Posted on Authorea 11 May 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.162074695.55679504/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. Lu Chen Chen This hybrid. of stricta of hybrids utilization natural the of for characterization data Molecularcytogenetic provided results The hybrids. gene turczaninovii. indicated had nuclear natural R. study plants copy of This and hybrid single study turczaninovii. stricta the case the R. R. on and a that stricta of based provided showed R. analysis hybrids study to analysis Phylogenetic were related GISH pairing (StY). closely plants were turczaninovii Meiotic the turczaninovii. plants R. the that R. (2n=4x=28). showed and rps16 and turczaninovii stricta gene stricta R. R. chloroplast (Drob.) and of R. and DMC1 that turczaninovii of stricta as those R. Roegneria genome number. than of same floret and regular that the and Roegneria Keng less to number of stricta were corresponding tiller hybrids hybrids chromosomes height, putative Roegneria little in plant 28 of of was in number had intermediate phenotypic There large heterosis Hybrids a showed strong and distinguish. showed found Nevski. hybrids genetic we plants to putative study, rich hybrid difficult this the The had and In Morphologically, China. population Triticeae. blurred Plateau, of parents progeny Sichuan hybrids their West hybrid natural and in of The them origin the between evolution. on boundaries research species the of made part which variation, important an is Hybridization Abstract 2021 11, May 4 3 2 1 Sha Lina Chen Chen (Triticeae: turczaninovii Poaceae) Roegneria and of stricta hybrids Roegneria natural of characterization cytogenetic Molecular nvriy hnd 110 iha,Cia. China Sichuan, 611130, Chengdu University, 5 4 3 2 China; 1 Zhang bing tt e aoaoyo rpGn xlrto n tlzto nSuhetCiaScunAgricultural China,Sichuan Southwest in Utilization and Exploration Gene Crop of Laboratory Key State iha cdm fGasadScience Grassland of Technology Academy and Sichuan Science Grassland Sciences of Life College and Chemistry of College Institute Research Triticeae olg fCeityadLf cecs hnd omlUiest,Cegu613,Scun China; Sichuan, 611130, Chengdu University, Normal Chengdu Sciences, Life and China; Chemistry Sichuan, of 610000, College Chengdu Science, Grassland China; Sichuan, of Academy 611130, Sichuan Chengdu University, Agricultural Sichuan Institute, Research Triticeae olg fGasadSineadTcnlg,ScunArclua nvriy hnd 110 Sichuan, 611130, Chengdu University, Agricultural Sichuan Technology, and Science Grassland of College ,5 1, igFan Xing , and 3 oyn Kang Houyang , ogei turczaninovii Roegneria 2# 3* 1 u Zheng Lue , aqnZhang Haiqin , iu Zheng Zilue , ,5 2, iaSha Lina , 1 a Wu Dan , 1 2# iWang Yi , ,5 1, ,5 2, adnWu Dandan , * oyn Kang Houyang , Tiiee Poaceae) (Triticeae: 1 uTan Lu , 1 ogZhou Hong , ,5 2, 1 uTan Lu , 1 ogYang Rong , ,5 2, iWang Yi , 1 igZhang Bing , 2 arn Yang Cairong , 2 igLiu Qing , Roegneria ,5 2, ogogZhou Yonghong , 4 n aqnZhang Haiqin and , 2 4 eLu Le , ogigLiu Songqing , 3 igFan Xing , ,5 2, Chang- , 4 3 Jiale , 1 , Posted on Authorea 11 May 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.162074695.55679504/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. INTRODUCTION | 1 [email protected] China 611130, Wenjiang University, Agricultural Sichuan Technology, and Science Grassland of College Zhang Haiqin freely. me contact Sincerely, please publication authors questions, for all any submission and have this you part, consider If in kindly or will whole you in that publication, hope enclosed. We for that elsewhere manuscript submitted the approved been have not listed has described of work hybrids The were plants the that indicated study gene chloroplast and stricta R. height, performed plant we in of hybrids, heterosis intermediate stricta showed strong natural hybrids showed the of Morphologically, hybrids and natural mechanism number. floret that formation and confirmed number and results tiller genomic origin The analysis, the pairing analyses. chromosome phylogenetic explore analysis, Karyotype to analysis, study, morphological present Zhang. the Hai-Qin Zhang, In Chang-Bing Zhou, Yong-Hong Lu, Jia-Le Liu, “ of Evolution: Poaceae) and hybrids Ecology (Triticeae: natural to consideration of your characterization for manuscript togenetic following the is submitted The editor, Dear letter Cover KEYWORDS hybrids. natural of study case stricta gene nuclear to of copy that related single as closely the genome of on same based those the had analysis than plants regular hybrid less the that were of hybrids this that the in to In Morphologically, pairing corresponding number. Triticeae. chromosomes floret of 28 and had hybrids of number Hybrids natural tiller of hybrids height, intermediate of putative showed plant origin hybrids in of putative blurred the heterosis number parents strong on showed their large research plants and little a hybrid them was found between There we boundaries study, the distinguish. made to which difficult variation, and phenotypic and genetic rich Abstract E-mail: author. *Corresponding ogei turczaninovii Roegneria and and .turczaninovi R. and yrdzto sa motn ato pce vlto.Tehbi rgn ouainhad population progeny hybrid The evolution. species of part important an is Hybridization .turczaninovii R. .turczaninovii R. aua yrd,GS,pyoeei analysis, phylogenetic GISH, hybrids, Natural R . rps e:+613550042478 +86 Tel: ; stricta ,b hnCe,Z-u hn,DnDnW,TnL,CiRn ag Song-Qing Yang, Cai-Rong Lu, Tan Wu, Dan-Dan Zheng, Zi-Lue Chen, Chen by ”, 6soe h lnswr lsl eae to related closely were plants the showed 16 .Terslspoie aafrteuiiaino yrd hssuypoie a provided study This hybrid. of utilization the for data provided results The i. IHaayi hwdta h yrdpat a h aegnm sta of that as genome same the had plants hybrid the that showed analysis GISH . Do. esi eoi arn nhbiswr esrglrta hs of those than regular less were hybrids in pairing Meiotic Nevski. (Drob.) and ( [email protected] StY .turczaninovii. R. .Pyoeei nlssbsdo h igecp ula gene nuclear copy single the on based analysis Phylogenetic ). ogei stricta Roegneria DMC .stricta R. .stricta R. hssuyidctdta h lnswr yrd of hybrids were plants the that indicated study This 2 n hools gene chloroplast and 1 .stricta R. H.Zhang), (HQ. ogei stricta Roegneria .stricta R. Roegneria egand Keng and and .turczaninovii R. Roegneria and .turczaninovii R. and Roegneriaturczaninovii nWs iha lta,Cia The China. Plateau, Sichuan West in .tu R. [email protected] c.b.zhang@126. . .stricta R. .turczaninovii R. eoe eoi pairing. meiotic genome, , caioi 2=x2) Meiotic (2n=4x=28). rczaninovii and rps and . ogei turczaninovii Roegneria 6soe h lnswere plants the showed 16 IHaayi showed analysis GISH . nsitu in .turczaninovii R. ogei stricta Roegneria ( StY C.Zhang) (CB. yrdzto and hybridization Do. Nevski. (Drob.) oeua cy- Molecular .Phylogenetic ). DMC This . Keng R. R. 1 Posted on Authorea 11 May 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.162074695.55679504/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. h xeietlfil fScunAaeyo rsln cec SG)lctdo otws Sichuan Northwest on located (SAGS) 31 Science Province, Grassland Sichuan county, of Academy (Hongyuan Sichuan China of Plateau, field meiotic available experimental the DNA Among The 2006). sequences, al., 2014). nuclear et al., available (Smith et ( grasses (Yan the S16 in Triticeae protein inherited Among maternally ribosomal 2010). is sequences, phylogenetic DNA) chloroplast genes, al., of (cp nuclear studies et DNA low-copy chloroplast for Sha The markers or hybrids useful 2018; polyploid Single- ( as or al., 1 basis 2011). serve recombinase diploid could the et al., of evolution, was et (Lei concerted genome This (Yu to the relationships processes. susceptible analysis (Quijada in evolutionary less hybrids phylogenetic sites different were have natural different by which identifying genes at hybridization these for genes detecting choice Since species, for parent first 1995). repetitiveness different al., the insufficient between from et also and relationship derived Sang was non-dominance genetic other 1997; method of some the al., The with shortcomings reflect et verified markers. the only be molecular overcome not to other also needs could determined of still but analysis been it parents, has Phylogenetic origin, species and 1992). hybrid a hybrids or al., if hybrid even et a Therefore, it (Soltis be GISH. hybrids, evidence to and interspecific FISH cytogenetics of by or hybrids homology morphology of from chromosome GISH origin parental and explore FISH to high Using difficult the example, was For to 2017). due al., However, et of 2019). (Paˇstov´a Mao parents al., 2004; two al., et the et markers (Han techniques, Cytological hybrids analysis, natural pairing analyze 1995). a meiotic and analysis, (Rieseberg, from identify karyotype hybrids including came hybridization, identify plant for to criteria Genomic a Therefore, alone important as environment. whether used used or evolution infer be been convergent washave by not to caused intermediate could be parents morphology also markers and and may the It low, morphological characteristics, of was hybridization. morphological markers to intermediate related on morphological always morphology of not based reliability the mainly the (Rauscher on was However, hybrids of hybridization based hybridization. origin of explore and often to identification diploid and was hybrid of Early However, a it formation was 1993). 2002). species the Soltis, a & al., of whether Soltis identify cause et accurately 1995; direct to (Rieseberg, easy evolution the not reticulate was was of it hybridization production evolution, the and system species plant polyploid of process researchers the years, In recent In ( hybrids. of hybrids natural hybrids of natural have value natural pentaploid the Predecessors some replace not 1959). discovered could (Keng, had and crops hybridization artificial cereal the of for by hybrid of genes a hybrids of 1995), the contributors al., on potential studies as some used reported be also could but with 2008). tetraploid al., were which et of & most Stebbins species, 1949; Walters, & (Stebbins Roegneria hybrids 1954). aspects natural Vaarama, other of & and origin Stebbins set possible 1950; seed the Singh, pairing, that chromosome speculated morphology, comparison, for of hybrids natural and of artificial hybrids of hybridization, natural hybrids Triticeae: triploid 1926, of the 1949); hybrids as in hybrids Walters, early in (2n=12x). natural As & species of dodecaploid Triticeae. (Stebbins series of to the a majority in reported (2n=2x) The oftenoccurred al. diploid species of from 1984). hybrid or natural (Dewey, ranging habitats genera the ecological regions different levels of between alpine ploidy range hybridization tropic with wide Natural a and allopolyploids, in subtropical were distributed and that Triticeae and crops species temperate cereal 450 of the improvement approximately genetic over included for It pool gene grasses. important forage an represented (Poaceae) Triticeae tribe The nsitu in Elymus .Kc a eaieylreprnilgnsi rtca,adicue prxmtl 130 approximately includes and Triticeae, in genus perennial large relatively a was Koch C. Roegneria DMC yrdzto GS)adFluorescence and (GISH) hybridization and Triticum )gn eune aebe sdt xmn yrdzto vns(age l,2017). al., et (Tang events hybridization examine to used been have sequences gene 1) .ciliaris R. Sitanion pce o nypoie eei aeilfrteipoeeto oaecrops forage of improvement the for material genetic provided only not species StStYYP Elytrigia - Aegilops Sebn arm,15) ttesm ie hypromdartificial performed they time, same the At 1954). Vaarama, & (Stebbins and emsmulticaulis Leymus between ) × - Roegneria Roegneria mucronata Secale StY rps Agropyron a eotd(o shra lir 96.Sebn et Stebbins 1926). Bleier, & Tschermak (Von reported was 6 eeue oietf h aenldnro eeain genera of donor maternal the identify to used were 16) Roegneria gnm,nal 0o hc eefudi hn (Yang China in found were which of 70 nearly -genome, uha yrdof hybrid a as such , o xml,Zn ta.(02 a icvrdthe discovered had (2012) al. et Zeng example, For . 3 ol esuidtruhsga ie nchromosomes on sites signal through studied be could nsitu in Zage l,20) hs yrd eecreated were hybrids These 2008). al., et (Zhang ° 1 o3dg3 ,11e5’t 0dg2 W) 103deg22’ to 101deg51’ N, 33deg33’ to 51’ and ( StY yrdzto FS) hc ol eue to used be could which (FISH), hybridization Elymus and ) Kengyilia Sebn ig,15) natural 1950); Singh, & (Stebbins Roegneria .condensatus E. ( StYP and Hordeum ). and .triticoides E. Zo et (Zhou Posted on Authorea 11 May 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.162074695.55679504/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. N a xrce rmfehlae yteCA ehd(ury&Topo,18) lsis(from Plasmids 1980). Thompson, & genomic (Murray Total method (2004). CTAB al. the et by Han leaves of fresh method the from to extracted according was analysis DNA GISH for prepared calculation were and Chromosomes and staining preparation fixation, of Chromosome (2006). procedures | Zhou The 2.5 and (1991). Zhang al. followed et pairing Gill meiotic by of followed were analysis analysis pairing Karyotype meiotic and Karyotype plant. | per I 2.4 sample an 10-spike in The a stained from were calculated. anthers estimated was mature was from average observation. of grains the set direct pollens width and by seed The leaves, recorded times and were flag 10 fertility node Pollen measured of stem | was length and 2.3 trait sheath number, Each leaf floret basal etc. number, leaf, of spikes, tiller pubescence of height, length plant leaves, including flag observed on were performed traits was the analysis with Morphological deposited analysis were Morphological specimens China | University, voucher 2.2 Agricultural which Sichuan Institute, authors for Research W The Triticeae accessions, and USA). the other PI WA, of (SAUTI). all with herbarium (Pullman, and Materials System collected nursery Germplasm study perennial S1. Plant Table present National level, in the ploidy American listed numbers, of by were accession provided numbers abbreviations, kindly taxa, accession sampled were GenBank the and of names constitution The genomic analysis. sequences DNA for genomes the (representing and species , diploid 20 China. Sichuan, Roegneria in and found RH1) in (named appeared hybrids 17 RH2) including hybrids nature putative 57 materials Plant formation | breeding and 2.1 MATERIALS for origin AND foundation for METHODS material laid | resources and 2 useful Triticeae, provided the in results evolution varieties. The species new analysis, hybrids, fertility natural plants. analysis, of accompanying morphological mechanism their including study, methods and current analysis, different the hybrids conducted In pairing of we natural time. meiotic hybrids case, constitutions, long karyotype, were the a genome plants indeed for and together sterile is ploidy grown this the same were that the they hypothesized had if them we species between two occur these might Because very hybridizations was China. set Mongolia, Inner seed their stricta of and R. characters plants morphological around of intermediate Both than showed stronger They individual grew then hybrids 3). turczaninovii and putative Figure species These (0.23%-5.59%, two distributed low the randomly a-c). of 23/400) 2 (5.75%, seeds hybrids (Figures putative the 23 harvested that found We we SAGS. in growing, years in three After close of planting. very species planted Two were m. Nevski] 3500 altitude at .stricta R. .turczaninovii R. D .stricta R. ,adseiswt ieetgnmccmiain ( combinations genomic different with species and ), and oefo uu ony iha,Ciawhile China Sichuan, County, Luhuo from come edad5 uaiehbis(63% 430 admydsrbtdin distributed randomly 54/330) (16.36%, hybrids putative 54 and field uha uecneo ef aa efset n tmnd Fgrs1d-o). 1 (Figures node stem and sheath leaf basal leaf, of pubescence as such , Elymus and .turczaninovii R. n h te rtca pce rwn erywr lootie,icuigseisof species including obtained, also were nearby growing species Triticeae other the and , .turczaninovii R. l fte eecletdfo h xeietlfil fSG,Hnya County, Hongyuan SAGS, of field experimental the from collected were them of All . Roegneria edwr sdi hssuy(al ) h osbeparents possible The 1). (Table study this in used were field nsitu in eettali eena pce 2=x2)wt the with (2n=4x=28) species perennial tetraploid were nsitu in .stricta R. yrdzto n N euneaayi nteeputative these in analysis sequence DNA and hybridization [ ogei stricta Roegneria hybridization 4 , .turczaninovii R. .stricta R. 2 StY K ouinfrple etlt td.Se set Seed study. fertility pollen for solution -KI St .turczaninovii R. , egand Keng , H StH and , E .stricta R. e rmtetieTiieewr used were Triticeae tribe the from ) .turczaninovii R. n uaiehbis Agronomic hybrids. putative and , E b Roegneriaturczaninovii , W edad4 yrd (named hybrids 40 and field rgn rmLniCounty, Linxi from origins , P .turczaninovii R. , Ta .stricta R. odtrieif determine To . , V StY , Ns .stricta R. genome. (Drob.) , and A field , R. B 6 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. aytp nlsssoe that showed analysis Karyotype of set, seed and fertility pollen including fertility, The of x=2)(iue4.Temitccngrtoso h osbeprn n h uaiehbiswr listed were hybrids putative the and parent possible the of configurations meiotic S2. The Table 4). in (Figure 28) = 4x were they that indicating low, very were pollen hybrids the putative could RH2, of 3.3 It than hybrids sets 3). lower species. the seed (Figure were stable and for 0.23%-5.59% not sets fertilities from As and varying seed pollen hybrids 3). lower, the the were (Figure that and set 0.41%-4.50% seen seed 1.01%-8.09%, be and from from 0.83%-13.63%, varying varied from parents, fertilities varied possible fertilities pollen their the of RH1, those hybrids the for As turczaninovii In R. 3. Figure in shown 2i). 2c-2g, (Figures spike the of 3.2 length and awn, of length leaf, turczaninovii stricta ± (128.90 RH1 hybrids of height characteristics The unique some combined 1d-o). hybrids (Figures natural pubescence These to 1a-c). phenology and (Figures of morphology plants in surrounding similar their were than which grasses, perennial were Roegneria hybrids natural putative 57 The ek 03.Teeouinr oe eetdfrBysa nlsswssm sM analysis. ML as 3.1 same Huelsen- was & analyses (Ronquist Bayesian 3.1 for MrBayes 3 selected using performed model also evolutionary were and The analyses replications 2003). Bayesian 1000 were analysis, beck, values of with ML BS measurement calculated to the were a addition values if In As branch) (BS) the support 1998). (above bootstrap Crandall, figure the & determined in clades, was (Posada displayed analysis tree criterion phylogenetic of information for robustness Akaike model the evolutionary with best-fit v3.7 The ModelTest 2009). using al., et (Guindon 3.0 PhyML of analyses phylogenetic The lnswr eetdfrsqecn ySaga agnBooia niern n ehooySrieLtd. independent Service Technology random 2.7 and 15 Engineering least Biological At Sangon (TaKaRa). Shanghai vector China). by pMD19-T (Shanghai, sequencing the for into 50- selected cloned were a were the clones in for products protocols PCR conducted amplification were S1. PCR Table PCRs The All Japan). Shiga, (TaKaRa, 2005). al., et Shaw The sequencing (2017). and were al Amplification visualization et | and Wang detection, 2.6 of procedure, method Hybridization the to method. according translation performed nick the using red-5-dCTP are that clones positive | 22)adhbisR2(389.63 RH2 hybrids and 12.24) .turczaninovii R. .stricta R. RESULTS | | | | DMC aytp nlssadcrmsm arn tmtpaeI metaphase at pairing chromosome and analysis Karyotype set seed and fertility pollen of Evaluation opooia characteristics Morphological aaanalysis Data (225.93 pce,sc soesiee e oeadplaeuln em.Ms fhbiswr stronger were hybrids of Most lemma. equaling palea and node per spikelet one as such species, and 1 and ntelnt fflglae,wdho a evs egho o eodla,wdho o second top of width leaf, second top of length leaves, flag of width leaves, flag of length the in ± h olnfriiisadse e eehg ih9.1 n 21% respectively. 92.18%, and 91.61% with high were set seed and fertilities pollen the , .turczaninovii R. rps 53)(iue2) h yrd hwditreit hrce between character intermediate showed hybrids The 2b). (Figure 15.35) (118.63 6gn a mlfiduigtepieslse nTbeS Ptre eeg2002; Seberg & (Petersen S1 Table in listed primers the using amplified was gene 16 .stricta R. St eoe n the and genome) ± .1c)and cm) 1.11 DMC h olnfriiiswr pt 20%adtese eswr 00% In 90.02%. were sets seed the and 92.05% to up were fertilities pollen the , .stricta R. ± uha efpbsec,se oepbsec n aa efsheath leaf basal and pubescence node stem pubescence, leaf as such , ± 37)soe oetlesthan tillers more showed 13.72) and 1 .7c)adhbisR2(132.68 RH2 hybrids and cm) 1.27 rps .stricta R. , StY .turczaninovii R. 6dt yuigtemxmmlklho M)mto in method (ML) maximum-likelihood the using by data 16 eoewr aee ihfloeci-2dT rTexas- or fluorescein-12-dUTP with labeled were genome .stricta R. 5 (118.70 μ ecinvlm,wt . xa polymerase ExTaq U 1.5 with volume, reaction L > ± 0 Flesen 1985). (Felsenstein, 50% n uaiehbiswr erpod 2 = (2n tetraploids were hybrids putative and , .4c)(iue2) yrd H (284.18 RH1 Hybrids 2a). (Figure cm) 1.54 .turczaninovii R. DMC .turczaninovii R. and 1 ± .6c)wshge hnthat than higher was cm) 1.86 rps n uaiehbiswere hybrids putative and 6gn r rsne in presented are gene 16 (112.00 .stricta R. ± .2 and 9.72) and R. R. Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. nodrt nlz h osbeprnso h yrd,w nlzdtencergene nuclear the analyzed we hybrids, the of parents gene possible the plast analyze to order In RH2-2, RH1-14, RH1-11, RH1-8, (RH1-3, were 3.5 hybrids RH2-39) with 11 RH2-37, hybridized and RH2-17, parents were RH2-15, putative hybrids RH2-12, of and RH2-10, signals constitution parents genomic fluorescent putative the of displayed that chromosomes hybrids 28 of and where set parents the analysis, putative one GISH by of contained confirmed chromosomes they 14 the that if that indicating detect showed to results used FISH was marker This hybrids. and 2017). for parents al., the putative hybrids et of some (Wang arm selected region entire centromeric we the hybrids, on natural present were of constitutions St genomic bridization. the explore further To n ymxmmlklho nlssuigteTMu oe -nlklho 573)wssonin shown was 4547.37) = likelihood ( the (-Ln of model generat- G analyses the tree + phylogenetic PP=0.97), phylogenetic TPM1uf The single the A 8. using informative. analysis Figure parsimony likelihood were maximum 235 by and ing variable were characters 267 which of (Figures I. anaphase at 3.4 observed were bridges chromosome c-value and chromosomes the i). lagging two hybrids, 5f, some and all time, regular In same comparatively RH2 the was homology. univalent. At hybrids hybrids 0.90 were had the of 40 hybrids hybrids of c-value in in all pairing with genomes chromosome pairing RH2-31, cell of that hybrid Chromosome per sets 13.52 suggesting bivalents for 0.81, and 13.55 S2). Except than univalents and Table higher S2). univalents 0.98 was e; Table 0.85 of h; 5d, of average average 5g, (Figures an an (Figures 0.89 with with of high, high c-value comparatively comparatively were with were cell RH1 hybrids per bivalents 17 in pairing Meiotic of Meiosis f1 yrd and hybrids 15 of h aenldnro h yrd RH2. 4 hybrids the tree of ML donor maternal The that the showed results analysis. above phylogenetic The in and used sequences turczaninovii was the TIM1 RH1 of 1555.21) hybrids analyses = informative. phylogenetic 5 parsimony likelihood The were (-Ln 9. 30 rps model Figure and best-fit in characters displayed the variable was analysis. were as ML 30 G for characters, + hybrids selected 881 of were contained length sequences matrix 28 The of analysis. lot ( phylogenetic A genomes for basic selected different was 10 containing species diploid B 10 included clade other diploid included clade stricta of the PP=1.00), St Roegneria and , | DMC StY 6sqecsfo yrd H eegopdwith grouped were RH1 hybrids from sequences 16 pce,tetraploid species, ) DISCUSSION | | hlgntcaaye ftencergene nuclear the of analyses Phylogenetic IHadGS analysis GISH and FISH ( D StY eune fhbisrne rm98t 04p h aamti otie 16caatr,of characters, 1166 contained matrix data The 1004bp. to 998 from ranged hybrids of sequences 1 rb from probe nodrt xlr h aenloii ftehbisietfidcytologically, identified hybrids the of origin maternal the explore to order In ) rps .stricta R. ( omdasbld B=4,P=.3.I ld I B=6,P=.0,teHtp sub- H-type the PP=1.00), (BS=96%, III clade In PP=0.83). (BS=64%, subclade a formed ) StY B=8,P=.0.Tecaecnand1 yrd H eune and sequences RH2 hybrids 10 contained clade The PP=1.00). (BS=88%, 6sqecso h yrd n hi soitdseisof species associated their and hybrids the of sequences 16 2 St Y 8 a IHmre o the for marker FISH a was -80 tp eune omdasrnl upre ld,wihcnandtettali species tetraploid the contained which clade, supported strongly a formed sequences -type tp eune omdasrnl upre ld,wihicue diploid included which clade, supported strongly a formed sequences -type pce n yrd.The hybrids. and species ) .turczaninovii R. .ciliaris R. Hordeum and Elymus .turczaninovii R. pce n tetraploid and species .stricta R. .stricta R. ( Fgrs6,d n b ,f.Terslso IHadGS indicated GISH and FISH of results The f). d, 7b, and f d, 6b, (Figures StH ( StY and ) St omdasbld B=1,P=.0.I ld I(BS=99%, II clade In PP=1.00). (BS=51%, subclade a formed ) The . a h aenldnro h yrd RH1, hybrids the of donor maternal the was eoecrmsms xeta h etoei einadnear and region centromeric the at except chromosomes, genome Roegneria DMC eeqierglrwt 4bvlns(iue ac al S2). Table 5a-c, (Figures bivalents 14 with regular quite were St Y tp eune f1 hybrids, 15 of sequences -type St eoe(iue a ,ead7,c ) hsrsl was result This e). c, 7a, and e c, 6a, (Figures genome rps eunewr hw nFgr .I ld (BS=54%, I clade In 8. Figure in shown were sequence 1 eoe(ag ta. 07.Sgaspoue ySt by produced Signals 2017). al., et (Wang, genome 6sqecsfo yrd H eegopdwith grouped were RH2 hybrids from sequences 16 DMC rmssterilis Bromus 6 Elymus .stricta R. ( StY n h hools gene chloroplast the and 1 StY pce n yrd.The hybrids. and species ) ( rps StH rps B=4,P=.7.Tecaecontained clade The PP=0.97). (BS=64%, . 6sqec eesoni iue9 The 9. Figure in shown were sequence 16 pce.CaeI B=6,PP=1.00). (BS=96%, IV Clade species. ) 6sqecsvre rm80t 831bp. to 830 from varied sequences 16 eeue steotru.Tedata The outgroup. the as used were Roegneria .turczaninovii R. E St e , E eoepeetdi the in presented genome and b DMC , W .turczaninovii R. Elymus , rps St P n h chloro- the and 1 .turczaninovii R. Pseudoroegneria tp sequences -type , rps 6sequences 16 Ta ( h length The . StY 6sequence 16 , nsitu in V , and ) Ns 2 was , hy- -80 A R. R. . , Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ta. 07 ots&Sli 09.Atog oelrefmle n eeawr icl oproduce to difficult were genera and such genera, families several large of hybridizations some (Goulet interspecific Although plants frequent also of were mechanisms 2009). there evolutionary Soltis 1996), as main al., & et the Soltis (Ellstrand of hybrids 2017; one was al., hybridization et conditions, natural Under gene nuclear on based with analysis relationships Y phylogenetic close have of hybrids results natural The PP=0.83). (BS=64%, clade the In PP=1.00). phylogenetic distinct (BS=51%, performed Two we study, compositions. present genomic the ( different hybrids, In species with from associated species 2017). have Triticeae the species al., hybrids, other relation- polyploid et the the of source Tang study introgression of allopolyploid, gene to 2002; analyses phylogeny and of events, molecular (Sang, history hybridization plant advantages speciation of of relationship, generation significant There- analysis donor, phylogenetic evolution. the genome plant concerted in species polyploid by sequence of affected species, DNA rarely ideal related is an of and as ship parents used both is from it inherited fore, is gene nuclear copy Single Chro- 4). (Figure 2n=4x=28 of tetraploids, meiosis were that hybrids were showed natural plants analysis putative the pairing that 57 mosomal hypothesized that We showed low 1d-o). analysis very (Figures Karyotype is node set stem seed and sheath their leaf and of basal plants hybrids between leaf, intermediate around plants morphologically of than sterile were pubescence stronger distributed They as grew randomly 3). plants were and sterile there 1a-c These that (Figures found field. We experiment individually. the them in planted and species two the stricta R. Yne l,21) t.Tiieewsayuggop hr a ag osblt frno hybridization hybrids random natural of of possibility generation The large a 2009). was Bothmer, there & (Barkwoth group, Triticeae young the a in was genera Triticeae relative the etc. among 2013), al., et (Yan RH2. hybrids the 4.3 of parents that male suggested and we female analysis, phylogenetic the and cytological of results turczaninovii the on based Therefore, RH1, hybrids the of parent with from with grouped collected grouped were were sequences sequences RH1 RH2 hybrids 5 showed sequence St the with tetraploids were hybrids 4.2 these that indicated results the above with was The hybridized hybrids were and chromosomes parents 28 the of where constitution GISH, by confirmed was from result hy- This all In genome. S2). (Table displayed RH2 hybrids hybrids St comparatively in using was genomes. 3.45 hybrids analysis homology the to FISH of of 0 varying pairing sets Univalent chromosome from two that MI. varying had indicating at it and 0.81, univalent whereas than regular, had higher RH1, hybrids was hybrids c-value all the in RH2-31, brids, 2.00 hybrid to for 0.42 Except from 5). (Figure hybrids putative 4.1 Asplenium eoe.Terslswr ossetwt yooia tde.Pyoeei nlssbsdon based analyses Phylogenetic studies. cytological with consistent were results The genomes. and | | | .ciliaris R. omto rcs fntrlhybrids natural of process Formation RH2 and RH1 hybrids of Origin hybrids natural of Identification Y and .stricta R. lds(iue8.I the In 8). (Figure clades eetefml n aeprnso h yrd RH1; hybrids the of parents male and female the were .stricta R. Lee l,2015), al., et (Lee .stricta R. .turczaninovii R. Fgrs6,d n b ,f.Terslsof results The f). d, 7b, and f d, 6b, (Figures St and ye(iue a ,ead7,c ) niaigta hycnandoesto the of set one contained they that indicating e), c, 7a, and e c, 6a, (Figures type 2 8 hwdta h 4crmsmsof chromosomes 14 the that showed -80 yrd H eecletdfrom collected were RH2 hybrids , , .turczaninovii R. .turczaninovii R. .stricta R. Y eepatdi h xeietlbs fSG.W olce h ed of seeds the collected We SAGS. of base experimental the in planted were Senecio ld,1 yrd sequences, hybrids 15 clade, .turczaninovii R. St a h eaeprn ftehbisRH2. hybrids the of parent female the was ld,1 yrd eune and sequences hybrids 15 clade, Abt oe 2004), Lowe, & (Abbott n h te rtca pce rwn erywr iie into divided were nearby growing species Triticeae other the and . StY R . stricta .stricta R. .stricta R. . B=7,P=.0.Frhroe yrd H were RH1 hybrids Furthermore, PP=1.00). (BS=87%, 7 and , and .turczaninovii R. .turczaninovii R. .turczaninovii R. .turczaninovii R. nsitu in .stricta R. .turczaninovii R. .stricta R. Betula yrdzto hwdta h genomic the that showed hybridization .turczaninovii R. .stricta R. StY .turczaninovii R. Wn ta. 2014), al., et (Wang , B=4,P=.7,1 hybrids 10 PP=0.97), (BS=64%, .turczaninovii R. So, . DMC n hyalcontained all they and , , genome. .grandis R. and eemr eua hnthe than regular more were and oiso h sequences the of copies 1 .stricta R. .stricta R. .turczaninovii R. and DMC , omdasubclade a formed .sibiricus E. .stricta R. n h natural the and .stricta R. a h female the was Rhododendron hwdthat showed 1 omdasub- a formed StY St and such , probe rps and ) were and St R. 16 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. eeoi a eyipratbooia hnmnnta yrd ups aet nidvda ie via- size, individual in parents surpass hybrids that phenomenon biological important very a was Heterosis 97.S,tentrlhbisfudi hssuypoie odrsac aeilfrepoigthe exploring for material research good a species. hybrid provided of an study formation was the this and on in 4.5 needed process, found be evolution hybrids will the (Rieseberg, the research natural speciation Further in hybrid in the of formation. mechanism example, types formation So, For the transition explore to important 1997). system species. material the the new retained of part to which indispensable species that transition variable, published showed hybrid highly previously analysis was of some sequence words, DNA of state other and hybrid intermediate cytology In natural or through species. (2011) hybrid of population, Zeng which be understanding Triticeae, characteristics, 2003). progeny morphological wrong to (Abbott, hybrid to the distinguish likely according the to to species were lead new in difficult a to and variation such defined easy blurred only phenotypic evolution, was became botanists and of parents past, 1998; the ways genetic their in Carney, different and abundant Therefore, & them by the between (Rieseberg produced to boundaries 2005; hybridization were the Due introgressive (Mallet, species evolution and New 2017). hybridization, species Wang, 2016). homoploid of Stukenbrock, component polyploidization, 2016; important as an al., as et recognized Mallet increasingly was Hybridization aet eddt efrhrvrfidb oeua akr rohrmethods. other or the markers of molecular diversity by 4.4 verified genetic further The of be field to rate. the needed hybridization the parents in while natural observed low, were higher was differences a diversity rate morphological hybridization genetic Large natural the that diversity. seen and be single 330 can was It about parents the 16.36%. about among was 400 while rate about of hybridization 5.75%, the natural of about hybrids, out was 54 hybrids were rate 23 hybridization were natural factors there natural underwent rate, and the and hybridization environment of other favorable perspective each a the pollinated From form pollen which hybrids. their natural of growing, form all process to the synchronous, hybridization In was with hybridization. time natural flowering relationships for the close and have close, hybrids was natural 15 turczaninovii R. that indicated results turczaninovii genomes The the (representing hybridization. analysis. natural species the genomic for basic Ns conditions provided 20 which selected close, We also was areas distribution their and yrd admydsrbtdi hs ed.Tentrlhbismrhlgclycmie oeunique some combined morphologically hybrids species. natural two The the of fields. 1d-o) these (Figure characteristics in distributed randomly hybrids epcieyadidvdal lne hmfrepnigpoaain hr eeaot40pat in plants planted 400 are about fields were adjacent There two The propagation. years. expanding ten for than them more planted the for individually the field and in the planted respectively in were kept Triticeae as in be with constitutions such could genome SAGS, they different the planting,perennials, with of close species and base genera environment experiment hybridization. different open-air natural study, good of this The occurrence so In the 2017). species, for (Tian, other created with hybridization encounters were occur flowering conditions to of favorable be of In likely possibility to the more stage needed increasing was flowering conditions. also which it hybridization the environmental months, natural several example, and of for For habits parents lasted have the stage. pollination distribution, flowering close species, in very of close or overlapping constitution the genomic to the addition by affected was .turczaninovii R. , .stricta R. | | R A tlzto fntrlhybrids natural of Utilization yrdspeciation Hybrid . , stricta B and , eseuae httehbiswr rdcdb h yrdzto between hybridization the by produced were hybrids the that speculated We . ed n bu 3 lnsi the in plants 330 about and field, nti td.Terpod n h eoi osiuinwr h ae h itiuinarea distribution the same, the were constitution genomic the and ploidy Their study. this in and D .rigidula K. a bu ie htof that times 3 about was fTiiee yrd n soitdseisgoigaon yrd o phylogenetic for hybrids around growing species associated and hybrids Triticeae, of ) .turczaninovii R. and lmsnutans Elymus epciey fe he er fpatn,w olce hi seeds their collected we planting, of years three After respectively. , Roegneria .stricta R. .stricta R. .turczaninovii R. ahrta elseis yrdpoeypopulation progeny Hybrid species. real a than rather , ( StY 8 h esnmyb httesuc fthe of source the that be may reason The . ), a iia to similar was Elymus eoi crassirostris Begonia .turczaninovii R. St .stricta R. ed efudsm uaienatural putative some found We field. ( StH , H .turczaninovii R. .turczaninovii R. , t.Det hs lnswere plants these to Due etc. ) E e aet and parents .turczaninovii R. , E b aethshge genetic higher has parent egii stenachyra Kengyilia and , W .stricta R. eoi hemsleyana Begonia R , hc eddto leaded which , nflwrn time flowering in P .turczaninovii R. . .stricta R. stricta , lns there plants, I lns and plants, , .stricta R. Ta and , and V sa is R. , Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. altp eune forsuyivle r eoie nGnakwt ceso ubr MZ130327- numbers accession with GenBank The in REFERENCES /dryad.v41ns1rw9. deposited doi.org/10.5061 are https:// involved at study Repository our MZ130377. Digital of Dryad sequences the haplotype from available are Data Supervision (Equal). (Equal); ACCESSIBILITY editing DATA Resources & (Equal); Writing-review (Equal); administration draft Project Writing-original (Lead); (Equal); Investigation (Equal). (Lead); Supervision acquisition (Equal); Resources (Equal); Zhou porting). (Supporting). Validation (Supporting); Soft- ing). (Supporting); (Equal). Resources (Equal). Software (Equal); Visualization (Supporting); (Equal); analysis Formal Supervision (Equal); (Equal); (Equal). ware editing curation & Data Writing-review (Equal); (Equal). (Equal); Conceptualization editing draft Writing-original & (Lead); Writing-review Software (Lead); (Equal); draft Writing-original Zheng (Equal); Zilue administration Project (Equal); Chen Chen and 21YYJSYJ0083) 31870309 (2021NZZJ0010, Province CONTRIBUTION Nos. Sichuan (Grant AUTHOR of China of Bureau supports. Foundation Technology financial Science and their Natural for Science National the the and to 31670331) thankful are authors The be We ACKNOWLEDGMENTS could benefits. hybrids F economic natural hybrid and these in good ecological If fertility with good low. in have hybrids fertility. very would increase natural was it an some fertility varieties, found the found forage had but we new study, leaf, create this and to improved In tillers, genetically height, 1910). heterosis plant (Keeble, used in improvement long traits have genetic forage Breeders of means 1908). (Shull, a quality as and yield adaptability, environmental fertility, bility, Gl,BS,Fib,B,&Ed,TR 19) tnadkroyeadnmnltr ytmfrdescrip- for system nomenclature and karyotype spontaneous Standard (1991). Press. of T.R. Science Endo, Beijing, & Distribution (Gramineae). B., Sinicarum Evolution, Friebe, Primarum B.S., Plantarum bootstrap. Gill, Illustrata the Flora 8. using (1984). approach (1996). Y. an Keng, phylogenies: 7. L.H. on limits Confidence Rieseberg, (1985). J. & Felsenstein, 6. R.W. hybridization intergeneric Whitkus, to guide N.C., a as Ellstrand, classification 5. of system Genomics genomic and The Genetics Triticeae. (1984). the in D.R. Names Dewey, Scientific 1189–1190. 4. (2009). 301: R.V. Science, species: Bothmer, speciation. polyploid & and new M.E., sunflowers, Barkwoth, of Sex, evolution 3. (2003). R.J. and Abbott, establishment 2. Origins, (2004). A.J. Lowe, & R.J. Abbott, 1. ogigLiu Songqing ino hoooebnsadsrcua brain nwet( 5090-5093. wheat in aberrations structural 93: and bands USA, chromosome of Sciences, tion of Academy tb00420.x National 5646.1985. https://doi.org/10.1111/j.1558 the 783–791. 39: of Proceedings https://doi.org/10.1073/pnas.93.10.5090 (pp. Improvement hybrids. Plant in plant Manipulation Gene Press. (Ed), University Gustafson Columbia York, J.P. New In 209-279). Triticeae. perennial the with 3-30. Triticeae, the of j.1095-8312.2004.00333.x https://doi.org/10.1111/ 467-474. 82: cambrensis Senecio aiain(Supporting). Validation : oyn Kang Houyang ocpulzto Eul;Fra nlss(ed;Ivsiain(ed;Methodology (Lead); Investigation (Lead); analysis Formal (Equal); Conceptualization : ocpulzto Eul;Dt uain(qa) omlaayi Eul;Investigation (Equal); analysis Formal (Equal); curation Data (Equal); Conceptualization : eore (Supporting). Resources : and uevso (Supporting). Supervision : .eboracensis S. arn Yang Cairong hnbn Zhang Changbing igFan Xing 2 nteBiihIls ilgclJunlo h ina Society, Linnean the of Journal Biological Isles. British the in ˜2%.W ilcniu osl-rs h yrd oimprove to hybrids the self-cross to continue will We 25%). (˜ il Lu Jiale ocpulzto Spotn) ehdlg (Support- Methodology (Supporting); Conceptualization : otae(Supporting). Software : aqnZhang Haiqin 9 aacrto Eul;Poetadministration Project (Equal); curation Data : rjc diitain(uprig;Supervision (Supporting); administration Project : iWang Yi uTan Lu omlaayi Eul;Investigation (Equal); analysis Formal : ocpulzto Eul;Funding (Equal); Conceptualization : aiain(Supporting). Validation : rtcmaestivum Triticum iaSha Lina iulzto (Sup- Visualization : .Gnm,34: Genome, ). adnWu Dandan Yonghong : Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. Gidn . esc . uaad .. ace,O 20) siaigmxmmlikelihood maximum Estimating (2009). O. Gascuel, & J.F., Dufayard, F., Delsuc, S., Guindon, 10. Sn,T,Cafr,DJ,&Susy ..(95.Dcmnaino eiuaeeouini peonies in evolution reticulate of Documentation (1995). T.F. Stuessy, in & Reviews D.J., Critical phylogenetics. Crawford, plant T., in sequences Sang, gene 30. nuclear low-copy of mixed Utility under (2002). inference T. phylogenetic Sang, Systematics, Bayesian 599-624. 3: 140(4): & 29. MRBAYES Phytologist, (2003). Ecology New J.P. hybridization. of Huelsenbeck, Plant & Review (1998). F., Annual S.E. Ronquist, Carney, species. 28. & plant L.H., Rieseberg, of 27. origins Journal American Hybrid skins. (1997). new in L.H. wine old Rieseberg, evolution: in 26. hybridization of role pri- The (1995). repeat-specific L.H. spacer Rieseberg, transcribed 25. Internal (2002). a A.H.D. as Brown, region & ITS J.J., ribosomal Doyle, The J.T., (1997). Rauscher, E. 24. Alvarez-buylla, Bioin- & substitution. W., DNA Robinson, of A., model Liston, the A., testing Quijada, MODELTEST: 23. (1998). K.A. Crandall, & D., application Posada, phylogenetic and 22. evolution Molecular (2002). O. Seberg, & G., Petersen, 21. of characterisation cytogenetic Molecular (2019). V. Nucleic DNA. Mahelka, combining plant weight & hybridization: molecular A., Paˇstov´a, high Phy- test Belyayev, of and 20. isolation L., Rapid detect to (1980). W.F. used (2018). Thompson, Approaches & H.G., H. (2017). Murray, 140-149. R.C. 38: 19. Zhou, Zhang, BioEssays, 20: & species? Evolution, Y., are & Ma, reticulated J., Ecology How Mao, . in . (2016). . Trends 18. M.W. Hahn, genome. H., & the N., Besansky, of Kang, J., invasion Mallet, an Y., 17. as Hybridization Wang, (2005). L., J. Mallet, Sha, 16. X., Fan, hybrids J., natural unrecorded Liu, peas one in and in Y., flowering new variation Two of Lei, time and (2015). 15. and K.S. Chung, constitution stature & of Genomic S.H. inheritance Yeau, of K., mode Lee, The C.S., (2004). Lee, (1910). 14. Z. C. Pellew, Liu, & F., & Keeble, 13. G., Fedak, B., Press. Liu, Science Beijing: Sinicae, F., Popularis Reipublicae Han, Flora 12. (1987). B. Guo, 11. Gue,BE,Rd,F,&Hpis .(07.Hbiiaini lns l da,nwtechniques. new ideas, old plants: in Hybridization (2017). R. Hopkins, & F., Roda, B.E., Goulet, 9. hlgne ihPyL ehd nMlclrBooy 3:1317 https://doi.org/10.1007/978- 113-137. 537: Biology, Molecular in 1-59745-251-9 Methods PhyML. with phylogenies https://doi.org/10.1104/pp.16.01340 65–78. 173(1): Physiology, Plant https://doi.org/10.1139/G91-128 830-839. iceityadMlclrBooy 73:1117 https://doi.org/10.1080/10409230290771474 121-147. 37(3): Biology, Molecular and Biochemistry https://doi.org/10.1093/bioinformatics/btg180 1572–1574. 19: Bioinformatics, model. 359-389. 28(28): https://doi.org/10.1002/J.1537-2197.1995.TB15711.X 944-953. 82: Botany, of the https://doi.org/10.1046/j.1365-294X.2002.01640.x in 2691-2702. hybridization 11(12): of Ecology, analysis Molecular the and mers https://doi.org/10.1046/j.1365- 995-996. 6: Ecology, Molecular pines. 294X.1997.t01-1-00273.x in hybridization detect to marker /14.9.817 https://doi.org/10.1093/bioinformatics 817–818. 14: formatics, https://doi.org/10.1006/mpev.2001.1011 43-50. (1): 22 Evolution, and Phylogenetics https://doi.org/10.1186/s12870-019-1806-y 230. 19(1): × 8.19.4321 https://doi.org/10.1093/NAR/ 4321-4325. 8: 577-599. Research, 25: Acids Science, Biodiversity analyses. genetic population and phylogenetic 129–142. 186, https://doi.org/10.1002/bies.201500149 Society, Linnean the of https://doi.org/10.1016/j.tree.2005.02.010 229-237. Journal Botanical Triticeae). the https://doi.org/10.1093/botlinnean/box081 of (Poaceae: evolution genera affinitive molecular and logeny 2015.45.4.362 https://doi.org/10.11110/kjpt. 362-368. 45: 1070-1076. 109(5): between Genetics, Applied and Theoretical ( analysis. protein – storage wheat https://doi.org/10.1007/s00122-004-1720-y seed of and amphiploids GISH partial five iu sativum Pisum mucronata slnu ruprechtii Asplenium aua yrdof hybrid natural a , 6 .Junlo eeis :4-6 https://doi.org/10.1007/BF01798042 47-56. 1: Genetics, of Journal ). n eae aa(slnaee.Kra ora fPatTaxonomy, Plant of Journal Korean (Aspleniaceae). taxa related and .intermedia E. Thinopyrumintermedium DMC 10 lcn tomentella Glycine and eei h oyli genus polyploid the in gene 1 .repens E. Tiiee oca) M ln Biology, Plant BMC Poaceae). (Triticeae, srvae yGS,multicolor GISH, by revealed as Lgmnse oyli complex. polyploid (Leguminosae) Roegneria DMC .Molecular 1. Elytrigia n its and Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. Tn,C,Q,J,Ce,N,Sa . ag . eg . a .(07.Gnm rgnadphy- and origin Genome (2017). X. Fan . . . J., Zeng, Y., Wang, L., Sha, N., plant Chen, fungal J., new of Qi, emergence C., and Tang, evolution the 42. in hybridization of role The (2016). E.H. Stukenbrock, Hordeae. 41. Tribe Gramineae, the in hybrids natural and Artificial Hordeae. (1949). Tribe M.S. Gramineae, Walters, the & Hordeae. in G.L., Tribe hybrids Stebbins, Gramineae, natural 40. and the Artificial in (1954). hybrids A. Vaarama, natural & G.L., and Stebbins, In Artificial plants. (1950). 39. in R. evolution Singh, & polyploid of G.L., and Stebbins, Review data Annual Molecular 38. (1992). speciation. D.E. plant Soltis, in Critical & hybridization polyploidy. J.J., of of Doyle, role P.S., nature The Soltis, dynamic (2009). 296-301. 37. the D.E. and 4: Soltis, data & , P.S., Molecular Soltis, Heredity, (1993). P.S. 36. of Soltis, of Journal & duplication D.E., maize. A Soltis, of (2006). 35. V.L. field Woo, & a M.M., of Funke, J.F., composition Smith, The 34. (1908). tortoise The G.H. (2005). R.L. Shull, Small, re- . 33. Phylogenetic . . (2010). J., Miller, Y. W., Liu, Zhou, S.B., Farmer, J.T., . Beck, . . E.B., Lickey, J., L., Shaw, Zhang, 32. C., Ding, H., Kang, R., Yang, X., Fan, L., Sha, 31. Yn . a,L,&L,D 21) oeua vdnefrntrlhbiiainbetween hybridization natural for evidence Molecular (2013). D. Li, & L., Gao, L., Yan, com- reveals 49. phylogeny DNA chloroplast and Nuclear 565-576. (2014). 25(6): C.L. McIntyre, Science, & Biodiversity G., Sun, speciation. Q., Mole- Hu, and C., (2014). hybridization Yan, Natural R.J.A. 48. (2017). Buggs, Y. & Wang, R.A. 47. Nichols, A., marker Kuttapitiya, FISH new W.J., a Bodles, St2-80: characte- J.S., (2017). Y. Borrell, and Zhou, N., . Wang, Occurrence . . 46. X., (2017). Fan, L., Sha, R. Y., Wang, Wu, H., Su, & Q., Shi, L., Y., Wang, 45. Tong, (1926). H. N., Bleier, & Fu, E., Tschermak, Von Y., 44. Xiao, C., Li, D., Tian, 43. oeei eainhp of relationships logenetic https://doi.org/10.1094/PHYTO-08-15-0184-RVW 104-112. 106: Phytopathology, pathogens. 301. involving Hybrids III. between allopolyploids and Hybrids VII. of York, hybrids New triploid -201). Two 177 IV. (pp. Plant of Systematics Molecular Hall. (Eds.), & Doyle Chapman J.J. NY: & Soltis, D.E. Soltis, P.S. annurev.arplant.043008.092039 https://doi.org/10.1146/ 561–588. 60: Biology, Plant https://doi.org/10.1080/07352689309701903 243-273. 12: Sciences, Plant in Reviews https://doi.org/10.1007/s00606-006-0445-6 245-256. 261(1-4): lution, tribe analysis. phylogenetic for sequences https://doi.org/10.1093/jhered/os-4.1.296 DNA chloroplast https://doi.org/10.3732/ajb.92.1.142 142-166. noncoding 92: 21 Botany, of of utility Journal relative American II: hare the and j.ympev.2009.05.005 https://doi.org/10.1016/ 1, between United lationships the of Sciences of Academy https://doi.org/10.1073/pnas.92.15.6813 National 6813-6817. the 92: of States, Proceedings evolution. concerted and biogeography ( 1, 2014-0002 of history 2771-2782. evolutionary 23: plex Ecology, Molecular Britain. in birch dwarf of retreat Holocene https://doi.org/10.1111/mec.12768 the of footprints cular 2016-0228 for 110–132. 44: Gesellschaft, Botanischen schen of hybridization natural ps://doi.org/10.17520/biods.2017050 of ristics ps://doi.org/10.1016/j.bse.2016.11.011 Paeonia DMC DMC St Coronanthereae eoeadgnm nlssi rtca.Gnm,6:5353 https://doi.org/10.1139/gen- 553–563. 60: Genome, Triticeae. in analysis genome and genome n chloroplast and 1 n chloroplast and 1 sn nenltasrbdsae eune fncerrbsmlDA mlctosfor implications DNA: ribosomal nuclear of sequences spacer transcribed internal using ) Hystrix Gseica) hlgntcaayi n vlto.PatSseaisadEvo- and Systematics Plant evolution. and analysis phylogenetic (Gesneriaceae): lmscondensatus Elymus lmsvillosus Elymus trnL Agropyron lmspendulinus Elymus trnL n t lsl eae eea(rtca;Paee ae nnuclear on based Poaceae) (Triticeae; genera related closely its and - F - F eune.BohmclSseaisadEooy 0 6–7.htt- 168–176. 70: Ecology, and Systematics Biochemical sequences. eune.MlclrPyoeeisadEouin 4 327–335. 54: Evolution, and Phylogenetics Molecular sequences. Begonia and lmsglaucus Elymus brfruchtbare Uber ¨ Tiiee oca)bsdo igecp nuclear single-copy on based Poaceae) (Triticeae: and Elymus rmCia idvriySine 5 5-7.htt- 654-674. 25: Science, Biodiversity China. from .triticoides E. 11 eoe 72:9–0.https://doi.org/10.1139/gen- 97–109. 57(2): Genome, . mrcnJunlo oay 75:388-393. 37(5): Botany, of Journal American . Aegilops and mrcnJunlo oay 63:291- 36(3): Botany, of Journal American . Sitanion Wiebsad.Brct e Deut- der Berichte -Weizenbastarde. gcyc p.Gntc,3() 378-395. 39(3): Genetics, spp. rdtsdvrec within divergence predates Acc Rhododen- 1, Pgk Acc Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. AL 1 TABLE yrd7 hybrid 6 hybrid 5 hybrid Locality 4 hybrid 7 3 hybrid 6 Accesssion 2 hybrid 5 1 hybrid 4 2n 3 2 Genome Species/Hybrids 1 Number 2 TABLE yrdR21˜H-0––4 0Scun China Sichuan, China Sichuan, 40 17 40 17 – – – – ˜RH2-40 RH2-1 ˜RH1-17 RH1-1 Origins Origins No. Plants 2n Genomes Hybrid No. Hybrid Accession stricta Roegneria turczaninovii Roegneria hybris and Parents Zo,Y,Yn . ag .(95.Asuyo h negnrchbi of hybrid intergeneric the on study A (1995). J. between Yang, hybrids & intergeneric of C., studies Yen, Cytogenetic Y., (2008). Zhou, Y. Zhou, 56. and & constitution Y., Molecular Wang, genomic X., (2012). in Fan, H., differences Y. Zhang, reveals Zhou, behaviour 55. pairing . . Meiotic . (2006). L., Y. Zhang, Zhou, H., & H., Kang, Zhang, L., 54. Sha, H., Zhang, X., Fan, J., Zeng, 53. on Study Phylogenetic Molecular networks phylogenetic (2011). on J. histories Zeng, Coalescent (2011). 52. L. Nakhleh & J.H., Degnan, C., Than, genus Y., the Yu, of revision 51. A (2008). C. Yen, & B.R., Baum, J., Yang, 50. vulgare. ciliaris Roegneria https://doi.org/10.1007/s00606-005-0394-5 129-136. 258: Evolution, and Genes matics China. west in between origin and /s13258-012-0057-1 occurrence https://doi.org/10.1007 hybrids 499-507. grass 34: wheat Genomics, natural & the for evidences cytological from Derived Resources University. Breeding Agricultural 138-149. New Sichuan 60: of Biology, Analysis Systematic Cytogenetic sorting. lineage incomplete despite hybridization https://doi.org/10.1093/sysbio/syq084 of detection and 311–381. 26: University, Agricultural Sichuan of Journal https://doi.org/10.1111/j.1759-6831.2012.00243.x spiciferum dron h aeil sdi hsstudy this in used materials The ln aeil sdi hlgntcanalysis Phylogenetic in used materials Plant ora fScunArclua nvriy 3 144-149. 13: University, Agricultural Sichuan of Journal yti patula Hystrix and and 2102 Y 11140 ZY .spinuliferum R. emsmulticaulis Leymus n te pce fgenus of species other and StY StY StY StY StY StY StY Eiaee.Junlo ytmtc n vlto,5:426-434. 51: Evolution, and Systematics of Journal (Ericaceae). StY StY Paee rtca) caPaautreSnc,1:162-165. 17: Sinica, Prataculturae Acta Triticeae). (Poaceae: 12 xR25Sichuan, Sichuan, RH2-5 Sichuan, RH2-2 Sichuan, Sichuan, RH1-14 4x Sichuan, RH1-12 4x Sichuan, RH1-8 4x RH1-6 4x RH1-3 4x 4x 4x Hystrix 866InrMnoi,china China Mongolia, Sichuan, Inner 14 6 14 6 28 28 Kengyilia onh(oca,Tiiee.PatSyste- Plant Triticeae). (Poaceae, Moench Roegneria .YnE ..Yn n Molecular and Yang J.L. Et Yen C. Elytrigia .Kc Paee Triticeae). (Poaceae: Koch C. ev Tiiee Poaceae). (Triticeae: Desv. .kamoji R. China China China China China China China × Hordeum No. GenBank rps DMC 16 1 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 25 ubrSeisHbisGnm nAcsso oaiyGenBank Locality Accesssion 24 23 Putative 2n Genome 22 Species/Hybrids Number Putative 20 hybrid 19 hybrid 21 18 hybrid 20 17 hybrid 19 16 hybrid 18 15 hybrid 17 14 hybrid 16 13 hybrid Locality 15 12 hybrid 14 11 Accesssion hybrid 13 10 hybrid 9 hybrid 12 8 2n hybrid 11 10 Genome Species/Hybrids 9 8 Number Rf)Swezey (Raf.) elymoides Elymus caninus Elymus sibiricus Elymus Nevski (Drobow) turczaninovii Roegneria parent S.L.Chen (Keng) strictus Roegneria parent L. L. StH StH StY StY StY StY StY StY StY StY StY StY StY StY StY StH StY StY 13 xP 264Uie ttsFJ695161* States United Soviet Former 628684 PI 314621 PI 4x 4x Sichuan, Sichuan, RH2-39 Sichuan, RH2-37 Sichuan, RH2-31 Sichuan, 4x RH2-30 Sichuan, 4x RH2-18 Sichuan, 4x RH2-17 Sichuan, 4x RH2-16 Sichuan, 4x RH2-15 Sichuan, 4x RH2-14 Sichuan, 4x RH2-13 Sichuan, 4x Sichuan, RH2-11 4x RH2-10 4x RH2-7 4x 4x 4x xP 159Xinjiang, 619579 PI Inner 4x 11140 ZY 4x Sichuan, 2102 Y 4x Union China China China China China China China China China China China China China China China Mongolia, China No. GenBank EU366408* EU366407* FJ695160* rps DMC NO. GQ855198* EU366409* 16 1 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ubrSeisHbisGnm nAcsso Locality Accesssion 2n Genome Species/Hybrids 26 Number 28 27 38 GenBank 37 Locality Accesssion 36 35 2n Genome 34 Species/Hybrids Number 33 32 31 30 29 Buckley glaucus Elymus wawawaiensi Elymus virginicus Elymus L A. (Pursh) spicata Pseudoroegneria Dewey R. D. (Hackel) libanotica Pseudoroegneria Nevski (Drob.) ugamica Roegneria C.Yen & Yang L. J. Salomon) (B. shandongensis Roegneria Drob. (Boiss.) longearistata Roegneria Kitagawa hondai Roegneria grandis Roegneria dura Roegneria Nevski ciliaris Roegneria Koch caucasica Roegneria ¨ ove Keng (Trin.) Keng K. L. StH StH StH St St StY StY StY StY StY StY StY StY 14 xP 931PI United 490361 Oregon PI 593652 PI 4x 4x xP 411PI 547161 PI 2x Sichuan, 506284 PI 4x xP 239PI 228389 Sichuan, PI 1698 KX578862* Y China Shanxi, 2x 3150 Inner ZY 4x 2259 Y 4x Sichuan, 4x 0362 Neimenggu, Y Y 3189 ZY 2124 Y 4x Xinjiang, 335 87-88 4x 4x 3207 H 4x 4x 882397 632532 228392 3189 88-89-238 China Sichuan, States United States ntdSae FJ695175* States United China rnFJ695174* Iran China China Mongolia, China KU160615* China Xizang, China China Sichuan, Armenia No. GenBank GQ855196* GQ855195* FJ695162* FJ695163* KY636118* rps DMC NO. KX578878* KX578877* KX578848 KX578841* KX578840* KU160618* KX578879* KU160617* KU160610* HM770784* HM770785* 16 1 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ubrSeisHbisGnm nAcsso Locality Accesssion 2n Genome Species/Hybrids 39 Number 51 50 49 44 40 52 GenBank Locality Accesssion 2n 48 Genome 47 Species/Hybrids Number 46 45 43 42 41 Nevski) ex (Czern. stipifolia Pseudoroegneria Tausch. speltoides Aegilops Kuo P.C ex Keng huashanica Psathyrostachys A. Rayss) & (Savul. bessarabicum Thinopyrum Schult. & Roem. chilense Hordeum L A. Bieb.) strigosa Pseudoroegneria tauschii Aegilops L A. (Host) elongatum Lophopyrum vulgare Hordeum Wilensky bogdanii Hordeum Hook.f pubiflorum Hordeum L A. (Vickery) retrofractum Australopyrum Gaertn cristatus Agropyron L A. tauri Pseudoroegneria ¨ ove ¨ ove (Boiss.) . L (M. Coss. . (L.) ¨ ove ¨ ove St B Ns E H St D E W St I H H P b e 15 xP 211Stavropol, 325181 PI 2x xP 371W6 531711 PI 2x xH66 E2 AF277235* DQ247833* AE429 6668 H 6779 H Shanxi, 2x 531823 PI 2x 2x 531719 PI 2x FJ695173* Chile 531781 PI PI 6723 H 2x 2x 401329 PI PI 595164 PI 2x 2x xH37 tl EF115541* Italy FJ695172* 3878 H KY636108* China 2x 531761 PI 2028 BCC 2x 2x PI 4349 H 2x 21890 PI531718 531553 PI380650 499637 598628 Russian usaAF277254* Russia China AF277246* Israel States United China KU160613 Iran China Xinjiang, Kazakhstan China No. GenBank FJ695176* FJ695177* KY636145* GU165826* MH331643* KY636080.1* AF277251* JQ754651* rps DMC NO. KY126307* AF277241* MH331641* 16 1 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. n 4crmsmswr aee snnS ye b,()ad()Wt oa eoi N of DNA genomic total With (f) and (d) (b), signals. fluorescent type. green non-St as labeled ( were St chromosomes Using 14 (e) and and (c) (a), RH2-15. of DNA genomic 7 total FIGURE With (f) and (d) signals. (b), fluorescent RH2-11 red type. (h) non-St rod). as labeled 2 ciliaris were and chromosomes ring 14 bridge. (12 and chromosome (arrowed) II RH2-11 14 (i) with I. 2 RH2-29 (f) + (g) rod) 6 chromosomes. 2 lagging FIGURE and RH2-38 ring (11 (f) II I. 13 2 with + rod) 8 + (c) II. 14 with 5 FIGURE Different leaf. Note: second turczaninovii awn. top of 4 of Length Length (i) FIGURE (e) florets. of leaf. Number flag ANOVA. (h) of 3 of spike. Width FIGURE difference of (d) of Length leaf. significance (g) flag the leaf. shows of second letter Length top (c) of Width tillers. (f) of Number (b) height. (h) (l) 2 (arrowed). FIGURE parents. RH2 parents. and hybrid hybrids and O: of hybrids (arrowed). segments of RH1 Stem hybrid leaves (k) Basal (arrowed). – (o) (d) RH1 (h) – hybrid (arrowed). (c) parents. RH2 (arrowed). hybrid and turczaninovi RH2 G: hybrids hybrid (arrowed). of (b) RH1 Leaves hybrid (arrowed). (g) RH1 – hybrid (a) (d) hybrids. of distribution 1 FIGURE (http://www.ncbi.nlm.nih.gov) GenBank the legends in Figure sequences published from Data Locality 1* Note: Accesssion 57 56 2n 55 Genome Species/Hybrids 53 Number 54 StY .turczaninovii R. eoe a aee ihfloeci-2dT gen spoe 8crmsmswr aee as labeled were chromosomes 28 probe, as (green) fluorescein-12-dUTP with labeled was genome) ( StY opooia nlsso yrd H,hbisRH2, hybrids RH1, hybrids of analysis Morphological arwd.(i) (arrowed). i eoi soitosi Mso h aetlseisadhbis a n (b) and (a) hybrids. and species parental the of PMCs in associations Meiotic olnfriiyadse e fhbisR1 yrd RH2, hybrids RH1, hybrids of set seed and fertility Pollen nlsso IHadGS in GISH and FISH of Analysis nlsso IHadGS nhbis a n b H-1 c n d H-2 n F and E RH2-12. (d) and (c) RH1-11. (b) and (a) hybrids. in GISH and FISH of Analysis (b) . eoe a aee ihTxsrd5dT rd spoe 8crmsmswr aee as labeled were chromosomes 28 probe, as (red) Texas-red-5-dCTP with labeled was genome) aytp nlsso yrd H,hbisRH2, hybrids RH1, hybrids of analysis Karyotype opooia hrceitc ftentrlhbisadterprns a c Natural (c) – (a) parents. their and hybrids natural the of characteristics Morphological .stricta R. sterilis Bromus urartu Triticum Nevski (L.) copmedusae Taeniatherum Nevski Koch) villosum Dasypyrum cereale Secale .stricta R. a,()ad()Ue St Used (e) and (c) (a), . ih1 I d H-5wt 4I 1 ig+2rd.()R17wt 3I 9ring (9 II 13 with RH1-7 (e) rod). 2 + ring (12 II 14 with RH1-15 (d) II. 14 with Tum L. L. (K. .stricta R. . c H-3 b RH2-10. (b) RH1-13. (c) . 2 8 spoe(re) 4crmsmswr aee as labeled were chromosomes 14 (green), probe as –80 A Ta V R arwd.()hbi H arwd.K yrdR2(roe) (l) (arrowed). RH2 hybrid K: (arrowed). RH1 hybrid (j) (arrowed). .stricta R. 2 8 spoe(e) 4crmsmswr aee as labeled were chromosomes 14 (red), probe as –80 .turczaninovi R. .turczaninovi R. 16 xH66 DQ247826* 6664 H 2x xKC912691* 10254 H W6 5552 H 2x 2x 2x and .turczaninovii R. arwd.(m) (arrowed). i arwd.(e) (arrowed). i .stricta R. .stricta R. S 2 AF277234* 420 OSA PI220591 7264 .stricta R. and a n (b) and (a) . and .turczaninovii R. .stricta R. .turczaninovii. R. .stricta R. and .turczaninovii R. St .stricta R. .turczaninovii R. arwd.(f) (arrowed). arwd.(n) (arrowed). ye(arrowed) type a Plant (a) . .ciliaris R. St c – (c) . (a) type R. R. R. No. GenBank MH285850* AF277236* MH285856* AF277249* Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. H-22 . 22 .51. 59 0.93 0.87 0.84 0.88 0.89 25.95 0.87 24.55 0.88 23.55 0.87 24.75 0.91 24.95 0.88 0.9 24.27 0.94 24.75 24.45 0.91 25.4 0.88 0 0.93 24.5 0.88 0 26.45 25.2 0 0 25.6 0 0.9 0.92 0.86 25.91 24.5 0.93 0 24.55 0 0.9 0 13.7 0 13.3 0.87 0 12.95 25.71 0.9 25.3 13.35 24.2 0 0 25.9 0.93 13.45 25.1 0 12.97 0.87 0.86 13.45 0 0 0.92 13.35 25.17 24.3 0.92 0 1.45 13.75 25.95 0.81 13.45 2.05 2.35 13.75 24.49 1.95 24.15 13.7 0 0 1.95 25.85 0 0 25.7 13.6 2.05 24.65 13.79 0 2.15 2.25 13 12.25 13.4 0 0 2.1 11.25 0 2.4 10.6 1.05 11.4 13.74 13.55 2.2 11.5 0 0 13.5 13.75 11.11 0 1.6 13.35 1.67 0 11.3 11.1 0 13.73 1.5 2.25 13.45 0.5 11.65 3.45 11.05 13.8 0.7 12.7 1.77 1.3 13.51 1.8 13.05 11.5 1.1 2.8 1.6 13.7 1.7 12.12 13.65 1.6 12 2.15 13.2 11.15 1.3 2.29 11.5 2.6 0.5 20 1.65 1.1 24 11.97 11.75 0.5 20 2.53 1.95 22 12.15 0.6 10.7 20 1.55 0.42 11.75 31 1.6 0.8 RH2-12 20 1.75 11.44 1.2 10.85 RH2-11 23 2 12.15 RH2-10 20 0.51 RH2-9 20 10.98 0.9 11.1 RH2-8 20 0.5 12.15 RH2-7 20 1 12.05 RH2-6 1.3 32 11.45 RH2-5 0.53 20 RH2-4 1.1 20 RH2-3 0.5 20 RH2-2 0.93 35 RH2-1 1.9 21 RH1-17 0.6 25 RH1-16 0.9 20 RH1-15 20 1.6 RH1-14 34 RH1-13 20 RH1-12 24 RH1-11 23 RH1-10 35 RH1-9 21 RH1-8 value 28 C RH1-7 24 cell Chiasmata RH1-6 pairing Chromosome RH1-5 pairing RH1-4 Chromosome RH1-3 pairing Chromosome RH1-2 pairing Chromosome RH1-1 pairing turczaninovii Chromosome R. stricta observed R. cells of No. hybrids and Species S2 TABLE (5 primer of rps Sequence primers of Name DMC Gene values. S1 probability TABLE posterior Bayesian are nodes material below supplementary numbers and values, values. bootstrap probability are posterior Bayesian nodes are nodes 9 below FIGURE numbers and values, bootstrap are nodes 8 FIGURE 16 T 1 rps rps T DMC DMC 6 ACAGGTGAGAC1cce i 5;3 yle:4 4,4s5 i 0s7 yl:1 i 72 min 10 cycle: 1 ; 72 s 40 min 1 , 55 40s , 94 s 40 cyclies: 35 ; 95 min 3 cycle: 1 ACATCAATTGCAACGATTCGATA AAACGATGTGGTAGAAAGCAAC 16R 16F eoi soitosa eahs nPC fteprna pce n hybrid and species parental the of PMCs in I metaphase at associations Meiotic study this in used primers The hlgntcte ae on based tree Phylogenetic hlgntcte ae on based tree Phylogenetic e0 GCATCGGGTT yl:4mn9 5cce:1mn9 i 2,2mn4 2;1cce 0mn72 min 10 cycle: 1 ; 72 s 40 min 2 , 52 min 1 , 94 min 1 cycles: 35 ; 94 min 4 cycle: 1 TGCCAATTGCTGAGAGATTTG 1e10F e5 AGCCACCTGTTGTAATCTGG 1e15R 9 35 .31.600 75 0.98 0.99 27.57 27.6 0.02 0.01 13.96 13.99 0.43 0.44 13.53 13.55 0 0 198 463 DMC rps 6sqecso yrd sn L ubr ihbl above bold with Numbers ML. using hybrids of sequences 16 igI o ITtlI IV II Total II Rod II Ring I eune fhbisuigM.Nmeswt odabove bold with Numbers ML. using hybrids of sequences 1 ´ 3 - 17 ´ Profiles ) Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. H-03 . 22 .21.302.40.93 0.92 0.88 0.93 0.89 26.14 0.91 25.72 0.89 24.56 0.92 26.15 0.91 0.91 25.05 0.91 25.36 24.95 0.91 0.91 25.43 25.55 0.92 25.6 0 0.93 25.51 0.91 0 0 25.35 0 25.45 0.9 0 0.92 25.7 25.9 0 25.55 0 0.94 13.93 0.91 0.89 0.91 0 0 25.25 13.91 0 0 25.65 0.9 13.24 13.5 26.39 0.87 0.88 0 13.4 0 24.85 25.45 25.6 13.67 0.84 0 13.6 0 0.89 25.25 0 13.62 1.72 0.88 24.25 14 13.69 2.1 13.8 24.7 0 1.92 23.55 0 0.85 13.7 1.75 24.85 13.5 0 24.75 1.98 13.75 0 0 2.25 0 13.9 12.21 13.7 1,81 0 11.81 2.45 1.87 13.8 11.32 0 2 12.65 0 13.9 11.65 0 2.05 13.73 1.55 11.69 0 13.53 13.95 11.35 0 1.8 13.4 11.81 1.9 1.85 0.1 13.65 11.55 11.82 0.58 13.55 2.35 1.48 13.75 11.8 2.15 0.8 12.95 11.65 11.95 1.2 1.07 13.65 0.5 2.21 13.55 2.45 11.95 0.8 1.2 11.85 0.7 2.05 12 39 0.68 11.45 48 2.85 0 11.75 19 2.8 0.4 2.35 23 12.66 0.8 40 2.45 11.32 1 2.35 11.5 24 0.5 RH2-40 12.2 24 0.6 RH2-39 11.6 37 0.2 RH2-38 38 10.7 0.4 RH2-37 10.95 31 0.2 RH2-36 10.6 26 0.46 RH2-35 22 11.2 0.42 RH2-34 11.2 24 0.1 RH2-33 21 1.2 RH2-32 35 0.7 RH2-31 27 0.95 RH2-30 20 0.5 RH2-29 20 2.1 RH2-28 47 0.85 RH2-27 19 0.9 RH2-26 20 RH2-25 20 RH2-24 20 RH2-23 value C 20 RH2-22 cell 20 Chiasmata RH2-21 20 pairing Chromosome RH2-20 20 pairing RH2-19 Chromosome 20 RH2-18 pairing Chromosome RH2-17 pairing Chromosome RH2-16 pairing Chromosome RH2-15 observed RH2-14 cells of No. RH2-13 hybrids and Species 18 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 19 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 20 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 21 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 22 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 23 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 24 Posted on Authorea 11 May 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162074695.55679504/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 25