Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7356-7360, October 1989 Biochemistry An RNA polymerase II transcription factor has an associated DNA-dependent ATPase (dATPase) activity strongly stimulated by the TATA region of promoters (messenger RNA synthesis/core promoter/run-off transcription) RONALD C. CONAWAY* AND JOAN WELIKY CONAWAY* Department of Chemistry and Clayton Foundation Biochemical Institute, University of Texas at Austin, Austin, TX 78712-1096 Communicated by Michael J. Chamberlin, June 26, 1989 (received for review May 11, 1989)

ABSTRACT A transcription factor required for synthesis itate formation of the functional RNA polymerase II preini- of accurately initiated run-off transcripts by RNA polymerase tiation complex have not been defined. Finally, it has not II has been purified and shown to have an associated DNA- been possible to identify the factor or factors that mediate the dependent ATPase (dATPase) activity that is strongly stimu- ATP (dATP)-dependent activation of the preinitiation com- lated by the TATA region of promoters. This transcription plex or to determine how ATP is utilized in this activation factor, designated 8, was purified more than 3000-fold from step: whether it is hydrolyzed to provide energy or to serve extracts of crude rat liver nuclei and has a native molecular as a phosphate donor in a phosphorylation reaction or mass of approximately 230 kDa. DNA-dependent ATPase whether it is bound by a component of the transcription (dATPase) and transcription activities copurify when 8 is system. analyzed by hydrophobic interaction and ion-exchange HPLC, To address these questions, we sought to assemble a arguing that transcription factor 6 possesses an ATPase (dAT- transcription system composed of homogeneous RNA poly- Pase) activity. ATPase (dATPase) is specific for adenine nu- merase II and accessory factors. Thus far, we have purified cleotides; ATP and dATP, but not CTP, UTP, or GTP, are two accessory transcription factors, designated a and 8ry, to hydrolyzed. ATPase (dATPase) is stimulated by both double- apparent homogeneity and have demonstrated that they play stranded and single-stranded DNAs, including pUC18, ssM13, an integral role in formation of the functional preinitiation and poly(dT); however, DNA fragments containing the TATA complex (8, 11). We recently purified a third accessory region of either the adenovirus 2 major late or mouse inter- factor, designated 8, and found that it has an associated leukin 3 promoters stimulate ATPase as much as 10-fold more DNA-dependent ATPase (dATPase) activity. Further anal- effectively than DNA fragments containing nonpromoter se- ysis has led to the surprising discovery that this ATPase quences. These data suggest the intriguing possibility that 8 (dATPase) activity is strongly stimulated by the TATA region plays a critical role in the ATP (dATP)-dependent activation of of promoters. run-off transcription through a direct interaction with the TATA region of promoters. MATERIALS AND METHODS Initiation of mRNA synthesis is a key control point in the Materials. Male Sprague-Dawley rats (200-300 g) were from expression of many eukaryotic genes. Biochemical studies Simonson or Harlan-Sprague-Dawley. Unlabeled ultrapure have shown that initiation is an elaborate process requiring, ribonucleoside 5'-triphosphates and 2'-deoxynucleoside 5'- in addition to RNA polymerase II, multiple accessory tran- triphosphates were purchased from Pharmacia LKB Biotech- scription factors (1-12) and an ATP (dATP) cofactor (13-16). nology. [a-32P]CTP, [a-32P]ATP, [a-32P]GTP, [a-32P]UTP, Although the mechanism of initiation is at present poorly and [a-32P]dATP, all at 800 Ci/mmol (1 Ci = 37 GBq), were understood, a crude model has emerged from analyses of obtained from NEN. Bovine serum albumin (reagent grade) partially purified transcription systems. According to this was from ICN Immunobiologicals. Phenylmethylsulfonyl flu- model, one or more accessory factors first interact specifi- oride, antipain, and leupeptin were obtained from Sigma. cally with the TATA region of promoters. RNA polymerase Polyethylenimine-cellulose sheets were from Brinkmann. II, assisted by additional accessory factors, then recognizes Poly(dA), poly(dT), poly(C), poly(A), heparin, and single- and assembles with this nucleoprotein complex to form a stranded M13mpl8 were purchased from Sigma. functional preinitiation complex (4, 11, 17-21). Finally, in an Buffers. Buffer A was 20 mM Hepes (adjusted to pH 7.9 ATP (dATP)-dependent step, this complex is converted to an with "activated" complex, which is capable of initiating RNA NaOH)/1 mM EDTA/1 mM dithiothreitol/20% (vol/ synthesis rapidly upon addition of the remaining ribonucle- vol) glycerol/0.5 mM phenylmethylsulfonyl fluoride. Buffer oside triphosphates (16). C was 40 mM Tris-HCl, pH 7.9/0.5 mM EDTA/1 mM Although these studies have provided insight into the dithiothreitol/10% glycerol. Buffer D was 40 mM Hepes mechanism of initiation, an elucidation of the interactions (adjusted to pH 7.9 with NaOH)/0.5 mM EDTA/1 mM leading to formation and activation of the RNA polymerase dithiothreitol/10% glycerol. Buffer F was 40 mM Tris HCl, II preinitiation complex has been hindered by lack of a pH 7.5/0.5 mM EDTA/1 mM dithiothreitol/10% glycerol. purified transcription system. Several crucial questions re- Preparation of the Nuclear Extract. Fifty rats were lightly main unanswered. First, the exact number of accessory anesthetized with ether and killed by decapitation. All further factors required for initiation is not known; in fact, few ofthe steps were carried out at 4°C. The livers were removed, factors have been purified to homogeneity. Second, the rinsed in TMSD buffer (10 mM Tris HCl, pH 7.5/1.5 mM mechanisms by which the individual accessory factors facil- Abbreviation: Ad(-50 to +10), nucleotides -50 to +10 (relative to the cap site) of the adenovirus 2 major late promoter. The publication costs of this article were defrayed in part by page charge *Present address: Program in Molecular and Cell Biology, Oklahoma payment. This article must therefore be hereby marked "advertisement" Medical Research Foundation, 825 N.E. 13th Street, Oklahoma in accordance with 18 U.S.C. §1734 solely to indicate this fact. City, OK 73104.

7356 Downloaded by guest on October 3, 2021 Biochemistry: Conaway and Conaway Proc. Natl. Acad. Sci. USA 86 (1989) 7357 MgCl2/0.25 M sucrose/0.5 mM dithiothreitol/0.5 mM phen- DEAE-NPR HPLC column (35 x 4.6 mm) (Hewlett- ylmethylsulfonyl fluoride), minced, suspended in TMSD Packard) equilibrated with buffer C containing 0.05 M KCl. buffer to a final volume of 1500 ml, homogenized by one pass The column was eluted at 0.6 ml/min with a 9-ml linear through a continuous-flow homogenizer (22), and centrifuged gradient from 0.05 M to 0.27 M KCl, and 0.2-ml fractions at 800 x g for 10 min. The crude nuclear pellet was washed were collected. twice by resuspension in TMSD buffer and centrifugation at Preparation of RNA Polymerase II and Transcription Fac- 800 x g for 10 min, suspended in TMSD buffer to 2000 ml, and tors. RNA polymerase II and transcription factors a and fry extracted with 0.33 M (NH4)2SO4 by dropwise addition of 180 were purified from rat liver as previously described (8, 11). ml of saturated (NH4)2SO4 with gentle stirring (see Fig. 1). Fraction D was purified from the nuclear extract by phos- After 30 min, the extract was centrifuged at 12,000 X g for 90 phocellulose and carboxymethyl-Sephadex chromatography min. Solid (NH4)2SO4 was then added slowly to the super- performed as described (8). Active fractions from carboxy- natant (fraction I; see Table 1) to 40% saturation [0.186 g of methyl-Sephadex were concentrated by precipitation with (NH4)2SO4 per ml]. After the addition of 1 ,l of1M NaOH per ammonium sulfate (0.35 g/ml) and further purified by gel g of (NH4)2SO4, the suspension was centrifuged at 12,000 x filtration on a 1.5- x 60-cm AcA 22 column (IBF Biotechnics) g for 45 min. The precipitate was resuspended in buffer A in buffer A containing 0.5 M KCl and by chromatography on containing leupeptin and antipain at 10 ,ug/ml each and a 35- x 4.6-mm TSK DEAE-NPR HPLC column, which was dialyzed against buffer A to a conductivity equivalent to 0.1 eluted at 0.6 ml/min with a 9-ml gradient from 100 to 400 mM M KCI (fraction II). KCl in buffer C. Purification of Transcription Factor 6. Fraction II was Assay of Run-off Transcription. Except when indicated in centrifuged at 4000 x g for 10 min and then loaded onto a the figure legends, assays were performed as described (8) 100-ml phosphocellulose column (P11, Whatman) equili- with 0.1 /ig of Nde I-digested pDN-AdML (16), 50 ng of brated with buffer A containing 0.1 M KCl. Transcription fraction D, 2 ng of transcription factor a (fraction V), 10 ng activity was eluted stepwise at one packed column volume oftranscription factor ,8y (fraction V), and 0.01 units ofRNA per hour with buffer A containing 0.5 M KCl. One-fifth polymerase II. Reaction mixtures contained ATP, UTP, and column volume fractions were collected, and the active GTP at 50 tLM, CTP at 10 ,uM, and 10 kLCi of [a-32P]CTP; fractions were pooled and dialyzed against buffer C to a heparin (10 pgg/ml) was routinely added to reaction mixtures conductivity equivalent to buffer C containing 0.05 M KCl 2 min after addition of the four ribonucleoside triphosphates (fraction III). Fraction III was centrifuged at 16,000 x g for and magnesium in order to limit transcription to one round of 20 min and applied to a Spherogel TSK DEAE-SPW column initiation per promoter (10). (21.5 mm x 15 cm) (Beckman) equilibrated with buffer C Assay of ATPase. Reaction mixtures (20 pl) contained 40 containing 0.05 M KCl. Transcription activity was eluted at mM Tris HCI at pH 7.9, 7 mM MgCl2, 50 mM KCI, 0.1 mM 5 ml/min with a 500-ml linear gradient from 0.05 M to 0.25 M EDTA, 1 mM dithiothreitol, 0.5 mg of bovine serum albumin KCl. Ten-milliliter fractions were collected, and the active per ml, and 2% glycerol; reactions were incubated at 280C. fractions, which eluted with approximately 0.2 M KCl, were Radioactive and unlabeled nucleoside triphosphates and pooled and dialyzed against buffer D to a conductivity DNA were included in reaction mixtures as indicated in the equivalent to buffer D containing 0.05 M KCl (fraction IV). legends. ATPase was measured by polyethylenimine- Fraction IV was centrifuged at 16,000 X g for 20 min and then cellulose thin-layer chromatography (23). applied to a Bio-Gel TSK SP-5-PW column (7.5 x 75 mm) (Bio-Rad) equilibrated with buffer D containing 0.05 M KCl. Transcription activity was eluted at 1 ml/min with a 40-ml RESULTS linear gradient from 0.05 M to 0.4 M KCl. One-milliliter Purification of Transcription Factor S. We previously frac- fractions were collected, and the active fractions, which tionated rat liver and identified a set of transcription factors eluted at approximately 0.23 M KCl, were pooled (fraction that are essential for accurate initiation of transcription by V). Fraction V was diluted 3-fold with buffer D containing 3.0 RNA polymerase II at many promoters, including those ofthe M (NH4)2SO4, centrifuged at 20,000 x g for 20 min, and adenovirus 2 major late, mouse interleukin 3, rat ,8-actin, and applied to a Bio-Gel TSK phenyl-5-PW column (7.5 x 75 mm) rat y-fibrinogen genes. These transcription factors were frac- (Bio-Rad) equilibrated with buffer D containing 1.0 M tionated into two distinct protein factors, B and D (Fig. 1). (NH4)2SO4. Transcription activity was eluted at 1 ml/min Fraction B was shown to contain two transcription factors, with a 30-ml linear gradient from 1.0 M (NH4)2SO4 in buffer designated a and fry, which we have purified to homogeneity D to buffer D. One-milliliter fractions were collected, and the (8, 11). In the course of purifying the transcription activity active fractions, which eluted with approximately 0.1 M (activities) in fraction D, we discovered that fraction D con- (NH4)2SO4 were pooled (fraction VI). tained at least two transcription factors. Further analysis Analytical 4000SW Spherogel TSK HPLC. Fifty micro- revealed that the bulk of one of these factors was actually grams of 8 (fraction V) was centrifuged at 15,000 X g for 10 separated from fraction D during phosphocellulose chroma- min and applied to a 4000SW Spherogel TSK gel-filtration tography, where it eluted with the 0.5 M KCl step (Fig. 1). column (7.5 x 600 mm) (Beckman) equilibrated with buffer F Here we report purification of this factor, designated 8. in 0.5 M KCl. The column was eluted at 0.5 ml/min, and 8 was assayed by its ability to reconstitute synthesis of a 0.5-ml fractions were collected. 260-nucleotide run-offtranscript from the adenovirus 2 major Analytical TSK SP-NPR HPLC. Twenty micrograms of 8 late promoter in the presence of saturating amounts of RNA (fraction VI) was adjusted to a conductivity equivalent to polymerase II, purified transcription factors a and fry, and buffer D containing 0.05 M KCl by dilution into buffer D, fraction D (see Fig. 1). Because our aim is to identify and centrifuged at 15,000 x g for 10 min, and applied to a TSK purify factors that are essential for promoter-specific initia- SP-NPR HPLC column (35 x 4.6 mm) (Hewlett-Packard) tion by RNA polymerase II, our standard template was equilibrated with buffer D containing 0.05 M KCl. The column pDN-AdML (16), which includes only core adenovirus 2 was eluted at 0.6 ml/min with a 6-ml linear gradient from 0.05 major late promoter sequences -50 to +10 from the cap site M to 0.4 M KCl, and 0.2-ml fractions were collected. [Ad(-50 to + 10)]. 8 was purified more than 3000-fold from a Analytical TSK DEAE-NPR HPLC. Twenty micrograms of 0.33 M ammonium sulfate extract of crude rat liver nuclei by 8 (fraction VI) was adjusted to a conductivity equivalent to ammonium sulfate fractionation and chromatography succes- buffer C containing 0.05 M KCI by dilution into buffer C, sively on phosphocellulose, preparative TSK DEAE-SPW, centrifuged at 15,000 x g for 10 min, and applied to a TSK TSK SP-5-PW, and TSK phenyl-5-PW columns (Table 1). 8 Downloaded by guest on October 3, 2021 7358 Biochemistry: Conaway and Conaway Proc. Natl. Acad. Sci. USA 86 (1989)

Rat Liver Homogenate 800 x g

Nuclear pellet cytosol 0.33 M (NH4)2SO4 extract 0-40% (NH4)2SO4 fraction 40-65% (NH4)2SO4 fraction I I P-cell P-cellF- I I %, 0.1 M KCI 0.5 M KCI 1.0 M KCI 0.33 M KCI 0.6 7 KCI 1 2 3 4 | CMMSeph TSK DEAE-5PW I B FIG. 2. Synthesis of run-off transcripts from the adenovirus 2 I late and mouse interleukin 3 6. Where I DEAE-NPR AcA34 major promoters depends upon TSK SP-5PW I I indicated, reaction mixtures included 45 ng of 6 (fraction VI) and 100 TSK DEAE-5PW HAP ng of Nde I-cut pDN-AdML (16), which contains the adenovirus 2 TSK 0-5PW D TSK SP-5PW TSKO-5PW major late promoter (AdML, lanes 1 and 2) or 100 ng of Nde I-cut pDN-IL-3 (11), which contains the mouse interleukin 3 promoter (IL-3, lanes 3 and 4). The arrowheads indicate the positions ofrun-off lY el transcripts from the adenovirus 2 major late (lane 2) or mouse 86 interleukin 3 (lane 4) promoters. FIG. 1. Resolution and purification of transcription factors from rat liver. P-cell, phosphocellulose; CM-Seph, carboxymethyl- cause ofthe presence of substantial DNA-independent dATP- Sephadex; 4, phenyl. ase activity in cruder fractions of 6, it was not possible to determine whether transcription and DNA-dependent dATP- (fraction VI) has no detectable RNase (8), DNase, or topo- ase activities copurified quantitatively throughout the entire isomerase (24, 25) activity. By TSK 4000SW size-exclusion purification. 6 (fraction VI) was therefore analyzed by high- HPLC in 0.5 M KCl, 6 has a native molecular mass of resolution ion-exchange HPLC on TSK SP-NPR and TSK approximately 230 kDa (data not shown). DEAE-NPR (Fig. 4); in each case, cochromatography of Purified 8 is required for synthesis of accurately initiated transcription and DNA-dependent dATPase activities was run-off transcripts from several promoters, including those of observed, supporting the contention that transcription factor the adenovirus 2 major late and mouse interleukin 3 genes (Fig. 6 has a closely associated dATPase' activity. 2). Thus, like transcription factors a and fy, 6 plays an integral When analyzed by SDS/polyacrylamide gel electrophoresis, role in promoter-specific transcription by RNA polymerase II. the most highly purified preparations of 6 (active fractions from 6 Has an Associated DNA-Dependent ATPase (dATPase) TSK SP-NPR HPLC, see Fig. 4 Inset) reproducibly contain Activity That Is Strongly Stimulated by the TATA Region of polypeptides of 35, 38, 43, 46, 68, 85, and 94 kDa. It will be Promoters. During purification of transcription factor 6, we important to determine, first, which polypeptides comprise discovered that preparations ofthe purified factor catalyze the transcription and DNA-dependent dATPase activities and, sec- hydrolysis ofdATP to dADP in the presence ofclosed circular ond, whether any ofthese polypeptides are derived from higher pUC18 DNA. Transcription and dATPase activities were molecular mass polypeptides by proteolysis. found to copurify when 8 was analyzed by hydrophobic A variety of single- and double-stranded DNAs, such as interaction HPLC on TSK phenyl-5-PW (Fig. 3). Further pUC18, ssM13, and poly(dT) stimulated dATPase, whereas analysis revealed that the hydrolysis of dATP was dependent the polyribonucleotides poly(A) and poly(C) did not (Table on DNA; the last traces of contaminating DNA-independent 2). Remarkably, 60-base-pair double-stranded oligonucleo- dATPase activity could be removed by TSK phenyl-5-PW tides containing the TATA region of either the adenovirus 2 chromatography. The dATPase activity copurifying with tran- major late or mouse interleukin 3 promoters (nucleotides -50 scription activity in fractions 41-43 (Fig. 3) was completely to + 10 from the cap site) strongly stimulated dATP hydrol- DNA-dependent, whereas the dATPase activity in fractions ysis. Maximal dATPase required an intact TATA region; 31-33 was not dependent upon DNA (data not shown). Be- neither the individual single-stranded oligonucleotides that reconstitute the Ad(-50 to + 10) promoter fragment nor Table 1. Purification of transcription factor 6 from 0.5 kg of rat liver -I 5- Specific 0. -1.0 activity, E Activity,t U) 10- 2 Frac- Protein,* units units Yield, 0 6-2 0. tion Step mg x 10-1 x 10-2/mg % a ?I -0.5r 5- IC I Nuclear extract 7110 a- N II 40%o (NH4)2SO4 1876 3350 1.8 100t -J z fraction 2 0- L -- v0 III Phosphocellulose 211 1421 6.7 42 10 20 30 40 50 ` IV TSK DEAE-5PW 29 938 32 28 Fraction Number V TSK SP-5-PW 1.1 544 495 16 FIG. 3. Cochromatography of dATPase and transcription activ- VI TSK phenyl-5-PW 0.06 332 5533 10 ities during TSK phenyl-5-PW HPLC. Run-off transcription and *Protein was measured with the protein dye assay (Bio-Rad) with dATPase assays were performed; dATPase assays contained 5 ,uM bovine serum albumin as the standard. dATP, 1 ,Ci of [a-32P]dATP, and 250 ng of pUC18 DNA. AdML tOne unit is the amount of 8 required for half-maximal run-off run-off transcript refers to the relative synthesis, per transcription transcription. reaction, of the 260-nucleotide run-off transcript synthesized from tYield is based on fraction II since activity could not be reliably the adenovirus 2 major late promoter (expressed in arbitrary units measured in fraction I. determined by densitometry of autoradiograms). Downloaded by guest on October 3, 2021 Biochemistry: Conaway and Conaway Proc. Natl. Acad. Sci. USA 86 (1989) 7359 Table 3. Stimulation of dATPase activity by short DNA fragments dATP hydrolyzed, DNA pmol Ad(-50 to +10) 18.4 IL-3(-50 to + 10) 17.6 ssAd(-50 to +10), coding strand 2.9 ssAd(-50 to + 10), noncoding strand 4.7 Ad(-50 to +10 TAGA) 6.9 VDF 6.0 Kappa 2.4 Fraction Number Alpha-2 1.3 Reaction mixtures, which contained 5 ,uM dATP, 1 ,uCi of [a- 32P]dATP, 45 ng of 8 (fraction VI), and 250 ng of the indicated DNA, were incubated for 4 hr. The sequences of Ad(-50 to + 10) and VDF (a mutant of the mouse interleukin 2 gene) are given in ref. 11. Ad(-50 to + 10 TAGA) is identical to Ad(-50 to + 10) except for the single base change of TAIAAAA to TAQAAAA. IL-3(-50 to + 10) (nucleotides -50 to +10 of the mouse interleukin 3 promoter), CCGGCCCCGCCCCACCCCTCTCTGAATACATATAAGGT- GAAGGCTCCTGTGGCTTCTTCAGAACCCCTTGG; kappa (en- te E hancer of the K immunoglobulin light-chain gene), CAGAGGG- o- -30020 5 40 4 5' 2 0 GACTTTCCGAGAGGCGGTAC; alpha-2 (a2-macroglobulin oI flanking region), AATTCGTAACTGGAAAGTCCTTAATCCTTC- n0 0 - TGGGAATTCTGGCTAACGGGTCAGAGCT. Except where indi- cated (by ss), all fragments were doubled-stranded. system (31). Thus dATPase appears to be preferentially 10 15 20 25 30 35 40 45 stimulated by the TATA regions of the adenovirus 2 major Fraction Number late and mouse interleukin 3 promoters. Of the nucleoside triphosphates tested, only ATP and FIG. 4. Cochromatography of dATPase and transcription activ- dATP were hydrolyzed; no hydrolysis of CTP, UTP, or GTP ities during analytical TSK SP-NPR (Upper) and TSK DEAE-NPR could be detected (data not shown). In the presence of (Lower) HPLC. Run-off transcription and dATPase assays were max- performed as described in Materials and Methods and in the legend saturating levels of the Ad(-50 to +10) fragment, the to Fig. 3. (Inset) Fraction 21 was analyzed by SDS/8% polyacryl- imum rate ofhydrolysis ofATP and dATP was approximately amide gel electrophoresis, and the gel was silver-stained as described 5 pmol-min-1 ,4g-1 of 8 (fraction VI), and the Km for dATP (26, 27). The molecular masses (in kDa) of the bands are indicated. was 13 ,uM. ATPase (dATPase) was linear for up to 6 hr under standard reaction conditions and was proportional to enzyme similar sized double-stranded oligonucleotides from the en- concentration over a broad range of concentrations. hancer for the K immunoglobulin light-chain gene (28), a2- macroglobulin 5' flanking region (29), and a mutant of the mouse interleukin 2 gene (mutant no. 123, ref. 30) support DISCUSSION comparable dATPase activity (Table 3 and Fig. 5). In addi- An understanding of the mechanism by which RNA poly- tion, an oligonucleotide containing a mutant adenovirus 2 merase II selects its promoter and initiates mRNA synthesis major late promoter (single base change of TATAAAA to is crucial to our understanding of many mechanisms of gene TAjAAAA) stimulated dATPase less than 40% as well as the regulation. Previous biochemical studies have demonstrated oligonucleotide containing the wild-type promoter (Table 3 that transcription initiation is a complex, multistep reaction and Fig. 5). This mutant promoter also has a greatly dimin- requiring, in addition to RNA polymerase II, several acces- ished capacity to support transcription in the reconstituted sory transcription factors and an ATP (dATP) cofactor. A rat liver transcription system (E. Travis, R.C.C., and J.W.C., major aim of our research has been to discover how RNA unpublished results). A similar mutation (TAIAAAA to TA-AAAA) was previously shown to decrease the activity 10 of the conalbumin promoter in a HeLa cell transcription E 0- Table 2. DNA dependence of dATPase activity -0 N dATP hydrolyzed, 0 DNA pmol >0 None <0.3 I Ad(-50 to + 10) 19 0C pUC18 3.7 3.8 pDN-AdML 20 40 60 80 100 120 ssM13 6.0 0 poly(dA) 0.7 DNA (ng) poly(dT) 3.4 poly(A) <0.3 FIG. 5. DNA-dependent hydrolysis ofdATP. Reaction mixtures, which contained 5 ,uM dATP, 1 ,uCi of [a-32P]dATP, 45 ng of 8 poly(C) <0.3 (fraction VI), and either Ad(-50 to + 10) (e), Ad(-50 to + 10 TAGA) Reaction mixtures, which contained 5 ,uM dATP, 1 ,Ci of [a- (o), or alpha-2 (-) DNA, were incubated for 1.5 hr. The sequences 32P]dATP, 45 ng of 8 (fraction VI), and 250 ng of the indicated DNA, of Ad(-50 to +10 TAGA) and alpha-2 DNA are given in the legend were incubated for 4 hr. to Table 3. Downloaded by guest on October 3, 2021 7360 Biochemistry: Conaway and Conaway Proc. Natl. Acad. Sci. USA 86 (1989) polymerase II and the accessory transcription factors utilize 1. Matsui, T., Segall, J., Weil, P. A. & Roeder, R. G. (1980) J. ATP (dATP) to activate initiation. Our approach has been to Biol. Chem. 255, 11992-11996. purify RNA polymerase II and the accessory factors and to 2. Tsai, S. Y., Tsai, M.-J., Kops, L. E., Minghetti, P. P. & O'Malley, B. W. (1981) J. Biol. Chem. 256, 13055-13059. assess directly their ability, alone or in combination, to 3. Samuels, M., Fire, A. & Sharp, P. A. (1982) J. Biol. Chem. 257, hydrolyze or bind ATP and dATP. In this report, we have 14419-14427. described the properties of one such factor, designated 8, 4. Davison, B. L., Egly, J.-M., Mulvihill, E. R. & Chambon, P. which we have shown has an associated DNA-dependent (1983) Nature (London) 301, 680-686. ATPase (dATPase) activity that is strongly stimulated by the 5. Dynan, W. S. & Tijan, R. (1983) Cell 32, 669-680. TATA region of promoters. 6. Parker, C. S. & Topol, J. (1984) Cell 36, 165-175. 7. Tolunay, H. E., Yang, L., Safer, B. & French-Anderson, W. Several findings are consistent with the notion that 6 plays (1984) Mol. Cell. Biol. 4, 17-22. a direct role in the activation of promoter-specific transcrip- 8. Conaway, J. W., Bond, M. W. & Conaway, R. C. (1987) J. tion by ATP (dATP): (i) Ofthe accessory factors required for Biol. Chem. 262, 8293-8297. accurate initiation in the liver transcription system, only 6 has 9. Price, D. H., Sluder, A. E. & Greenleaf, A. L. (1987) J. Biol. measurable ATPase activity. We have been unable to detect Chem. 262, 3244-3255. ATPase in near-homogeneous preparations ofRNA polymer- 10. Zheng, X.-M., Moncollin, V., Egly, J.-M. & Chambon, P. ase II and factors a and (1987) Cell 50, 361-368. transcription fBy, and no ATPase 11. Conaway, J. W. & Conaway, R. C. (1989) J. Biol. Chem. 264, activity appears to copurify with transcription activity in 2357-2362. fraction D (refs. 8 and 11; unpublished results). (ii) 6 hydro- 12. Lue, N. F. & Kornberg, R. D. (1987) Proc. Natl. Acad. Sci. lyzes ATP and dATP but not CTP, UTP, or GTP. Likewise, USA 84, 8839-8843. the cofactor requirement in transcription initiation is satisfied 13. Bunick, D., Zandomeni, R., Ackerman, S. & Weinmann, R. by ATP and dATP but not by CTP, UTP, or GTP. (iii) The (1982) Cell 29, 877-886. ATPase (dATPase) associated with 8 is strongly stimulated 14. Sawadogo, M. & Roeder, R. G. (1984) J. Biol. Chem. 259, by the TATA region of promoters. ATPase (dATPase) ac- 5321-5326. tivity can be stimulated by a variety of DNAs, but it is most 15. Rappaport, J. & Weinmann, R. (1987) J. Biol. Chem. 262, 17510-17515. strongly stimulated by DNA fragments containing the TATA 16. Conaway, R. C. & Conaway, J. W. (1988) J. Biol. Chem. 263, regions of the adenovirus 2 major late and mouse interleukin 2962-2968. 3 promoters. Notably, a mutant adenovirus 2 major late 17. Fire, A., Samuels, M. & Sharp, P. A. (1984) J. Biol. Chem. 259, promoter (single base change TAIAAAA to TAjAAAA), 2509-2516. which is transcribed poorly in the reconstituted liver tran- 18. Sawadogo, M. & Roeder, R. G. (1985) Cell 43, 165-175. scription system, stimulates ATPase significantly less than 19. Reinberg, D., Horikoshi, M. & Roeder, R. G. (1987) J. Biol. does the wild-type promoter. Taken together, these findings Chem. 262, 3322-3330. suggest the possibility that 6 plays a role in the ATP (dATP)- 20. Nakajima, N., Horikoshi, M. & Roeder, R. G. (1988) Mol. Cell. dependent activation of run-off transcription, perhaps Biol. 8, 4028-4040. 21. Carthew, R. W., Samuels, M. & Sharp, P. A. (1988) J. Biol. through a direct interaction with the TATA region of pro- Chem. 263, 17128-17135. moters. 22. Ziegler, D. M. & Pettit, F. H. (1966) Biochemistry 5, 2932- Preliminary investigations suggest that 8 interacts only 2938. weakly with DNA and that, during transcription initiation, 23. Nakayama, N., Arai, N., Kaziro, Y. & Arai, K. (1984) J. Biol. stable binding of 6 to the adenovirus 2 major late promoter Chem. 259, 88-96. requires at least one additional transcription factor. First, 24. Champoux, J. J. & McConaughy, B. L. (1976) Biochemistry attempts to detect formation of complexes between 8 and 15, 4638-4682. DNA fragments containing the major late promoter by gel- 25. Mattoccia, E., Attardi, D. G. & Tocchini-Valentini, G. P. shift assays (32) have been unsuccessful. Second, results of (1976) Proc. Natl. Acad. Sci. USA 73, 4551-4554. 26. Laemmli, U. K. (1970) Nature (London) 227, 680-685. template competition experiments indicate that 8 can stably 27. Merril, C. R., Goldman, S., Sedman, S. A. & Ebert, M. H. associate with the major late promoter only after an initial (1981) Science 211, 1437-1438. complex between a transcription factor(s) in fraction D and 28. Lenardo, M. J., Kuang, A., Gifford, A. & Baltimore, D. (1988) template DNA has been formed (unpublished results). Proc. Natl. Acad. Sci. USA 85, 8825-8829. 29. Tsuchiya, Y., Hattori, M., Hayashida, K., Ishibashi, H., We thank Drs. Roger Kornberg and I. Robert Lehman for critical Okubo, H. & Sakaki, Y. (1987) Gene 57, 73-80. readings of the manuscript. We also thank Ellen Travis for technical 30. Zurawski, S. & Zurawski, G. (1988) EMBO J. 7, 1061-1069. assistance, Monica Coverson for preparing the manuscript, and 31. Wasylyk, B., Derbyshire, R., Guy, A., Molko, D., Roget, A., Raquelle Keegan for artwork. We are especially grateful to Felix Teoule, R. & Chambon, P. (1980) Proc. Natl. Acad. Sci. USA Vega, Sandra Zurawski, and Gerard Zurawski for generously pro- 77, 7024-7028. viding synthetic DNAs. This work was supported in part by Grant 32. Fried, M. & Crothers, D. M. (1981) Nucleic Acids Res. 9, GM41628 from the National Institutes of Health. 6505-6524. Downloaded by guest on October 3, 2021