DOCSLIB.ORG

Differential Expression of the CCN Family Members Cyr61, CTGF and Nov in Human Breast Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Endocrine-Related Cancer (2004) 11 781–791

Differential expression of the CCN family members Cyr61, CTGF and Nov in human breast cancer

Wen G Jiang, Gareth Watkins, Oystein Fodstad 1, Anthony Douglas-Jones 2, Kefah Mokbel 3 and Robert E Mansel

Metastasis & Angiogenesis Research Group, University of Wales College of Medicine, Cardiff University, Cardiff, UK 1Cancer Research Institute, University of South Alabama, Mobile, AL, USA 2Pathology, University of Wales College of Medicine, Cardiff University, Cardiff, UK 3Department of Surgery, St George Hospital, London, UK

(Requests for offprints should be addressed to W G Jiang; Email: [email protected])

Abstract

The CCN family members cysteine-rich 61 (Cyr61/CCN1), connective tissue growth factor (CTGF/ CCN2) and nephroblastoma over-expressed (Nov/CCN3) play diverse roles in cells, are known to regulate cell growth, adhesion, matrix production and migration and are involved in endocrineregulated pathways in various cell types. The role of these molecules in cancer remains controversial. In a cohort of 122 human breast tumours (together with 32 normal breast tissues) we have analysed the expression of all three CCN members at the mRNA and protein levels. Significantly higher levels of Cyr61 ðP ¼ 0:02Þ, but low levels of CTGF and Nov, were seen in tumour tissues compared with normal tissues. Significantly raised levels of Cyr61 were associated with poor prognosis ðP ¼ 0:02Þ, nodal involvement ðP ¼ 0:03Þ and metastatic disease ðP ¼ 0:016Þ. Patients who died of breast cancer also had high levels of Cyr61. In contrast, CTGF in patients with poor prognosis ðP ¼ 0:021Þ, metastasis ðP ¼ 0:012Þ, local recurrence ðP ¼ 0:0024Þ and mortality ðP ¼ 0:0072Þ had markedly reduced levels. Similar to CTGF, low levels of Nov were also seen in patients with poor prognosis and mortality and with significantly decreased survival (P ¼ 0:033 and P ¼ 0:0146, respectively). This result was fully supported by immunohistochemical analysis of frozen sectioned tissues. While fibroblasts and endothelial cells generally expressed good levels of all three CCN proteins, highly invasive MDA MB 231 cells expressed lower levels of CTGF and Nov, but higher levels of Cyr61, than the less invasive MCF-7. It is concluded that members of the CCN family are differentially expressed and may play important but contrasting roles in the progressive nature of human breast cancer. While Cyr61 appears to act as a factor stimulating aggressiveness, CTGF and Nov may act as tumour suppressors.

Endocrine-Related Cancer (2004) 11 781–791

activities probably occur through the ability of CCN

Introduction

proteins to bind and activate cell-surface integrins and
The CCN family comprises cysteine-rich 61 (Cyr61/ CCN1), connective tissue growth factor (CTGF/CCN2) and nephroblastoma over-expressed (Nov/CCN3). Recently the Wnt-induced secreted proteins (WISPs) have been found to also belong to the CCN family and so WISP-1 has been named CCN4, WISP-2 is CCN5 and WISP-3 is CCN6. These proteins stimulate mitosis, adhesion, apoptosis, extracellular matrix production, growth arrest and migration of multiple cell types (for a recent review, see Brigstock 2003). Many of these intracellular signalling molecules including fibulin 1C, Notch 1, S100A4 and ion channels (Perbel 2004). Accumulating evidence supports a role for these factors in endocrine pathways and endocrine-related processes. Despite the progress in understanding the biology of these molecules in cells and signalling pathways, the role of the CCN members in cancer is far from clear and the results in the literature remain controversial.
Cyr61 is a known angiogenic factor (Babic et al. 1998,
Mo et al. 2002), which acts probably by regulating pro-

Endocrine-Related Cancer (2004) 11 781–791

1351-0088/04/011–781 # 2004 Society for Endocrinology Printed in Great Britain
DOI:10.1677/erc.1.00825

Online version via http://www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 02:32:55PM via free access

Jiang et al.: CCN family in human breast cancer

Table 1 Clinical information on patients in the study

exhibited lower levels in breast tumours and were inversely linked to a poor prognosis, suggesting that differentially expressed CCN members may have clear contrasting roles in the development of human breast cancer.

Clinical Information

n

  • Nodal status
  • Negative

Positive
65 55 23 41 56 69 60
7

  • Grade
  • Grade 1

Grade 2

Materials and methods

Sample collection

Grade 3

  • TNM-1
  • TNM staging

Human breast cancer cell lines MCF-7 and MDA MB 231, and human fibroblast cell line MRC-5, were purchased from the European Collection of Animal Cell Cultures (ECACC, Salisbury, Hants, UK). Human umbilical vein endothelial cells (HUVECs) were purchased from TCS Biologicals (Oxford, UK). Breast cancer tissues ðn ¼ 120Þ and normal background tissues ðn ¼ 32Þ were collected immediately after surgery and stored in a deep freeze until use. Patients were routinely followed clinically after surgery. The median follow-up period was 72 months for the current study. The presence of tumour cells in the collected tissues was verified by a consultant pathologist (A D-J), who examined Hematoxylin and Eosin (H&E)-stained frozen sections. Details of the histology were obtained from pathology reports and have been given in Table 1.

TNM-2 TNM-3

  • TNM-4
  • 4

  • Clinical outcome
  • Disease-free

With metastasis With local recurrence Died of breast cancer
87
65
19

angiogenic integrins (Tsai et al. 2000, Leu et al. 2002). MCF-7 breast cancer cells, when transfected with Cyr61, acquire hormone independence and anti-oestrogen resistance. These cells become tumorigenic and invasive, accompanied by increased angiogenic activities. Cyr61 has been indicated in tumorigenesis and disease progression in breast tumour models (Tasi et al. 2002a). Cyr61 expression can be up-regulated by hormones such as progestin (Sampath et al. 2002), and agents including phorbol ester and vitamins D and E2 (Sampeth et al. 2001, Tsai et al. 2002b), but down-regulated by retinoic acid (Tsai et al. 2002b). The role for CTGF/CCN2 in cancer is far less clear. CTGF has been shown to affect cell-cycle progression, by up-regulating cyclin A and reducing p27kip1 (Kothapalli and Grotendorst 2000). CTGF has been found to be highly expressed in proliferating endothelial cells and glioma cells (Pan et al. 2002). In breast cancer cells, CTGF mRNA was found to be absent from MCF-7. Transfection of MCF-7 with CTGF expression vector results in a high degree of apoptosis (Hishikawa et al. 1999). This has been supported partly by a recent study which shows that over-expression of CTGF in oral squamous cell carcinoma results in reduction in cell growth and tumorigenesis (Moritani et al. 2003). Nov/CCN3 is probably the least-studied CCN member. Nov has been indicated to stimulate the proliferation of fibroblasts (Liu et al. 1999). Over-expression of Nov in glioma cells results in cells with slower growth rate and low tumorigenicity (Gupta et al. 2001).

Materials

RNA-extraction kit and RT kit were obtained from AbGene, Guildford, Surrey, UK. PCR primers were designed using Beacon Designer (Palo Alto, CA, USA) and synthesized by Invitrogen (Paisley, Scotland, UK). Molecular-biology-grade agarose and DNA ladder were from Invitrogen. Mastermix for routine PCR and quantitative PCR was from AbGene. Goat anti-human Cyr61, CTGF and Nov antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Tissue processing, RNA extraction and cDNA synthesis

Frozen sections of tissues were cut at a thickness of 5– 10 mm and kept for immunohistochemistry and routine histology (Jiang et al. 2003a). A further 15–20 sections were homogenized using a hand-held homogenizer in icecold RNA extraction solution. The concentration of RNA was determined using a UV spectrophotometer. Reverse transcription was carried out using an RT kit with an anchored oligo-dT primer supplied by AbGene, using 1 mg total RNA in a 96-well plate. The quality of cDNA was verified using b-actin primers.
Thus, the role of the CCN family in clinical cancer is unclear and in many cases remains controversial. In the current study, we have examined the relationship between Cyr61, CTGF and Nov at the mRNA and protein levels in a cohort of human breast cancer, and studied the clinical outcomes. We report here that while Cyr61 was highly over-expressed in tumour tissues and was linked to the progressive nature of breast tumours, CTGF and Nov

Quantitative analysis of CCN family members

The transcript level of the CCN family members from the above-prepared cDNA was determined using a real-time

782

www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 02:32:55PM via free access

Endocrine-Related Cancer (2004) 11 781–791

quantitative PCR, based on the AmplifluorTM technology (Nazarenko et al. 1997), modified from a previously reported method (Jiang et al. 2003a, 2003b). Briefly, a pair of PCR primers was designed using the Beacon Designer software (version 2). To one of the primers (routinely the antisense primer in our laboratory), an additional sequence, known as the Z sequence (50- ACTGAACCTGACCGTACA-30), which is complementary to the universal Z probe (Nazarenko et al. 1997; Intergen, Oxford, UK), was added. A Taqman detection kit for b-actin was purchased from Perkin-Elmer. The primers used were: Cyr61, 50-GGGCTGGAATGCAA CTTC-30 and 50-ACTGAACCTGACCGTACACGTT TTGGTAGATTCTGGAG-30 (spanning the third intron; GenBank accession no. AF307860); CTGF, 50-GAGT GGGTGTGTGACGAG30 and 50-ACTGAACCTGACC GTACAGGCAGT- TGGCTCTAATCATA-30 (spanning the fourth intron; NM_001901); and Nov, 50-CTGTGAA al. 2003c). The sections were mounted on Super Frost Plus microscope slides, air dried and then fixed in a mixture of 50% acetone/50% methanol. The sections were then placed in Optimax wash buffer for 5–10 min to rehydrate. Sections were incubated for 20 min in a 0.6% BSA blocking solution and probed with the primary antibody. Following extensive washings, sections were incubated for 30 min with the secondary biotinylated antibody (Multilink Swine anti-goat/mouse/rabbit immunoglobulin; Dako, Ely, Cambs, UK). Following washings, avidin–biotin complex (Vector Laboratories, Burlingame, CA, USA) was then applied to the sections followed by extensive washings. Diaminobenzidine chromogen (Vector Laboratories) was then added to the sections, which were incubated in the dark for 5 min. Sections were then counterstained in Gill’s haematoxylin and dehydrated in ascending grades of methanol before clearing in xylene and mounting under a cover slip. Cytoplasmic staining of the respective proteins was quantified using Optimas 6.0 software as we described previously (Davies et al. 2000, King et al. 2004) and is shown here as relative staining intensity.

  • CAAGAGCCAGAG-30
  • and
  • 50-ACTGAACCTGA

CCGTACACTTGAACTGCAGGTGGAT-30 (spanning positions 848–849; NM-002514). Primers used for quantitation of oestrogen receptor (ER) and ER-b were as reported previously (Ye et al. 2003): ER, 50-CCTAC TACCTGGAGAACGAG-30 and 50-CTCTTCGGTCTT TTCGTATG-30; and ER-b, 50-AAAAGAATCATTCA ATGACA-30 and 50-ATTAACACCTCCATCCAACA- 30. Cytokeratin-19 (CK19) was used for comparison of cellularity during the analysis and primers for CK19 were 50-CAGGTCCGAGGTTACTGAC-30 and 50-ACTGAA CCTGACCGTACACACTTTCTGCCAGTGTGTCTTC -30 (King et al. 2004, Parr and Jiang 2004).
Statistical analysis was carried out using Mann–
Whitney U test, the Kruskal–Wallis test and survival analysis using Kaplan–Meier survival curves and Univariate analysis (SPSS11).

Results

Expression of CCN members in breast tissues

Using quantitative PCR, it was shown that Cyr61 displayed significantly higher levels in tumour tissues compared with normal tissues (Fig. 1). In contrast, levels of CTGF were significantly lower in tumour tissues than in normal tissues. The levels of Nov (CCN3) were also low in tumour tissues, but the difference was not statistically significant. When the levels of the transcripts were normalized by CK19, as revealed by the CCN:CK19 ratio (Fig. 1, inserts), similar trends were seen with respective molecules.
The reaction was carried out using the following: Hotstart Q-master mix (Abgene), 10 pmol of specific forward primer, 10 pmol of reverse primer which has the Z sequence, 100 pmol of 6-carboxyfluorescein (FAM)- tagged probe (Intergen), and cDNA from approximately 50 ng RNA (calculated from the starting RNA in the reverse transcriptase reaction). The reaction was carried out using IcyclerIQTM (BioRad) which is equipped with an optic unit that allows real-time detection of 96 reactions, using the following conditions: 948C for 120 min, 50 cycles of 948C for 150 s, 558C for 400 s and 728C for 200 s (Jiang et al. 2003b, 2003c, Parr and Jiang 2004). The levels of the transcripts were generated from an internal standard (Jiang et al. 2003a) that was simultaneously amplified with the samples, and are shown here in two ways: levels of transcripts based on equal amounts of RNA, and as a target/CK19 ratio.

Distribution of CCN members in different cell types

In immunohistochemical analysis, strong Cyr61 staining was seen in both cancer cells and endothelial cells in tumour tissues (Fig. 2A & B). In contrast, the staining of both cell types in normal tissues was visibly weaker than in cancer cells (Fig. 2A). The staining pattern of CTGF was in clear contrast with Cyr61, in that CTGF strongly stained normal epithelial cells, stromal cells and endothelial cells, but only weakly stained cancer cells (Fig. 2C & D). However, it is noteworthy that matrix in tumour

Immunohistochemical staining of the CCN family proteins

Frozen sections of breast tumour and background tissue were cut at a thickness of 6 mm using a cryostat (Jiang et

www.endocrinology-journals.org

783

Downloaded from Bioscientifica.com at 09/24/2021 02:32:55PM via free access

Jiang et al.: CCN family in human breast cancer

Figure 1 Levels of expression of Cyr61 (left-hand panel), CTGF (middle panel) and Nov (right-hand panel) in normal and tumour tissues. ÃP < 0:05 compared with normal tissues. Inserts: Cyr61:CK19, CTGF:CK19 and Nov:CK19 ratios.

tissues exhibited some degree of staining. The pattern of Nov staining was similar to that of CTGF (Fig. 2E & F). Fig. 3 shows the quantitative analysis of cytoplasmic staining of normal mammary epithelial cells and breast cancer cells, using image analysis. Protein levels of Cyr61 were significantly higher in cancer cells compared with normal mammary epithelial cells. In contrast, both CTGF and Nov proteins were seen at lower levels in breast cancer cells (Fig. 3, middle and right-hand panels).
To further verify the cell source of these molecules, we measured the levels of transcripts in highly aggressive MDA MB 231 and less-invasive MCF-7 breast cancer cells, MRC5 fibroblasts, and HECV and human umbilical vein endothelial cells (HUVEC) endothelial cells. Both fibroblasts and endothelial cells expressed high levels of all three members. The expression patterns of Cyr61 and those of CTGF and Nov were very different in breast cancer cell lines. The highly invasive MDA MB 231 cells expressed high levels of Cyr61, but relatively lower levels of CTGF and Nov, when compared with non-invasive MCF-7 cells. panel). No significant difference was seen for the Nov transcript between different groups (Fig. 4, right-hand panel; P ¼ 0:07, NPI-3 compared with NPI-1). Similar trends were seen when the target:CK19 ratio was assessed (Fig. 4, inserts).
Cyr61 was expressed at significantly higher levels in node-positive tumours compared with node-negative tumours (P ¼ 0:034; Fig. 5, left-hand panel). Although node-positive tumours had higher levels of CTGF than node-negative ones (Fig. 5, middle panel), the difference was not statistically significant. No difference of Nov transcripts was seen between node-positive and -negative tumours (Fig. 5, right-hand panel). The same changes were also seen with the CCN:CK19 ratio (Fig. 5, inserts).

Levels of CCN members and relationship with TNM staging and tumour differentiation

Cyr61 was highly expressed in TNM-3/4 tumours (Fig. 6, left-hand panel), compared with TNM-1 tumours (P ¼ 0:05 and 0.106 respectively). A marginal and nonsignificant reduction of CTGF was seen in TNM-2/3/4 tumours, compared with TNM-1 tumours (Fig. 6, middle panel). The changes of Nov transcripts were similar to those of CTGF, except that TNM-4 tumours had significantly lower levels of Nov compared with TNM-1 tumours (P ¼ 0:0048; Fig. 6, right-hand panel). Similar trend of changes in each molecule were seen when the CCN:CK19 ratios were compared (Fig. 6, inserts).
Grade 2 and grade 3 tumours have significantly higher levels of Cyr61, compared with grade 1 tumours (Table 2). Although levels of CTGF and Nov in grade 3 tumours were generally low compared with grade 1 tumours, this difference is nonetheless not statistically significant (Table 2).

Levels of CCN members and relationship with prognostic indices and nodal involvement

The prognosis indices used here were 2-fold; nodal status and the Nottingham Prognostic Index (NPI; where NPI-1 represents patients with NPI<3.5 and good prognosis, NPI-2 is 3.5–5.4 with moderate prognosis, and NPI-3 is > 5.4 with poor prognosis).
Significantly higher levels of Cyr61 were seen in NPI-3 tumours when compared with NPI-1 tumours (P ¼ 0:02; Fig. 4, left-hand panel). Although Cyr61 was higher in NPI-2 tumours, the difference between NPI-1 and NPI-2 was nonetheless not significant. In contrast to Cyr61, CTGF was significantly lower in NPI-3 tumours (P ¼ 0:021 compared with NPI-1 tumours; Fig. 4, middle

784

www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 02:32:55PM via free access

Endocrine-Related Cancer (2004) 11 781–791

Figure 2 Immunohistochemical staining of Cyr61 (A, B), CTGF (C, D) and Nov (E, F) in normal (A, C, E) and tumour (B, D, F) tissues. Shown are magnifications Â100 (main panels), and Â400 (inserts).

Correlation between levels of CCN members and ER status

tumours ðr ¼ ꢀ0:32Þ, and CTGF and Nov in TNM-3 tumours (r ¼ ꢀ0:40 and r ¼ ꢀ0:58, respectively), and Nov in TNM-4 tumours ðr ¼ ꢀ0:76Þ. The correlations between ER-b and the CCN members revealed an inverse correlation with all three members in tumours which developed metastasis (r ¼ ꢀ0:32 for Cyr61, r ¼ ꢀ0:39 for CTGF and r ¼ ꢀ0:49 for Nov, respectively).
The possible relationship between CCN family members and ER status was also analysed. There was no significant correlation between ER and ER-b with any of the family members when tumours were analysed as an entire cohort. However, ER was inversely correlated with Nov in NPI-3

www.endocrinology-journals.org

785

Downloaded from Bioscientifica.com at 09/24/2021 02:32:55PM via free access

Jiang et al.: CCN family in human breast cancer

Figure 3 Staining intensity of normal mammary epithelial cells and breast cancer cells in mammary tissues. Cyr61 is shown on the left, CTGF in the middle and Nov on the right. Cytoplasmic staining of the respective molecules was analysed using Optimas 6 and is shown as relative staining intensity. ÃP < 0:05 compared with normal epithelial cells.

Figure 4 Expression of Cyr61 (left-hand panel), CTGF (middle panel), and Nov (right-hand panel) in relation to the Nottingham Prognostic Index (NPI), where NPI-1 ð< 3:4Þ indicates good prognosis, NPI-2 (3.4–5.4) is moderate and NPI-3 ð> 5:4Þ is poor prognosis. ÃP < 0:02 compared with NPI-1. Inserts: respective CCN:CK19 ratios.

CCN and clinical outcome

compared with those groups with incidence (a combination of the other three groups). As shown in Fig. 7 (lefthand panel), patients with metastasis had significantly higher levels of Cyr61 ðP ¼ 0:016Þ. A marginally high level of the molecule was also seen in those who had recurrence and mortality. The Cyr61:CK19 ratios were 193 Æ 120, 3145 Æ 1311, 31466 Æ 15670 and 2951 Æ 1169
Following a 6-year follow up, patients were divided into four groups; those who remained disease-free, developed metastasis, had local recurrence and those who died of breast cancer (excluding deaths unrelated to breast cancer). In addition, the disease-free group was also

Figure 5 Levels of expression of the CCN family members in node-negative and node-positive tumours. Significantly high levels of Cyr61 were seen in node-positive tumours ðÃP ¼ 0:034Þ. Inserts: respective CCN:CK19 ratios.

786

www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 02:32:55PM via free access

Endocrine-Related Cancer (2004) 11 781–791

Figure 6 Levels of expression of Cyr61, CTGF and Nov in relation to TNM staging. Significantly higher levels of Cyr61 was seen in TNM-3 tumours ðÃP ¼ 0:05Þ and non-significant high level in TNM-4 tumours ðP ¼ 0:106Þ compared with TNM-1 tumours. Significantly lower levels of Nov were seen in TNM-4 tumours compared with TNM-1 ðÃP ¼ 0:0048Þ. Inserts: respective CCN:CK19 ratios.

Recommended publications
  • Genetic Analysis of the Roles of Hh, FGF8, and Nodal Signaling During Catecholaminergic System Development in the Zebrafish Brain

    Genetic Analysis of the Roles of Hh, FGF8, and Nodal Signaling During Catecholaminergic System Development in the Zebrafish Brain

    The Journal of Neuroscience, July 2, 2003 • 23(13):5507–5519 • 5507 Development/Plasticity/Repair Genetic Analysis of the Roles of Hh, FGF8, and Nodal Signaling during Catecholaminergic System Development in the Zebrafish Brain Jochen Holzschuh, Giselbert Hauptmann, and Wolfgang Driever Developmental Biology, Institute Biology 1, University of Freiburg, D-79104 Freiburg, Germany CNS catecholaminergic neurons can be distinguished by their neurotransmitters as dopaminergic or noradrenergic and form in distinct regions at characteristic embryonic stages. This raises the question of whether all catecholaminergic neurons of one transmitter type are specified by the same set of factors. Therefore, we performed genetic analyses to define signaling requirements for the specification of distinct clusters of catecholaminergic neurons in zebrafish. In mutants affecting midbrain–hindbrain boundary (MHB) organizer for- mation, the earliest ventral diencephalic dopaminergic neurons appear normal. However, after2dofdevelopment, we observed fewer cells than in wild types, which suggests that the MHB provides proliferation or survival factors rather than specifying ventral diencephalic dopaminergic clusters. In hedgehog (Hh) pathway mutants, the formation of catecholaminergic neurons is affected only in the pretectal cluster. Surprisingly, neither fibroblast growth factor 8 (FGF8) alone nor in combination with Hh signaling is required for specification of early developing dopaminergic neurons. We analyzed the formation of prosomeric territories in the forebrain of Hh and Nodal pathway mutants to determine whether the absence of specific dopaminergic clusters may be caused by early patterning defects ablating corre- sponding parts of the CNS. In Nodal pathway mutants, ventral diencephalic and pretectal catecholaminergic neurons fail to develop, whereas both anatomical structures form at least in part.
  • Epha Receptors and Ephrin-A Ligands Are Upregulated by Monocytic

    Epha Receptors and Ephrin-A Ligands Are Upregulated by Monocytic

    Mukai et al. BMC Cell Biology (2017) 18:28 DOI 10.1186/s12860-017-0144-x RESEARCHARTICLE Open Access EphA receptors and ephrin-A ligands are upregulated by monocytic differentiation/ maturation and promote cell adhesion and protrusion formation in HL60 monocytes Midori Mukai, Norihiko Suruga, Noritaka Saeki and Kazushige Ogawa* Abstract Background: Eph signaling is known to induce contrasting cell behaviors such as promoting and inhibiting cell adhesion/ spreading by altering F-actin organization and influencing integrin activities. We have previously demonstrated that EphA2 stimulation by ephrin-A1 promotes cell adhesion through interaction with integrins and integrin ligands in two monocyte/ macrophage cell lines. Although mature mononuclear leukocytes express several members of the EphA/ephrin-A subclass, their expression has not been examined in monocytes undergoing during differentiation and maturation. Results: Using RT-PCR, we have shown that EphA2, ephrin-A1, and ephrin-A2 expression was upregulated in murine bone marrow mononuclear cells during monocyte maturation. Moreover, EphA2 and EphA4 expression was induced, and ephrin-A4 expression was upregulated, in a human promyelocytic leukemia cell line, HL60, along with monocyte differentiation toward the classical CD14++CD16− monocyte subset. Using RT-PCR and flow cytometry, we have also shown that expression levels of αL, αM, αX, and β2 integrin subunits were upregulated in HL60 cells along with monocyte differentiation while those of α4, α5, α6, and β1 subunits were unchanged. Using a cell attachment stripe assay, we have shown that stimulation by EphA as well as ephrin-A, likely promoted adhesion to an integrin ligand- coated surface in HL60 monocytes. Moreover, EphA and ephrin-A stimulation likely promoted the formation of protrusions in HL60 monocytes.
  • Ephb3 Suppresses Non-Small-Cell Lung Cancer Metastasis Via a PP2A/RACK1/Akt Signalling Complex

    Ephb3 Suppresses Non-Small-Cell Lung Cancer Metastasis Via a PP2A/RACK1/Akt Signalling Complex

    ARTICLE Received 7 Nov 2011 | Accepted 11 Jan 2012 | Published 7 Feb 2012 DOI: 10.1038/ncomms1675 EphB3 suppresses non-small-cell lung cancer metastasis via a PP2A/RACK1/Akt signalling complex Guo Li1, Xiao-Dan Ji1, Hong Gao1, Jiang-Sha Zhao1, Jun-Feng Xu1, Zhi-Jian Sun1, Yue-Zhen Deng1, Shuo Shi1, Yu-Xiong Feng1, Yin-Qiu Zhu1, Tao Wang2, Jing-Jing Li1 & Dong Xie1 Eph receptors are implicated in regulating the malignant progression of cancer. Here we find that despite overexpression of EphB3 in human non-small-cell lung cancer, as reported previously, the expression of its cognate ligands, either ephrin-B1 or ephrin-B2, is significantly downregulated, leading to reduced tyrosine phosphorylation of EphB3. Forced activation of EphB3 kinase in EphB3-overexpressing non-small-cell lung cancer cells inhibits cell migratory capability in vitro as well as metastatic seeding in vivo. Furthermore, we identify a novel EphB3-binding protein, the receptor for activated C-kinase 1, which mediates the assembly of a ternary signal complex comprising protein phosphatase 2A, Akt and itself in response to EphB3 activation, leading to reduced Akt phosphorylation and subsequent inhibition of cell migration. Our study reveals a novel tumour-suppressive signalling pathway associated with kinase-activated EphB3 in non-small-cell lung cancer, and provides a potential therapeutic strategy by activating EphB3 signalling, thus inhibiting tumour metastasis. 1 Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Graduate School of Chinese Academy of Sciences, Shanghai 200031, China. 2 The Eastern Hepatobiliary Surgery Hospital, the Second Military Medical University, Shanghai 200433, China.
  • Fgf8b Oncogene Mediates Proliferation and Invasion of Epstein–Barr Virus-Associated Nasopharyngeal Carcinoma Cells: Implication for Viral-Mediated Fgf8b Upregulation

    Fgf8b Oncogene Mediates Proliferation and Invasion of Epstein–Barr Virus-Associated Nasopharyngeal Carcinoma Cells: Implication for Viral-Mediated Fgf8b Upregulation

    Oncogene (2011) 30, 1518–1530 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE FGF8b oncogene mediates proliferation and invasion of Epstein–Barr virus-associated nasopharyngeal carcinoma cells: implication for viral-mediated FGF8b upregulation VWY Lui1,7, DM-S Yau1,7, CS-F Cheung1, SCC Wong1, AK-C Chan2, Q Zhou1, EY-L Wong1, CPY Lau1, EKY Lam1, EP Hui1, B Hong1, CWC Hui1, AS-K Chan1, PKS Ng3, Y-K Ng4, K-W Lo5, CM Tsang6, SKW Tsui3, S-W Tsao6 and ATC Chan1 1State Key Laboratory of Oncology in South China, Sir YK Pao Center for Cancer, Department of Clinical Oncology, Chinese University of Hong Kong, Hong Kong; 2Department of Pathology, Queen Elizabeth Hospital, Hong Kong; 3School of Biomedical Sciences, Chinese University of Hong Kong, Hong Kong; 4Department of Surgery, Chinese University of Hong Kong, Hong Kong; 5Department of Anatomical and Cellular Pathology, Chinese University of Hong Kong, Hong Kong and 6Department of Anatomy, University of Hong Kong, Hong Kong The fibroblast growth factor 8b (FGF8b) oncogene is identified LMP1 as the first viral oncogene capable of known to be primarily involved in the tumorigenesis and directly inducing FGF8b (an important cellular oncogene) progression of hormone-related cancers. Its role in other expression in human cancer cells. This novel mechanism of epithelial cancers has not been investigated, except for viral-mediated FGF8 upregulation may implicate a new esophageal cancer, in which FGF8b overexpression was role of oncoviruses in human carcinogenesis. mainly found in tumor biopsies of male patients. These Oncogene (2011) 30, 1518–1530; doi:10.1038/onc.2010.529; observations were consistent with previous findings in published online 29 November 2010 these cancer types that the male sex-hormone androgen is responsible for FGF8b expression.
  • Hepatocyte Growth Factor Signaling Pathway As a Potential Target in Ductal Adenocarcinoma of the Pancreas

    Hepatocyte Growth Factor Signaling Pathway As a Potential Target in Ductal Adenocarcinoma of the Pancreas

    JOP. J Pancreas (Online) 2017 Nov 30; 18(6):448-457. REVIEW ARTICLE Hepatocyte Growth Factor Signaling Pathway as a Potential Target in Ductal Adenocarcinoma of the Pancreas Samra Gafarli, Ming Tian, Felix Rückert Department of Surgery, Medical Faculty Mannheim, University of Heidelberg, Germany ABSTRACT Hepatocyte growth factor is an important cellular signal pathway. The pathway regulates mitogenesis, morphogenesis, cell migration, invasiveness and survival. Hepatocyte growth factor acts through activation of tyrosine kinase receptor c-Met (mesenchymal epithelial transition factor) as the only known ligand. Despite the fact that hepatocyte growth factor is secreted only by mesenchymal origin cells, the targets of this multifunctional pathway are cells of mesenchymal as well as epithelial origin. Besides its physiological role recent evidences suggest that HGF/c-Met also plays a role in tumor pathophysiology. As a “scatter factor” hepatocyte growth factor stimulates cancer cell migration, invasion and subsequently promote metastases. Hepatocyte growth factor further is involved in desmoplastic reaction and consequently indorse chemo- and radiotherapy resistance. Explicitly, this pathway seems to mediate cancer cell aggressiveness and to correlate with poor prognosis and survival rate. Pancreatic Ductal Adenocarcinoma is a carcinoma with high aggressiveness and metastases rate. Latest insights show that the HGF/c-Met signal pathway might play an important role in pancreatic ductal adenocarcinoma pathophysiology. In the present review, we highlight the role of HGF/c-Met pathway in pancreatic ductal adenocarcinoma with focus on its effect on cellular pathophysiology and discuss its role as a potential therapeutic target in pancreatic ductal adenocarcinoma. INTRODUCTION activation causes auto-phosphorylation of c-Met and subsequent activation of downstream signaling pathways Hepatocyte growth factor (HGF) is a multifunctional such as mitogen-activated protein kinases (MAPKs), gene.
  • Involvement of Cyr61 in the Growth, Invasiveness and Adhesion of Esophageal Squamous Cell Carcinoma Cells

    Involvement of Cyr61 in the Growth, Invasiveness and Adhesion of Esophageal Squamous Cell Carcinoma Cells

    INTERNATIONAL JOURNAL OF MoleCular MEDICine 27: 429-434, 2011 Involvement of Cyr61 in the growth, invasiveness and adhesion of esophageal squamous cell carcinoma cells JIAN-JUN XIE1, LI-YAN XU2, YANG-MIN XIE3, ZE-PENG DU2, CAI-HUA FENG1, HUI-DONG1 and EN-MIN LI1 1Department of Biochemistry and Molecular Biology, 2Institute of Oncologic Pathology, The Key Immunopathology Laboratory of Guangdong Province and 3Department of Experimental Animal Center, Medical College of Shantou University, Shantou 515041, P.R. China Received October 27, 2010; Accepted December 29, 2010 DOI: 10.3892/ijmm.2011.603 Abstract. Cysteine-rich 61 (Cyr61), a secreted protein which overexpressed (Nov/CCN3), Wnt-1 induced secreted protein 1 belongs to the CCN family, has been found to be differentially (Wisp-1/CCN4), Wisp-2/CCN5, and Wisp-3/CCN6 (1,2). expressed in many cancers and to be involved in tumor Encoded by a growth factor-inducible immediate early gene, progression. The expression of Cyr61 in esophageal squamous Cyr61 is a 40 kDa protein which is extremely cysteine-rich. cell carcinoma (ESCC) has only recently been described, but This heparin-binding protein shares a 40-50% amino acid the roles of Cyr61 in ESCC cells still remained unclear. In homology with the other CCN family members. An important this study, we have shown that there are high levels of Cyr61 structural feature of CCN proteins is that they contain four in ESCC cell lines. Furthermore, using RNA interference conserved modules which exhibit similarities to the insulin-like (RNAi), we stably silenced the expression of Cyr61 in EC109 growth factor-binding proteins (IGFBPs), the von Willebrand cells, an ESCC cell line.
  • Investigations of Ephrin Ligands During Development

    Investigations of Ephrin Ligands During Development

    lB-c'è-C,-a Investigations of ephrin ligands during development A thesis submitted for the degree of Doctor of Philosophy Molecular Biosciences, Adelaide University By Paul Tosch, B.Sc (Hons.) Department of Molecular Bioscience, Adelaide University, Australia, Adelaide, South Australia, 5005 CNUcE L IÙ'day 2002 2 4 I think and think for months and years. Ninety-nine times, the conclusion is false. The hundredth time I am right. Albert Einstein (1879-1955), German-born U.S. theoretical physicist. 5 6 Acknowledgments Well what an amazing experience my PhD has been, I am not sure if I have grown more as a person or more as an academic. It is obvious that I could not have achieved any of this without the contributions of a large number of people. I would like to thank the following people: Paul Moir for driving me across the desert and giving me somewhere to live, he is like the brother I never had (it's getting a bit sand duney around here hey). Jacinta Makin for putting up with and listening to countless theories, and teaching me to ride horses. My two supervisors Dr Simon Koblar and Dr Robert Saint for providing me with the resources to perform this work. The following postdocs for providing challenging my mind and pushing me beyond my limits: Dr Tetyana Shandala, Dr Daniel Kortschak, Dr Rory Hope, Dr Tim Cox' The members of the Koblar lab past and present: Agnes Stokowski, Edwina Ashby, Chathurani Jayesena (Chaza), Anthony Condina, Dr Warren Flood (Wazza), Dr Robert Moyer , and Rebecca Mclennon The members of the Hope lab: Dave Wheeler, Scott Spargo The members of the Saint lab: Julianne Camerotto, Volkan Evci, Greg Somers (Gregor), Peter Smibert, Donna Crack, Jane Sibbons, Michelle Coulson, Member of the genetics department: Velta Vingelis, Itty Bitty Kitty People who have helped out at various times: Rebecca Patrick, Vera Shandala, Ian Miller, Calluna Denwood, James Brooks, Matthew Kelcey, Dr Peter Gunn, and Martin Blanchard.
  • Differential Expression of the CCN Family Members Cyr61, CTGF and Nov in Human Breast Cancer

    Differential Expression of the CCN Family Members Cyr61, CTGF and Nov in Human Breast Cancer

    Endocrine-Related Cancer (2004) 11 781–791 Differential expression of the CCN family members Cyr61, CTGF and Nov in human breast cancer Wen G Jiang, Gareth Watkins, Oystein Fodstad 1, Anthony Douglas-Jones 2, Kefah Mokbel 3 and Robert E Mansel Metastasis & Angiogenesis Research Group, University of Wales College of Medicine, Cardiff University, Cardiff, UK 1Cancer Research Institute, University of South Alabama, Mobile, AL, USA 2Pathology, University of Wales College of Medicine, Cardiff University, Cardiff, UK 3Department of Surgery, St George Hospital, London, UK (Requests for offprints should be addressed to W G Jiang; Email: [email protected]) Abstract The CCN family members cysteine-rich 61 (Cyr61/CCN1), connective tissue growth factor (CTGF/ CCN2) and nephroblastoma over-expressed (Nov/CCN3) play diverse roles in cells, are known to regulate cell growth, adhesion, matrix production and migration and are involved in endocrine- regulated pathways in various cell types. The role of these molecules in cancer remains controversial. In a cohort of 122 human breast tumours (together with 32 normal breast tissues) we have analysed the expression of all three CCN members at the mRNA and protein levels. Significantly higher levels of Cyr61 ðP ¼ 0:02Þ, but low levels of CTGF and Nov, were seen in tumour tissues compared with normal tissues. Significantly raised levels of Cyr61 were associated with poor prognosis ðP ¼ 0:02Þ, nodal involvement ðP ¼ 0:03Þ and metastatic disease ðP ¼ 0:016Þ. Patients who died of breast cancer also had high levels of Cyr61. In contrast, CTGF in patients with poor prognosis ðP ¼ 0:021Þ, metastasis ðP ¼ 0:012Þ, local recurrence ðP ¼ 0:0024Þ and mortality ðP ¼ 0:0072Þ had markedly reduced levels.
  • Metabolic and Mitogenic Functions of FGF1

    Metabolic and Mitogenic Functions of FGF1

    University of Groningen Metabolic and mitogenic functions of fibroblast growth factor 1 Struik, Dicky DOI: 10.33612/diss.133879075 IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2020 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Struik, D. (2020). Metabolic and mitogenic functions of fibroblast growth factor 1. University of Groningen. https://doi.org/10.33612/diss.133879075 Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 25-09-2021 Chapter 2 : Fibroblast Growth Factors in control of lipid metabolism: from biological function to clinical application Dicky Struik , Marleen B. Dommerholt and Johan W. Jonker Section of Molecular Metabolism and Nutrition, Department of Pediatrics, University of Groningen, University Medical Center Groningen, Hanzeplein 1, 9713 GZ Groningen, The Netherlands. Current Opinion in Lipidology, 2019, 30(3), 235-243.
  • Gene Section Review

    Gene Section Review

    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Gene Section Review EPHA3 (EPH receptor A3) Peter W. Janes Department of Biochemistry, Molecular Biology, Monash University, Wellington Road, Clayton, VIC, 3800, Australia. [email protected] Published in Atlas Database: July 2015 Online updated version : http://AtlasGeneticsOncology.org/Genes/EPHA3ID40463ch3p11.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62775/07-2015-EPHA3ID40463ch3p11.pdf DOI: 10.4267/2042/62775 This article is an update of : Stringer B, Day B, McCarron J, Lackmann M, Boyd A. EPHA3 (EPH receptor A3). Atlas Genet Cytogenet Oncol Haematol 2010;14(3) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology Identity Local order (tel) C3orf38 (ENSG00000179021) ->, 949,562bp, HGNC (Hugo): EPHA3 EPHA3 (374,609bp) ->, 720,071bp, <- Location: 3p11.1 AC139337.5 (ENSG00000189002) (cen) Other names: EC 2.7.10.1, ETK, ETK1, EphA3, Note HEK, HEK4, TYRO4 EPHA3 is flanked by two gene deserts. Figure 1: Chromosomal location of EPHA3 (based on Ensembl Homo sapiens version 53.36o (NCBI36)). Figure 2: Genomic neighbourhood of EPHA3 (based on Ensembl Homo sapiens version 53.36o (NCBI36)). Figure 3: Genomic organisation of EPHA3. Atlas Genet Cytogenet Oncol Haematol. 2016; 20(5) 264 EPHA3 (EPH receptor A3) Janes PW Figure 4: Domain organisation of EphA3. molecular mass of the translated protein minus the DNA/RNA signal peptide is 92.8kDa. The 521 amino acid Note extracellular domain contains five potential sites for EPHA3 spans the human tile path clones CTD- N-glycosylation such that EphA3 is typically 2532M17, RP11-784B9 and RP11-547K2.
  • Hypercalcemia of Malignancy: an Update on Pathogenesis and Management Aibek E

    Hypercalcemia of Malignancy: an Update on Pathogenesis and Management Aibek E

    University of Kentucky UKnowledge Internal Medicine Faculty Publications Internal Medicine 11-2015 Hypercalcemia of Malignancy: An Update on Pathogenesis and Management Aibek E. Mirrakhimov University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits oy u. Follow this and additional works at: https://uknowledge.uky.edu/internalmedicine_facpub Part of the Medicine and Health Sciences Commons Repository Citation Mirrakhimov, Aibek E., "Hypercalcemia of Malignancy: An Update on Pathogenesis and Management" (2015). Internal Medicine Faculty Publications. 82. https://uknowledge.uky.edu/internalmedicine_facpub/82 This Article is brought to you for free and open access by the Internal Medicine at UKnowledge. It has been accepted for inclusion in Internal Medicine Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. Hypercalcemia of Malignancy: An Update on Pathogenesis and Management Notes/Citation Information Published in North American Journal of Medical Sciences, v. 7, no. 11, p. 483-493. © 2015 North American Journal of Medical Sciences | Published by Wolters Kluwer - Medknow This is an open access article distributed under the terms of the Creative Commons Attribution- NonCommercial-ShareAlike 3.0 License, which allows others to remix, tweak, and build upon the work non- commercially, as long as the author is credited and the new creations are licensed under the identical terms. Digital Object Identifier (DOI) http://dx.doi.org/10.4103/1947-2714.170600 This article is available at UKnowledge: https://uknowledge.uky.edu/internalmedicine_facpub/82 [Downloaded free from http://www.najms.org on Friday, November 27, 2015, IP: 202.164.43.126] Review Article Hypercalcemia of Malignancy: An Update on Pathogenesis and Management Aibek E.
  • Hypercalcemia of Malignancy: an Update on Pathogenesis and Management

    Hypercalcemia of Malignancy: an Update on Pathogenesis and Management

    [Downloaded free from http://www.najms.org on Thursday, July 16, 2020, IP: 69.27.229.130] Review Article Hypercalcemia of Malignancy: An Update on Pathogenesis and Management Aibek E. Mirrakhimov Department of Medicine, University of Kentucky School of Medicine, 800 Rose Street, Lexington, KY 40536, USA Abstract Hypercalcemia of malignancy is a common finding typically found in patients with advanced stage cancers. We aimed to provide an updated review on the etiology, pathogenesis, clinical presentation, and management of malignancy-related hypercalcemia. We searched PubMed/Medline, Scopus, Embase, and Web of Science for original articles, case reports, and case series articles focused on hypercalcemia of malignancy published from 1950 to December 2014. Hypercalcemia of malignancy usually presents with markedly elevated calcium levels and therefore, usually severely symptomatic. Several major mechanisms are responsible for the development of hypercalcemia of malignancy including parathyroid hormone-related peptide-mediated humoral hypercalcemia, osteolytic metastases-related hypercalcemia, 1,25 Vitamin D-mediated hypercalcemia, and parathyroid hormone-mediated hypercalcemia in patients with parathyroid carcinoma and extra parathyroid cancers. Diagnosis should include the history and physical examination as well as measurement of the above mediators of hypercalcemia. Management includes hydration, calcitonin, bisphosphonates, denosumab, and in certain patients, prednisone and cinacalcet. Patients with advanced underlying kidney disease and refractory severe hypercalcemia should be considered for hemodialysis. Hematology or oncology and palliative care specialists should be involved early to guide the options of cancer targeted therapies and help the patients and their closed ones with the discussion of comfort-oriented care. Keywords: Cancer, hypercalcemia, parathyroid hormone related peptide, vitamin D Address for correspondence: Dr.