DOCSLIB.ORG

Analysis of P53 Mutations and Their Expression in 56 Colorectal Cancer Cell Lines

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Analysis of P53 Mutations and Their Expression in 56 Colorectal Cancer Cell Lines Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines Ying Liu and Walter F. Bodmer* Cancer Research UK Cancer and Immunogenetics Laboratory, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DS, United Kingdom Contributed by Walter F. Bodmer, November 23, 2005 A comprehensive analysis of the TP53 gene and its protein status thought to mark the transition from adenoma to carcinoma, than in was carried out on a panel of 56 colorectal cancer cell lines. This early adenomas. This finding implies that most TP53 mutations analysis was based on a combination of denaturing HPLC mutation probably occur before metastasis (7, 8). The mechanism of how, or screening of all exons of the p53 gene, sequencing the cDNA, and whether, p53 plays a role in the metastasis of CRC remains assessing the function of the p53 protein by assaying the induced unknown. In an effort to address the above questions, we have expression of phosphorylated p53 and p21 after exposing cells to carried out a thorough analysis of p53 status in a panel of 56 ␥-rays. In a few cases where there was no production of p53 genetically well characterized CRC cell lines. The implications of message nor evidence of functional p53 protein, all of the p53 the results and comparisons with published data are discussed. exons were sequenced directly. Thirteen of the 56 cell lines had functional p53, 21 lines had missense mutations (one of which Results made no detectable protein), 4 lines produced no p53 transcripts, TP53 Mutation Detection. Primers located at least 50 bp away from and the remaining 18 lines carried truncating TP53 mutations. Thus, the ends of each exon were designed to amplify exons 1–11 of the our results showed a relatively high frequency of TP53 mutations TP53 gene (Table 1). All amplicons had exactly the size expected, (76.8%) in our cell lines, with almost half of the mutations being except in one case, namely exon 1 in cell line SW1222, where a truncating mutations. This is a rather higher frequency of such smaller amplicon than expected was observed. Sequencing con- mutations than usually reported. Of the 18 cell lines with truncat- firmed that the anomalous amplicon was due to a 113-bp homozy- ing mutations, 12 had detectable truncated protein based on gous deletion. All amplicons were subjected to denaturing HPLC Western blot analysis, whereas no protein was detected in the (DHPLC) analysis on the WAVE machine (Transgenomic, remaining 6 cell lines. Our data provide a valuable source of TP 53 Omaha, NE). Samples showing abnormal patterns were subse- mutations for further studies and raise the question of the extent quently sequenced. However, all of the exon 3 and 4 amplicons were to which truncating mutations may have dominant negative ef- sequenced directly because they did not show clear-cut peaks in fects, even when no truncated protein can be detected by standard DHPLC analysis. Based on this analysis, mutations were found in methods. 37 cell lines (Table 2). DNA damage ͉ p21 ͉ oncogenicity ͉ ␥-ray ͉ tumorigenesis For the 19 cell lines in which no mutations were detected by DHPLC analysis, RT-PCR was carried out to amplify the full length Ͼ of the p53 ORF. The complete TP53 ORF could be amplified in 11 he gene encoding p53 is found mutated in 50% of all types of of these cell lines. All of these ORF amplicons were sequenced Thuman cancers. Its most important normal function is probably directly, and mutations were identified in two further cell lines, to direct cell cycle arrest at the G1 or G2 phase of the cell cycle after CCK-81 and SNU-C2B. The p53 mRNA expression in the 8 cell certain types of DNA damage and to induce apoptosis when the lines that had not yielded an amplified p53 ORF was subsequently damage is too severe (1). The normal function of the p53 protein tested by using primers designed to amplify small regions of the can be assessed by its response to DNA damage, for example, mRNA (see Expression of Mutant and Truncated p53). ␥-irradiation. TP53 mutations in tumors are most probably primar- In the 17 cell lines in which no mutations had so far been ily selected for, because they interfere with the apoptotic process. identified, DNA damage experiments were carried out to ascertain To date, Ͼ75% of the TP53 mutations reported in colorectal whether they had functional p53 protein. Each of these cell lines in carcinomas (CRC) are missense mutations, which have been the ␥ focus of in vitro and in vivo studies. The in vitro studies clearly show exponential growth phase was treated with 6 Gy -ray and har- that (i) many mutant p53 proteins can inhibit normal p53 function, vested at 6 and 24 h after irradiation. The relative amounts of total (ii) the mutant proteins can acquire new abnormal functions, and p53 and Ser-15-phosphorylated p53 were assessed by Western (iii) different mutants vary in their oncogenicity (2). Recent in vivo blotting by using appropriate antibodies. Thirteen of these cell lines studies using mice transgenic for two mutations, R270H and showed obviously increased expression of phosphorylated p53, and, R172H, further support these findings (3, 4). These studies have in some cases total p53 (Fig. 1 and Table 3). Four cell lines, however, also, however, raised further questions. What are the mechanisms showed unexpected p53 expression patterns after treatment. Thus, that cause the variation in oncogenicity in different mutants? Could in cell lines NCI-H716 and CoCM1, no total or phosphorylated p53 they involve interactions between p53 and its relatives, such as p63 could be detected; in cell line RCM1, there was a smaller size p53 and p73 (5)? In the two mouse studies, the p53 mutants examined protein and no expression of phosphorylated p53; in cell line CC20, were minimally present in normal tissues and became stabilized there was no difference between the expression of total p53 and only in tumors. It was therefore suggested that a key p53 regulatory phosphorylated p53 before or after DNA damage. To clarify the network must be altered for the mutant protein to be selected for cause of the abnormal expression of p53, direct sequencing of exons during tumor evolution (6). Thus, the role of mutant p53 in the process of tumorigenesis may be much more complicated than previously thought, involving cell-type specificity and potential Conflict of interest statement: No conflicts declared. interactions with changes in other genes. Freely available online through the PNAS open access option. TP53 is estimated to be mutated in 40–50% of CRCs (http:͞͞ Abbreviations: CRC, colorectal carcinoma; DHPLC, denaturing HPLC. www-p53.iarc.fr͞index.html and http:͞͞p53.free.fr͞). It is much *To whom correspondence should be addressed. E-mail: [email protected]. more frequently mutated in high-grade dysplastic polyps, which are © 2006 by The National Academy of Sciences of the USA 976–981 ͉ PNAS ͉ January 24, 2006 ͉ vol. 103 ͉ no. 4 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0510146103 Downloaded by guest on September 26, 2021 Table 1. PCR amplification conditions for exons 1–11 of TP53 and their corresponding DHPLC analysis conditions PCR DHPLC denaturating Primer sequences product PCR Tm, temperature, °C͞gradient Exon (5Ј-3Ј) size, bp °C initial buffer B, % 1 cacagctctggcttgcaga 442 66 60͞58, 64͞52 agcgattttcccgagctga 2 agctgtctcagacactggca 317 64* 65͞47 gagcagaaagtcagtcccatg 3–4 agacctatggaaactgtgagtgga 631 56* N/A gaagcctaagggtgaagagga 5–6 cgctagtgggttgcagga 550 64 61͞57, 66͞49 cactgacaaccacccttaac 7 ctgcttgccacaggtctc 283 64 58͞54, 66͞46 tggatgggtagtagtatggaag 8–9 gttgggagtagatggagcct 455 64 57͞57, 63͞50 ggcattttgagtgttagactg 10 ctcaggtactgtgtatatacttac 351 59 57͞55, 65͞46 atactacgtggaggcaagaat 11 tcccgttgtcccagcctt 476 58 56͞58, 62͞53 taacccttaactgcaagaacat *With the addition of 0.5 ϫ Q (Qiagen PCR amplification kit). 1–11 of these 4 cell lines was carried out. This sequencing revealed C70. Freshly made Western blots from the remaining 11 cell lines, that each of them carried mutations in TP53 (Table 2). in which no protein had been detected by antibody DO-1, were To further confirm that the phosphorylated p53 in the 13 cell hybridized with a different N-terminal antibody to p53, PAb 1801. lines from the above study could indeed have an effect on its A single band with the expected truncated protein size was detected expected target genes, the expression of p21 protein was analyzed in an additional cell line C80. This protein product was not in those cell lines. Twelve of the 13 cell lines showed the expected detectable by DO-1, perhaps because the relevant epitope was increase in p21 protein, whereas one cell line, NCI-747, did not obscured by the conformation of the mutant protein. All of the cell show any expression of p21 either before or after DNA damage lines with truncation mutations were also analyzed with another p53 (Fig. 2 and Table 2). This finding may reflect mutation or deletion antibody, PAb1802, with specificity for a determinant near the C of the p21 gene in this cell line. terminus of p53. As expected, they were all negative for this Our results confirm that only one of the cell lines with mutant C-terminal antibody (data not shown). No protein product was p53, HCA7, also has WT p53 (Table 3). This result is in agreement detected consistently in the remaining 10 cell lines with truncation with our loss of heterozygosity (LOH) data for this region of or frameshift mutations in p53. chromosome 17p (data can be provided on request). The two cell For all of the 11 cell lines in which no mutant or truncated p53 lines SNU-C2B and VACO429 were each apparently heterozygous could be detected by Western blot analysis, RT-PCR was per- for two different mutations.
Load more

Recommended publications
  • Exam 1 Name Mcbio
    Exam 1 Name _______________________________ Mcbio 316 Q1. Mutants defective for the proofreading function of DNA polymerase III typically form small, unhealthy looking colonies on rich medium. (2) Why? • Such mutations in the dnaQ gene (called mutD) produce a "mutator" phenotype. Because they are unable to proofread errors that occur during DNA replication, such strains accumulate mutations at a high frequency. The resulting large number of "lethal mutations" that arise during cell division slows the growth of the colonies. • The mutation frequency is highest when the cells are growing on rich medium which allows the cells to grow more rapidly than the resulting errors can be corrected by other repair systems. Q2. The DNA and corresponding amino acid sequence of a portion of the wild-type trpA gene is shown below. The DNA sequence of three different trpA mutations is shown directly below the corresponding region in the wild-type sequence. [The DNA sequence of the coding strand is shown -- i.e., TTG = UUG => Leu.] 209 210 211 212 213 214 215 216 217 218 219 220 221 TTG CAG GGA TTT GGT ATT TCC GCC CCG GAT CAG GTA AAA Leu Gln Gly Phe Gly Ile Ser Ala Pro Asp Gln Val Lys * TAG CAG GGA TTT GGT ATT TCC GCC CCG GAT CAG GTA AAA Amber * TTG CAG GGA TTT GGT GTT TCC GCC CCG GAT CAG GTA AAA Leu Gln Gly Phe Gly Val Ser Ala Pro Asp Gln Val Lys D TTG CAG GGA TTT GGT ATT TCC GCC CCG ATC AGG TAA AA- Leu Gln Gly Phe Gly Ile Ser Ala Pro Ile Arg Ochre (6) Using the attached codon table, show the amino acid sequence for the protein made in each of the three trpA mutants.
    [Show full text]
  • Molecular Modelling and Screening of Androgen Receptor Ligands to Treat Prostate Cancer
    MOLECULAR MODELLING AND SCREENING OF ANDROGEN RECEPTOR LIGANDS TO TREAT PROSTATE CANCER A THESIS Submitted to The Tamil Nadu Dr.MGR Medical University, Chennai In the partial fulfillment of the requirements for the award of the degree of DOCTOR OF PHILOSOPHY In Faculty of Pharmacy & Pharmaceutical Sciences By S. DIVAKAR, M. Pharm., (Reg. No. 141340505) Under the guidance of Dr. M. RAMANATHAN, M.Pharm., Ph.D. Professor and Head Department of Pharmacology PSG College of Pharmacy Coimbatore June 2017 Dr. M. RAMANATHAN, M.Pharm., PhD., Professor and Head, Department of Pharmacology, PSG College of Pharmacy, Coimbatore. Certificate This is to certify that the Ph.D. thesis entitled “MOLECULAR MODELLING AND SCREENING OF ANDROGEN RECEPTOR LIGANDS TO TREAT PROSTATE CANCER” being submitted to the Tamil Nadu Dr. MGR Medical University, Chennai, for the award of degree of DOCTOR OF PHILOSOPHY in PHARMACY & PHARMACEUTICAL SCIENCES was carried out by S. DIVAKAR at PSG College of Pharmacy, Peelamedu, Coimbatore, under my direct supervision and guidance to my fullest satisfaction. The contents of this thesis, in full or in parts, have not been submitted to any other Institute or University for the award of any degree or diploma. Dr. M. RAMANATHAN, M.Pharm., Ph.D. (Supervisor & Guide) Place:Coimbatore Date: Dr. V. Sankar, M. Pharm, PhD., Professor and Head, Department of Pharmaceutics, PSG College of Pharmacy, Coimbatore. Certificate This is to certify that the Ph.D. thesis entitled “MOLECULAR MODELLING AND SCREENING OF ANDROGEN RECEPTOR LIGANDS TO TREAT PROSTATE CANCER” being submitted to the Tamil Nadu Dr. MGR Medical University, Chennai, for the award of degree of DOCTOR OF PHILOSOPHY in PHARMACY & PHARMACEUTICAL SCIENCES was carried out by S.
    [Show full text]
  • Computational and Experimental Approaches to Reveal the Effects of Single Nucleotide Polymorphisms with Respect to Disease Diagnostics
    Int. J. Mol. Sci. 2014, 15, 9670-9717; doi:10.3390/ijms15069670 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Review Computational and Experimental Approaches to Reveal the Effects of Single Nucleotide Polymorphisms with Respect to Disease Diagnostics Tugba G. Kucukkal 1,†, Ye Yang 2,†, Susan C. Chapman 3,*, Weiguo Cao 2,* and Emil Alexov 1,* 1 Department of Physics, Clemson University, Clemson, SC 29634, USA; E-Mail: [email protected] 2 Department of Genetics and Biochemistry, Clemson University, 049 Life Sciences Facility, 190 Collins Street, Clemson, SC 29634, USA; E-Mail: [email protected] 3 Department of Biological Sciences, Clemson University, Clemson, SC 29634, USA † These authors contributed equally to this work. * Authors to whom correspondence should be addressed; E-Mails: [email protected] (S.C.C.); [email protected] (W.C.); [email protected] (E.A.); Tel.: +1-864-656-5307 (E.A.); Fax: +1-864-656-0805 (E.A.). Received: 8 April 2014; in revised form: 15 May 2014 / Accepted: 16 May 2014 / Published: 30 May 2014 Abstract: DNA mutations are the cause of many human diseases and they are the reason for natural differences among individuals by affecting the structure, function, interactions, and other properties of DNA and expressed proteins. The ability to predict whether a given mutation is disease-causing or harmless is of great importance for the early detection of patients with a high risk of developing a particular disease and would pave the way for personalized medicine and diagnostics. Here we review existing methods and techniques to study and predict the effects of DNA mutations from three different perspectives: in silico, in vitro and in vivo.
    [Show full text]
  • IGA 8/E Chapter 14
    16 Mutation, Repair, and Recombination WORKING WITH THE FIGURES 1. In Figure 16-3a, what is the consequence of the new 5′ splice site on the open reading frame? In 16-3b, how big could the intron be to maintain the reading frame (let’s say between 75 and 100 bp)? Answer: A mutation that generates a new 5′ splice site within an existing exon will result in the loss of information from the open reading frame, since some of the exon will be removed with the splicing of the intron. In addition, because the number of nucleotides deleted is not a multiple of 3 (64 nt) a frameshift mutation will result. In part b of the figure, the retained intron will maintain the reading frame as long as the length in nucleotides is divisible by three (ex. 99 bp) and it does not contain any stop codons in the same frame as exon 1. 2. Using Figure 16-4 as an example, compare the migration of RNA and protein for the wild-type gene and the mutation shown in Figure 16-3b. Assume that the retained intron maintains the reading frame. Answer: The RNA produced by the mutation in Figure 16-3b will be longer than the mature wild-type RNA and thus will not migrate as far in the gel. The same will be true of the protein (mutant protein will be larger than wild-type protein) if the reading frame is maintained and no stop codons are present in the sequence. 3. In the Ames test shown in Figure 16-17, what is the reason for adding the liver extract to each sample? Answer: Sometimes compounds only become mutagenic when processed by the enzymes in the vertebrate liver.
    [Show full text]
  • Containing Truncated Mutant Proteins in the Tumors with High Microsatellite Instability
    Published OnlineFirst May 14, 2013; DOI: 10.1158/1078-0432.CCR-13-0684 Clinical Cancer Human Cancer Biology Research Identification and Selective Degradation of Neopeptide- Containing Truncated Mutant Proteins in the Tumors with High Microsatellite Instability Won Kyu Kim1, Misun Park1, Minhee Park1, Yun Ji Kim1, Nara Shin1, Hyun Ki Kim1, Kwon Tae You2, and Hoguen Kim1 Abstract Purpose: Frameshift mutations in coding mononucleotide repeats (cMNR) are common in tumors with high microsatellite instability (MSI-H). These mutations generate mRNAs containing abnormal coding sequences and premature termination codons (PTC). Normally, mRNAs containing PTCs are degraded by nonsense-mediated mRNA decay (NMD). However, mRNAs containing PTCs located in the last exon are not subject to degradation by NMD (NMD-irrelevant). This study aimed to discover whether genes with frameshift mutations in the last exon generate truncated mutant proteins. Experimental Design: We identified 66 genes containing cMNRs in the last exon by bioinformatic analysis. We found frequent insertion/deletion mutations in the cMNRs of 29 genes in 10 MSI-H cancer cell lines and in the cMNRs of 3 genes in 19 MSI-H cancer tissues. We selected 7 genes (TTK, TCF7L2, MARCKS, ASTE1, INO80E, CYHR1, and EBPL) for mutant mRNA expression analysis and 3 genes (TTK, TCF7L2, and MARCKS) for mutant protein expression analysis. Results: The PTC-containing NMD-irrelevant mRNAs from mutated genes were not degraded. However, only faint amounts of endogenous mutant TTK and TCF7L2 were detected, and we failed to detect endogenous mutant MARCKS. By polysome analysis, we showed that mRNAs from genomic mutant MARCKS constructs are normally translated.
    [Show full text]
  • In Silico Analysis Predicting Effects of Deleterious Snps of Human
    www.nature.com/scientificreports OPEN In silico analysis predicting efects of deleterious SNPs of human RASSF5 gene on its structure and functions Md. Shahadat Hossain1,3, Arpita Singha Roy1 & Md. Sajedul Islam 2,3* Ras association domain-containing protein 5 (RASSF5), one of the prospective biomarkers for tumors, generally plays a crucial role as a tumor suppressor. As deleterious efects can result from functional diferences through SNPs, we sought to analyze the most deleterious SNPs of RASSF5 as well as predict the structural changes associated with the mutants that hamper the normal protein–protein interactions. We adopted both sequence and structure based approaches to analyze the SNPs of RASSF5 protein. We also analyzed the putative post translational modifcation sites as well as the altered protein–protein interactions that encompass various cascades of signals. Out of all the SNPs obtained from the NCBI database, only 25 were considered as highly deleterious by six in silico SNP prediction tools. Among them, upon analyzing the efect of these nsSNPs on the stability of the protein, we found 17 SNPs that decrease the stability. Signifcant deviation in the energy minimization score was observed in P350R, F321L, and R277W. Besides this, docking analysis confrmed that P350R, A319V, F321L, and R277W reduce the binding afnity of the protein with H-Ras, where P350R shows the most remarkable deviation. Protein–protein interaction analysis revealed that RASSF5 acts as a hub connecting two clusters consisting of 18 proteins and alteration in the RASSF5 may lead to disassociation of several signal cascades. Thus, based on these analyses, our study suggests that the reported functional SNPs may serve as potential targets for diferent proteomic studies, diagnosis and therapeutic interventions.
    [Show full text]
  • IN SILICO MODELING the EFFECT of SINGLE POINT MUTATIONS and RESCUING the EFFECT by SMALL MOLECULES BINDING Zhe Zhang Clemson University, [email protected]
    Clemson University TigerPrints All Dissertations Dissertations 5-2013 IN SILICO MODELING THE EFFECT OF SINGLE POINT MUTATIONS AND RESCUING THE EFFECT BY SMALL MOLECULES BINDING Zhe Zhang Clemson University, [email protected] Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Part of the Biological and Chemical Physics Commons Recommended Citation Zhang, Zhe, "IN SILICO MODELING THE EFFECT OF SINGLE POINT MUTATIONS AND RESCUING THE EFFECT BY SMALL MOLECULES BINDING" (2013). All Dissertations. 1126. https://tigerprints.clemson.edu/all_dissertations/1126 This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected]. IN SILICO MODELING THE EFFECT OF SINGLE POINT MUTATIONS AND RESCUING THE EFFECT BY SMALL MOLECULES BINDING A Thesis Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Physics and Astronomy by Zhe Zhang May 2013 Accepted by: Dr. Emil Alexov, Committee Chair Dr. Feng Ding Dr. Sumanta Tewari Dr. Charles Schwartz Dr. Maria Miteva Dr. Philippe Roche ABSTRACT Single-point mutation in genome, for example, single-nucleotide polymorphism (SNP) or rare genetic mutation, is the change of a single nucleotide for another in the genome sequence. Some of them will result in an amino acid substitution in the corresponding protein sequence (missense mutations); others will not. This investigation focuses on genetic mutations resulting in a change in the amino acid sequence of the corresponding protein. This choice is motivated by the fact that missense mutations are frequently found to affect the native function of proteins by altering their structure, interaction and other properties and cause diseases.
    [Show full text]
  • A Low-Prevalence Single-Nucleotide Polymorphism in the Sensor Kinase Phor in Mycobacterium Tuberculosis Suppresses Its Autophosp
    fmicb-12-724482 August 19, 2021 Time: 16:39 # 1 ORIGINAL RESEARCH published: 25 August 2021 doi: 10.3389/fmicb.2021.724482 A Low-Prevalence Single-Nucleotide Polymorphism in the Sensor Kinase PhoR in Mycobacterium tuberculosis Suppresses Its Autophosphatase Activity and Reduces Pathogenic Fitness: Implications in Evolutionary Selection Uchenna Watson Waturuocha1,2, M. S. Krishna1, Vandana Malhotra3, Narendra M. Dixit4,5 and Deepak Kumar Saini2,5* 1 Department of Studies in Zoology, University of Mysore, Mysore, India, 2 Department of Molecular Reproduction Development and Genetics, Indian Institute of Science, Bengaluru, India, 3 Sri Venkateswara College, University of Delhi, New Delhi, India, 4 Department of Chemical Engineering, Indian Institute of Science, Bengaluru, India, 5 Center Edited by: for Biosystems Science and Engineering, Indian Institute of Science, Bengaluru, India George Grant, University of Aberdeen, United Kingdom The genome sequencing of Mycobacterium tuberculosis, the causative organism of Reviewed by: tuberculosis, has significantly improved our understanding of the mechanisms that Amanda Jane Gibson, Aberystwyth University, drive the establishment of infection and disease progression. Several clinical strains United Kingdom of M. tuberculosis exhibit single-nucleotide polymorphisms (SNPs), the implications Roberto Zenteno-Cuevas, of which are only beginning to be understood. Here, we examined the impact of Universidad Veracruzana, Mexico a specific polymorphism in PhoR, the sensor kinase of the PhoPR two-component *Correspondence: Deepak Kumar Saini system. Biochemical analysis revealed reduced autophosphatase/ATPase activity, which [email protected] led to enhanced downstream gene expression. We complemented M. tuberculosis H37Ra with the wild-type and mutant phoPR genes and characterized the strains in Specialty section: This article was submitted to a cell line infection model.
    [Show full text]
  • Impaired NEPHRIN Localization in Kidney Organoids Derived from Nephrotic Patient Ips Cells
    www.nature.com/scientificreports OPEN Impaired NEPHRIN localization in kidney organoids derived from nephrotic patient iPS cells Tomoko Ohmori1, Shankhajit De1, Shunsuke Tanigawa1, Koichiro Miike1, Mazharul Islam1, Minami Soga2, Takumi Era2, Shinichi Shiona3, Koichi Nakanishi4,5, Hitoshi Nakazato6 & Ryuichi Nishinakamura1* Mutations in the NPHS1 gene, which encodes NEPHRIN, cause congenital nephrotic syndrome, resulting from impaired slit diaphragm (SD) formation in glomerular podocytes. We previously reported NEPHRIN and SD abnormalities in the podocytes of kidney organoids generated from patient-derived induced pluripotent stem cells (iPSCs) with an NPHS1 missense mutation (E725D). However, the mechanisms underlying the disease may vary depending on the mutations involved, and thus generation of iPSCs from multiple patients is warranted. Here we established iPSCs from two additional patients with diferent NPHS1 mutations and examined the podocyte abnormalities in kidney organoids derived from these cells. One patient had truncating mutations, and NEPHRIN was undetectable in the resulting organoids. The other patient had a missense mutation (R460Q), and the mutant NEPHRIN in the organoids failed to accumulate on the podocyte surface to form SD precursors. However, the same mutant protein behaved normally when overexpressed in heterologous cells, suggesting that NEPHRIN localization is cell context-dependent. The localization of another SD-associated protein, PODOCIN, was impaired in both types of mutant organoids in a cell domain-specifc manner. Thus, the new iPSC lines and resultant kidney organoids will be useful resources for dissecting the disease mechanisms, as well as for drug development for therapies. Te glomerulus is the fltration apparatus within the kidney, and the podocytes in glomeruli are essential for the fltration process1,2.
    [Show full text]
  • Analysis and Interpretation of the Impact of Missense Variants in Cancer
    International Journal of Molecular Sciences Review Analysis and Interpretation of the Impact of Missense Variants in Cancer Maria Petrosino 1, Leonore Novak 1, Alessandra Pasquo 2, Roberta Chiaraluce 1 , Paola Turina 3 , Emidio Capriotti 3,* and Valerio Consalvi 1,* 1 Dipartimento Scienze Biochimiche “A. Rossi Fanelli”, Sapienza University of Rome, 00185 Roma, Italy; [email protected] (M.P.); [email protected] (L.N.); [email protected] (R.C.) 2 ENEA CR Frascati, Diagnostics and Metrology Laboratory FSN-TECFIS-DIM, 00044 Frascati, Italy; [email protected] 3 Dipartimento di Farmacia e Biotecnologie (FaBiT), University of Bologna, 40126 Bologna, Italy; [email protected] * Correspondence: [email protected] (E.C.); [email protected] (V.C.) Abstract: Large scale genome sequencing allowed the identification of a massive number of genetic variations, whose impact on human health is still unknown. In this review we analyze, by an in silico-based strategy, the impact of missense variants on cancer-related genes, whose effect on protein stability and function was experimentally determined. We collected a set of 164 variants from 11 proteins to analyze the impact of missense mutations at structural and functional levels, and to assess the performance of state-of-the-art methods (FoldX and Meta-SNP) for predicting protein stability change and pathogenicity. The result of our analysis shows that a combination of experimental data on protein stability and in silico pathogenicity predictions allowed the identification of a subset of variants with a high probability of having a deleterious phenotypic effect, as confirmed by the Citation: Petrosino, M.; Novak, L.; significant enrichment of the subset in variants annotated in the COSMIC database as putative cancer- Pasquo, A.; Chiaraluce, R.; Turina, P.; driving variants.
    [Show full text]
  • The Effects of Single Nucleotide Polymorphisms in Cancer Rnai
    cancers Review The Effects of Single Nucleotide Polymorphisms in Cancer RNAi Therapies 1, 1, 1 2 Magdalena Gebert y, Maciej Ja´skiewicz y , Adrianna Moszy ´nska , James F. Collawn and Rafał Bartoszewski 1,* 1 Department of Biology and Pharmaceutical Botany, Medical University of Gda´nsk,80-416 Gda´nsk,Poland; [email protected] (M.G.); [email protected] (M.J.); [email protected] (A.M.) 2 Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, Birmingham, AL 35294, USA; [email protected] * Correspondence: [email protected] These authors contributed equally to this work. y Received: 21 September 2020; Accepted: 23 October 2020; Published: 25 October 2020 Simple Summary: Despite the recent progress in RNAi delivery of siRNA-based therapeutics for cancer therapy, the presence of single nucleotide polymorphisms (SNPs) in the general population could dramatically reduce the effectiveness of RNAi therapy. Their ubiquitous presence can also lead to unpredictable and adverse side effects. Because both SNPs and somatic mosaicisms have also been implicated in a number of human diseases including cancer, however, these specific changes offer the ability to selectively and efficiently target cancer cells. Here, we discuss how SNPs influence the development and success of novel anticancer RNAi therapies. Abstract: Tremendous progress in RNAi delivery methods and design has allowed for the effective development of siRNA-based therapeutics that are currently under clinical investigation for various cancer treatments. This approach has the potential to revolutionize cancer therapy by providing the ability to specifically downregulate or upregulate the mRNA of any protein of interest.
    [Show full text]
  • 1 Characterization of the P.Q189X Nonsense Mutation in Dpy-17 in C. Elegans By: Alyssa Li Wellesley College, Department of Biolo
    Characterization of the p.Q189X nonsense mutation in dpy-17 in C. elegans By: Alyssa Li Wellesley College, Department of Biological Sciences Abstract The need to characterize the genetic basis for phenotypes in Caenorhabditis elegans arises from its astonishingly high homology to humans and other eukaryotic organisms. In particular, aspects of the dpy genes’ structure and function, which encodes a flexible and resilient exoskeleton (i.e., cuticle collagen) crucial for normal body morphology in C. elegans, can be applied to other organisms. We report the location and characterization of a functionally significant dpy gene mutation in C. elegans. The dpy gene of interest was determined to be located on chromosome 3 and linked to unc-32 via linkage testing. The dpy gene was found to be 14.7 map units (m.u.) from unc-32 via mapping. Complementation analysis indicated that the gene of interest was dpy-17, a previously characterized gene. The mutant dpy-17 gene was sequenced and analyzed to understand the effects of the mutation at the nucleotide and amino acid level. The nature and extent of the change in the dpy-17 gene in the mutant vs. wild type (WT) C. elegans was determined to be a nonsense mutation via PCR and Sanger sequencing, resulting in an early stop codon in the mutant. The WT polypeptide sequence is nearly twice as long as the mutant peptide, as predicted by DNAstar. Our work in studying the molecular consequences of mutations in dpy-17 in C. elegans is extremely valuable, as it provides insight into the gene’s significant relevance to Marfan syndrome in humans and may inform new and effective treatments in the future.
    [Show full text]