle 20 Homolog NM_023223 Cdc25b -1.14 0.004 Cell Division Cycle 25 Homolog B NM_023117 Cdc25c -2.07 0.037 Cell Division Cycle 25 Homolog C NM_009860 Cdc2a -1.92 0.040 Cell Division Cycle 2 Homolog A NM_007659 Cdc45l -1.59 0.015 Cell Division Cycle 45 Homolog NM_009862 Cdc6 -1.87 0.020 Cell Division Cycle 6 Homolog NM_011799 Cdca2 -3.41 0.010 Cell Division Cycle-Associated 2 NM_175384 Cdca3 -3.41 0.018 Cell Division Cycle-Associated 3 NM_013538 Cdca5 -2.89 0.004 Cell Division Cycle-Associated 5 NM_026410 Cdca7l -1.51 0.018 Cell Division Cycle-Associated 7 Like NM_146040 Cdca8 -2.54 0.005 Cell Division Cycle-Associated 8 NM_026560 Cdkn2c -2.06 0.046 Cdk4 And Cdk6 Inhibitor p18 U19596 Cdkn2d -2.03 0.007 Cyclin-Dependent Kinase Inhibitor 2D p19 NM_009878 Cdkn3 -3.63 0.036 Cyclin-Dependent Kinase Inhibitor 3 BC049694 Cdt1 -1.35 0.030 Chromatin Licensing and DNA Replication Factor 1 NM_026014 Cenpa -1.43 0.003 Centromere Protein A NM_007681 Cenpe -1.69 0.027 Centromere Protein E NM_173762 Cenph -2.33 0.001 Centromere Protein H NM_021886 Cenpi -2.19 0.000 Centromere Protein I NM_145924 Cenpk -2.24 0.001 Centromere Protein K NM_021790 Cenpl -1.67 0.048 Centromere Protein L NM_027429 Cenpm -2.79 0.006 Centromere Protein M NM_178269 Cenpp -2.43 0.008 Centromere Protein P NM_025495 Cenpq -1.63 0.009 Centromere Protein Q NM_031863 Cep192 -1.13 0.016 Centrosomal Protein 192 BC064462 Cep290 -1.10 0.017 Centrosomal Protein 290 AK172940 Cep55 -2.93 0.017 Centrosomal Protein 55 NM_028760 Cep72 -1.52 0.008 Centrosomal Protein 72 NM_028959 Cep76 -1.11 0.008 Centrosomal Protein 76 NM_001081073 Cep78 -1.34 0.018 Centrosomal Protein 78 NM_198019 Chaf1a -1.75 0.018 Chromatin Assembly Factor 1 subunit A NM_013733 Chaf1b -1.62 0.021 Chromatin Assembly Factor 1 subunit B NM_028083 Chek1 -1.52 0.006 Checkpoint Kinase 1 Homolog NM_007691 Chtf18 -2.43 0.006 Chromosome Transmission Fidelity Factor 18 Homolog NM_145409 Ckap2 -3.15 0.011 Cytoskeleton-Associated Protein 2 NM_001004140 Ckap2l -2.76 0.012 Cytoskeleton-Associated Protein 2-Like NM_181589 Cks1b -1.23 0.020 CDC28 Protein Kinase 1b NM_016904 Clspn -2.21 0.003 Claspin Homolog NM_175554 Cul7 -1.14 0.007 Cullin 7 AK082134 Dbf4 -1.55 0.004 DBF4 Homolog NM_013726 Dck -1.53 0.003 Deoxycytidine Kinase NM_007832

102 Supplement

gene log2-fold p-value full name target ID symbol change Dig7 -1.82 0.010 Discs Large Homolog 7 NM_144553 Dnmt1 -1.41 0.035 DNA Methyltransferase 1 NM_010066 Dsn1 -2.36 0.002 DSN1 (MIND Kinetochore Complex Component) NM_025853 Dtl -1.89 0.016 Denticleless Homolog NM_029766 Dut -1.50 0.005 Deoxyuridine Triphosphatase NM_023595 E2f1 -1.62 0.029 E2F Transcription Factor 1 NM_007891 E2f2 -1.04 0.025 E2F Transcription Factor 2 NM_177733 E2f7 -2.12 0.015 E2F Transcription Factor 7 NM_178609 E2f8 -2.02 0.011 E2F Transcription Factor 8 NM_001013368 Ercc6l -1.17 0.023 Excision Repair Cross-Complementing Rodent RepairtDeficiency NM_146235 Complementation Group 6 - Like Espl1 -3.07 0.007 Extra Spindle Poles-Like 1 NM_001014976 Exo1 -2.13 0.006 Exonuclease 1 NM_012012 Exod1 -1.12 0.020 Exonuclease Domain Containing 1 NM_027698 Ezh2 -1.64 0.013 Enhancer Of Zeste Homolog 2 NM_007971 Fancb -1.81 0.001 Fanconi Anemia Complementation Group B NM_175027 Fancd2 -2.71 0.032 Fanconi Anemia Complementation Group D2 NM_001033244 Fancg -1.34 0.007 Fanconi Anemia Complementation Group G BC050890 Fbxo5 -2.38 0.005 F-Box Protein 5 NM_025995 Fen1 -1.74 0.020 Flap Structure Specific Endonuclease 1 NM_007999 Fmn2 -1.56 0.010 Formin 2 NM_019445 Foxm1 -3.00 0.016 Forkhead Box M1 NM_008021 Gas2l3 -1.58 0.011 Growth Arrest-Specific 2 Like 3 NM_001079876 Gins1 -1.25 0.035 GINS Complex Subunit 1 (Psf1 Homolog) BC027537 Gins3 -1.66 0.009 GINS Complex Subunit 3 (Psf3 Homolog) NM_030198 Gmnn -1.37 0.002 Geminin NM_020567 Gsg2 -1.99 0.004 Germ Cell-Specific Gene 2 NM_010353 Gspt2 t1.42 0.026 G1 To S Phase Transition 2 NM_008179 Gtse1 -2.94 0.010 G Two S Phase Expressed Protein 1 NM_013882 H2afx -1.90 0.008 H2A Histone Family member X NM_010436 H2afz -1.10 0.020 H2A Histone Family Member Z NM_016750 Hells -1.87 0.013 Helicase Lymphoid Specific NM_008234 Hmga2-ps1 -1.96 0.033 High Mobility Group AT-Hook 2 Pseudogene 1 AK033703 Hmgb2 -2.42 0.010 High Mobility Group Box 2 NM_008252 Hmgb3 -1.35 0.033 High Mobility Group Box 3 NM_008253 Hmmr -3.00 0.013 Hyaluronan Mediated Motility Receptor NM_013552 Incenp -2.34 0.010 Inner Centromere Protein NM_016692 Kif11 -1.32 0.002 Kinesin Family Member 11 NM_010615 Kif14 -1.78 0.006 Kinesin Family Member 14 NM_001081258 Kif15 -1.04 0.003 Kinesin Family Member 15 NM_010620 Kif18a -2.21 0.016 Kinesin Family Member 18A NM_139303 Kif20a -3.24 0.012 Kinesin Family Member 20A NM_009004 Kif22 -2.99 0.035 Kinesin Family Member 22 NM_145588 Kif23 -2.54 0.037 Kinesin Family Member 23 NM_024245 Kif24 -2.00 0.011 Kinesin Family Member 24 NM_024241 Kif26b -1.29 0.038 Kinesin Family Member 26B NM_177757 Kif2c -2.79 0.022 Kinesin Family Member 2C NM_134471 Kif4 -2.78 0.007 Kinesin Family Member 4 NM_008446 Kntc1 -2.19 0.017 Kinetochore-Associated 1 NM_001042421 Lig1 -1.99 0.019 Ligase I NM_010715 Mad2l1 -1.97 0.005 Mitotic Checkpoint Component Mad2 U83902 Mcm3 -1.51 0.020 Minichromosome Maintenance Deficient 3 NM_008563 Mcm4 -1.31 0.038 Minichromosome Maintenance Deficient 4 Homolog NM_008565 Mcm5 -1.54 0.021 Minichromosome Maintenance Deficient 5 NM_008566 Mcm6 -1.76 0.008 Minichromosome Maintenance Deficient 6 NM_008567 Mcm7 -1.54 0.006 Minichromosome Maintenance Deficient 7 NM_008568 Mcm8 -1.42 0.009 Minichromosome Maintenance Deficient 8 NM_025676 Mki67 -2.96 0.031 Ki-67 X82786 Mphosph1 -2.52 0.001 M-Phase Phosphoprotein 1 NM_183046 Msh6 -1.12 0.018 Muts Homolog 6 NM_010830 Mtbp -1.19 0.007 Mdm2 Transformed 3T3 Cell Double Minute p53 Binding Protein NM_134092 Mutyh -1.51 0.009 Muty Homolog NM_133250 Myh10 -1.59 0.004 Myosin Heavy Polypeptide 10 NM_175260 Ncapd2 -2.36 0.016 Non-SMC Condensin I Complex Subunit D2 NM_146171 Ncapd3 -1.11 0.002 Non-SMC Condensin II Complex Subunit D3 NM_178113 Ncapg -2.57 0.008 Hypothetical Protein Expressed In Thymocytes AJ237585 Ncapg2 -2.04 0.018 Non-SMC Condensin II Complex Subunit G2 NM_133762

103 Supplement

gene log2-fold p-value full name target ID symbol change Ncaph -2.20 0.021 Non-SMC Condensin I Complex Subunit H NM_144818 Ndc80 -2.44 0.005 NDC80 Homolog Kinetochore Complex Component NM_023294 Neil3 -3.26 0.037 Nei Like 3 NM_146208 Nek2 -2.49 0.015 NIMA (Never In Mitosis Gene A)-Related Expressed tKinase 2 NM_010892 Nsl1 -2.15 0.002 NSL1 (MIND Kinetochore Complex Component) NM_198654 Nuf2 -3.02 0.015 NUF2 (NDC80 Kinetochore Complex Component) NM_023284 Nusap1 -3.39 0.024 Nucleolar and Spindle-Associated Protein 1 NM_133851 Pard3 t1.34 0.003 Partitioning Defective 3 NM_033620 Pcna -1.72 0.032 Proliferating Cell Nuclear Antigen NM_011045 Plk1 -3.57 0.028 Polo-Like Kinase 1 NM_011121 Plk4 -1.99 0.001 Polo-Like Kinase 4 NM_011495 Pms2 -1.12 0.003 Postmeiotic Segregation Increased 2 NM_008886 Pola1 -1.29 0.029 Polymerase (DNA Directed) Alpha 1 NM_008892 Pold1 -1.20 0.011 Polymerase (DNA Directed) Delta 1 NM_011131 Pole -1.93 0.009 Polymerase (DNA Directed) Epsilon NM_011132 Pole2 -1.62 0.022 Polymerase (DNA Directed) Epsilon 2 NM_011133 Polh -1.08 0.010 Polymerase (DNA Directed) Eta BC049159 Polq -2.56 0.039 Polymerase (DNA Directed) Theta NM_029977 Prc1 -3.50 0.030 Protein Regulator Of Cytokinesis 1 NM_145150 Prim1 -1.55 0.004 DNA Primase p49 Subunit NM_008921 Psmb9 -1.38 0.000 Proteosome (Prosome, Macropain) Subunit Beta Type 9 NM_013585 Psmc3ip -1.71 0.002 Proteasome (Prosome, Macropain) 26S Subunit, tATPase 3, NM_008949 Interacting Protein Psrc1 -2.81 0.003 Proline/Serine-Rich Coiled-Coil 1 NM_019976 Racgap1 -3.13 0.040 Rac GTPase-Activating Protein 1 NM_012025 Rad18 -1.44 0.007 RAD18 Homolog NM_021385 Rad51 -2.15 0.001 RAD51 Homolog NM_011234 Rad51ap1 -2.36 0.019 RAD51-Associated Protein 1 NM_009013 Rad54l -2.42 0.011 RAD54 Like NM_009015 Rbl1 -1.50 0.046 Retinoblastoma-Like 1 (p107) NM_011249 Recql4 -1.11 0.008 RecQ Protein-Like 4 NM_058214 Rfc3 -1.22 0.019 Replication Factor C (Activator 1) 3 NM_027009 Rfc4 -1.70 0.001 Replication Factor C (Activator 1) 4 NM_145480 Rfc5 -1.24 0.008 Replication Factor C (Activator 1) 5 NM_028128 Rpa1 -1.16 0.008 Replication Protein A1 NM_026653 Rpa2 -1.62 0.006 Replication Protein A2 NM_011284 Rrm1 -1.56 0.001 Ribonucleotide Reductase M1 NM_009103 Rrm2 -2.80 0.003 Ribonucleotide Reductase M2 NM_009104 Sass6 -1.10 0.001 Spindle Assembly 6 Homolog NM_028349 Sgol1 -2.77 0.013 Shugoshin-Like 1 NM_028232 Sgol2 -3.24 0.010 Shugoshin-Like 2 NM_199007 Skp2 -1.66 0.049 S-Phase Kinase-Associated Protein 2 (p45) NM_013787 Slbp -1.29 0.002 Stem-Loop Binding Protein NM_009193 Smc2 -2.03 0.006 Structural Maintenance Of Chromosomes 2 NM_008017 Smc4 -1.77 0.005 Structural Maintenance Of Chromosomes 4 NM_133786 Spag5 -3.39 0.002 Sperm-Associated Antigen 5 NM_017407 Spc24 -1.73 0.004 SPC24 (NDC80 Kinetochore Complex Component) NM_026282 Spc25 -1.92 0.015 SPC25 (NDC80 Kinetochore Complex Component) NM_025565 Stmn1 -3.02 0.032 Stathmin 1 NM_019641 Suv39h1 -1.36 0.006 Suppressor Of Variegation 3-9 Homolog 1 NM_011514 Syce2 -1.53 0.029 Synaptonemal Complex Central Element Protein 2 NM_027954 Tacc3 -2.39 0.001 Transforming Acidic Coiled-Coil Containing Protein 3 NM_001040435 Timeless -1.31 0.015 Timeless Homolog NM_011589 Tipin -1.06 0.011 Timeless Interacting Protein NM_025372 Tk1 -1.51 0.034 Thymidine Kinase 1 NM_009387 Top2a -2.68 0.003 Topoisomerase (DNA) II Alpha NM_011623 Tpx2 -2.69 0.004 TPX2 (Microtubule-Associated Protein) NM_028109 Traip -2.19 0.001 TRAF-Interacting Protein NM_011634 Trip13 -1.89 0.003 Thyroid Hormone Receptor Interactor 13 NM_027182 Ttk -3.22 0.008 Ttk Protein Kinase NM_009445 Ube2c -2.98 0.020 Ubiquitin-Conjugating Enzyme E2C NM_026785 Ush1c -1.40 0.014 Usher Syndrome 1C Homolog NM_153677 Xrcc2 -1.47 0.008 X-Ray Repair Complementing Defective Repair In Chinese Ham- NM_020570 ster Cells 2 Zwilch -2.12 0.003 Zwilch (Kinetochore-Associated) NM_026507

104 Acknowledgements

Acknowledgements

I thank Prof Achim Leutz for giving me the opportunity to work in the inspiring surrounding of his research group at the Max-Delbrueck-Center for Molecular Medicine (MDC). I am ex- plicitly grateful for his support during this thesis and concomitant projects, and for sharing ideas and visionary views, when trying to find new ways out of blind alleys. I am also grateful to Prof Bernd Dörken for initial employment. I thank Dr Valérie Bégay for her great help introducing me to scientific work and experimental designs, for the generation of C/EBP mutant mice, and for the contributions and critical discussions during the preparation of this thesis. I am also grateful to Dr Cornelis Calkhoven and Dr Volker Wiesenthal, who performed ground-laying work for this thesis prior to my time at the MDC. I thank Dr Jeske Smink for her great scientific contributions, helping to characterize the bone/osteoclast phenotype of C/EBPuORF mice. I am also thankful for her highly motivating nature in- and outside the lab, and for her inexhaustible impetus to initiate social events and non-scientific breaks. I thank Dr Katrin Zaragoza for her contributions on the E2F regulatory properties of C/EBP isoforms and for introducing spanish coffee to my world. I thank Dr Elisabeth Kowenz-Leutz for sharing knowledge and plasmids, Dr Jörn Lausen for continuous scientific discussion, and Dr Marina Scheller for help with hematopoietic methods. Great thanks to Ruth Zarmstorff, Nadine Bur- bach, and Sarah Jaksch for excellent technical assistance, and to Nina Brauer and Juliette Bergemann for caretaking of the mice. I thank Sylvia Sibilak for gummy bears and for her help and talent in organizing bureaucratic issues. I am highly thankful to Dr Ole Pless, Maria Knoblich and Karolin Voss, who always lent a helping hand in the lab and, with their empa- thy and great sense of humor, made the MDC a good place to be. I thank Prof Carmen Birchmeier for providing the pTV-flox targeting vector, Prof Kristian Helin and Prof Stefan Gaubatz for kind donation of luciferase reporter- or expression- plasmids, Dr Malgorzata Borowiak, Dr Björn von Eyss and Dr Ulrike Ziebold for valuable technical advice, and Dr Miguel Andrade and Matthew Huska for help with microarray data analysis. This work was supported by the Deutsche Krebshilfe (grant 107968 to K.W. and A.L.). Ich danke meinen Eltern Anne und Klaus Wethmar, die mir durch ihre Liebe und Unter- stützung in allen Lebenslagen ein unbeschreiblich großer Rückhalt sind. Finally, I thank Christine Wethmar for being an unlimited source of happiness in my life.

105 References

Abastado, J. P.; Miller, P. F.; Jackson, B. M. and Hinnebusch, A. G. (1991): Suppression of ribosomal reinitiation at upstream open reading frames in amino acid-starved cells forms the basis for GCN4 translational control, Mol Cell Biol 11 [1], pp. 486-96. Agrawal, Alok; Cha-Molstad, Hyunjoo; Samols, David and Kushner, Irving (2003): Overexpressed nuclear factor-kappaB can participate in endogenous C-reactive protein induction, and enhances the effects of C/EBPbeta; and signal transducer and activator of transcription-3, Immunology 108 [4], pp. 539-547. Akira, S. (1997): IL-6-regulated transcription factors, Int J Biochem Cell Biol 29 [12], pp. 1401-18. Akira, S.; Isshiki, H.; Sugita, T.; Tanabe, O.; Kinoshita, S.; Nishio, Y.; Nakajima, T.; Hirano, T. and Kishimoto, T. (1990): A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family, Embo J 9 [6], pp. 1897-906. Alam, T.; An, M. R. and Papaconstantinou, J. (1992): Differential expression of three C/EBP isoforms in multiple tissues during the acute phase response, J. Biol. Chem. 267 [8], pp. 5021-4. Allerson, C. R.; Cazzola, M. and Rouault, T. A. (1999): Clinical severity and thermodynamic effects of iron- responsive element mutations in hereditary hyperferritinemia-cataract syndrome, J Biol Chem 274 [37], pp. 26439-47. Alonzi, Tonino; Maritano, Diego; Gorgoni, Barbara; Rizzuto, Gabriella; Libert, Claude and Poli, Valeria (2001): Essential Role of STAT3 in the Control of the Acute-Phase Response as Revealed by Inducible Gene Activation in the Liver, Mol. Cell. Biol. 21 [5], pp. 1621-1632. An, M. R.; Hsieh, C. C.; Reisner, P. D.; Rabek, J. P.; Scott, S. G.; Kuninger, D. T. and Papaconstantinou, J. (1996): Evidence for posttranscriptional regulation of C/EBPalpha and C/EBPbeta isoform expression during the lipopolysaccharide-mediated acute-phase response, Mol Cell Biol 16 [5], pp. 2295-306. Baccam, Mekhine; Woo, So-Youn; Vinson, Charles and Bishop, Gail A. (2003): CD40-Mediated Transcriptional Regulation of the IL-6 Gene in B Lymphocytes: Involvement of NF-{kappa}B, AP-1, and C/EBP, J Immunol 170 [6], pp. 3099-3108. Baer, M. and Johnson, P. F. (2000): Generation of truncated C/EBPbeta isoforms by in vitro proteolysis, J. Biol. Chem. 275 [34], pp. 26582-90. Bakri, Y.; Sarrazin, S.; Mayer, U. P.; Tillmanns, S.; Nerlov, C.; Boned, A. and Sieweke, M. H. (2005): Balance of MafB and PU.1 specifies alternative macrophage or dendritic cell fate, Blood 105 [7], pp. 2707-16. Bedi, R.; Du, J.; Sharma, A. K.; Gomes, I. and Ackerman, S. J. (2009): Human C/EBP-epsilon activator and repressor isoforms differentially reprogram myeloid lineage commitment and differentiation, Blood 113 [2], pp. 317-27. Berenson, J. R. and Yellin, O. (2008): New drugs in multiple myeloma, Curr Opin Support Palliat Care 2 [3], pp. 204-10. Boyce, B. F.; Xing, L.; Yao, Z.; Shakespeare, W. C.; Wang, Y.; Metcalf, C. A., 3rd; Sundaramoorthi, R.; Dal- garno, D. C.; Iuliucci, J. D. and Sawyer, T. K. (2006): Future anti-catabolic therapeutic targets in bone disease, Ann N Y Acad Sci 1068, pp. 447-57. Bracken, A. P.; Ciro, M.; Cocito, A. and Helin, K. (2004): E2F target genes: unraveling the biology, Trends Biochem Sci 29 [8], pp. 409-17. Buck, M. and Chojkier, M. (2003): Signal transduction in the liver: C/EBPbeta modulates cell proliferation and survival, Hepatology 37 [4], pp. 731-8. Buck, M.; Turler, H. and Chojkier, M. (1994): LAP (NF-IL-6), a tissue-specific transcriptional activator, is an inhibitor of hepatoma cell proliferation, Embo J. 13 [4], pp. 851-60. Calkhoven, C. F.; Bouwman, P. R.; Snippe, L. and Ab, G. (1994): Translation start site multiplicity of the CCAAT/enhancer binding protein alpha mRNA is dictated by a small 5' open reading frame, Nucleic Acids Res. 22 [25], pp. 5540-7. Calkhoven, C. F.; Muller, C. and Leutz, A. (2000): Translational control of C/EBPalpha and C/EBPbeta isoform expression, Genes Dev 14 [15], pp. 1920-32. Calkhoven, C. F.; Muller, C. and Leutz, A. (2002): Translational control of gene expression and disease, Trends Mol Med 8 [12], pp. 577-83. Calkhoven, C. F.; Muller, C.; Martin, R.; Krosl, G.; Pietsch, H.; Hoang, T. and Leutz, A. (2003): Translational control of SCL-isoform expression in hematopoietic lineage choice, Genes Dev 17 [8], pp. 959-64. Calkhoven, C. F.; Snippe, L. and Ab, G. (1997): Differential stimulation by CCAAT/enhancer-binding protein alpha isoforms of the estrogen-activated promoter of the very-low-density apolipoprotein II gene, Eur J Biochem 249 [1], pp. 113-20.

106 References

Calvo, S. E.; Pagliarini, D. J. and Mootha, V. K. (2009): Upstream open reading frames cause widespread reduction of protein expression and are polymorphic among humans, Proc Natl Acad Sci U S A 106 [18], pp. 7507-12. Cereghini, S. (1996): Liver-enriched transcription factors and hepatocyte differentiation, The FASEB Journal 10 [2], p. 267. Chan, S.; Scheulen, M. E.; Johnston, S.; Mross, K.; Cardoso, F.; Dittrich, C.; Eiermann, W.; Hess, D.; Morant, R.; Semiglazov, V.; Borner, M.; Salzberg, M.; Ostapenko, V.; Illiger, H. J.; Behringer, D.; Bardy- Bouxin, N.; Boni, J.; Kong, S.; Cincotta, M. and Moore, L. (2005): Phase II study of temsirolimus (CCI-779), a novel inhibitor of mTOR, in heavily pretreated patients with locally advanced or metas- tatic breast cancer, J Clin Oncol 23 [23], pp. 5314-22. Chappell, S. A.; LeQuesne, J. P.; Paulin, F. E.; deSchoolmeester, M. L.; Stoneley, M.; Soutar, R. L.; Ralston, S. H.; Helfrich, M. H. and Willis, A. E. (2000): A mutation in the c-myc-IRES leads to enhanced internal ribosome entry in multiple myeloma: a novel mechanism of oncogene de-regulation, Oncogene 19 [38], pp. 4437-40. Chatterjee, S. and Pal, J. K. (2009): Role of 5'- and 3'-untranslated regions of mRNAs in human diseases, Biol Cell 101 [5], pp. 251-62. Chen, S. S.; Chen, J. F.; Johnson, P. F.; Muppala, V. and Lee, Y. H. (2000): C/EBPbeta, when expressed from the C/ebpalpha gene locus, can functionally replace C/EBPalpha in liver but not in adipose tissue, Mol Cell Biol 20 [19], pp. 7292-9. Chen, Xueni; Liu, Weimin; Ambrosino, Concetta; Ruocco, Maria R.; Poli, Valeria; Romani, Luigina; Quinto, Ileana; Barbieri, Susan; Holmes, Kevin L.; Venuta, Salvatore and Scala, Giuseppe (1997): Impaired Generation of Bone Marrow B Lymphocytes in Mice Deficient in C/EBPbeta, Blood 90 [1], p. 156. Child, S. J.; Miller, M. K. and Geballe, A. P. (1999): Translational control by an upstream open reading frame in the HER-2/neu transcript, J Biol Chem 274 [34], pp. 24335-41. Cooper, Cathleen; Henderson, Andrew; Artandi, Steven; Avitahl, Nicole and Calame, Kathryn (1995): Ig/EBP (C/EBP{gamma}) is a transdominant negative inhibitor of C/EBP family transcriptional activators, Nu- cleic Acids Research 23 [21], pp. 4371-4377. Corradetti, M.N. and Guan, K.L. (2006): Upstream of the mammalian target of rapamycin: do all roads pass through mTOR?, Oncogene 25, pp. 6347-6360. Cressman, D. E.; Greenbaum, L. E.; DeAngelis, R. A.; Ciliberto, G.; Furth, E. E.; Poli, V. and Taub, R. (1996): Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice, Science 274 [5291], pp. 1379-83. Croniger, Colleen; Trus, Michael; Lysek-Stupp, Keren; Cohen, Hannah; Liu, Yan; Darlington, Gretchen J.; Poli, Valeria; Hanson, Richard W. and Reshef, Lea (1997): Role of the Isoforms of CCAAT/Enhancer- binding Protein in the Initiation of Phosphoenolpyruvate Carboxykinase (GTP) Gene Transcription at Birth, J. Biol. Chem. 272 [42], pp. 26306-26312. Crowe, M. L.; Wang, X. Q. and Rothnagel, J. A. (2006): Evidence for conservation and selection of upstream open reading frames suggests probable encoding of bioactive peptides, BMC Genomics 7, p. 16. D'Alo, Francesco; Johansen, Lisa M.; Nelson, Erik A.; Radomska, Hanna S.; Evans, Erica K.; Zhang, Pu; Ner- lov, Claus and Tenen, Daniel G. (2003): The amino terminal and E2F interaction domains are critical for C/EBP{alpha}-mediated induction of granulopoietic development of hematopoietic cells, Blood 102 [9], p. 3163. Descombes, P. and Schibler, U. (1991): A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA, Cell 67 [3], pp. 569-79. Diehl, Anna Mae (1998): Roles of CCAAT/Enhancer-binding Proteins in Regulation of Liver Regenerative Growth, J. Biol. Chem. 273 [47], pp. 30843-30846. Duong, David T.; Waltner-Law, Mary E.; Sears, Rosalie; Sealy, Linda and Granner, Daryl K. (2002): Insulin Inhibits Hepatocellular Glucose Production by Utilizing Liver-enriched Transcriptional Inhibitory Pro- tein to Disrupt the Association of CREB-binding Protein and RNA Polymerase II with the Phosphoe- nolpyruvate Carboxykinase Gene Promoter, J. Biol. Chem. 277 [35], pp. 32234-32242. Eiring, A. M.; Harb, J. G.; Neviani, P.; Garton, C.; Oaks, J. J.; Spizzo, R.; Liu, S.; Schwind, S.; Santhanam, R.; Hickey, C. J.; Becker, H.; Chandler, J. C.; Andino, R.; Cortes, J.; Hokland, P.; Huettner, C. S.; Bhatia, R.; Roy, D. C.; Liebhaber, S. A.; Caligiuri, M. A.; Marcucci, G.; Garzon, R.; Croce, C. M.; Calin, G. A. and Perrotti, D. (2010): miR-328 functions as an RNA decoy to modulate hnRNP E2 regulation of mRNA translation in leukemic blasts, Cell 140 [5], pp. 652-65. Erickson, R. L.; Hemati, N.; Ross, S. E. and MacDougald, O. A. (2001): p300 coactivates the adipogenic transcription factor CCAAT/enhancer-binding protein alpha, J Biol Chem 276 [19], pp. 16348-55.

107 References

Flodby, P.; Barlow, C.; Kylefjord, H.; Ahrlund-Richter, L. and Xanthopoulos, K. G. (1996): Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha, J Biol Chem 271 [40], pp. 24753-60. Freytag, S. O.; Paielli, D. L. and Gilbert, J. D. (1994): Ectopic expression of the CCAAT/enhancer-binding protein alpha promotes the adipogenic program in a variety of mouse fibroblastic cells, Genes Dev 8 [14], pp. 1654-63. Friedman, Joshua R.; Larris, Brian; Le, Phillip P.; Peiris, T. Harshani; Arsenlis, Athanasios; Schug, Jonathan; Tobias, John W.; Kaestner, Klaus H. and Greenbaum, Linda E. (2004): Orthogonal analysis of C/EBP{beta} targets in vivo during liver proliferation, Proceedings of the National Academy of Sci- ences 101 [35], p. 12986. Fujimoto, T.; Anderson, K.; Jacobsen, S. E. W.; Nishikawa, S. i and Nerlov, C. (2007): Cdk6 blocks myeloid differentiation by interfering with Runx1 DNA binding and Runx1-C/EBP[alpha] interaction, Embo J 26 [9], pp. 2361-2370. Gaba, A.; Jacobson, A. and Sachs, M. S. (2005): Ribosome occupancy of the yeast CPA1 upstream open reading frame termination codon modulates nonsense-mediated mRNA decay, Mol Cell 20 [3], pp. 449-60. Gery, S.; Gombart, A. F.; Fung, Y. K. and Koeffler, H. P. (2004): C/EBPepsilon interacts with retinoblastoma and E2F1 during granulopoiesis, Blood 103 [3], pp. 828-35. Girelli, D.; Corrocher, R.; Bisceglia, L.; Olivieri, O.; De Franceschi, L.; Zelante, L. and Gasparini, P. (1995): Molecular basis for the recently described hereditary hyperferritinemia-cataract syndrome: a mutation in the iron-responsive element of ferritin L-subunit gene (the "Verona mutation"), Blood 86 [11], pp. 4050-3. Gorgoni, Barbara; Maritano, Diego; Marthyn, Paola; Righi, Marco and Poli, Valeria (2002): C/EBP{beta} Gene Inactivation Causes Both Impaired and Enhanced Gene Expression and Inverse Regulation of IL-12 p40 and p35 mRNAs in Macrophages, J Immunol 168 [8], pp. 4055-4062. Greenbaum, L. E.; Cressman, D. E.; Haber, B. A. and Taub, R. (1995): Coexistence of C/EBP alpha, beta, growth-induced proteins and DNA synthesis in hepatocytes during liver regeneration. Implications for maintenance of the differentiated state during liver growth, J Clin Invest 96 [3], pp. 1351-65. Greenbaum, Linda E.; Li, Wei; Cressman, Drew E.; Peng, Yong; Ciliberto, Gennaro; Poli, Valeria and Taub, Rebecca (1998): CCAAT Enhancer-binding Protein beta Is Required for Normal Hepatocyte Prolifera- tion in Mice after Partial Hepatectomy, J. Clin. Invest. 102 [5], pp. 996-1007. Griffin, Erik; Re, Alessandro; Hamel, Nance; Fu, Chenzong; Bush, Harry; McCaffrey, Timothy and Asch, Adam S. (2001): A link between diabetes and atherosclerosis: Glucose regulates expression of CD36 at the level of translation, Nat Med 7 [7], pp. 840-846. Guerzoni, Clara; Bardini, Michela; Mariani, Samanta A.; Ferrari-Amorotti, Giovanna; Neviani, Paolo; Panno, Maria Luisa; Zhang, Ying; Martinez, Robert; Perrotti, Danilo and Calabretta, Bruno (2006): Inducible activation of CEBPB, a gene negatively regulated by BCR/ABL, inhibits proliferation and promotes differentiation of BCR/ABL-expressing cells, Blood 107 [10], pp. 4080-4089. Hampf, M. and Gossen, M. (2006): A protocol for combined Photinus and Renilla luciferase quantification com- patible with protein assays, Anal. Biochem. 356 [1], pp. 94-9. Hanfrey, Colin; Elliott, Katherine A.; Franceschetti, Marina; Mayer, Melinda J.; Illingworth, Crista and Michael, Anthony J. (2005): A Dual Upstream Open Reading Frame-based Autoregulatory Circuit Controlling Polyamine-responsive Translation, Journal of Biological Chemistry 280 [47], pp. 39229-39237. Harding, H. P.; Novoa, I.; Zhang, Y.; Zeng, H.; Wek, R.; Schapira, M. and Ron, D. (2000): Regulated translation initiation controls stress-induced gene expression in mammalian cells, Mol Cell 6 [5], pp. 1099-108. Harris, T. E.; Albrecht, J. H.; Nakanishi, M. and Darlington, G. J. (2001): CCAAT/enhancer-binding protein- alpha cooperates with p21 to inhibit cyclin-dependent kinase-2 activity and induces growth arrest independent of DNA binding, J Biol Chem 276 [31], pp. 29200-9. Hata, K.; Nishimura, R.; Ueda, M.; Ikeda, F.; Matsubara, T.; Ichida, F.; Hisada, K.; Nokubi, T.; Yamaguchi, A. and Yoneda, T. (2005): A CCAAT/enhancer binding protein beta isoform, liver-enriched inhibitory protein, regulates commitment of osteoblasts and adipocytes, Mol Cell Biol 25 [5], pp. 1971-9. He, Feng; Li, Xiangrui; Spatrick, Phyllis; Casillo, Ryan; Dong, Shuyun and Jacobson, Allan (2003): Genome- Wide Analysis of mRNAs Regulated by the Nonsense-Mediated and 52 to 32 mRNA Decay Pathways in Yeast 12 [6], pp. 1439-1452. Hill, Aubrey E. and Sorscher, Eric J. (2006): The non-random distribution of intronless human genes across molecular function categories, FEBS letters 580 [18], pp. 4303-4305. Hinnebusch, A. G. (1984): Evidence for translational regulation of the activator of general amino acid control in yeast, Proc Natl Acad Sci U S A 81 [20], pp. 6442-6. Hinnebusch, A. G. (2005): Translational regulation of GCN4 and the general amino acid control of yeast, Annu Rev Microbiol 59, pp. 407-50.

108 References

Hinnebusch, Alan G. (1997): Translational Regulation of Yeast GCN4. A window on factors that control initiator-tRNA binding to the ribosome, J. Biol. Chem. 272 [35], pp. 21661-21664. Hirai, H.; Zhang, P.; Dayaram, T.; Hetherington, C. J.; Mizuno, S.; Imanishi, J.; Akashi, K. and Tenen, D. G. (2006): C/EBPbeta is required for 'emergency' granulopoiesis, Nat Immunol 7 [7], pp. 732-9. Hu, H. M.; Tian, Q.; Baer, M.; Spooner, C. J.; Williams, S. C.; Johnson, P. F. and Schwartz, R. C. (2000): The C/EBP bZIP domain can mediate lipopolysaccharide induction of the proinflammatory cytokines interleukin-6 and monocyte chemoattractant protein-1, J Biol Chem 275 [21], pp. 16373-81. Humbert, P. O.; Verona, R.; Trimarchi, J. M.; Rogers, C.; Dandapani, S. and Lees, J. A. (2000): E2f3 is critical for normal cellular proliferation, Genes Dev 14 [6], pp. 690-703. Iacono, Michele; Mignone, Flavio and Pesole, Graziano (2005): uAUG and uORFs in human and rodent 5'untranslated mRNAs, Gene 349, p. 97. Iakova, P.; Awad, S. S. and Timchenko, N. A. (2003): Aging reduces proliferative capacities of liver by switch- ing pathways of C/EBPalpha growth arrest, Cell 113 [4], pp. 495-506. Ida-Yonemochi, H.; Ishibashi, O.; Sakai, H. and Saku, T. (2004): Recruitment of osteoclasts in the mandible of osteopetrotic (op/op) mice, Eur J Oral Sci 112 [2], pp. 148-55. Ingolia, N. T.; Ghaemmaghami, S.; Newman, J. R. and Weissman, J. S. (2009): Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling, Science 324 [5924], pp. 218-23. Irvin-Wilson, C. V. and Chaudhuri, G. (2005): Alternative initiation and splicing in dicer gene expression in human breast cells, Breast Cancer Res 7 [4], pp. R563-9. Ishida, Seiichi; Huang, Erich; Zuzan, Harry; Spang, Rainer; Leone, Gustavo; West, Mike and Nevins, Joseph R. (2001): Role for E2F in Control of Both DNA Replication and Mitotic Functions as Revealed from DNA Microarray Analysis, Mol. Cell. Biol. 21 [14], pp. 4684-4699. Isken, Olaf and Maquat, Lynne E. (2007): Quality control of eukaryotic mRNA: safeguarding cells from abnor- mal mRNA function, Genes & Development 21 [15], pp. 1833-3856. Isshiki, H.; Akira, S.; Sugita, T.; Nishio, Y.; Hashimoto, S.; Pawlowski, T.; Suematsu, S. and Kishimoto, T. (1991): Reciprocal expression of NF-IL6 and C/EBP in hepatocytes: possible involvement of NF-IL6 in acute phase protein gene expression, New Biol 3 [1], pp. 63-70. Jackson, R. J.; Hellen, C. U. and Pestova, T. V. (2010): The mechanism of eukaryotic translation initiation and principles of its regulation, Nat Rev Mol Cell Biol 11 [2], pp. 113-27. Janzen, Deanna M.; Frolova, Lyudmila and Geballe, Adam P. (2002): Inhibition of Translation Termination Mediated by an Interaction of Eukaryotic Release Factor 1 with a Nascent Peptidyl-tRNA, Mol. Cell. Biol. 22 [24], pp. 8562-8570. Jensen, L. E. and Whitehead, A. S. (1998): Regulation of serum amyloid A protein expression during the acute- phase response, Biochem. J. 334 [3], pp. 489-503. Johansen, L. M.; Iwama, A.; Lodie, T. A.; Sasaki, K.; Felsher, D. W.; Golub, T. R. and Tenen, D. G. (2001): c- Myc is a critical target for c/EBPalpha in granulopoiesis, Mol Cell Biol 21 [11], pp. 3789-806. Johnson, Peter F. (2005): Molecular stop signs: regulation of cell-cycle arrest by C/EBP transcription factors, J Cell Sci 118 [12], pp. 2545-2555. Jones, F. E.; Jerry, D. J.; Guarino, B. C.; Andrews, G. C. and Stern, D. F. (1996): Heregulin induces in vivo proliferation and differentiation of mammary epithelium into secretory lobuloalveoli, Cell Growth Dif- fer 7 [8], pp. 1031-8. Jousse, Celine; Bruhat, Alain; Carraro, Valerie; Urano, Fumihiko; Ferrara, Marc; Ron, David and Fafournoux, Pierre (2001): Inhibition of CHOP translation by a peptide encoded by an open reading frame localized in the chop 5'UTR, Nucleic Acids Research 29 [21], p. 4341. Jundt, Franziska; Raetzel, Nina; Muller, Christine; Calkhoven, Cornelis F.; Kley, Katharina; Mathas, Stephan; Lietz, Andreas; Leutz, Achim and Dorken, Bernd (2005): A rapamycin derivative (everolimus) controls proliferation through down-regulation of truncated CCAAT enhancer binding protein {beta} and NF- {kappa}B activity in Hodgkin and anaplastic large cell lymphomas, Blood 106 [5], pp. 1801-1807. Kaisho, Tsuneyasu; Tsutsui, Hiroko; Tanaka, Takashi; Tsujimura, Tohru; Takeda, Kiyoshi; Kawai, Taro; Yo- shida, Nobuaki; Nakanishi, Kenji and Akira, Shizuo (1999): Impairment of Natural Killer Cytotoxic Activity and Interferon Gamma Production in Ccaat/Enhancer Binding Protein Gamma-Deficient Mice, The Journal of Experimental Medicine 190 [11], pp. 1573-1582. Kelly, L. M.; Englmeier, U.; Lafon, I.; Sieweke, M. H. and Graf, T. (2000): MafB is an inducer of monocytic differentiation, Embo J 19 [9], pp. 1987-97. Kim, K.; Kim, J. H.; Lee, J.; Jin, H. M.; Kook, H.; Kim, K. K.; Lee, S. Y. and Kim, N. (2007): MafB negatively regulates RANKL-mediated osteoclast differentiation, Blood 109 [8], pp. 3253-9. Kim, K.; Lee, S. H.; Ha Kim, J.; Choi, Y. and Kim, N. (2008): NFATc1 induces osteoclast fusion via up- regulation of Atp6v0d2 and the dendritic cell-specific transmembrane protein (DC-STAMP), Mol En- docrinol 22 [1], pp. 176-85.

109 References

Kirstetter, P.; Schuster, M. B.; Bereshchenko, O.; Moore, S.; Dvinge, H.; Kurz, E.; Theilgaard-Monch, K.; Mansson, R.; Pedersen, T. A.; Pabst, T.; Schrock, E.; Porse, B. T.; Jacobsen, S. E.; Bertone, P.; Tenen, D. G. and Nerlov, C. (2008): Modeling of C/EBPalpha mutant acute myeloid leukemia reveals a common expression signature of committed myeloid leukemia-initiating cells, Cancer Cell 13 [4], pp. 299- 310. Kneissel, M.; Luong-Nguyen, N. H.; Baptist, M.; Cortesi, R.; Zumstein-Mecker, S.; Kossida, S.; O'Reilly, T.; Lane, H. and Susa, M. (2004): Everolimus suppresses cancellous bone loss, bone resorption, and cathepsin K expression by osteoclasts, Bone 35 [5], pp. 1144-56. Kowenz-Leutz, E. and Leutz, A. (1999): A C/EBP beta isoform recruits the SWI/SNF complex to activate myeloid genes, Mol Cell 4 [5], pp. 735-43. Kowenz-Leutz, E.; Twamley, G.; Ansieau, S. and Leutz, A. (1994): Novel mechanism of C/EBP beta (NF-M) transcriptional control: activation through derepression, Genes Dev 8 [22], pp. 2781-91. Kozak, M. (1987): Effects of intercistronic length on the efficiency of reinitiation by eucaryotic ribosomes, Mol Cell Biol 7 [10], pp. 3438-45. Kozak, M. (1989): Circumstances and mechanisms of inhibition of translation by secondary structure in eucaryotic mRNAs, Mol Cell Biol 9 [11], pp. 5134-42. Kozak, M. (1991): An analysis of vertebrate mRNA sequences: intimations of translational control, J Cell Biol 115 [4], pp. 887-903. Kozak, M. (2001): Constraints on reinitiation of translation in mammals, Nucleic Acids Res 29 [24], pp. 5226- 32. Kozak, M. (2002): Pushing the limits of the scanning mechanism for initiation of translation, Gene 299 [1-2], p. 1. Kozak, Marilyn (1978): How do eucaryotic ribosomes select initiation regions in messenger RNA?, Cell 15 [4], pp. 1109-1123. Kozak, Marilyn (1986): Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes, Cell 44 [2], pp. 283-292. Kozak, Marilyn (1987): An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs, Nucleic Acids Res 15 [20], pp. 8125-8148. Kozak, Marilyn (1987): At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells, J Mol Biol 196 [4], pp. 947-950. Kuilman, T.; Michaloglou, C.; Vredeveld, L. C.; Douma, S.; van Doorn, R.; Desmet, C. J.; Aarden, L. A.; Mooi, W. J. and Peeper, D. S. (2008): Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network, Cell 133 [6], pp. 1019-31. Lamb, J.; Ramaswamy, S.; Ford, H. L.; Contreras, B.; Martinez, R. V.; Kittrell, F. S.; Zahnow, C. A.; Patterson, N.; Golub, T. R. and Ewen, M. E. (2003): A mechanism of cyclin D1 action encoded in the patterns of gene expression in human cancer, Cell 114 [3], pp. 323-34. Lee, Min-Ho and Schedl, Tim (2004): Translation repression by GLD-1 protects its mRNA targets from nonsense-mediated mRNA decay in C. elegans, Genes & Development 18 [9], pp. 1047-1059. Lee, Sook; Miller, Maria; Shuman, Jon D. and Johnson, Peter F. (2010): CCAAT/enhancer binding protein beta DNA binding is auto-inhibited by multiple elements that also mediate association with p300/CBP, J Biol Chem 285, pp. 21399-410. Lekstrom-Himes, J. A. (2001): The role of C/EBP(epsilon) in the terminal stages of granulocyte differentiation, Stem Cells 19 [2], pp. 125-33. Lekstrom-Himes, J. and Xanthopoulos, K. G. (1999): CCAAT/enhancer binding protein epsilon is critical for effective neutrophil-mediated response to inflammatory challenge, Blood 93 [9], pp. 3096-105. Leroy, H.; Roumier, C.; Huyghe, P.; Biggio, V.; Fenaux, P. and Preudhomme, C. (2005): CEBPA point mutations in hematological malignancies, Leukemia 19 [3], pp. 329-34. Lin, F. T.; MacDougald, O. A.; Diehl, A. M. and Lane, M. D. (1993): A 30-kDa alternative translation product of the CCAAT/enhancer binding protein alpha message: transcriptional activator lacking antimitotic activity, Proc Natl Acad Sci U S A 90 [20], pp. 9606-10. Lincoln, A. J.; Monczak, Y.; Williams, S. C. and Johnson, P. F. (1998): Inhibition of CCAAT/enhancer-binding protein alpha and beta translation by upstream open reading frames, J Biol Chem 273 [16], pp. 9552-60. Liu, L.; Dilworth, D.; Gao, L.; Monzon, J.; Summers, A.; Lassam, N. and Hogg, D. (1999): Mutation of the CDKN2A 5' UTR creates an aberrant initiation codon and predisposes to melanoma, Nat Genet 21 [1], pp. 128-32. Liu, S.; Croniger, C.; Arizmendi, C.; Harada-Shiba, M.; Ren, J.; Poli, V.; Hanson, R. W. and Friedman, J. E. (1999): Hypoglycemia and impaired hepatic glucose production in mice with a deletion of the C/EBPbeta gene, J Clin Invest 103 [2], pp. 207-13.

110 References

Lopez, R. G.; Garcia-Silva, S.; Moore, S. J.; Bereshchenko, O.; Martinez-Cruz, A. B.; Ermakova, O.; Kurz, E.; Paramio, J. M. and Nerlov, C. (2009): C/EBPalpha and beta couple interfollicular keratinocyte proliferation arrest to commitment and terminal differentiation, Nat Cell Biol 11 [10], pp. 1181-90. Luedde, T.; Duderstadt, M.; Streetz, K.L.; Tacke, F.; Kubicka, S.; Manns, M.P. and Trautwein, C. (2004): C/EBP beta isoforms LIP and LAP modulate progression of the cell cycle in the regenerating mouse liver, Hepatology 40 [2], pp. 356-365. Macejak, D. G. and Sarnow, P. (1991): Internal initiation of translation mediated by the 5' leader of a cellular mRNA, Nature 353 [6339], pp. 90-4. Mantena, S. R.; Kannan, A.; Cheon, Y. P.; Li, Q.; Johnson, P. F.; Bagchi, I. C. and Bagchi, M. K. (2006): C/EBPbeta is a critical mediator of steroid hormone-regulated cell proliferation and differentiation in the uterine epithelium and stroma, Proc Natl Acad Sci U S A 103 [6], pp. 1870-5. Matsui, Motomu; Yachie, Nozomu; Okada, Yuki; Saito, Rintaro and Tomita, Masaru (2007): Bioinformatic analysis of post-transcriptional regulation by uORF in human and mouse, FEBS letters 581 [22], pp. 4184-4188. Meijer, H. A. and Thomas, A. A. (2002): Control of eukaryotic protein synthesis by upstream open reading frames in the 5'-untranslated region of an mRNA, Biochem J 367 [Pt 1], pp. 1-11. Mendell, J. T.; Sharifi, N. A.; Meyers, J. L.; Martinez-Murillo, F. and Dietz, H. C. (2004): Nonsense surveillance regulates expression of diverse classes of mammalian transcripts and mutes genomic noise, Nat Genet 36 [10], pp. 1073-8. Messenguy; Messenguy, F.; Vierendeels; Vierendeels, F.; Piérard; Piérard, A.; Delbecq and Delbecq, P. (2002): Role of RNA surveillance proteins Upf1/CpaR, Upf2 and Upf3 in the translational regulation of yeast CPA1 gene, Current Genetics 41 [4], pp. 224-231. Michalopoulos, G. K. and DeFrances, M. C. (1997): Liver regeneration, Science 276 [5309], pp. 60-6. Mignone, Flavio; Gissi, Carmela; Liuni, Sabino and Pesole, Graziano (2002): Untranslated regions of mRNAs, Genome Biology 3 [3], pp. 4.1 - 4.10. Minamishima, Y. A. and Nakayama, K. (2002): Recovery of liver mass without proliferation of hepatocytes after partial hepatectomy in Skp2-deficient mice, Cancer Res 62 [4], pp. 995-9. Mink, S.; Haenig, B. and Klempnauer, K. H. (1997): Interaction and functional collaboration of p300 and C/EBPbeta, Mol Cell Biol 17 [11], pp. 6609-6617. Mischoulon, D.; Rana, B.; Bucher, N. L. and Farmer, S. R. (1992): Growth-dependent inhibition of CCAAT enhancer-binding protein (C/EBP alpha) gene expression during hepatocyte proliferation in the regenerating liver and in culture, Mol. Cell. Biol. 12 [6], pp. 2553-2560. Mueller, Peter P. and Hinnebusch, Alan G. (1986): Multiple upstream AUG codons mediate translational control of GCN4, Cell 45 [2], pp. 201-207. Muller, Christine; Alunni-Fabbroni, Marianna; Kowenz-Leutz, Elisabeth; Mo, Xianming; Tommasino, Massimo and Leutz, Achim (1999): Separation of C/EBPbeta-mediated proliferation arrest and differentiation pathways, Proc Natl Acad Sci U S A 96 [13], pp. 7276-7281. Muller, Christine; Bremer, Anna; Schreiber, Sandra; Eichwald, Sabrina and Calkhoven, Cornelis F. (2010): Nucleolar retention of a translational C/EBP[alpha] isoform stimulates rDNA transcription and cell size, Embo J 29, pp. 897-909. Muller, H.; Moroni, M. C.; Vigo, E.; Petersen, B. O.; Bartek, J. and Helin, K. (1997): Induction of S-phase entry by E2F transcription factors depends on their nuclear localization, Mol Cell Biol 17 [9], pp. 5508-20. Nakayama, K.; Nagahama, H.; Minamishima, Y. A.; Matsumoto, M.; Nakamichi, I.; Kitagawa, K.; Shirane, M.; Tsunematsu, R.; Tsukiyama, T.; Ishida, N.; Kitagawa, M. and Hatakeyama, S. (2000): Targeted disruption of Skp2 results in accumulation of cyclin E and p27(Kip1), polyploidy and centrosome overdupli- cation, Embo J 19 [9], pp. 2069-81. Neafsey, Daniel E. and Galagan, James E. (2007): Dual Modes of Natural Selection on Upstream Open Reading Frames, Mol Biol Evol 24 [8], pp. 1744-1751. Nerlov, C. (2010): Transcriptional and translational control of C/EBPs: the case for "deep" genetics to understand physiological function, Bioessays 32 [8], pp. 680-6. Nerlov, C. and Graf, T. (1998): PU.1 induces myeloid lineage commitment in multipotent hematopoietic progenitors, Genes Dev 12 [15], pp. 2403-12. Nerlov, C. and Ziff, E. B. (1995): CCAAT/enhancer binding protein-alpha amino acid motifs with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast and mammalian cells, Embo J 14 [17], pp. 4318-28. Nerlov, Claus (2004): C/EBP[alpha] mutations in acute myeloid leukemias, Nat Rev Cancer 4 [5], p. 394. Nerlov, Claus (2007): The C/EBP family of transcription factors: a paradigm for interaction between gene expression and proliferation control, Trends in Cell Biology 17 [7], pp. 318-324.

111 References

Nerlov, Claus (2008): C/EBPs: recipients of extracellular signals through proteome modulation, Curr Opin Cell Biol 20 [2], pp. 180-185. Niehof, M.; Kubicka, S.; Zender, L.; Manns, M. P. and Trautwein, C. (2001): Autoregulation enables different pathways to control CCAAT/enhancer binding protein beta (C/EBP beta) transcription, J Mol Biol 309 [4], pp. 855-68. Niehof, Monika; Streetz, Konrad; Rakemann, Tim; Bischoff, Stephan C.; Manns, Michael P.; Horn, Friedemann and Trautwein, Christian (2001): Interleukin-6-induced Tethering of STAT3 to the LAP/C/EBPbeta Promoter Suggests a New Mechanism of Transcriptional Regulation by STAT3, J. Biol. Chem. 276 [12], pp. 9016-9027. Nyiko, T.; Sonkoly, B.; Merai, Z.; Benkovics, A. H. and Silhavy, D. (2009): Plant upstream ORFs can trigger nonsense-mediated mRNA decay in a size-dependent manner, Plant Mol Biol 71 [4-5], pp. 367-78. Ossipow, V.; Descombes, P. and Schibler, U. (1993): CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials, Proc Natl Acad Sci U S A 90 [17], pp. 8219-23. Oyadomari, S.; Takeda, K.; Takiguchi, M.; Gotoh, T.; Matsumoto, M.; Wada, I.; Akira, S.; Araki, E. and Mori, M. (2001): Nitric oxide-induced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway, Proc Natl Acad Sci U S A 98 [19], pp. 10845-50. Oyama, Masaaki; Itagaki, Chiharu; Hata, Hiroko; Suzuki, Yutaka; Izumi, Tomonori; Natsume, Tohru; Isobe, Toshiaki and Sugano, Sumio (2004): Analysis of Small Human Proteins Reveals the Translation of Up- stream Open Reading Frames of mRNAs, Genome Research 14 [10b], pp. 2048-2052. Oyama, Masaaki; Kozuka-Hata, Hiroko; Suzuki, Yutaka; Semba, Kentaro; Yamamoto, Tadashi and Sugano, Sumio (2007): Diversity of Translation Start Sites May Define Increased Complexity of the Human Short ORFeome, Mol Cell Proteomics 6 [6], pp. 1000-1006. Pabst, T.; Mueller, B. U.; Zhang, P.; Radomska, H. S.; Narravula, S.; Schnittger, S.; Behre, G.; Hiddemann, W. and Tenen, D. G. (2001): Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia, Nat Genet 27 [3], pp. 263-70. Parfitt, A. M.; Drezner, M. K.; Glorieux, F. H.; Kanis, J. A.; Malluche, H.; Meunier, P. J.; Ott, S. M. and Recker, R. R. (1987): Bone histomorphometry: standardization of nomenclature, symbols, and units. Report of the ASBMR Histomorphometry Nomenclature Committee, J Bone Miner Res 2 [6], pp. 595-610. Pei, D. Q. and Shih, C. H. (1991): An "attenuator domain" is sandwiched by two distinct transactivation domains in the transcription factor C/EBP, Mol Cell Biol 11 [3], pp. 1480-7. Pelletier, J. and Sonenberg, N. (1988): Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA, Nature 334 [6180], pp. 320-5. Pepys, M. B. and Hirschfield, G. M. (2003): C-reactive protein: a critical update, J Clin Invest 111 [12], pp. 1805-12. Pesole, Graziano; Gissi, Carmela; Grillo, Giorgio; Licciulli, Flavio; Liuni, Sabino and Saccone, Cecilia (2000): Analysis of oligonucleotide AUG start codon context in eukariotic mRNAs, Gene 261 [1], pp. 85-91. Pickering, Becky M. and Willis, Anne E. (2005): The implications of structured 5' untranslated regions on translation and disease, Semin Cell Dev Biol 16 [1], pp. 39-47. Piva, R.; Pellegrino, E.; Mattioli, M.; Agnelli, L.; Lombardi, L.; Boccalatte, F.; Costa, G.; Ruggeri, B. A.; Cheng, M.; Chiarle, R.; Palestro, G.; Neri, A. and Inghirami, G. (2006): Functional validation of the anaplastic lymphoma kinase signature identifies CEBPB and BCL2A1 as critical target genes, J Clin Invest 116 [12], pp. 3171-82. Poli, V. (1998): The role of C/EBP isoforms in the control of inflammatory and native immunity functions, J. Biol. Chem. 273 [45], pp. 29279-82. Porse, B. T.; Pedersen, T. A.; Xu, X.; Lindberg, B.; Wewer, U. M.; Friis-Hansen, L. and Nerlov, C. (2001): E2F repression by C/EBPalpha is required for adipogenesis and granulopoiesis in vivo, Cell 107 [2], pp. 247-58. Porse, Bo T.; Bryder, David; Theilgaard-Monch, Kim; Hasemann, Marie S.; Anderson, Kristina; Damgaard, Inge; Jacobsen, Sten Eirik W. and Nerlov, Claus (2005): Loss of C/EBP{alpha} cell cycle control increases myeloid progenitor proliferation and transforms the neutrophil granulocyte lineage, The Journal of Experimental Medicine 202 [1], p. 85. Qiao, L.; Maclean, P. S.; You, H.; Schaack, J. and Shao, J. (2006): Knocking down Liver C/EBP{alpha} by Adenovirus-transduced siRNA Improves Hepatic Gluconeogenesis and Lipid Homeostasis in db/db Mice, Endocrinology. Rabadan-Diehl, C.; MartÌnez, A.; Volpi, S.; Subburaju, S. and Aguilera, G. (2007): Inhibition of Vasopressin V1b Receptor Translation By Upstream Open Reading Frames in the 5'-Untranslated Region, Journal of Neuroendocrinology 19 [4], pp. 309-319.

112 References

Rahmani, Fatemeh; Hummel, Maureen; Schuurmans, Jolanda; Wiese-Klinkenberg, Anika; Smeekens, Sjef and Hanson, Johannes (2009): Sucrose Control of Translation Mediated by an Upstream Open Reading Frame-Encoded Peptide, Plant Physiol 150 [3], pp. 1356-1367. Rajkowitsch, L.; Vilela, C.; Berthelot, K.; Ramirez, C. V. and McCarthy, J. E. (2004): Reinitiation and recycling are distinct processes occurring downstream of translation termination in yeast, J Mol Biol 335 [1], pp. 71-85. Ramani, A. K.; Nelson, A. C.; Kapranov, P.; Bell, I.; Gingeras, T. R. and Fraser, A. G. (2009): High resolution transcriptome maps for wild-type and nonsense-mediated decay-defective Caenorhabditis elegans, Ge- nome Biol 10 [9], p. R101. Ramji, D. P. and Foka, P. (2002): CCAAT/enhancer-binding proteins: structure, function and regulation, Bio- chem J 365 [Pt 3], pp. 561-75. Ramji, D. P.; Vitelli, A.; Tronche, F.; Cortese, R. and Ciliberto, G. (1993): The two C/EBP isoforms, IL- 6DBP/NF-IL6 and C/EBP delta/NF-IL6 beta, are induced by IL-6 to promote acute phase gene transcription via different mechanisms, Nucleic Acids Res. 21 [2], pp. 289-94. Raney, Alexa; Baron, Anita C.; Mize, Gregory J.; Law, G. Lynn and Morris, David R. (2000): In Vitro Transla- tion of the Upstream Open Reading Frame in the Mammalian mRNA EncodingS-Adenosylmethionine Decarboxylase, Journal of Biological Chemistry 275 [32], pp. 24444-24450. Rask, K.; Thorn, M.; Ponten, F.; Kraaz, W.; Sundfeldt, K.; Hedin, L. and Enerback, S. (2000): Increased expression of the transcription factors CCAAT-enhancer binding protein-beta (C/EBBeta) and C/EBzeta (CHOP) correlate with invasiveness of human colorectal cancer, Int J Cancer 86 [3], pp. 337-43. Raught, B.; Gingras, A. C.; James, A.; Medina, D.; Sonenberg, N. and Rosen, J. M. (1996): Expression of a translationally regulated, dominant-negative CCAAT/enhancer-binding protein beta isoform and up- regulation of the eukaryotic translation initiation factor 2alpha are correlated with neoplastic transformation of mammary epithelial cells, Cancer Res 56 [19], pp. 4382-6. Ray, A. and Ray, B. K. (1994): Serum amyloid A gene expression under acute-phase conditions involves partici- pation of inducible C/EBP-beta and C/EBP-delta and their activation by phosphorylation, Mol. Cell. Biol. 14 [6], pp. 4324-32. Ren, B.; Cam, H.; Takahashi, Y.; Volkert, T.; Terragni, J.; Young, R. A. and Dynlacht, B. D. (2002): E2F inte- grates cell cycle progression with DNA repair, replication, and G(2)/M checkpoints, Genes Dev 16 [2], pp. 245-56. Robinson, G. W.; Johnson, P. F.; Hennighausen, L. and Sterneck, E. (1998): The C/EBPbeta transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland, Genes Dev 12 [12], pp. 1907-16. Roy, B.; Vaughn, J. N.; Kim, B. H.; Zhou, F.; Gilchrist, M. A. and Von Arnim, A. G. (2010): The h subunit of eIF3 promotes reinitiation competence during translation of mRNAs harboring upstream open reading frames, Rna 16 [4], pp. 748-61. Ruiz-Echevarria, M. J. and Peltz, S. W. (2000): The RNA binding protein Pub1 modulates the stability of transcripts containing upstream open reading frames, Cell 101 [7], pp. 741-51. Sakharkar, Kishore Ramaji; Sakharkar, Meena Kishore; Culiat, Cymbeline T.; Chow, Vincent T. K. and Pervaiz, Shazib (2006): Functional and evolutionary analyses on expressed intronless genes in the mouse genome, FEBS letters 580 [5], pp. 1472-1478. Sato, Yoshitaka; Miyake, Katsuhide; Kaneoka, Hidenori and Iijima, Shinji (2006): Sumoylation of CCAAT/enhancer-binding protein alpha and its functional roles in hepatocyte differentiation, J. Biol. Chem., p. M600852200. Scheper, G. C.; van der Knaap, M. S. and Proud, C. G. (2007): Translation matters: protein synthesis defects in inherited disease, Nat Rev Genet 8 [9], pp. 711-23. Schrem, Harald; Klempnauer, Jurgen and Borlak, Jurgen (2002): Liver-Enriched Transcription Factors in Liver Function and Development. Part I: The Hepatocyte Nuclear Factor Network and Liver-Specific Gene Expression, Pharmacol Rev 54 [1], pp. 129-158. Schwartz, C.; Beck, K.; Mink, S.; Schmolke, M.; Budde, B.; Wenning, D. and Klempnauer, K. H. (2003): Re- cruitment of p300 by C/EBPbeta triggers phosphorylation of p300 and modulates coactivator activity, Embo J 22 [4], pp. 882-92. Schwenk, F.; Baron, U. and Rajewsky, K. (1995): A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells, Nucleic Acids Res 23 [24], pp. 5080-1. Screpanti, I.; Musiani, P.; Bellavia, D.; Cappelletti, M.; Aiello, F. B.; Maroder, M.; Frati, L.; Modesti, A.; Gulino, A. and Poli, V. (1996): Inactivation of the IL-6 gene prevents development of multicentric Cas- tleman's disease in C/EBP beta-deficient mice, J Exp Med 184 [4], pp. 1561-6.

113 References

Screpanti, I.; Romani, L.; Musiani, P.; Modesti, A.; Fattori, E.; Lazzaro, D.; Sellitto, C.; Scarpa, S.; Bellavia, D.; Lattanzio, G. and et al. (1995): Lymphoproliferative disorder and imbalanced T-helper response in C/EBP beta-deficient mice, Embo J. 14 [9], pp. 1932-41. Seagroves, Tiffany N.; Krnacik, Susanne; Raught, Brian; Gay, Jason; Burgess-Beusse, Bonnie; Darlington, Gretchen J. and Rosen, Jeffrey M. (1998): C/EBPbeta , but not C/EBPalpha , is essential for ductal morphogenesis, lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland, Genes Dev. 12 [12], pp. 1917-1928. Sears, R. C. and Sealy, L. (1994): Multiple forms of C/EBP beta bind the EFII enhancer sequence in the Rous sarcoma virus long terminal repeat, Mol Cell Biol 14 [7], pp. 4855-71. Sebastian, T. and Johnson, P. F. (2006): Stop and go: anti-proliferative and mitogenic functions of the transcription factor C/EBPbeta, Cell Cycle 5 [9], pp. 953-7. Sebastian, T.; Malik, R.; Thomas, S.; Sage, J. and Johnson, P. F. (2005): C/EBPbeta cooperates with RB:E2F to implement Ras(V12)-induced cellular senescence, Embo J 24 [18], pp. 3301-12. Sellick, G. S.; Spendlove, H. E.; Catovsky, D.; Pritchard-Jones, K. and Houlston, R. S. (2005): Further evidence that germline CEBPA mutations cause dominant inheritance of acute myeloid leukaemia, Leukemia 19 [7], pp. 1276-8. Shao, Jianhua; Qiao, Liping; Janssen, Rachel C.; Pagliassotti, Michael and Friedman, Jacob E. (2005): Chronic Hyperglycemia Enhances PEPCK Gene Expression and Hepatocellular Glucose Production Via Ele- vated Liver Activating Protein/Liver Inhibitory Protein Ratio, Diabetes 54 [4], pp. 976-984. Slomiany, B. A.; D'Arigo, K. L.; Kelly, M. M. and Kurtz, D. T. (2000): C/EBPalpha inhibits cell growth via direct repression of E2F-DP-mediated transcription, Mol Cell Biol 20 [16], pp. 5986-97. Smink, J. J.; Begay, V.; Schoenmaker, T.; Sterneck, E.; de Vries, T. J. and Leutz, A. (2009): Transcription factor C/EBPbeta isoform ratio regulates osteoclastogenesis through MafB, Embo J 28 [12], pp. 1769-1781. Smink, J. J. and Leutz, A. (2010): Rapamycin and the transcription factor C/EBPbeta as a switch in osteoclast differentiation: implications for lytic bone diseases, J Mol Med 88 [3], pp. 227-33. Smith, M. L.; Cavenagh, J. D.; Lister, T. A. and Fitzgibbon, J. (2004): Mutation of CEBPA in familial acute myeloid leukemia, N Engl J Med 351 [23], pp. 2403-7. Sobczak, K. and Krzyzosiak, W. J. (2002): Structural determinants of BRCA1 translational regulation, J Biol Chem 277 [19], pp. 17349-58. Sonenberg, N. and Hinnebusch, A. G. (2009): Regulation of translation initiation in eukaryotes: mechanisms and biological targets, Cell 136 [4], pp. 731-45. Spevak, Christina C.; Park, Eun-Hee; Geballe, Adam P.; Pelletier, Jerry and Sachs, Matthew S. (2006): her-2 upstream open reading frame effects on the use of downstream initiation codons, Biochem Biophys Res Commun 350 [4], p. 834. Stein, B.; Cogswell, P. C. and Baldwin, A. S., Jr. (1993): Functional and physical associations between NF- kappa B and C/EBP family members: a Rel domain-bZIP interaction, Mol Cell Biol 13 [7], pp. 3964- 74. Sterneck, E.; Muller, C.; Katz, S. and Leutz, A. (1992): Autocrine growth induced by kinase type oncogenes in myeloid cells requires AP-1 and NF-M, a myeloid specific, C/EBP-like factor, Embo J. 11 [1], pp. 115- 26. Sterneck, E.; Paylor, R.; Jackson-Lewis, V.; Libbey, M.; Przedborski, S.; Tessarollo, L.; Crawley, J. N. and Johnson, P. F. (1998): Selectively enhanced contextual fear conditioning in mice lacking the transcriptional regulator CCAAT/enhancer binding protein delta, Proc Natl Acad Sci U S A 95 [18], pp. 10908- 13. Sterneck, E.; Tessarollo, L. and Johnson, P. F. (1997): An essential role for C/EBPbeta in female reproduction, Genes Dev. 11 [17], pp. 2153-62. Sterneck, E.; Zhu, S.; Ramirez, A.; Jorcano, J. L. and Smart, R. C. (2006): Conditional ablation of C/EBP beta demonstrates its keratinocyte-specific requirement for cell survival and mouse skin tumorigenesis, On- cogene 25 [8], pp. 1272-6. Stockklausner, C.; Breit, S.; Neu-Yilik, G.; Echner, N.; Hentze, M. W.; Kulozik, A. E. and Gehring, N. H. (2006): The uORF-containing thrombopoietin mRNA escapes nonsense-mediated decay (NMD), Nu- cleic Acids Res 34 [8], pp. 2355-63. Su, W. C.; Chou, H. Y.; Chang, C. J.; Lee, Y. M.; Chen, W. H.; Huang, K. H.; Lee, M. Y. and Lee, S. C. (2003): Differential activation of a C/EBP beta isoform by a novel redox switch may confer the lipopolysaccharide-inducible expression of interleukin-6 gene, J Biol Chem 278 [51], pp. 51150-8. Sundfeldt, K.; Ivarsson, K.; Carlsson, M.; Enerback, S.; Janson, P. O.; Brannstrom, M. and Hedin, L. (1999): The expression of CCAAT/enhancer binding protein (C/EBP) in the human ovary in vivo: specific increase in C/EBPbeta during epithelial tumour progression, Br J Cancer 79 [7-8], pp. 1240-8. Takayanagi, H.; Kim, S.; Koga, T.; Nishina, H.; Isshiki, M.; Yoshida, H.; Saiura, A.; Isobe, M.; Yokochi, T.; Inoue, J.; Wagner, E. F.; Mak, T. W.; Kodama, T. and Taniguchi, T. (2002): Induction and activation of

114 References

the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts, Dev Cell 3 [6], pp. 889-901. Takayanagi, H.; Kim, S.; Matsuo, K.; Suzuki, H.; Suzuki, T.; Sato, K.; Yokochi, T.; Oda, H.; Nakamura, K.; Ida, N.; Wagner, E. F. and Taniguchi, T. (2002): RANKL maintains bone homeostasis through c-Fos- dependent induction of interferon-beta, Nature 416 [6882], pp. 744-9. Takayuki, Hattori; Nobumichi, Ohoka; Hidetoshi, Hayashi and Kikuo, Onozaki (2003): C/EBP homologous protein (CHOP) up-regulates IL-6 transcription by trapping negative regulating NF-IL6 isoform, FEBS letters 541 [1], p. 33. Tanaka, T.; Akira, S.; Yoshida, K.; Umemoto, M.; Yoneda, Y.; Shirafuji, N.; Fujiwara, H.; Suematsu, S.; Yo- shida, N. and Kishimoto, T. (1995): Targeted disruption of the NF-IL6 gene discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages, Cell 80 [2], pp. 353-61. Tanaka, T.; Yoshida, N.; Kishimoto, T. and Akira, S. (1997): Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/EBPdelta gene, Embo J 16 [24], pp. 7432-43. Tang, Q. Q.; Otto, T. C. and Lane, M. D. (2003): CCAAT/enhancer-binding protein beta is required for mitotic clonal expansion during adipogenesis, Proc Natl Acad Sci U S A 100 [3], pp. 850-5. Timchenko, N. A.; Harris, T. E.; Wilde, M.; Bilyeu, T. A.; Burgess-Beusse, B. L.; Finegold, M. J. and Darling- ton, G. J. (1997): CCAAT/enhancer binding protein alpha regulates p21 protein and hepatocyte proliferation in newborn mice, Mol Cell Biol 17 [12], pp. 7353-61. Timchenko, N. A.; Welm, A. L.; Lu, X. and Timchenko, L. T. (1999): CUG repeat binding protein (CUGBP1) interacts with the 5' region of C/EBPbeta mRNA and regulates translation of C/EBPbeta isoforms, Nu- cleic Acids Res 27 [22], pp. 4517-25. Timchenko, N. A.; Wilde, M. and Darlington, G. J. (1999): C/EBPalpha regulates formation of S-phase-specific E2F-p107 complexes in livers of newborn mice, Mol Cell Biol 19 [4], pp. 2936-45. Timchenko, N. A.; Wilde, M.; Iakova, P.; Albrecht, J. H. and Darlington, G. J. (1999): E2F/p107 and E2F/p130 complexes are regulated by C/EBPalpha in 3T3-L1 adipocytes, Nucleic Acids Res 27 [17], pp. 3621-30. Timchenko, N. A.; Wilde, M.; Nakanishi, M.; Smith, J. R. and Darlington, G. J. (1996): CCAAT/enhancer- binding protein alpha (C/EBP alpha) inhibits cell proliferation through the p21 (WAF-1/CIP-1/SDI-1) protein, Genes & Development 10 [7], pp. 804-815. Timchenko, Nikolai A.; Wang, Gou-Li and Timchenko, Lubov T. (2005): RNA CUG-binding Protein 1 In- creases Translation of 20-kDa Isoform of CCAAT/Enhancer-binding Protein {beta} by Interacting with the {alpha} and {beta} Subunits of Eukaryotic Initiation Translation Factor 2, J. Biol. Chem. 280 [21], pp. 20549-20557. Tominaga, H.; Maeda, S.; Hayashi, M.; Takeda, S.; Akira, S.; Komiya, S.; Nakamura, T.; Akiyama, H. and Imamura, T. (2008): CCAAT/enhancer-binding protein beta promotes osteoblast differentiation by enhancing Runx2 activity with ATF4, Mol Biol Cell 19 [12], pp. 5373-86. Touriol, Christian; Bornes, StÈphanie; Bonnal, Sophie; Audigier, Sylvie; Prats, HervÈ; Prats, Anne-Catherine and Vagner, StÈphan (2003): Generation of protein isoform diversity by alternative initiation of translation at non-AUG codons, Biology of the Cell 95 [3-4], pp. 169-178. Trautwein, C.; Caelles, C.; van der Geer, P.; Hunter, T.; Karin, M. and Chojkier, M. (1993): Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain, Nature 364 [6437], pp. 544-7. Uematsu, Satoshi; Kaisho, Tsuneyasu; Tanaka, Takashi; Matsumoto, Makoto; Yamakami, Megumi; Omori, Hiroko; Yamamoto, Masahiro; Yoshimori, Tamotsu and Akira, Shizuo (2007): The C/EBPbeta Isoform 34-kDa LAP Is Responsible for NF-IL-6-Mediated Gene Induction in Activated Macrophages, but Is Not Essential for Intracellular Bacteria Killing, J Immunol 179 [8], pp. 5378-5386. Wang, H.; Iakova, P.; Wilde, M.; Welm, A.; Goode, T.; Roesler, W. J. and Timchenko, N. A. (2001): C/EBPalpha arrests cell proliferation through direct inhibition of Cdk2 and Cdk4, Mol Cell 8 [4], pp. 817-28. Wang, Haitao; Larris, Brian; Peiris, T. Harshani; Zhang, Liping; Le Lay, John; Gao, Yan and Greenbaum, Linda (2007): C/EBPbeta activates E2F regulated genes in vivo via recruitment of the coactivator CBP/P300, Journal of Biological Chemistry 282, pp. 24679-24688. Wang, N. D.; Finegold, M. J.; Bradley, A.; Ou, C. N.; Abdelsayed, S. V.; Wilde, M. D.; Taylor, L. R.; Wilson, D. R. and Darlington, G. J. (1995): Impaired energy homeostasis in C/EBP alpha knockout mice, Sci- ence 269 [5227], pp. 1108-12. Wegrzyn, J. L.; Drudge, T. M.; Valafar, F. and Hook, V. (2008): Bioinformatic analyses of mammalian 5'-UTR sequence properties of mRNAs predicts alternative translation initiation sites, BMC Bioinformatics 9, p. 232. Wen, Y.; Liu, Y.; Xu, Y.; Zhao, Y.; Hua, R.; Wang, K.; Sun, M.; Li, Y.; Yang, S.; Zhang, X. J.; Kruse, R.; Cichon, S.; Betz, R. C.; Nothen, M. M.; van Steensel, M. A.; van Geel, M.; Steijlen, P. M.; Hohl, D.; Huber, M.; Dunnill, G. S.; Kennedy, C.; Messenger, A.; Munro, C. S.; Terrinoni, A.; Hovnanian, A.;

115 References

Bodemer, C.; de Prost, Y.; Paller, A. S.; Irvine, A. D.; Sinclair, R.; Green, J.; Shang, D.; Liu, Q.; Luo, Y.; Jiang, L.; Chen, H. D.; Lo, W. H.; McLean, W. H.; He, C. D. and Zhang, X. (2009): Loss-of- function mutations of an inhibitory upstream ORF in the human hairless transcript cause Marie Unna hereditary hypotrichosis, Nat Genet 41 [2], pp. 228-33. Wessells, Jennifer; Yakar, Shoshana and Johnson, Peter F. (2004): Critical Prosurvival Roles for C/EBP{beta} and Insulin-Like Growth Factor I in Macrophage Tumor Cells, Mol. Cell. Biol. 24 [8], pp. 3238-3250. Westmacott, A.; Burke, Z. D.; Oliver, G.; Slack, J. M. and Tosh, D. (2006): C/EBPalpha and C/EBPbeta are markers of early liver development, Int J Dev Biol 50 [7], pp. 653-7. Wiesenthal, Volker (2005): Regulated translation of the C/EBPalpha and C/EBPbeta mRNAs : a genetic mouse model and the establishment of a translation control reporter system, Dissertation , Dissertation, Math.-Nat. Fakultät I, Humboldt University, Berlin. Wiestner, A.; Schlemper, R. J.; van der Maas, A. P. and Skoda, R. C. (1998): An activating splice donor mutation in the thrombopoietin gene causes hereditary thrombocythaemia, Nat Genet 18 [1], pp. 49-52. Wilkie, Gavin S.; Dickson, Kirsten S. and Gray, Nicola K. (2003): Regulation of mRNA translation by 5'- and 3'-UTR-binding factors, Trends Biochem Sci 28 [4], pp. 182-188. Williams, S. C.; Baer, M.; Dillner, A. J. and Johnson, P. F. (1995): CRP2 (C/EBP beta) contains a bipartite regulatory domain that controls transcriptional activation, DNA binding and cell specificity, Embo J 14 [13], pp. 3170-83. Xiong, Wei; Hsieh, Ching-Chyuan; Kurtz, Andrew J.; Rabek, Jeffrey P. and Papaconstantinou, John (2001): Regulation of CCAAT/enhancer-binding protein-{beta} isoform synthesis by alternative translational initiation at multiple AUG start sites, Nucleic Acids Res 29 [14], pp. 3087-3098. Yamanaka, R.; Kim, G. D.; Radomska, H. S.; Lekstrom-Himes, J.; Smith, L. T.; Antonson, P.; Tenen, D. G. and Xanthopoulos, K. G. (1997): CCAAT/enhancer binding protein epsilon is preferentially up-regulated during granulocytic differentiation and its functional versatility is determined by alternative use of promoters and differential splicing, Proc Natl Acad Sci U S A 94 [12], pp. 6462-7. Yamanaka, Ryuya; Barlow, Carrolee; Lekstrom-Himes, Julie; Castilla, Lucio H.; Liu, Pu P.; Eckhaus, Michael; Decker, Thomas; Wynshaw-Boris, Anthony and Xanthopoulos, Kleanthis G. (1997): Impaired granulopoiesis, myelodysplasia, and early lethality in CCAAT/enhancer binding protein epsilon-deficient mice, Proc Natl Acad Sci U S A 94 [24], pp. 13187-13192. Zahnow, C. A. (2002): CCAAT/enhancer binding proteins in normal mammary development and breast cancer, Breast Cancer Res 4 [3], pp. 113-21. Zahnow, C. A. (2009): CCAAT/enhancer-binding protein beta: its role in breast cancer and associations with receptor tyrosine kinases, Expert Rev Mol Med 11, p. e12. Zahnow, C. A.; Cardiff, R. D.; Laucirica, R.; Medina, D. and Rosen, J. M. (2001): A role for CCAAT/enhancer binding protein beta-liver-enriched inhibitory protein in mammary epithelial cell proliferation, Cancer Res 61 [1], pp. 261-9. Zahnow, C. A.; Younes, P.; Laucirica, R. and Rosen, J. M. (1997): Overexpression of C/EBPbeta-LIP, a naturally occurring, dominant-negative transcription factor, in human breast cancer, J Natl Cancer Inst 89 [24], pp. 1887-91. Zaragoza, K.; Begay, V.; Schuetz, A.; Heinemann, U. and Leutz, A. (2010): Repression of transcriptional activity of C/EBPalpha by E2F-dimerization partner complexes, Mol Cell Biol 30 [9], pp. 2293-304. Zaret, K. S. and Grompe, M. (2008): Generation and regeneration of cells of the liver and pancreas, Science 322 [5907], pp. 1490-4. Zhang, D. E.; Zhang, P.; Wang, N. D.; Hetherington, C. J.; Darlington, G. J. and Tenen, D. G. (1997): Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein alpha-deficient mice, Proc Natl Acad Sci U S A 94 [2], pp. 569-74. Zhou, W. and Song, W. (2006): Leaky scanning and reinitiation regulate BACE1 gene expression, Mol Cell Biol 26 [9], pp. 3353-64. Zhu, Songyun; Yoon, Kyungsil; Sterneck, Esta; Johnson, Peter F. and Smart, Robert C. (2002): CCAAT/enhancer binding protein-beta is a mediator of keratinocyte survival and skin tumorigenesis involving oncogenic Ras signaling, PNAS 99 [1], pp. 207-212. Zinszner, H.; Kuroda, M.; Wang, X.; Batchvarova, N.; Lightfoot, R. T.; Remotti, H.; Stevens, J. L. and Ron, D. (1998): CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum, Genes Dev 12 [7], pp. 982-95.

116 Erklärung

Erklärung

Ich versichere hiermit, dass die von mir vorgelegte Dissertation selbstständig angefertigt wurde und ich die Stellen in der Arbeit, die anderen Werken in Wortlaut oder Sinn nach entnommen sind, in jedem Einzelfall als Entlehnung kenntlich gemacht habe. Diese Dissertation wurde noch keiner anderen Fakultät zur Prüfung vorgelegt.

Berlin, 21.09.2010

117

Publikationsliste

K Wethmar, J Smink and A Leutz Upstream open reading frames: Molecular switches in (patho)physiology BioEssays 2010; 32 (10): 885-893.

K Wethmar, V Bégay, J Smink, K Zaragoza, V Wiesenthal, B Dörken, CF Calkhoven and A Leutz C/EBPuORF mice – a genetic model for uORF-mediated translational control in mammals Genes Dev. 2010 Jan 1; 24 (1): 15-20.

Varga G, Balkow S, Wild MK, Stadtbaeumer A, Krummen M, Rothoeft T, Higuchi T, Beis- sert S, Wethmar K, Scharffetter-Kochanek K, Vestweber D, Grabbe S. Active MAC-1 (CD11b/CD18) on DCs inhibits full T-cell activation. Blood 2007; 109: 661-9

Wethmar K, Helmus Y, Luhn K, Jones C, Laskowska A, Varga G, Grabbe S, Lyck R, Engel- hardt B, Bixel MG, Butz S, Loser K, Beissert S, Ipe U, Vestweber D, Wild MK. Migration of immature mouse DC across resting endothelium is mediated by ICAM-2 but independent of beta2-integrins and murine DC-SIGN homologues. Eur J Immunol 2006; 36: 2781-94

Acton ST, Wethmar K, Ley K. Automatic tracking of rolling leukocytes in vivo. Microvasc Res. 2002 Jan;63(1):139-48.

Singbartl K, Thatte J, Smith ML, Wethmar K, Day K, Ley K. A CD2-green fluorescence protein-transgenic mouse reveals very late antigen-4-dependent CD8+ lymphocyte rolling in inflamed venules. J Immunol. 2001 Jun 15;166(12):7520-6.

Berlin, 21.09.2010

118