DOCSLIB.ORG

Title Stimulation of Methanotrophic Growth in Cocultures by Cobalamin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Title Stimulation of Methanotrophic Growth in Cocultures by Cobalamin View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Kyoto University Research Information Repository Stimulation of methanotrophic growth in cocultures by Title cobalamin excreted by rhizobia. Author(s) Iguchi, Hiroyuki; Yurimoto, Hiroya; Sakai, Yasuyoshi Applied and environmental microbiology (2011), 77(24): 8509- Citation 8515 Issue Date 2011-12 URL http://hdl.handle.net/2433/152321 Right © 2011, American Society for Microbiology. Type Journal Article Textversion author Kyoto University 1 Stimulation of methanotrophic growth in co-cultures by 2 cobalamin excreted by rhizobia 3 4 Hiroyuki Iguchi,1 Hiroya Yurimoto,1 and Yasuyoshi Sakai1,2* 5 6 Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto 7 University, Kyoto,1 and Research Unit for Physiological Chemistry, the 8 Center for the Promotion of Interdisciplinary Education and Research, 9 Kyoto,2 Japan 10 11 Corresponding author: Yasuyoshi Sakai, Ph.D. Professor 12 Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto 13 University, Kitashirakawa-Oiwake, Sakyo-ku, Kyoto 606-8502, Japan. 14 Tel: +81 75 753 6385. Fax: +81 75 753 6454 15 E-mail: [email protected] 16 17 Running title: Cobalamin stimulates methanotrophic growth 18 19 1 20 ABSTRACT 21 Methanotrophs play a key role in the global carbon cycle, in which they 22 affect methane emissions and help to sustain diverse microbial communities 23 through the conversion of methane to organic compounds. To investigate the 24 microbial interactions that caused positive effects on the methanotroph, co-cultures 25 were constructed using Methylovulum miyakonense HT12 and each of nine 26 non-methanotrophic bacteria, which were isolated from a methane-utilizing 27 microbial consortium culture established from forest soil. Three rhizobial strains 28 were found to strongly stimulate the growth and methane oxidation of M. 29 miyakonense HT12 in co-cultures. We purified the stimulating factor produced by 30 Rhizobium sp. Rb122, and identified it as cobalamin. Growth stimulation by 31 cobalamin was also observed for three other -proteobacterial methanotrophs. These 32 results suggest that microbial interactions through cobalamin play an important 33 role in methane oxidation in various ecosystems. 34 2 35 INTRODUCTION 36 Methane is the second most important greenhouse gas, and mitigating 37 emissions of methane has become a major global concern (17). Aerobic 38 methanotrophs are the major terrestrial methane sink and are widespread in a 39 large variety of ecosystems (26). They belong to the -Proteobacteria (type I), 40 -Proteobacteria (type II) and Verrucomicrobia (26). Methanotrophs utilize 41 methane as a single source of carbon and energy, but only some methanotrophic 42 strains in the class -Proteobacteria can assimilate substrates with C-C bonds (8). 43 Mutual interactions that occur between methanotrophs and other 44 organisms, ranging from microbes to plants and animals, may affect the global 45 methane cycle in various ways. Stable isotope probing (SIP) experiments revealed 46 that methane-derived carbon was incorporated into methylotrophic or heterotrophic 47 bacteria when they were incubated with methanotrophs (5, 14, 20, 22-23), 48 indicating an important role of methanotrophs in supplying nutrients in the forms 49 of carbon sources to other non-methanotrophic organisms. At deep-sea 50 hydrothermal vents and cold seeps, invertebrates form symbiotic associations with 51 -proteobacterial methanotrophs living in their tissues (21, 26). Some invertebrates 52 can derive most of their carbon nutrition from methane, indeed acquiring it from 53 methane-derived metabolites of methanotrophs or by digestion of methanotrophs. 54 Inversely, the hosts provide methanotrophs with simultaneous access to methane 3 55 and oxygen by positioning themselves appropriately and also by providing a stable 56 environment. In peat bogs, Sphagnum mosses associate with -proteobacterial 57 methanotrophs and utilize carbon dioxide that is generated from methane by 58 methanotrophic symbionts (18, 24). Although previous studies have demonstrated 59 that methanotrophs serve as food suppliers for other organisms, less attention has 60 been paid to the specific benefits that methanotrophs acquire from such 61 interactions. 62 Previously, we established a microbial consortium from forest soil utilizing 63 methane as the single carbon and energy source, from which we isolated a new 64 obligate methanotroph Methylovulum miyakonense HT12 (15). The aim of the 65 present study is to clarify the beneficial factors for methanotrophic growth and 66 methane oxidation provided by other bacteria in the methane-grown microbial 67 consortium to further understand interactions between methanotrophs and 68 microorganisms. 4 69 MATERIALS AND METHODS 70 Methanotrophic strains and growth conditions. M. miyakonense HT12 71 was a lab stock (15). Methylococcus capsulatus Bath, Methylobacter luteus, 72 Methylomonas methanica S1 and Methylosinus trichosporium OB3b were obtained 73 from the culture collection of NCIMB (No. 11132, No. 11914, No. 11130 and No. 74 11131, respectively). Details of the isolation of methanotrophic strains OS501, R4F, 75 B3R, SH31p and SS2C will be described elsewhere: Iguchi H, Sato I, Sakakibara M, 76 Yurimoto H and Sakai Y, in preparation. The methanotrophic strains were grown in 77 nitrate mineral salts (NMS) medium (28) under a 20 : 80 methane to air atmosphere 78 at 28ºC with shaking in 25 ml vials capped with butyl-rubber stoppers. In order to 79 compensate for the slow growth, M. miyakonense HT12, strain OS501 and strain 80 R4F were subcultured in medium supplemented with Bacto tryptone (Becton, 81 Dickinson and Company) at 0.01% (w/v). 82 Isolation of bacterial strains grown in the consortium culture. The 83 methane-enriched culture of forest soil (15) was subcultured every month over two 84 years. The culture was serially diluted and spread onto agar plates: the media used 85 were modified Luria-Bertani (LB) broth (0.2% tryptone, 0.1% yeast extract, 0.1% 86 sodium chloride, 0.1% glucose), 10-fold diluted Tryptone Soya Broth (OXOID, 87 Cambridge, UK), 5-fold diluted Nutrient Broth (Becton, Dickinson and Company) 88 and NMS medium with 0.1% methanol. A single colony grown on the plate at 28ºC 5 89 was isolated. The 16S rRNA gene was amplified by PCR using the 27f-1492r primer 90 set (27) and sequenced. A similarity search for the nucleotide sequence of the 16S 91 rRNA gene of the isolates was carried out using the BLAST program 92 Mixed culture experiments. The cells of the heterotrophic isolates were 93 prepared from liquid cultures grown in modified LB broth. Because of the inability 94 to grow in this medium, strain Rb122 was grown in TY medium (0.5% tryptone, 95 0.3% yeast extract, 0.083% calcium chloride). Methanotroph cells were prepared 96 from liquid cultures in NMS medium with methane. Cells of the methanotroph and 97 the heterotroph were washed with water, and then mixed to adjust the OD600 ratio 98 to 10 : 1 (OD600 values, 0.0025 and 0.00025, respectively), and cultivated in NMS 99 medium with methane. For the second generation culture, the cells were harvested 100 by centrifugation from the 8 day-old mixed culture, washed with water and 101 inoculated into fresh NMS medium at an OD600 value of 0.0025. Triplicate samples 102 were prepared for each culture and for each time point, because after the methane 103 concentration was measured the vial was opened to measure the OD600. 104 Methane concentrations were determined using a Shimadzu GC-14B gas 105 chromatograph (Shimadzu, Kyoto, Japan) equipped with a flame ionization detector 106 and Porapak Q column (Shinwa chemical industries, Kyoto, Japan). Nitrogen gas 107 was used as the carrier. Analytical temperatures of the oven, injector and detector 108 were 100, 120 and 225ºC, respectively. 6 109 Quantitative PCR (qPCR). qPCR was carried out using a LightCycler 110 system (Roche Diagnostics, Tokyo, Japan) and SYBR Premix ExTaq (Takara Bio, 111 Shiga, Japan) according to the manufacturer’s instructions. Genomic DNA, which 112 was extracted from the culture by a method using SDS and proteinase K as 113 described previously (16), was used as template. Primers specific for the 16S rRNA 114 gene of each strain were designed. The primer sets were ht-fw 115 (TGGCCCCAATTATGGGGTAA) and ht-re (AGGGATCTCTGCCGAATCCA) for M. 116 miyakonense HT12, and rb-fw (GTCGGGCAGTTGACTGTTCG) and rb-re 117 (TACCGTCTCCGGTAACCGCGA) for strain Rb122. A standard curve for copy 118 number calculation was generated with plasmid DNA (pGEM-T Easy [Promega, 119 Madison, WI] harboring the 16S rRNA gene). 120 Preparation of spent medium and cell extracts. The pure culture of M. 121 miyakonense HT12, and the co-culture of M. miyakonense HT12 and strain Rb122 122 were grown in NMS medium with methane. Strain Rb122 was grown in Rhizobium 123 minimal medium (RMM) with glucose (13). Bacterial cells were removed from the 124 culture by centrifugation, and the spent medium was filter-sterilized using a 0.45 125 m filter. Until use, the samples were stored at -80 ºC. 126 For quantification, cobalamins were extracted from the lyophilized culture 127 or the harvested cells with methanol twice by incubating at 80ºC. The extracts were 128 lyophilized, dissolved in water and filter-sterilized using a 0.45 m filter. 7 129 Stimulatory activity assay on methanotrophic growth (the HT12 assay). 130 M. miyakonense HT12 was grown on methane in NMS medium containing a test 131 sample. The stimulatory activity of the sample was evaluated based on the OD600 132 value after cultivation for 48-72 hr. We confirmed that the addition of NMS medium, 133 RMM or methanol extracts of the media did not stimulate growth. For 134 quantification of the stimulatory activity, a calibration curve was established using 135 a cyanocobalamin standard (Wako Pure Chemical Industries, Osaka, Japan). 136 Bioassay of cobalamin (the Lactobacillus assay). Cobalamin was 137 quantified by the growth of Lactobacillus delbrueckii NBRC 3073 on B12 Assay 138 Medium (Becton, Dickinson and Company) according to the Difco & BBL Manual.
Load more

Recommended publications
  • Effect of Pyrroloquinoline Quinone Disodium in Female Rats During
    Downloaded from British Journal of Nutrition (2019), 121, 818–830 doi:10.1017/S0007114519000047 © The Authors 2019 https://www.cambridge.org/core Effect of pyrroloquinoline quinone disodium in female rats during gestating and lactating on reproductive performance and the intestinal barrier functions in the progeny . IP address: Boru Zhang, Wei Yang, Hongyun Zhang, Shiqi He, Qingwei Meng, Zhihui Chen and Anshan Shan* Institute of Animal Nutrition, Northeast Agricultural University, Harbin 150030, People’s Republic of China 170.106.202.226 (Submitted 26 September 2018 – Final revision received 21 December 2018 – Accepted 28 December 2018 – First published online 28 January 2019) , on Abstract 30 Sep 2021 at 19:42:41 The objective of this study was to investigate the effects of dietary pyrroloquinoline quinone disodium (PQQ·Na2) supplementation on the reproductive performance and intestinal barrier functions of gestating and lactating female Sprague–Dawley (SD) rats and their offspring. Dietary supplementation with PQQ·Na2 increased the number of implanted embryos per litter during gestation and lactation at GD 20 and increased the number of viable fetuses per litter, and the weight of uterine horns with fetuses increased at 1 d of newborn. The mRNA expression levels of catalase (CAT), glutathione peroxidase (GPx2), superoxide dismutase (SOD1), solute carrier family 2 member 1 (Slc2a1) · and solute carrier family 2 member 3 (Slc2a3) in the placenta were increased with dietary PQQ Na2 supplementation. Dietary , subject to the Cambridge Core terms of use, available at supplementation with PQQ·Na2 in gestating and lactating rats increased the CAT, SOD and GPx activities of the jejunal mucosa of weaned rats on PD 21.
    [Show full text]
  • Isolation and Characterisation of Methylocystis Spp. for Poly-3
    Rumah et al. AMB Expr (2021) 11:6 https://doi.org/10.1186/s13568-020-01159-4 ORIGINAL ARTICLE Open Access Isolation and characterisation of Methylocystis spp. for poly-3-hydroxybutyrate production using waste methane feedstocks Bashir L. Rumah† , Christopher E. Stead† , Benedict H. Claxton Stevens , Nigel P. Minton , Alexander Grosse‑Honebrink and Ying Zhang* Abstract Waste plastic and methane emissions are two anthropogenic by‑products exacerbating environmental pollution. Methane‑oxidizing bacteria (methanotrophs) hold the key to solving these problems simultaneously by utilising otherwise wasted methane gas as carbon source and accumulating the carbon as poly‑3‑hydroxybutyrate, a biode‑ gradable plastic polymer. Here we present the isolation and characterisation of two novel Methylocystis strains with the ability to produce up to 55.7 1.9% poly‑3‑hydroxybutyrate of cell dry weight when grown on methane from diferent waste sources such as landfll± and anaerobic digester gas. Methylocystis rosea BRCS1 isolated from a recrea‑ tional lake and Methylocystis parvus BRCS2 isolated from a bog were whole genome sequenced using PacBio and Illumina genome sequencing technologies. In addition to potassium nitrate, these strains were also shown to grow on ammonium chloride, glutamine and ornithine as nitrogen source. Growth of Methylocystis parvus BRCS2 on Nitrate Mineral Salt (NMS) media with 0.1% methanol vapor as carbon source was demonstrated. The genetic tractability by conjugation was also determined with conjugation efciencies up to 2.8 10–2 and 1.8 10–2 for Methylocystis rosea BRCS1 and Methylocystis parvus BRCS2 respectively using a plasmid with ColE1× origin of ×replication. Finally, we show that Methylocystis species can produce considerable amounts of poly‑3‑hydroxybutyrate on waste methane sources without impaired growth, a proof of concept which opens doors to their use in integrated bio‑facilities like landflls and anaerobic digesters.
    [Show full text]
  • Annotation Guidelines for Experimental Procedures
    Annotation Guidelines for Experimental Procedures Developed By Mohammed Alliheedi Robert Mercer Version 1 April 14th, 2018 1- Introduction and background information What is rhetorical move? A rhetorical move can be defined as a text fragment that conveys a distinct communicative goal, in other words, a sentence that implies an author’s specific purpose to readers. What are the types of rhetorical moves? There are several types of rhetorical moves. However, we are interested in 4 rhetorical moves that are common in the method section of a scientific article that follows the Introduction Methods Results and Discussion (IMRaD) structure. 1- Description of a method: It is concerned with a sentence(s) that describes experimental events (e.g., “Beads with bound proteins were washed six times (for 10 min under rotation at 4°C) with pulldown buffer and proteins harvested in SDS-sample buffer, separated by SDS-PAGE, and analyzed by autoradiography.” (Ester & Uetz, 2008)). 2- Appeal to authority: It is concerned with a sentence(s) that discusses the use of standard methods, protocols, and procedures. There are two types of this move: - A reference to a well-established “standard” method (e.g., the use of a method like “PCR” or “electrophoresis”). - A reference to a method that was previously described in the literature (e.g., “Protein was determined using fluorescamine assay [41].” (Larsen, Frandesn and Treiman, 2001)). 3- Source of materials: It is concerned with a sentence(s) that lists the source of biological materials that are used in the experiment (e.g., “All microalgal strains used in this study are available at the Elizabeth Aidar Microalgae Culture Collection, Department of Marine Biology, Federal Fluminense University, Brazil.” (Larsen, Frandesn and Treiman, 2001)).
    [Show full text]
  • Mechanism of Reconstitution/Activation of the Soluble PQQ-Dependent Glucose Dehydrogenase from Acinetobacter Calcoaceticus
    Mechanism of reconstitution/activation of the soluble PQQ-dependent glucose dehydrogenase from Acinetobacter calcoaceticus: a comprehensive study Claire Stines-Chaumeil, François Mavré, Brice Kauffmann, Nicolas Mano, Benoit Limoges To cite this version: Claire Stines-Chaumeil, François Mavré, Brice Kauffmann, Nicolas Mano, Benoit Limoges. Mecha- nism of reconstitution/activation of the soluble PQQ-dependent glucose dehydrogenase from Acine- tobacter calcoaceticus: a comprehensive study. ACS Omega, ACS Publications, 2020, 10.1021/ac- somega.9b04034. hal-02457126 HAL Id: hal-02457126 https://hal.archives-ouvertes.fr/hal-02457126 Submitted on 27 Jan 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Mechanism of reconstitution/activation of the soluble PQQ-dependent glucose dehydrogenase from Acinetobacter calcoaceticus: a comprehensive study Claire Stines-Chaumeil,*,a Francois Mavré,b Brice Kauffmann,c Nicolas Mano,a and Benoit Limoges*,b a CNRS, Université de Bordeaux, CRPP, UMR5031, 115 Avenue Schweitzer, F-33600 Pessac, France. b Université de Paris, Laboratoire d'Electrochimie Moléculaire, UMR 7591, CNRS, F-75013 Paris, France. c CNRS UMS3033, INSERM US001, Université de Bordeaux, IECB, 2, Rue Robert Escarpit, F- 33607 Pessac, France. KEYWORDS: pyrroloquinoline quinone, enzyme reconstitution, enzyme cofactor, apoenzyme, glucose dehydrogenase.
    [Show full text]
  • Prolonging Healthy Aging: Longevity Vitamins and Proteins PERSPECTIVE Bruce N
    PERSPECTIVE Prolonging healthy aging: Longevity vitamins and proteins PERSPECTIVE Bruce N. Amesa,1 Edited by Cynthia Kenyon, Calico Labs, San Francisco, CA, and approved September 13, 2018 (received for review May 30, 2018) It is proposed that proteins/enzymes be classified into two classes according to their essentiality for immediate survival/reproduction and their function in long-term health: that is, survival proteins versus longevity proteins. As proposed by the triage theory, a modest deficiency of one of the nutrients/cofactors triggers a built-in rationing mechanism that favors the proteins needed for immediate survival and reproduction (survival proteins) while sacrificing those needed to protect against future damage (longevity proteins). Impairment of the function of longevity proteins results in an insidious acceleration of the risk of diseases associated with aging. I also propose that nutrients required for the function of longevity proteins constitute a class of vitamins that are here named “longevity vitamins.” I suggest that many such nutrients play a dual role for both survival and longevity. The evidence for classifying taurine as a conditional vitamin, and the following 10 compounds as putative longevity vitamins, is reviewed: the fungal antioxidant ergo- thioneine; the bacterial metabolites pyrroloquinoline quinone (PQQ) and queuine; and the plant antioxidant carotenoids lutein, zeaxanthin, lycopene, α-andβ-carotene, β-cryptoxanthin, and the marine carotenoid astaxanthin. Because nutrient deficiencies are highly prevalent in the United States (and elsewhere), appro- priate supplementation and/or an improved diet could reduce much of the consequent risk of chronic disease and premature aging. vitamins | essential minerals | aging | nutrition I propose that an optimal level of many of the known adverse health effects.
    [Show full text]
  • PQQ —— a Novel Human Essential Nutrient General Information of PQQ
    PQQ —— A Novel Human Essential Nutrient General Information of PQQ Stable small molecular Chemical Name: Pyrroloquinoline Quinone Disodium Salt (PQQ●Na2) Molecular Formula: C14H4N2Na2O8 Molecular Weight: 374.17 CAS Number: 122628-50-6 Appearance: Reddish brown powder Melting Point: >300℃ (decomposed during the assay) Solubility: Water-soluble (3g/L at 25℃) Stability: Stable for at least 24 months. 50+ Years of Research 1964 1979 1989 2003 2008 2010 2012 2016 Discovered Extracted Identified Kasahara MGC’s UC Davis ZCHT ZCHT as the third from as an and Kato NDI filing published completed PQQ redox methanol essential stated that accepted PQQ developme obtained cofactor after dehydrogen nutrients PQQ was a by FDA promotes nt via US FDA nicotinamide ase and in animal. new mitochondrial chemical GRAS and flavin in identified vitamin in biogenesis synthesis bacteria its Nature LE introduced molecular Magazine the 1st PQQ structure Supplement More than 800 studies on PQQ published (by July 2016) 55 41 39 37 33 32 32 30 30 27 26 25 25 24 24 23 22 22 21 21 20 20 19 19 19 19 19 18 17 16 11 6 4 4 2 3 2 2016 2015 2014 2013 2012 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 2000 1999 1998 1997 1996 1995 1994 1993 1992 1991 1990 1989 1988 1987 1986 1985 1984 1983 1982 1981 1980 The Discovery of PQQ Produced by Bacteria Plants Growth Factor PQQ is Widely Distributed in Nature Playing important roles in Mammals Nature 1979；280(5725), 843-844 PQQ is Widely Distributed in Daily Life The PQQ Food PQQ(ng/g) Food PQQ(ng/g or ml) content of food products
    [Show full text]
  • Supplementary Material 16S Rrna Clone Library
    Kip et al. Biogeosciences (bg-2011-334) Supplementary Material 16S rRNA clone library To investigate the total bacterial community a clone library based on the 16S rRNA gene was performed of the pool Sphagnum mosses from Andorra peat, next to S. magellanicum some S. falcatulum was present in this pool and both these species were analysed. Both 16S clone libraries showed the presence of Alphaproteobacteria (17%), Verrucomicrobia (13%) and Gammaproteobacteria (2%) and since the distribution of bacterial genera among the two species was comparable an average was made. In total a 180 clones were sequenced and analyzed for the phylogenetic trees see Fig. A1 and A2 The 16S clone libraries showed a very diverse set of bacteria to be present inside or on Sphagnum mosses. Compared to other studies the microbial community in Sphagnum peat soils (Dedysh et al., 2006; Kulichevskaya et al., 2007a; Opelt and Berg, 2004) is comparable to the microbial community found here, inside and attached on the Sphagnum mosses of the Patagonian peatlands. Most of the clones showed sequence similarity to isolates or environmental samples originating from peat ecosystems, of which most of them originate from Siberian acidic peat bogs. This indicated that similar bacterial communities can be found in peatlands in the Northern and Southern hemisphere implying there is no big geographical difference in microbial diversity in peat bogs. Four out of five classes of Proteobacteria were present in the 16S rRNA clone library; Alfa-, Beta-, Gamma and Deltaproteobacteria. 42 % of the clones belonging to the Alphaproteobacteria showed a 96-97% to Acidophaera rubrifaciens, a member of the Rhodospirullales an acidophilic bacteriochlorophyll-producing bacterium isolated from acidic hotsprings and mine drainage (Hiraishi et al., 2000).
    [Show full text]
  • (Phb) Production Across Scale: Life Cycle Assessment, Pure Culture Experimentation, and Pathway/Genome Database Development
    UNDERSTANDING METHANOTROPHIC POLYHYDROXYBUTYRATE (PHB) PRODUCTION ACROSS SCALE: LIFE CYCLE ASSESSMENT, PURE CULTURE EXPERIMENTATION, AND PATHWAY/GENOME DATABASE DEVELOPMENT A DISSERTATION SUBMITTED TO THE DEPARTMENT OF CIVIL AND ENVIRONMENTAL ENGINEERING AND THE COMMITTEE ON GRADUATE STUDIES OF STANFORD UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Katherine Helen Rostkowski June 2012 © 2012 by Katherine Helen Rostkowski. All Rights Reserved. Re-distributed by Stanford University under license with the author. This work is licensed under a Creative Commons Attribution- Noncommercial 3.0 United States License. http://creativecommons.org/licenses/by-nc/3.0/us/ This dissertation is online at: http://purl.stanford.edu/mc120yq3299 ii I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy. Craig Criddle, Primary Adviser I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy. Michael Lepech I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy. Perry McCarty I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy. Peter Karp Approved for the Stanford University Committee on Graduate Studies. Patricia J. Gumport, Vice Provost Graduate Education This signature page was generated electronically upon submission of this dissertation in electronic format.
    [Show full text]
  • Downloaded from the Fungene Database (
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.307504; this version posted September 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Enhancement of nitrous oxide emissions in soil microbial consortia via copper competition between proteobacterial methanotrophs and denitrifiers Jin Chang,a,b Daehyun Daniel Kim,a Jeremy D. Semrau,b Juyong Lee,a Hokwan Heo,a Wenyu Gu,b* Sukhwan Yoona# aDepartment of Civil and Environmental Engineering, Korea Advanced Institute of Science and Technology, Daejeon, 34141, Korea bDepartment of Civil and Environmental Engineering, University of Michigan, Ann Arbor, MI, 48109 Running Title: Methanotrophic influence on N2O emissions #Address correspondence to Sukhwan Yoon, [email protected]. *Present address: Department of Civil & Environmental Engineering, Stanford University, Palo Alto CA, 94305 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.307504; this version posted September 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Unique means of copper scavenging have been identified in proteobacterial methanotrophs, particularly the use of methanobactin, a novel ribosomally synthesized post-translationally modified polypeptide that binds copper with very high affinity. The possibility that copper sequestration strategies of methanotrophs may interfere with copper uptake of denitrifiers in situ and thereby enhance N2O emissions was examined using a suite of laboratory experiments performed with rice paddy microbial consortia. Addition of purified methanobactin from Methylosinus trichosporium OB3b to denitrifying rice paddy soil microbial consortia resulted in substantially increased N2O production, with more pronounced responses observed for soils with lower copper content.
    [Show full text]
  • Why Are You So
    September is here, and for WHY many of us, the rat race picks up in speed, leading us to feel ARE drained. Yes, our adrenals are being affected; we’ve written often on how to address YOU stress and the resulting adrenal exhaustion. In this article, however, we address SO how to conquer energy drain at the cellular level. We also provide tips for better sleep, which is critical in giving DRAINED? you the energy boost you so By Carol Blair, BS, DiHom, CNC, Laurel Sterling, RD, desperately desire! and Shannon Morehouse, MA, CHHC Feed the mitochondria in your cells! at the very least, because the mitochondria the balance to our cells and even help make new Mitochondria is a big word with a big meaning! power up those cells to give you the energy you mitochondria. need. The mitochondria generate ATP, the main Resveratrol, another powerful antioxidant, energy for the body. You might call them Even a mild form of mitochondrial dysfunction can play an indirect role in AMPK by activating the energy powerhouses. Mitochondrial can lead to low energy, poor stamina, increased SIRT-1, an enzyme involved in longevity. insufficiency can tip the delicate balance in our fat storage, insulin resistance, and the SIRT-1 quiets the genes that cause unhealthy cells. accumulation of toxins inside the cells. responses to inflammation, stress, and fat storage. Resveratrol has gained much attention When most physicians think of mitochondrial Fortunately, today we know several ways to in recent years as a longevity factor; it is dysfunction, they think of major diseases like optimize mitochondrial function and revitalize thought to help reduce the effects of aging in Parkinson’s, MS, autism, or myasthenia gravis.
    [Show full text]
  • Methanotrophs in Geothermal Soils 1 Introduction A
    Discussion Paper | Discussion Paper | Discussion Paper | Discussion Paper | Biogeosciences Discuss., 11, 5147–5178, 2014 Open Access www.biogeosciences-discuss.net/11/5147/2014/ Biogeosciences BGD doi:10.5194/bgd-11-5147-2014 Discussions © Author(s) 2014. CC Attribution 3.0 License. 11, 5147–5178, 2014 This discussion paper is/has been under review for the journal Biogeosciences (BG). Methanotrophs in Please refer to the corresponding final paper in BG if available. geothermal soils Methanotrophic activity and bacterial A. L. Gagliano et al. diversity in volcanic-geothermal soils at Title Page Pantelleria island (Italy) Abstract Introduction A. L. Gagliano1,2, W. D’Alessandro3, M. Tagliavia2,*, F. Parello1, and P. Quatrini2 Conclusions References Tables Figures 1Department of Earth and Marine Sciences (DiSTeM), University of Palermo; via Archirafi, 36, 90123 Palermo, Italy 2 Department of Biological, Chemical and Pharmaceutical Sciences and Technologies J I (STEBICEF) University of Palermo; Viale delle Scienze, Bldg 16, 90128 Palermo, Italy 3Istituto Nazionale di Geofisica e Vulcanologia (INGV) – Sezione di Palermo, Via U. La Malfa J I 153, 90146 Palermo, Italy Back Close *now at: Institute of Biosciences and BioResources (CNR-IBBR), Corso Calatafimi 414, Palermo, Italy Full Screen / Esc Received: 12 February 2014 – Accepted: 11 March 2014 – Published: 1 April 2014 Printer-friendly Version Correspondence to: W. D’Alessandro ([email protected]) Interactive Discussion Published by Copernicus Publications on behalf of the European Geosciences Union. 5147 Discussion Paper | Discussion Paper | Discussion Paper | Discussion Paper | Abstract BGD Volcanic and geothermal systems emit endogenous gases by widespread degassing 11, 5147–5178, 2014 from soils, including CH4, a greenhouse gas twenty-five times as potent as CO2.
    [Show full text]
  • Widespread Soil Bacterium That Oxidizes Atmospheric Methane
    Widespread soil bacterium that oxidizes atmospheric methane Alexander T. Tveita,1, Anne Grethe Hestnesa,1, Serina L. Robinsona, Arno Schintlmeisterb, Svetlana N. Dedyshc, Nico Jehmlichd, Martin von Bergend,e, Craig Herboldb, Michael Wagnerb, Andreas Richterf, and Mette M. Svenninga,2 aDepartment of Arctic and Marine Biology, Faculty of Biosciences, Fisheries and Economics, UiT The Arctic University of Norway, 9037 Tromsoe, Norway; bCenter of Microbiology and Environmental Systems Science, Division of Microbial Ecology, University of Vienna, 1090 Vienna, Austria; cWinogradsky Institute of Microbiology, Research Center of Biotechnology of Russian Academy of Sciences, 117312 Moscow, Russia; dDepartment of Molecular Systems Biology, Helmholtz Centre for Environmental Research-UFZ, 04318 Leipzig, Germany; eFaculty of Life Sciences, Institute of Biochemistry, University of Leipzig, 04109 Leipzig, Germany; and fCenter of Microbiology and Environmental Systems Science, Division of Terrestrial Ecosystem Research, University of Vienna, 1090 Vienna, Austria Edited by Mary E. Lidstrom, University of Washington, Seattle, WA, and approved March 7, 2019 (received for review October 22, 2018) The global atmospheric level of methane (CH4), the second most as-yet-uncultured clades within the Alpha- and Gammaproteobacteria important greenhouse gas, is currently increasing by ∼10 million (16–18) which were designated as upland soil clusters α and γ tons per year. Microbial oxidation in unsaturated soils is the only (USCα and USCγ, respectively). Interest in soil atmMOB has known biological process that removes CH4 from the atmosphere, increased significantly since then because they are responsible but so far, bacteria that can grow on atmospheric CH4 have eluded for the only known biological removal of atmospheric CH4 all cultivation efforts.
    [Show full text]