University of Florida Thesis Or Dissertation Formatting

ANIMAL MODELS AND PATHOPHYSIOLOGY OF RAPID-ONSET DYSTONIA- PARKINSONISM AND RESTLESS LEGS SYNDROME

MARK P. DEANDRADE

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2014

To my parents, Avito and Neola, for their love and support; my brothers, Kevin and James, for their inspiration and motivation to strive for excellence; and in memory of my grandparents Louis and Helena Pereira de Andrade and Michael and Lydia Abreo.

ACKNOWLEDGMENTS

I would like to thank first and foremost Dr. Yuqing Li and the past and present

members of his laboratory, including but not limited to, Dr. Fumiaki Yokoi, Dr. Lin

Zhang, Dr. Li Zhang, Chad C. Cheetham, Atbin Doroodchi, Miki Jino, and Kelly Dexter,

for all their assistance and guidance.

I would like to thank my numerous collaborators who have helped make this work

possible. Dr. Thomas van Groen assisted in teaching me how to conduct several of the

behavioral experiments in this dissertation, alongside providing the equipment

necessary to carry the experiments out. Dr. J. David Sweatt, Dr. Steven N. Roper, and

their respective laboratories helped in conducting the electrophysiological experiments.

Drs. J. Michael Wyss and Ning Peng helped in the implantation of the biopotential

electrodes in the polysomnography and electromyographic studies, and provided the

equipment to carry out and analyze the data from these experiments. Dr. Karen L.

Gamble provided the wheel running setup used for the Btbd9 knockout animal studies,

assisted in analyzing the data from these experiments, and served on my committee

when I was a Master degree student at the University of Alabama at Birmingham. Dr.

Erica L. Unger assisted in analyzing striatal tissue for iron levels by atomic absorption

spectroscopy. Dr. Jerry B. Lingrel graciously supplied the Atp1a3 knockout mice.

I would like to thank the members of the Departments of Neurology and

Neuroscience, in particular Drs. Tetsuo Ashizawa, Lucia Notterpek, Wolfgang J. Streit,

Jennifer Bizon, Harry S. Nick, Jada Lewis, Ms. Linda Kilgore, Ms. Shuri Pass, and Ms.

Betty J. Streetman, for their advice, support, and patience. I would also like to thank Dr.

Paul Gulig and his staff in the Office of Graduate Education in the College of Medicine,

in particular Ms. Teresa Richardson and Ms. Susan Gardner, for their advice and

support. I would like to thank Drs. Pedro Fernandez-Funez, Suming Huang, Ronald J.

Mandel, and Michael S. Okun for serving on my graduate supervisory committee,

provide useful insight, and positive critiques with the aim of making me a better

scientist.

I have a heartfelt appreciation to Mónica Santisteban for her invaluable and indispensible support, sage advice, and constant encouragement throughout my graduate studies.

Lastly, I would like to thank the funding sources for Dr. Yuqing’s laboratory [NIH

NINDS (NS47692, NS54246, NS57098, NS47466, NS37406 and NS65273) and startup

funds from the Department of Neurology (UAB, UF) and Tyler’s Hope for a Dystonia

Cure, Inc.]. Without the above-mentioned people and funding sources, the work in this

dissertation would not be possible.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 9

LIST OF FIGURES ...... 10

LIST OF ABBREVIATIONS ...... 12

ABSTRACT ...... 15

CHAPTER

1 INTRODUCTION ...... 17

Animal Models ...... 17 Rapid-Onset Dystonia-Parkinsonism ...... 18 Clinical Features and Classification ...... 18 Dopaminergic System in Dystonia ...... 19 Genetics of Rapid-Onset Dystonia-Parkinsonism ...... 21 Alternating Hemiplegia in Childhood and Rapid-Onset Dystonia- Parkinsonism ...... 22 Restless Legs Syndrome ...... 22 Clinical Features, Prevalence, and Comorbidities ...... 22 Dopaminergic System in Restless Legs Syndrome ...... 23 Iron Homeostasis in Restless Legs Syndrome ...... 25 Genetics of Restless Legs Syndrome ...... 26 Goals and Significance ...... 27

2 MATERIALS AND METHODS ...... 28

General Considerations ...... 28 Mice ...... 28 Atp1a3 Knockout Mice ...... 28 Btbd9 Knockout Mice ...... 29 Behavior Paradigms ...... 30 Restraint Stress Protocol ...... 30 Beam-walking Test ...... 31 Rotarod Test ...... 31 Grip Strength Test ...... 32 Open Field Test ...... 32 Wheel Running Test ...... 32 Tail Flick Test ...... 33 Fear Conditioning Memory Assessment ...... 34 Polysomnography ...... 35

Electromyography ...... 36 High Performance Liquid Chromatography ...... 37 Iron Measurements ...... 38 Colorimetric Assay for Serum Iron ...... 38 Atomic Absorption Spectroscopy for Iron in Striatal Tissue ...... 39 Electrophysiology ...... 39 Field Recordings ...... 39 Whole-cell Recordings...... 40 Western Blot ...... 42 RT-PCR ...... 43 Statistics ...... 44

3 PART1: CHARACTERIZATION OF ATP1A3 KNOCKOUT MICE AS A MODEL FOR RAPID-ONSET DYSTONIA-PARKINSONISM ...... 45

Motor Deficits in Female Heterozygous Atp1a3 Mutant Mice ...... 45 Beam-walking test ...... 45 Accelerated Rotarod Test ...... 46 Grip Strength Test ...... 46 Activity Levels of Heterozygous Atp1a3 Mutant Mice ...... 46 Spontaneous activity levels ...... 46 Voluntary activity levels ...... 47 Sensory Deficits in Heterozygous Atp1a3 Mutant Mice ...... 47 No Alterations in Striatal Neurochemical Levels ...... 48

4 PART 2: CHARACTERIZATION OF BTBD9 KNOCKOUT MICE AS A POTENTIAL MODEL FOR RESTLESS LEGS SYNDROME ...... 55

Generation of Btbd9 Knockout Mice ...... 55 Motor Restlessness in Btbd9 Knockout Mice ...... 57 Thermal Sensory Alterations in Btbd9 Knockout Mice ...... 58 Sleep Structure Alterations in Btbd9 Knockout Mice ...... 59 Altered Iron Metabolism in Btbd9 Knockout Mice ...... 60 Altered Serotonergic Metabolism in Btbd9 Knockout Mice ...... 60

5 PART 3: ENHANCED HIPPOCAMPAL LONG-TERM POTENTIATION AND FEAR MEMORY IN BTBD9 KNOCKOUT MICE ...... 73

Field Recordings of Btbd9 Knockout Mice ...... 73 Whole-cell Recording of Btbd9 Knockout Mice ...... 74 Fear Memory in Btbd9 Knockout Mice ...... 74 Analysis of Proteins Involved in Synaptic Transmission in the Btbd9 Knockout Mice ...... 75

6 CONCLUSION ...... 81

Rapid-Onset Dystonia-Parkinsonism ...... 81 Restless Legs Syndrome ...... 83

Future Directions ...... 86 Rapid-onset Dystonia-Parkinsonism ...... 86 Electromyographic characterization of Atp1a3 mutant mice ...... 86 Generation and characterization of conditional knockout mice ...... 87 Restless Legs Syndrome...... 89 Magnetic resonance imaging of Btbd9 KO mice ...... 89 Electrophysiological characterization of the spinal cord in Btbd9 KO mice ...... 90 Generation and characterization of conditional knockout mice ...... 91 Common Themes ...... 92 Disease Perspective ...... 92 Animal Model Perspective ...... 93

LIST OF REFERENCES ...... 100

BIOGRAPHICAL SKETCH ...... 115

LIST OF TABLES

Table page

3-1 DA, 5-HT, and their metabolites in the striatum ...... 54

4-1 Primers located in the sixth of the Btbd9 gene ...... 68

4-2 Primers located in the β-geo gene trap vector ...... 69

4-3 Non-Mendelian ratios of pups from heterozygous Btbd9 mutant mice interbreeding...... 70

4-4 No alterations in anxiety or stereotypical behaviors in open field ...... 70

4-5 Wheel running activity parameters during normal 12:12 light, dark cycle (LD) ... 70

4-6 Wheel running activity parameters during constant darkness (DD) ...... 71

4-7 Polysomnographic sleep parameters during the rest phase ...... 71

4-8 Levels of dopamine, serotonin, and their metabolites in the striatum ...... 72

6-1 Sustained contractions in wild-type and Dyt1 KI mice ...... 99

LIST OF FIGURES

Figure page

3-1 Hind limb slips on the beam-walking test ...... 49

3-2 Latency to fall on the accelerated rotarod test ...... 50

3-3 Forelimb and hind limb grip strength ...... 50

3-4 Open field test to measure spontaneous activity levels ...... 51

3-5 Voluntary activity levels measured by wheel running ...... 52

3-6 Tail flick sensory test to determine perception of a warm stimulus ...... 53

4-1 Location of the β-geo vector insertion site and PCR map ...... 62

4-2 Generation and genotyping of Btbd9 knockout mice ...... 63

4-3 Confirmation of loss of WT mRNA and fusion protein expression in hippocampus of Btbd9 knockout mice ...... 64

4-4 Open field test to measure total activity ...... 64

4-5 Wheel running analysis to measure voluntary activity ...... 65

4-6 Tail flick test to determine sensory perception to warm stimuli...... 66

4-7 Iron concentrations in the serum and striatum ...... 67

5-1 Hippocampal CA1 electrophysiological field recordings ...... 76

5-2 Hippocampal CA1 electrophysiological whole-cell recordings ...... 77

5-3 Response to electric shocks...... 78

5-4 Freezing behavior in fear conditioning experiment ...... 79

5-5 Western blot analyses of synaptic proteins from hippocampal synaptosome fractions ...... 80

6-1 Electromyographic traces of the bicep femoris muscle ...... 94

6-2 MEMRI scans ...... 95

6-3 Quantification of MEMRI signals ...... 96

6-4 Spinal reflex amplitude in response to dopamine and the D2-like agonist quinpirole ...... 97

6-5 Quantitative RT-PCR revealed a specific reduction of Btbd9 mRNA in the striatum of the Btbd9 sKO mice ...... 97

6-6 Open field activity ...... 98

LIST OF ABBREVIATIONS

[11C] β-CFT [11C] 2- β-carbometoxy-3-β-(4-fluorophenyl)tropane

3-MT 3-methoxytyramine

5-HIAA 5-hydroxyindoleacetic acid

5-HT Serotonin

ADP Adenosine diphosphate

AHC Alternating hemiplegia in childhood

ANOVA Analysis of variance

ATP Adenosine triphosphate

ATP1A3 Human gene coding for the α subunit of the Na-K-ATPase

Atp1a3 Mouse gene coding for the α subunit of the Na-K-ATPase

BH4 Tetrahydrobiopterin

BP Base pair

BTB Bric-á-brac

BTBD9 Human gene coding for the BTBD9 protein

Btbd9 Mouse gene coding for the Btbd9 protein

BTBD9 Human bric-á-brac, tramtrack, broad complex domain containing 9 protein

Btbd9 Mouse bric-á-brac, tramtrack, broad complex domain containing 9 protein

CCW Counterclockwise

CSF Cerebrospinal fluid

CW Clockwise

DA Dopamine

DAT Dopamine transporter

DD Dark, dark cycle/constant darkness

DOPAC 3,4-dihyroxyphenylacetic acid

EEG Electroencephalographic

EMG Electromyographic

ES Embryonic stem

GABA γ-Aminobutyric acid

GPe Globus pallidus pars externa

GPi Globus pallidus pars interna

GWAS Genome-wide association study

Het Heterozygous knockout mouse

HPLC High performance liquid chromatography

HVA Homovanillic acid

I/O Input/output

IRLSSG International Restless Legs Syndrome Study Group

KB Kilobase

KO Homozygous knockout mouse

L-DOPA L-3,4-dihydroxyphenylalanine

LA-PCR Long and accurate PCR

LD Light, dark cycle

LS Least-square

LTP Long-term potentiation mEPSC Miniature excitatory post synaptic currents

MHPG 3-methoxy-4-hydroxyphenylglycol

MPTP 1-methyl-4-phenyl-1,3,4,6-tetrahydro pA Polyadenylation sequence

PCR Polymerase chain reaction

PLM Periodic leg movements

PPF Paired-pulse facilitation

PPR Paired-pulse ratios qPCR Quantitative PCR

RDP Rapid-onset dystonia-parkinsonism, DYT12 dystonia

REM Rapid eye movement sleep

RLS/WED Restless legs syndrome, Willis-Ekbom Disease

RPM Rotations per minute

RT-PCR Reverse transcriptase PCR

SEM Standard error of the mean

SNP Single nucleotide polymorphism

SWS Slow-wave sleep

TW:TS Total awake to total asleep ratio

WASO Wake after sleep onset

WT Wild-type mouse

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

ANIMAL MODELS AND PATHOPHYSIOLOGY OF RAPID-ONSET DYSTONIA- PARKINSONISM AND RESTLESS LEGS SYNDROME

Mark P. DeAndrade

May 2014

Chair: Yuqing Li Major: Medical Sciences - Neuroscience

Rapid-onset dystonia-parkinsonism (RDP) and restless legs syndrome (RLS) are two neurological movement disorders that are severely understudied. Patients with RDP exhibit the symptoms of dystonia and Parkinson’s disease. However, patients will not present with symptoms until triggered by a physiological stressor, and generally do not remit from there. In RLS, patients present with an uncontrollable urge to move at night or at rest, which is often accompanied by unpleasant sensations in the legs.

In the first aim of this research, we characterized the first genotypic mouse model of rapid-onset dystonia-parkinsonism using heterozygous Atp1a3 knockout mice. We demonstrated that these mice, like RDP patients, exhibit no motor deficits prior to a strong physiological stressor. However, post-stress, female mice display alterations in locomotor activity, motor performance, and perception of warm stimuli.

In the second aim of this research, we generated and characterized the first potential genotypic model of restless legs syndrome using homozygous Btbd9 knockout mice. We developed a battery of experiments to test these mice, and found motor restlessness, alterations in sleep architecture, changes in perception to warm stimuli, and dysfunction in iron homeostasis in the mice. Furthermore, we found that the Btbd9

knockout mice responded to a common treatment in RLS patients, ropinirole, and rescued the sensory deficits.

Finally, in the third aim of this research, we utilized the Btbd9 knockout mice to probe the natural function of the Btbd9 protein. Little is currently known about this protein. We found that mice deficient in Btbd9 exhibit altered neurotransmission and synaptic plasticity, with a consequential effect on learning and memory.

Overall, we put forth that the heterozygous Atp1a3 and homozygous Btbd9

knockout animals model their respective diseases well, and represent the first two

genotypic models. Furthermore, the comprehensive battery of tests that we developed

can be used on future potential animal models. Lastly, these studies provide a launch

pad for numerous studies, and several of these are discussed. Most importantly, these

mouse models can be used in future studies to elucidate the pathophysiology of their

associated diseases and develop novel therapeutics to treat patients.

CHAPTER 1 INTRODUCTION

Animal Models

From yeast to non-human primates, animal models are invaluable tools in

scientific research to discern pathophysiology and develop novel therapeutics.

Investigators primarily use rodents, in particular mice and rats, due to their nearly

homologous genome to humans, similar physiology, and short generation period

(Capecchi, 1994; Hall et al., 2009). With advances in genetic technology, animal models

are often developed to model diseases based on a known causative or associated gene. In the late 1980s, two independent groups generated the first genetic knockout

mice (Mansour et al., 1988; Schwartzberg et al., 1989). Global efforts are underway to

generate a knockout mouse of every gene in the mouse genome, with approximately

11,000 genes knocked out to date (Grimm, 2006; White et al., 2013).

The two main methods used to generate knockout mice are gene targeting and gene trapping. In the gene targeting method, an artificial DNA vector is designed based on a genomic region of interest. However, the targeting vector contains mutations in the genetic sequence that can be used to effectively silence the gene. This targeting vector is inserted into embryonic stem (ES) cells, e.g. by electroporation, and will align itself with the homologous genomic region. Using the natural DNA repair mechanism in ES cells, in particular the proteins associated with homologous recombination, the targeting vector will replace the normal genomic region in a small percentage of ES cells. In the

case of gene trapping, investigators insert a targeting vector into the promoter, an exon,

or an intron of a gene at random. In general, this vector consists of a reporter gene to

map the endogenous gene expression, a selection gene to isolate successfully targeted

ES cells, and a polyadenylation (pA) signal sequence to terminate the transcription of the gene prematurely. After insertion, investigators can identify which gene the targeting vector randomly inserted into using polymerase chain reaction (PCR) techniques.

We studied two new potential models of rapid-onset dystonia-parkinsonism and restless legs syndrome using knockout mice. The first knockout mouse was developed by gene targeting, while the second was developed by gene trapping. In this dissertation, we will discuss the current knowledge base of these two diseases, the characterization of the knockout mice, and what we learned from them.

Rapid-Onset Dystonia-Parkinsonism

Clinical Features and Classification

The definition of dystonia has evolved over time, but most recently it is defined as sustained or repetitive contractions that cause abnormal or repetitive movements

(Albanese et al., 2013). A recent coalition of dystonia clinicians and researchers suggested a new standard method of classifying dystonia based on two axes: clinical characteristics and etiology (Albanese et al., 2013). The clinical characteristics include the age of onset (e.g. infancy, adolescence, late adulthood), the distribution of the symptoms in the body (e.g. focal, generalized), temporal pattern, and associated features (e.g. myoclonus or parkinsonism). The etiology characteristics assess what is the origin of the disease, such as neurodegeneration, genetics, or another disease. To date, there are at least 22 forms of inherited, monogenic dystonias (Lohmann and Klein,

2013). These monogenic dystonias are often referred to as “DYT” followed by a number indicating the order in which it was first described. For instance, Oppenheim’s dystonia is commonly referred to as DYT1 dystonia, and dystonia caused by mutations in GNAL are referred to as DYT25 dystonia.

Parkinson’s disease is another neurological movement disorder characterized by

four hallmark features: resting tremors, akinesia, slowness of movement, and postural

instability (Jankovic, 2008). The majority of patients are over the age of 50 and have

Parkinson’s disease without a specific known cause (Jankovic, 2008). However, 5-10%

of patients involve an identified genetic component, which usually results in Parkinson’s

disease earlier in life. Generally, both forms of Parkinson’s disease result in

neurodegeneration of dopaminergic neurons in the substantia nigra, which causes the

motor symptoms.

The symptoms of dystonia and Parkinson’s disease can occur together in the same patient. For example, rapid-onset dystonia-parkinsonism (RDP), also known as

DYT12 dystonia, is a rare form of generalized, primary dystonia with Parkinson’s

disease features. RDP patients do not present with any dystonic or parkinsonian

symptoms until triggered by a physiological stressor (e.g. fever, alcoholism, traumatic

brain injury), typically in late adolescence or early adulthood (Dobyns et al., 1993;

Brashear et al., 1997). After this trigger, symptoms appear minutes to days later and are

permanent thereafter (Dobyns et al., 1993). Symptoms first affect the face, then the

arms, and finally the legs, which is commonly referred to as a rostrocaudal gradient

(Brashear et al., 2007).

Dopaminergic System in Dystonia

Similar to other dystonias, investigators hypothesize that alterations in the

dopaminergic system underlie the pathophysiological basis of RDP (Brashear et al.,

Reproduced with permission from DeAndrade MP, Yokoi F, van Groen T, Lingrel JB, Li Y (2011) Characterization of Atp1a3 mutant mice as a model of rapid-onset dystonia with parkinsonism. Behavioural Brain Research 216:659-665.

1998a; Brashear et al., 1998b). However, unlike Parkinson’s disease, dopaminergic neurons do not undergo neurodegeneration in the substantia nigra (Muller et al., 2002).

Additionally, dopaminergic treatments, such as L-DOPA or carbidopa, offer little, if any, symptomatic relief (Brashear et al., 2007; Svetel et al., 2010). In a small clinical study, analysis of cerebrospinal fluid (CSF) revealed decreased levels of homovanillic acid

(HVA), a metabolite of dopamine, in severe RDP patients and some asymptomatic

ATP1A3 mutation carriers (Brashear et al., 1998a). However, the level of HVA in patients did not correlate with severity of the disease or predict response to treatment

(Brashear et al., 1998a). This is similar to HVA levels in Parkinson’s disease (LeWitt et al., 1992). A follow-up study analyzed whether neurodegeneration of dopaminergic neurons terminating in the striatum or decreased dopamine re-uptake by dopamine transporter (DAT) was responsible for this altered level of HVA. The investigators utilized [11C] 2-β-carbometoxy-3-β-(4-fluorophenyl) tropane, also known as [11C] β-CFT

or [11C] WIN 35,428, in positron emission tomography (PET) of patients with RDP and

idiopathic Parkinson’s disease (Brashear et al., 1999). [11C] β-CFT is a structural derivative of cocaine used in PET imaging to assess indirectly the function and level of

DAT in patients. Parkinson’s disease patients exhibited a significant decrease in the volume of striatal [11C] β-CFT compared to age-matched controls (Brashear et al.,

1999). However, RDP patients displayed no observable difference, with a note of their being an increased level of [11C] β-CFT in the caudate of RDP patients compared to

controls, but not reaching significance perhaps due to the small sample size (Brashear

et al., 1999).

These data suggest that there is a subtle dopaminergic system abnormality in

RDP patients that should be investigated further. However, there is a critical problem plaguing RDP patient studies. As RDP is a rare type of dystonia, the number of patients

available to study is small, and therefore large, well-powered studies cannot be

conducted.

Genetics of Rapid-Onset Dystonia-Parkinsonism

RDP is inherited in an autosomal dominant fashion with reduced penetrance (de

Carvalho Aguiar et al., 2004). The causative gene of RDP is ATP1A3 (de Carvalho

Aguiar et al., 2004; Brashear et al., 2007). ATP1A3 encodes the α3 subunit of the

Na+/K+-ATPase, which regulates the electrochemical gradients of sodium (Na+) and potassium (K+) ions through active transport. These ions are essential for numerous

cellular functions including regulation of cellular osmolarity and action potentials of

excitable membranes (Dobretsov and Stimers, 2005). The α3 subunit is one of four α

isoforms that serve as the catalytic component of the Na+/K+-ATPase by hydrolyzing

adenosine triphosphate (ATP) to adenosine diphosphate (ADP) (Lingrel and

Kuntzweiler, 1994), and is exclusively expressed in neurons and cardiac muscle cells

(Lingrel et al., 2007). Investigations identified seven missense mutations in ATP1A3 as

causing RDP (Brashear et al., 2007; Zanotti-Fregonara et al., 2008). Studies showed six

of these mutations impair the activity or stability of the α3 subunit in cultured cells (de

Carvalho Aguiar et al., 2004). This suggests that these missense mutations lead to a

reduction or loss-of-function, which results in haploinsufficiency of the Na+/K+-ATPase in neurons and cardiac cells (de Carvalho Aguiar et al., 2004). This haploinsufficiency of the Na+/K+-ATPase potentially exacerbates the cellular response to a physiological

stressor in RDP patients, similar to stress induced channelopathies such as myasthenia gravis or chronic fatigue syndrome (Cannon, 2006; Breakefield et al., 2008).

Alternating Hemiplegia in Childhood and Rapid-Onset Dystonia-Parkinsonism

Recent evidence suggests that mutations in ATP1A3 can also cause alternating hemiplegia of childhood (AHC) (Heinzen et al., 2012; Rosewich et al., 2012; Ishii et al.,

2013; Sasaki et al., 2014b). AHC is a neurological disorder affecting children generally younger than 18 months of age with bouts of paralysis, dystonia, and abnormal ocular movements (Heinzen et al., 2012; Brashear et al., 2014). Patients can also present with cognitive impairment and developmental retardation. Recently, several leading clinicians and scientists hypothesized that RDP and AHC are a spectral disorder, with

RDP and AHC representing the extremes (Heinzen et al., 2012; Ozelius, 2012;

Rosewich et al., 2012; Ishii et al., 2013). A study supporting this hypothesis reported a patient with an intermediate form of RDP and AHC. The patient at first experienced flaccid hemiparalysis, followed by frequent hemiplegic dystonic attacks possibly triggered by a high fever and/or emotional excitement. Genetic screening revealed a missense mutation in ATP1A3 , reported previously in RDP and atypical AHC patients

(Sasaki et al., 2014a).

Restless Legs Syndrome

Clinical Features, Prevalence, and Comorbidities

Restless legs syndrome (RLS), also known as Willis-Ekbom disease (WED), is a common neurological disorder with motor, sensory, and circadian components. RLS is

characterized by an uncontrollable urge to move the legs for relief, and is often

accompanied by unpleasant sensations in the legs. Patients typically present with these

symptoms during rest or at night (Walters, 1995; Trenkwalder et al., 2005; Budhiraja et

al., 2012; Kerr et al., 2012). However, a recent study observed breakout symptoms during the daytime in moderate to severe RLS patients (Tzonova et al., 2012). RLS affects approximately 3 to 10% of the general population, with an increased risk towards women than men (Trenkwalder et al., 2005). The symptoms of RLS often lead to sleep disturbances, and can severely affect the patient’s daytime function and quality of life

(Abetz et al., 2004).

Several studies show an association between RLS and other conditions,

including neurological diseases such as Parkinson disease (Peeraully and Tan, 2012),

dystonia (Paus et al., 2011), and attention deficit hyperactivity disorder (ADHD)

(Cortese et al., 2005; Ming and Walters, 2009); cardiovascular diseases such as

hypertension (Schlesinger et al., 2009); and metabolic dysfunction such as iron

deficiency (Haba-Rubio et al., 2005; Connor, 2008) and renal failure (Araujo et al.,

2010; Quinn et al., 2011).

Dopaminergic System in Restless Legs Syndrome

The leading hypothesis on the pathogenesis of RLS focuses on the basal ganglia

and alterations in the central dopaminergic system. The basal ganglia includes the

striatum (caudate and putamen), subthalamic nucleus, globus pallidus, and substantia

nigra. The striatum is the first recipient for most inputs to the basal ganglia, including

excitatory input from all of the cerebral cortex except the primary visual and auditory

cortices. In addition, the striatum receives inputs from the intralaminar thalamic nuclei

and substantia nigra. One major projection from the striatum is to the globus pallidus

pars interna (GPi). These projections use γ-aminobutyric acid (GABA) as an inhibitory

neurotransmitter and form two pathways, a direct pathway link to the GPi directly and an

indirect pathway link to the GPi via the globus pallidus pars externa (GPe). The direct

pathway mainly expresses the D1 dopamine receptor and is likely involved in the facilitation of wanted movement. The indirect pathway, on the other hand, mainly expresses the D2 dopamine receptor and is thought to suppress unwanted movement.

Proper interaction between the direct and indirect pathways leads to the coordinated movement of the body. Additionally, the projections from the GPi are the major output controlling limb movements. The projections use GABA as an inhibitory

neurotransmitter and form a major projection to the thalamus that eventually regulates

the excitability of the motor cortex and other cortical areas involved in movement

control.

Most RLS patients respond to dopamine treatment and can be treated with low

doses of a dopamine agonist (Manconi et al., 2007; Zintzaras et al., 2010). How these dopaminergic treatments work and the nature of the dopaminergic system deficit is inconclusive, which could potentially be attributed to a heterogeneous RLS study population with multiple RLS etiologies and other unaccounted factors. For example, a study reported a decrease in 5-HIAA and tetrahydrobiopterin (BH4), an essential

cofactor for the biosynthesis of the monoamine neurotransmitters, in the cerebrospinal

fluid (CSF) of RLS patients (Earley et al., 2001). Moreover, another study observed an

increase in synaptic dopamine in RLS patients (Earley et al., 2013). In contrast, two

independent studies reported no alterations in the level of dopamine, serotonin, or their

metabolites in CSF of RLS patients (Stiasny-Kolster et al., 2004b; Earley et al., 2006).

Other studies reported decreased fluoro-dopa uptake (Turjanski et al., 1999; Ruottinen et al., 2000) and D2 receptor binding in RLS patients (Staedt et al., 1997; Turjanski et

al., 1999; Michaud et al., 2002). Elderly RLS patients exhibited increased levels of

dopamine transporter (DAT) (Kim et al., 2012), but other studies on RLS patients did not report similar findings (Michaud et al., 2002; Linke et al., 2004).

Additionally, the A11 dopaminergic nucleus of the posterior hypothalamus is hypothesized to be involved in RLS patients. Recent evidence suggests that periodic limb movements in sleep arise from the spinal cord in RLS patients (Clemens et al.,

2006). Moreover, the A11 nucleus is the primary, if not the only, descending dopaminergic innervation to the spinal cord grey matter (Holstege et al., 1996; Earley et al., 2009). Rodent lesions of the A11 nucleus, which results in hyperactivity, support its role in RLS pathophysiology (Ondo et al., 2000a; Qu et al., 2007; Zhao et al., 2007; Luo et al., 2011; Lopes et al., 2012). However, no investigator has reported observations of neurodegeneration or gross abnormalities in the A11 nucleus in RLS patients to date

(Earley et al., 2009). Nonetheless, subtle alterations in the A11 nucleus could exist that have yet to be elucidated.

Lastly, in addition to the regulation of movement in the basal ganglia, the balance between D1 and D2 dopamine receptor activation in the spinal cord is involved in sensory perception and processing. More specifically, D1 dopamine receptor activation is associated with pronociceptive effects, and conversely activation of the D2 dopamine receptor leads to antinociceptive effects (Ben-Sreti et al., 1983; Rooney and Sewell,

1989; Zarrindast and Moghaddampour, 1989; Verma and Kulkarni, 1993; Hore et al.,

1997; Zarrindast et al., 1999; Gao et al., 2000).

Iron Homeostasis in Restless Legs Syndrome

In addition to dopaminergic dysfunction, several studies demonstrated alterations

in iron homeostasis in RLS patients (Connor, 2008). MRI studies revealed less iron in

the brain of RLS patients than those of controls in the substantia nigra, an iron-enriched

area of the brain (Allen et al., 2001). Further studies demonstrated decreased levels of ferritin in RLS patients compared to controls in both serum and CSF, which is indicative of a systemic iron deficiency (Earley et al., 2000; Mizuno et al., 2005). Additionally, two studies demonstrated that intravenous iron administration improves symptoms in some

RLS patients (Earley et al., 2005; Bhandal and Russell, 2006). Taken together, these

results point to a deficiency of iron in the brain that could be central to the pathogenesis

of RLS.

Iron also appears to regulate the function of the dopaminergic system, thereby

potentially linking these two hypotheses of the pathogenesis of RLS. Animals fed with a

low iron diet exhibited lower densities of striatal D1 and D2 dopamine receptor ligand

bindings compared to controls (Erikson et al., 2001), suggesting a link between iron

deficiency and hypofunctioning of the dopaminergic system. Additionally, iron is an

essential cofactor for tyrosine hydroxylase, the rate-limiting step in the production of dopamine.

Genetics of Restless Legs Syndrome

A family history of RLS appears in approximately 60% of RLS cases

(Trenkwalder et al., 1996; Walters et al., 1996; Montplaisir et al., 1997; Lazzarini et al.,

1999; Winkelmann et al., 2002). Moreover, studies of 12 identical twin pairs in which one or both members have RLS revealed a concordance rate of 83.3%, suggesting a high genetic component (b et al., 2000a). Recently, investigators performed two independent genome-wide association studies (GWAS) with the aim of identifying polymorphisms in genes that are highly associated with RLS. In these studies, single nucleotide polymorphisms (SNPs) in MEIS1, MAP2K5, PTPRD, and BTBD9 correlated

strongly with RLS (Stefansson et al., 2007; Winkelmann et al., 2007). SNPs are single

nucleotide variations in the genome that exist naturally within the human population. As several investigations observed SNPs in BTBD9 to impart an increased susceptibility to

RLS, this made BTBD9 an excellent gene to study.

Goals and Significance

The overarching goal of this dissertation project is to characterize novel models of rapid-onset dystonia-parkinsonism and restless legs syndrome using behavioral,

electrophysiological, and biochemical techniques. This will fill a large knowledge gap in

the field. In the first specific aim of this dissertation project, I analyzed a line of

targeted knockout mice (heterozygous Atp1a3 knockout mice) as a model of rapid-onset dystonia-parkinsonism. This aim takes advantage of a previously generated line of mice of a well-understood protein, the α3 subunit of the Na+/K+-ATPase. In the second

specific aim of this project, I analyzed a different line of targeted knockout mice

(homozygous Btbd9 knockout mice) as a model of restless legs syndrome. We

generated a novel line of mice from a commercially available embryonic stem cell line,

with a deficiency in a protein with little known function. In the third specific aim, I used

the homozygous Btbd9 knockout mice to probe the function of this protein in the

regulation of synaptic plasticity and neurotransmission and, therefore, its consequence

on learning and memory. In addition to moving forward the understanding of the

pathophysiology of rapid-onset dystonia-parkinsonism and restless legs syndrome,

these three aims lay the groundwork for numerous follow up studies, including some

later discussed as future directions.

CHAPTER 2 MATERIALS AND METHODS

General Considerations

All experiments were carried out in compliance with the USPHS Guide for Care and Use of Laboratory Animals and approved by the Institutional Animal Use and Care

Committees at the University of Alabama at Birmingham (UAB) and the University of

Florida (UF). Investigators blind to the genotype of the mice conducted all experiments.

Animals were housed in a vivarium with a 12 hours light, 12 hours dark cycle with ad libitum access to food and water, unless otherwise noted.

Mice

Atp1a3 Knockout Mice

Heterozygous Atp1a3 knockout mice on the C57BL/6 background were bred with wild-type C57BL/6 (WT) mice to produce experimental animals. The animals were genotyped by PCR as previously described (Moseley et al., 2007). No spontaneous seizures were observed in the heterozygous Atp1a3 knockout mice as reported in mice carrying another Atp1a3 mutation (Clapcote et al., 2009). We used two cohorts of animals in the experiments. The first cohort consisted of 15 WT (9 males and 6 females) and 19 heterozygous Atp1a3 knockout mice (9 males and 10 females) with a mean age of 7.5 months. We first tested the mice on the beam-walking test. Following the beam- walking test, we stressed the mice using a restraint stress protocol. After the restraint stress exposure, we tested the mice in the following order: beam-walking test, grip

Reproduced and adapted with permission from DeAndrade MP, Yokoi F, van Groen T, Lingrel JB, Li Y (2011) Characterization of Atp1a3 mutant mice as a model of rapid- onset dystonia with parkinsonism. Behavioural Brain Research 216:659-665.

strength test, wheel running activity measurement, and tail flick sensory test. Two male animals died during the wheel running test for unknown reasons. The second cohort of mice consisted of 22 WT (10 males and 12 females) and 15 heterozygous Atp1a3 mutant mice (7 males and 8 females). For this cohort, we stressed all mice using the same restraint stress protocol as the first cohort. Following the restraint stress exposure the mice were used in the following order: open field locomotion test, accelerated rotarod test, and high performance liquid chromatography (HPLC) measurements of monoamines in the striatum.

Btbd9 Knockout Mice

We generated a line of Btbd9 knockout mice using a commercially available ES

cell clone that contained a β-geo gene trap vector within the sixth intron of the Btbd9

gene (RRE078, BayGenomics). The animals were genotyped by PCR using a two-step

process. First, a pair of primers was used to specifically detect the gene trap (v1531 –

5’-GGTCCCAGGTCCCGAAAACCAAAGAAGA-3’ and v1842R – 5’-

ACAGTATCGGCCTCAGGAAGATCGC-3’) along with a pair of primers serving as an

internal control (10200F – 5’-actctgagatgattaacaagagctcagggctga-3’ and 102200BR –

5’-agccctcagctcttgttaatcatcta-3’). Second, a pair of primers was used to detect the wild-

type allele, if one was present (102000B – 5’-agatgattaacaagagctgagggct-3’ and 6ERA

– 5’-tcagccacgtcttctaaatgtaatggtt-3). Heterozygous Btbd9 knockout mice were interbred

to produce experimental mice. In all experiments adult heterozygous Btbd9 knockout

mice and/or homozygous Btbd9 knockout mice were used along with WT littermate

mice as controls. Advanced age in rats (greater than 16 months) has been noted to

cause sleep-related motor phenomena such as periodic limb movements (Baier et al.,

2002). Therefore, we conducted all of our studies on non-aged, adult mice typical of

behavior and molecular experiments. The open field, first tail flick, and serum iron analysis were done in mice between the ages of 4 and 6.7 months of age. The second tail flick was performed in mice between the ages of 2 and 2.3 months of age. The wheel running was performed in mice between the ages of 2.5 and 4.3 months of age.

The polysomnography was done in mice between the ages of 7.5 and 8.3 months of age. The atomic absorption and high performance liquid chromatography were done in mice between 9.3 and 10 months of age. We used 16 WT mice and 5 homozygous

Btbd9 knockout mice for the open field experiment; seven male WT and seven male homozygous Btbd9 knockout mice for the wheel running experiment; 16 WT, six heterozygous Btbd9 knockout mice, and 5 homozygous Btbd9 knockout mice for the

first tail flick experiment; three WT and three homozygous Btbd9 knockout mice for the

polysomnography studies; three WT and 4 homozygous Btbd9 knockout mice for the

colorimetric iron assays; seven WT and seven homozygous Btbd9 knockout mice for

the iron and neurochemical measurements in the striatum; 20 WT mice and 15

homozygous Btbd9 knockout mice for the fear conditioning experiment; 6 WT and 6 homozygous Btbd9 knockout mice for field recordings; and 3 WT and 2 homozygous

Btbd9 knockout mice for whole-cell recordings.

Behavior Paradigms

Restraint Stress Protocol

To expose mice to a physiological stressor, mouse movement was constrained using a Mouse Decapicone (Braintree Scientific) disposable restrainer. Each mouse was placed in the restrainer for two consecutive 60 minutes sessions a day for five consecutive days. After five days, mice were allowed to rest for two weeks before experimentation. Herein, we define mice that have not undergone a restraint stress

protocol as non-stressed mice and mice that have undergone a restraint stress protocol as stressed mice.

Beam-walking Test

The beam-walking test assesses motor coordination and motor learning as mice transverse a narrow beam of various diameters to a dark box at the other end. We performed the test as previously described (Carter, 2001). In brief, we first trained

animals to transverse a medium square beam (14 mm wide) for two consecutive days

with three trials each day. After training, we tested the animals on the following two

consecutive days. On the first testing day, the animals traversed the medium square

beam and a medium round beam (17 mm diameter). On the second testing day, the

animals traversed a small round beam (10 mm diameter) and a small square beam (7

mm wide). Each beam was repeated twice consecutively and the time to transverse the

beam and number of hind limb slips were recorded. The beam-walking test was

performed twice on the same mice, once before the mice underwent a restraint stress

protocol and again after the restraint stress protocol.

Rotarod Test

The rotarod test assesses the ability of mice to maintain balance and

coordination on an accelerating, rotating rod. We performed the experiment as

previously described (Dang et al., 2006b). In brief, the accelerating rotarod (Ugo Basile)

started at an initial 4 rpm and accelerated at a rate of 0.2 rpm/s to a final rate of 28 rpm

over two minutes. We tested the mice for two consecutive days with three trials each

day. We performed the trials approximately one hour apart from each other. We

recorded the latency for each mouse to fall from the rod, without a maximum cutoff of

two minutes.

Grip Strength Test

We measured forelimb and hind limb strength using a grip strength meter (San

Diego Instruments). The meter records the force of a metal grate being pulled in newtons (N). To measure forelimb strength, we held the mice by their tail and allowed only the mouse’s forelimbs to hold on to the metal grate. We then quickly pulled back on the mouse’s tail. To measure hind limb strength, we held the mice by the skin behind their neck and held their tail at an angle that prevented the forelimbs from grasping the metal grate and were quickly pulled back. We conducted three measurements for the hind limbs and three measurements for the forelimbs, and the maximum force of the three trials was used for statistical analysis.

Open Field Test

An open field apparatus was used to measure spontaneous activity and stereotypic behaviors. The open field apparatus (Lafayette Instruments) is equipped with infrared sensors that detect breaks in the beams. This information was inputted and analyzed by computer software (Digiscan System, Accuscan Instruments) as described previously (Cao and Li, 2002; Dang et al., 2005; Yokoi et al., 2009). The center of the chamber was exposed to bright illumination (produced by a 60 W bulb). For the Atp1a3 studies, mice were recorded for 15 minutes. For the Btbd9 studies, mice were recorded for 30 minutes.

Wheel Running Test

The wheel running test examines voluntary activity levels of mice. For the studies involving Atp1a3 knockout mice we used a wheel running chamber equipped with an

optical sensor to detect the speed and number of revolutions of the wheel (Lafayette

Instruments). A computer collected this information at five minute intervals across six

consecutive days. The first three days of recordings were excluded from analysis due to acclimation and novelty of the wheel.

For the studies involving Btbd9 knockout mice, we used a chamber with a

magnetic sensor to detect movement of the wheel. The mice were maintained on a 12

hour light, 12 hour dark (LD) cycle for 17 days, and then followed by 17 days of constant

darkness (DD). Wheel running activity was recorded as the number of wheel revolutions

occurring during 5 min bins and analyzed using ClockLab software (Actimetrics). For the

last 10 days in LD we determined the proportions of activity during lights on and lights

off, the total amount of activity per day, and alpha length (time between onset and offset

of primary activity bout). The activity profile feature of ClockLab was used to determine

the proportion of activity over the course of the LD cycle averaged over a 7 day period.

The averaged data for each animal was normalized to the maximum activity for that

animal. Means from each group across 24 hr is shown in Figure 3-5. For statistical

comparison, data were binned into 3 hr bins and analyzed with a two-way repeated

measures ANOVA. In DD, activity was measured for the entire 17 days and ClockLab

was used to determine average counts per minute and alpha length. In addition, the chi-

squared periodogram analysis in ClockLab was used to determine period and rhythmic

power as a measure of the amplitude and coherence of behavioral rhythms (Gamble et

al., 2007; Ciarleglio et al., 2009).

Tail Flick Test

We tested the Atp1a3 and Btbd9 knockout mice for perception of pain using the

Tail Flick Analgesia Meter (San Diego Instruments). We placed each mouse in an

acrylic restrainer with the distal end of its tail protruding under a heat lamp. The heat

lamp was then manually switched on. In the first five seconds the lamp reached a

temperature of approximately 40°C and the temperature rose from there to 50°C at 10 seconds and 57°C at 15 seconds. A timer started once the heat lamp was turned on

and automatically stopped when the mouse produced a strong reaction to the heating

by moving its tail. This latency to respond was limited to 15 seconds to prevent injury.

In a second cohort of Btbd9 knockout mice, we conducted the tail flick experiment during the middle of the active phase (approximately Zeitgeber time (ZT) 18, where ZT 12 refers to lights off); during the middle of the rest phase (approximately ZT

6); and 15 min, 30 min, and 60 min following an intraperitoneal injection of 0.1 mg of

ropinirole per kg of body weight (0.1 mL/1 mL of saline). Ropinirole is a common

dopaminergic treatment for RLS patients, and previous study usued a similar dosage with efficacy (Qu et al., 2007).

Fear Conditioning Memory Assessment

We assessed memory formation and recall using the contextual and cued fear conditioning test as previously described (Shalin et al., 2006; Yokoi et al., 2009). Mice were trained during the morning of the first day in contextual chambers equipped wire shock grid floors. We allowed the mice to explore the context for four minutes before presentation of the first 30 seconds tone at 90 dB, which co-terminated with a 1 second,

0.5 mA electrical foot shock. We presented two tone-shock pairings in total with a shock interval of 120 seconds. Mice remained in the chamber for an additional 60 seconds before being returned to their home cages. The chamber was cleaned with 70% ethanol between animals. The next morning, we monitored mice in the context chambers for their freezing behavior for 5 minutes, without the presentation of tone or shock. In the afternoon, we significantly changed the attributes of the environment, including the

shape and smell. We then allowed the mice to explore this novel environment for 3 minutes before presentation of the tone, without shock, for 3 minutes. The chamber was cleaned with 75% isopropanol between animals. The time each mouse spent without any movement during the test was counted as freezing behavior. Freezing behavior was monitored and recorded by video and evaluated by software (Video Freeze, Med

Associates). The freezing time was divided by session time (for context, 5 min; for cued,

3 min) and expressed as percent freezing.

In addition to measurement of freezing behavior, an investigator subjectively scored the response to the electric shocks during the training phase on two rating scales. The first scale measured the gross response to the electric shock, and a score of 1 to 3 was given, where 1 represented no response, 2 represented flinching or modest interrupting in ongoing behavior but did not generate any gross movement, and

3 represented running or jumping or major interruption in ongoing behavior that generated gross movements. As all mice in the fear conditioning experiment responded with level 3 responses, the investigator then rated the response on a scale of 1 to 5, where 1 is a minimal but gross movement in response to the shock and 5 is a very large gross movement in response to the shock.

Finally, we measured electrical shock pain threshold as previously described

(Polter et al., 2010). In brief, we systematically applied increased shock intensities from

0.1 mA to 1.0 mA to the mice. Intensities at which the mouse flinched, jumped, or vocalized were recorded and analyzed.

Polysomnography

To measure sleep architecture, we utilized a wireless telemetry device (F20-EET,

Data Sciences International) that was approximately 3.9 g in weight and 1.9 cm3 in

volume with two biopotential channels. Each biopotential lead (2 per channel) had an outside diameter of 0.3 mm. We anesthetized the mice and made a small vertical cut

(approximately 1 cm) on one side of the skin near the hind limb and the tibialis cranialis muscle was localized. We then inserted a pair of leads into the muscle and sutured and glued in place to obtain electromyographic (EMG) data. We placed another pair of leads on the dura of the brain to obtain electroencephalographic (EEG) data, as suggested by the manufacturer, and secured by dental cement. The body of the transmitter and any excess wire were inserted under the back of the skin and sutured close. The mice were then allowed 48 hours to recover from surgery. The EEG and EMG signals were processed and sleep patterns analyzed by NeuroScore computer software (DSI

Instruments).

Electromyography

The EMG implantation was done similar to the polysomnography studies. Three

Dyt1 ΔGAG knock-in mice, a mouse model of DYT1 dystonia, and three wild-type

littermate controls of approximately 6 months of age were used in these studies. The

mice were deeply anesthetized by a mixture of ketamine and xylazine and maintained

using isoflurane, shaved, and a small vertical cut (approximately 1 cm) was made on

one side of the skin near the hind limb. The bicep femoris, which is involved in knee

flexion, and rectus femoris, which is involved in knee extension, were visually localized.

The biopotential leads were then inserted into the muscle, fastened with sutures, and

glued in place. The wireless transmitter body was then placed under the skin of the

back of the mouse alongside any excess wire. The incision was then closed with suture,

antibiotics were applied to the site, and the mouse was placed in a housing cage on top

of a heating pad, which was monitored for temperature, to aid in recovery from surgery.

After mice awoke from anesthesia and were freely walking around with ease, they were returned to a housing room to recover from surgery for an additional 24 to 48 hrs. After this recovery period the wireless transmitters were turned on using a magnet, and EMG data was acquired at 1,000 Hz by a connected computer using Dataquest A.R.T. software (Data Sciences International). The data was filtered using a bandpass filter set from 10 Hz to 100 Hz and analyzed using an automated detection program in

NeuroScore (Data Sciences International). We used three independent protocols for the detection program with varying stringency to assess sustained contractions. The first protocol (Protocol 1) assessed sustained contractions as being five times baseline activity (20 μV) for 10 s with a 2 s joint interval, the second protocol (Protocol 2) assessed sustained contractions as being four times baseline activity (16 μV) for 10 s with a 2 s joint interval, and the third protocol (Protocol 3) assessed sustained contractions as being three times baseline activity (12 μV) for 10 s with a 2 s joint interval. Statistical analysis was conducted using the non-parametric Mann-Whitney rank-sum test.

High Performance Liquid Chromatography

We analyzed neurochemicals in the striatum of Atp1a3 knockout mice using high performance liquid chromatography (HPLC). We conducted the experiment on striatal extracts from mice as previously described (Dang et al., 2005; Yokoi et al., 2006) except using 50 mM potassium phosphate buffer with 0.5 mM octyl sulfate (Sigma-Aldrich) and

8% acetonitrile as running buffer. Dopamine (DA), serotonin (5-HT), 3,4- dihyroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), 5-hydroxyindoleacetic acid (5-HIAA), and 3-methoxytyramine (3-MT) were measured by the Neurochemistry

Core Lab, Vanderbilt University Medical Center, Nashville, TN (Lindsey et al., 1998).

For the studies involving Btbd9 knockout mice, we performed HPLC using a different protocol. We homogenized the striatum, and the homogenate (50 mL), 0.24 M perchloric acid (50 mL) and internal standard 3,4-dihydroxybenzylamine (DHBA) were passed through a 0.2 mm micro-Sephadex column (Spin-X Costar, Corning Inc.) to remove endogenous substrates. Samples were then loaded onto a refrigerated ESA model 542 autosampler and 10 mL of sample was injected onto an ESA MD-150 narrow-bore

HPLC column (150 × 2 mm; ESA Inc). The mobile phase consisted of 75 mM sodium phosphate, 1.7 mM 1-octanesulfonic acid, 25 µM ethylenediaminetetracetic acid, 7.0 µM triethylamine, and 10% v/v acetonitrile in a volume of 2 L (pH 3.0). Once separated, compounds were measured with a coulometric detector (ESA model 5300, guard cell potential, +400 mV; working cell potentials, -174 mV and 350 mV). The neurotransmitter metabolite peak areas were integrated using EZ Chrom Elite Software (Scientific

Software, Inc.) and quantified against known standards. The standard curves exceeded r=0.99, and the relative standard deviation of DHBA between samples was less than

3%. Samples were normalized to weight of tissue and reported in pmol of neurochemical per gram of tissue.

Iron Measurements

Colorimetric Assay for Serum Iron

Blood was collected by retro-orbital blood collection from mice. The blood was allowed to clot and then separated by centrifugation at 1,500×g for 10 min. The serum was removed and centrifuged again at 1,500×g for 10 min for further purification. The iron concentration was quantified using a colorimetric assay (QuantiChrom Iron Assay

Kit, BioAssay Systems Inc.), according to the manufacturer’s instructions.

Atomic Absorption Spectroscopy for Iron in Striatal Tissue

Striatum from mice were dissected out and homogenized 1:10 in PBS (pH 7.4) containing protease inhibitors (Roche). Brain region aliquots were wet digested by published and standard procedures and analyzed for iron concentration by atomic absorption spectrometry (Perkin Elmer AAnalyst 600, Perkin Elmer) (Piñero et al.,

2000). Standards were prepared by diluting a Perkin Elmer iron standard

(PE#N9300126) in 0.2% ultra-pure nitric acid, and blanks prepared with digesting and diluting reagents to control for possible contamination. All standard curves exceeded r >

0.99.

Electrophysiology

Field Recordings

Preparation of hippocampal slice and electrophysiological analysis were performed as described previously (Levenson et al., 2004; Yokoi et al., 2009; Dang et al., 2012). In brief, hippocampi of adult mutant or wild type mice were rapidly removed and briefly chilled in ice-cold cutting saline (110 mM sucrose, 60 mM NaCl, 3 mM KCl,

1.25 mM NaH2PO4, 28 mM NaHCO3, 5 mM D-glucose, 500 μM CaCl2, 7 mM MgCl2, and

600 μM ascorbate). Transverse slices 400-μm thick were prepared with a Vibratome

and maintained at least 45 min in a holding chamber containing 50% artificial cerebral

spinal fluid (aCSF) (125 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 25 mM NaHCO3,

25 mM D-glucose, 2 mM CaCl2, and 1 mM MgCl2) and 50% cutting saline. The slices

were then transferred to a recording chamber and perfused (1 mL/min) with 100%

aCSF. Slices were allowed to equilibrate for 60–90 min in a Fine Science Tools

interface chamber at 30°C. All solutions were continuously bubbled with 95% O2/5%

CO2. For extracellular field recordings, glass recording electrodes were filled with aCSF

and placed in the stratum radiatum of the CA1 hippocampal region. Test stimuli were delivered to the Schaffer collateral/commissural pathway with bipolar Teflon coated platinum stimulating electrode positioned in the stratum radiatum of the CA3 hippocampal region. Responses were recorded using a computer with AxoClamp pClamp 8 data acquisition software. Excitatory post-synaptic potential (EPSP) slope measurements were taken after the fiber volley to eliminate contamination by population spikes. Following at least 20 min of stable baseline recording, long-term potentiation

(LTP) was induced with two, 100 Hz tetani (1 second), with an interval of 20 seconds between tetani. Synaptic efficacy was monitored by recording fEPSPs every 20 seconds beginning 0.5 hr prior to induction of LTP and ending 3 hr after induction of LTP (traces were averaged for every 2 min interval). Paired pulse ratios (PPRs) were measured at various inter-stimulus intervals (10, 20, 50, 100, 150, 200, 250, and 300 ms). All experimental stimuli were set to an intensity that evoked 50% of the maximum field

EPSP (fEPSP) slope. To measure input-output relationships, test stimuli were delivered and responses recorded at 0.05 Hz with every six consecutive responses over a 2 min period pooled and averaged. fEPSPs were recorded in response to increasing intensities of stimulation (from 2.5 μA to 45.0 μA).

Whole-cell Recordings

Animals were anesthetized by the inhalation of isoflurane, decapitated and the brain was rapidly removed. 400 µm-thick coronal brain slices were cut with a Vibratome

(Technical Products International, St. Louis, MO). Slices were incubated on cell culture inserts (8 µm pore diameter, Becton Dickinson, Franklin Lakes, NJ) covered by a thin layer of aCSF containing (in mM) 124 NaCl, 26 NaHCO2, 1.25 NaH2PO4, 2.5 KCl, 1

CaCl2, 6 MgCl2, 10 D-glucose and surrounded by a humidified 95% O2 and 5% CO2

atmosphere at room temperature (22°C). After at least 1 hr incubation, the slice was

transferred to a submerged recording chamber with continuous flow (2 ml/min) of aCSF

as described above except for 2.4 mM CaCl2 and 1.3 mM MgCl2 and gassed with 95%

O2-5% CO2 giving pH 7.4. All experiments were carried out at 30°C. Whole-cell recordings were made from pyramidal cells in the hippocampal CA1 region using infrared-differential interference contrast microscopy and an Axopatch 1D amplifier

(Axon Instruments, Foster City, CA). Patch electrodes had a resistance of 3-5 MΩ when filled with intracellular solution containing (in mM): 125 K-gluconate, 8 NaCl, 10 HEPES,

4 MgATP, 0.3 Na3GTP, 0.2 EGTA, and 0.1% biocytin (pH 7.3 with KOH, osmolarity

290-300 mOsM). mEPSCs were recorded at -68mV and with the both solution containing 1 µM TTX(a sodium channel blocker, 50 µM AP5(an NMDA receptor blocker)

and 50 µM picrotoxin (a blocker of GABA receptor). Series resistance was 9-15 MΩ and

cells were rejected if it changed >10% throughout the recording session. All drugs were

purchased from Sigma-Aldrich. Data were acquired using pClamp 10 software. The

recordings were started 5-10 min after accessing the cell to allow for stabilization of

spontaneous synaptic activity. Analysis of mEPSCs was based on 5 min continuous

recordings from each cell. Events were detected using the Mini Analysis Program

(Synaptosoft) with parameters optimized for each cell and then visually confirmed prior

to analysis. The peak amplitude, 10-90% rise time and the decay time constant were

measured based on the average of all events aligned by rise phase.

Western Blot

Two types of fractions were used depending on the experiment. The first was a whole hippocampus fraction and the second was a synaptosomal fraction. In both cases, the hippocampi were dissected and quickly frozen in liquid nitrogen. Whole hippocampus fraction preparation was performed as previously described (Yokoi et al.,

2010; Dang et al., 2012; Yokoi et al., 2012). In brief, the hippocampi were then

homogenized in 400 µL of ice-cold lysis buffer [50 mM Tris·Cl (pH 7.4), 175 mM NaCl, 5

mM EDTA, Complete Mini Protease Inhibitor Cocktail (Roche)] and sonicated for 10

seconds. One-ninth volume of 10% Triton X-100 in lysis buffer was added to the homogenates. The homogenates were incubated for 30 min on ice, and then centrifuged at 10,000 × g for 15 min at 4°C. The supernatants were then collected and the protein concentration was measured by Bradford assay with bovine serum albumin as standards. The homogenates were mixed with SDS-PAGE loading buffer and boiled for 5 min, incubated on ice for 1 minute, and then centrifuged for 5 min to obtain the supernatant for loading at 40 µg each lane. Synaptosomal fractions were prepared as previously described (Hallett et al., 2008; Yokoi et al., 2010). In brief, the hippocampi were defrosted in 5 mL of ice-cold TEVP buffer [10mM Tris-Cl (pH 7.4), 5 mM NaF, 1 mM Na3VO4, 1 mM EDTA, 1 mM EGTA] containing 320 mM sucrose for 5 min and

homogenized. The homogenates were centrifuged for 10 min at 800 × g at 4 °C and the

supernatants were collected. Supernatants were then centrifuged for 15 min at 9,200 ×

g and the pellets were obtained. After briefly rinsing with 1 mL TEVP buffer containing

35.6 mM sucrose, pellets were resuspended in 2 mL TEVP buffer and put on ice for 30

min. The samples were vortexed and centrifuged for 20 min at 25,000 × g at 4 °C.

Pellets were briefly rinsed with 1 mL of TEVP buffer and resuspended in 1 mL TEVP

buffer. These synaptosomal fractions were sonicated for 10 seconds and the protein concentration was measured by Bradford assay with bovine serum albumin as standards. Synaptosomal fractions were diluted with water containing Complete Mini

Protease Inhibitor Cocktail (Roche) and mixed with equal volume of 2 × SDS-PAGE loading buffer to the final protein concentration of 0.5 µg/µL. The solution was then boiled for 5 min, incubated on ice for 1 min, and centrifuged for 5 min to obtain the supernatant for loading at 10 µg each lane. In both fractions, the separated proteins were transferred to the nitrocellulose membrane. The membrane was blocked with 5% milk in wash buffer and treated with the primary antibody of the protein of interest. The secondary antibodies and detecting reagents were the same as previously described.

The experiments were performed in triplicate. For whole hippocampus fraction the antibody used was against β-galactosidase (55976, MP Biomedicals) and for synaptosomal fraction the antibodies used were against syntaxin-1 (PA1-1042, Affinity

BioReagents), SNAP-25 (SC-7538, Santa Cruz), synaptotagmin-1 (AB9202, Millipore), synaptobrevin-2 (018-15791, Wako), synaptophysin (PA1-1043, Affinity BioReagents), and dynamin 1 (SC-6402, Santa Cruz).

RT-PCR

Messenger RNA (mRNA) was obtained from 2 WT and 2 homozygous Btbd9 mutant mice brains using a Qiagen RNeasy Protect Kit. RT-PCR was performed using protocols from Qiagen OneStep RT-PCR kit with the forward primer located in the exon before the intron containing the gene-trap (Exon6 – 5’-

TTGAAGTGTCCATGGACGAACTTGATTGGA-3’) and the reverse primer located in the

exon after this intron (Exon7R – 5’-GAAAATCTTGTTCACTGTGTTGTGAGTCC-3’).

Statistics

We analyzed open field, wheel running, grip strength, tail flick, fear conditioning data using two-way ANOVAs, with age, sex, weight, and genotype as variables. We analyzed rotarod data using repeated ANOVAs, with age, sex, weight, and genotype as variables. Beam-walking data were analyzed by logistic regression (GENMOD) with negative binominal distribution using GEE model using genotype, sex, age and body weight as variables. WT mice were normalized to zero. Fear conditioning behavior response to the shock during training was analyzed using Wilcoxon rank-sum test.

Shock threshold was analyzed for each of three behaviors using a Student’s t-test

Electrophysiological data was analyzed in general by Student’s t-test. However, the overall distribution was analyzed using a Kolmogorov-Smirnov test for the input- output curve. Additionally, miniature excitatory post-synaptic current (mEPSC) amplitude and frequency was analyzed using a Kolmogorov-Smirnov test. Graphical data shows approximately 97-98% of mEPSC data for simplicity.

Western blot, HPLC, and iron data analyses were conducted using a Student’s t-test.

All data was analyzed using SAS 9.1 software and/or Microsoft Excel, with significance assigned at p ≤ 0.05.

CHAPTER 3 PART1: CHARACTERIZATION OF ATP1A3 KNOCKOUT MICE AS A MODEL FOR RAPID-ONSET DYSTONIA-PARKINSONISM

Motor Deficits in Female Heterozygous Atp1a3 Mutant Mice

Beam-walking test

We assessed motor coordination and motor learning deficits using the beam- walking test (Carter et al., 1999). We observed no statistical difference in non-stressed male or female heterozygous Atp1a3 knockout mice when compared to non-stressed wild-type mice (p > 0.05, Figure 3-1A). As the symptoms of DYT12 dystonia are absent until triggered by a physiological stressor (Dobyns et al., 1993; Pittock et al., 2000;

Linazasoro et al., 2002; Kamm et al., 2004; Zaremba et al., 2004; Brashear et al.,

2007), we examined the effects of stress on motor behavior. We exposed mice to a restraint stress for five days followed by a two-week rest period. Stressed female heterozygous Atp1a3 mutant mice exhibited a 250% increase in hind limb slips in the beam-walking test compared to stressed female WT mice (p < 0.05, Figure 3-1B).

However, we observed no significant increase in the number of hind limb slips in stressed male heterozygous Atp1a3 mutant mice compared to stressed male WT mice

(p > 0.05, Figure 3-1B). Previously, Koehl and colleagues observed that sensitivity to restraint stress is sex-dependent (Koehl et al., 2006). Therefore, it is possible that under the current conditions, we failed to trigger the dystonic-like phenotype in stressed male heterozygous Atp1a3 mutant mice. As stress induced motor deficits in the beam- walking test, we conducted the remaining experiments with only stressed animals.

Accelerated Rotarod Test

We used the rotarod test, another test for motor coordination and motor learning, on stressed mice. Stressed female heterozygous Atp1a3 mutant mice exhibited a significantly decreased latency to fall from the rotarod compared to stressed female WT mice (p < 0.05, Figure 3-2B,C). However, similar to the beam-walking test, stressed male heterozygous Atp1a3 mutant mice did not exhibit a deficit compared to stressed male WT mice (p > 0.05, Figure 3-2A,C). Similar to the beam-walking test, we observed motor deficits in the stressed female heterozygous Atp1a3 mutant mice.

Grip Strength Test

To determine if the motor deficits exhibited in the beam-walking and rotarod tests arose from a muscular weakness and not a neurological deficit, we assessed the grip strength of the stressed mice for both the forelimbs and the hind limbs. We observed no significant difference between stressed heterozygous Atp1a3 knockout mice and stressed WT mice in forelimb and hindlimb strength in males or females (3-3A,B). This suggests that stressed heterozygous Atp1a3 mutant mice do not exhibit a significant muscular deficiency.

Activity Levels of Heterozygous Atp1a3 Mutant Mice

Spontaneous activity levels

Several mouse models of dystonia exhibit alterations in activity levels and circling behavior (Dang et al., 2005; Shashidharan et al., 2005; Dang et al., 2006a; Yokoi et al.,

2006; Grundmann et al., 2007; Yokoi et al., 2008). In addition, Moseley and colleagues previously demonstrated that non-stressed heterozygous Atp1a3 mutant mice exhibited an increase in activity levels (Moseley et al., 2007). Therefore, to monitor stressed heterozygous Atp1a3 mutant mice for spontaneous activity, we used an open field

experiment. We observed no significant differences in the level of horizontal (p > 0.05,

Figure 3-4A) or vertical activity (p > 0.05, Figure 3-4A) in stressed heterozygous Atp1a3 mutant mice compared to stressed WT mice, regardless of sex. However, stressed heterozygous Atp1a3 mutant mice exhibited a significant decrease in clockwise circling

(p < 0.05, Figure 3-4B), but no significant difference in counterclockwise circling compared to stressed WT mice (p > 0.05, Figure 3-4B). Previous studies on mouse models of Parkinson’s disease linked alterations in activity and circling with alterations in the dopaminergic system (Kim et al., 2000; Viggiano et al., 2003), suggesting that the stressed heterozygous Atp1a3 mutant mice exhibit alterations in this system.

Voluntary activity levels

To monitor for voluntary activity levels, we used a standard cage equipped with a

wheel. We observed no significant difference in cumulative distance for four days for

stressed male or female heterozygous Atp1a3 mutant mice compared to stressed male

or female WT mice (p > 0.05, Figure 3-5B). However, the stressed female heterozygous

Atp1a3 mutant mice diverged into two separate groups (Figure 3-5C). One group was

significantly hyperactive when compared to stressed female WT mice (n=7, p < 0.05,

Figure 3-5D) and another was significantly hypoactive when compared to stressed

female WT mice (n=3, p < 0.0001, Figure 3-5D). This suggests that stressed female

heterozygous Atp1a3 mutant mice exhibit alterations in voluntary activity levels.

Sensory Deficits in Heterozygous Atp1a3 Mutant Mice

We conducted a standard tail flick sensory experiment to assess sensory

function in stressed heterozygous Atp1a3 mutant mice. Stressed female heterozygous

Atp1a3 mutant mice showed a significant increase in latency to respond to the stimulus

compared to stressed female WT mice (p < 0.05, Figure 2-6). In contrast, we observed

no significant difference between stressed male heterozygous Atp1a3 mutant and WT

mice (p>0.05, Figure 3-6). This suggests stressed female heterozygous Atp1a3 mutant

mice exhibit hyposensitivity.

No Alterations in Striatal Neurochemical Levels

Following the behavioral experiments, we sacrificed the mice and dissected out

the striatum from each mouse. We then performed high performance liquid

chromatography (HPLC) to analyze the striatal levels of dopamine, serotonin, and their

metabolites. We observed no significant differences between stressed heterozygous

Atp1a3 mutant mice and WT mice in dopamine, serotonin, or their metabolites (Table 3-

1). Therefore, the behavioral alterations observed in the Atp1a3 mutant mice are not

likely caused by gross changes in the dopaminergic or serotonergic system. However,

gross changes in these systems are not seen in RDP patients. We hypothesize that

subtle changes exist, such as an alteration in the level of dopamine receptors or

neurons, in the Atp1a3 mutant mice. Future studies will be targeted to testing this

hypothesis.

Figure 3-1. Hind limb slips on the beam-walking test. Non-stressed male and female mice showed no significant difference in hind limb slips (A). However, stressed female heterozygous Atp1a3 mutant mice showed an increase in slips compared to stressed female WT mice, while stressed male heterozygous Atp1a3 mutant mice showed no significant difference compared to stressed male WT mice (B). Bars represent means with standard errors of the mean. * p < 0.05.

Figure 3-2. Latency to fall on the accelerated rotarod test. Stressed male heterozygous Atp1a3 mutant mice showed no significant alterations in performance on the rotarod test by trial (A) or with all trials combined compared to stressed male WT mice (C). However, stressed female heterozygous Atp1a3 mutant mice showed a significant decrease in latency to fall compared to stressed female WT mice in both individual trials and with the trials combined (B, C). Bars represent means with standard errors of the mean. * p < 0.05.

Figure 3-3. Forelimb and hind limb grip strength. Stressed male and female heterozygous Atp1a3 mutant mice showed no difference in grip strength for forelimb (A) or hind limb (B) compared to stressed male and female WT mice (A). Bars represent means with standard errors.

Figure 3-4. Open field test to measure spontaneous activity levels. Stressed heterozygous Atp1a3 mutant mice, regardless of sex, showed no significant difference in horizontal activity (A) or vertical activity compared to stressed WT mice (A). Stressed heterozygous Atp1a3 mutant mice, regardless of sex, showed a significant decrease in clockwise (CW) circling (B), but no significant difference in counterclockwise circling (CCW) (B). Bars represent means with standard errors of the mean. * p < 0.05.

Figure 3-5. Voluntary activity levels measured by wheel running. Stressed male heterozygous Atp1a3 mutant mice showed no difference in the distribution (A) or the mean (B) of cumulative distance run. However, stressed female heterozygous Atp1a3 mutant mice showed a divergence in the distribution (C) with one group being increased in activity compared to stressed WT mice (Het – Hyperactive) and the other being decreased in activity compared to stressed WT mice (Het – Hypoactive) (D). Circles in (A) and (C) represent individual animal cumulative distances. Numbers in parenthesis in (C) indicates number of animals. Bars in (B) and (D) represent means with standard errors of the mean. * p < 0.05 compared to stressed WT mice. ** p < 0.01 compared to stressed WT mice.

Figure 3-6. Tail flick sensory test to determine perception of a warm stimulus. Stressed female heterozygous Atp1a3 mutant mice exhibited a significant increase in latency to respond to the stimulus compared to stressed female WT mice while stressed male heterozygous Atp1a3 mutant mice exhibited no difference compared to stressed male WT mice. Bars represent means with standard errors of the mean. * p < 0.05.

Table 3-1. DA, 5-HT, and their metabolites in the striatum. Neurochemical WT Het p DA 102.52 ± 3.00 101.05 ± 3.53 0.76 DOPAC 7.31 ± 0.25 7.11 ± 0.30 0.62 HVA 10.44 ± 0.38 10.33 ± 0.44 0.86 3-MT 5.94 ± 0.31 5.74 ± 0.36 0.69 5-HT 6.70 ± 0.28 6.84 ± 0.33 0.76 5-HIAA 2.96 ± 0.10 2.88 ± 0.12 0.62 DOPAC/DA 0.072 ± 0.002 0.070 ± 0.002 0.63 HVA/DA 0.102 ± 0.002 0.102 ± 0.003 0.99 5-HIAA/5-HT 0.446 ± 0.012 0.426 ± 0.014 0.29 The values of neurochemical are shown as mean ± standard errors (in ng/mg of wet tissue). The turnover of metabolites is shown as the ratio of the neurochemicals. WT, Wild-type mice; Het, Heterozygous Atp1a3 mutant mice.

CHAPTER 4 PART 2: CHARACTERIZATION OF BTBD9 KNOCKOUT MICE AS A POTENTIAL MODEL FOR RESTLESS LEGS SYNDROME

Generation of Btbd9 Knockout Mice

We obtained a commercial embryonic stem (ES) cell clone that contained a β- geo gene trap vector in the sixth intron of the Btbd9 gene (RRE078, BayGenomics). The gene trap was approximately 8.5 kilobase pairs (kb) long and included a single exon of the Engrailed-2 (En2) gene, the bacterial lacZ and neomycin phosphotransferase II genes, and a pA signal sequence. The En2 exon contained a 5’-splice site, thereby creating an artificial exon within the sixth intron of the Btbd9 gene. The gene trap version of the Btbd9 gene thereby produces a fusion protein containing the N-terminal portion of the Btbd9 protein, β-galactosidase, and neomycin. The ES cells were expanded and its fusion mRNA verified by RT-PCR. Next, we inserted the ES cells into blastocysts, and implanted them into pseudopregnant females, from which chimeras were generated. Chimeras that contained the gene trap in germline cells were detected by PCR using primers designed to target and amplify a sequence within the gene trap vector (v1531 – 5’-GGTCCCAGGTCCCGAAAACCAAAGAAGA-3’ and v1842R – 5’-

ACAGTATCGGCCTCAGGAAGATCGC-3’). Heterozygous mutant mice were interbred to generate homozygous mutant mice, which were identified initially using a microsatellite marker approximately 4 megabase pairs from the Btbd9 gene, which can identify differences between mouse inbred strains (D17M100a – 5’- gttaagaatgattttcacactacaaga-3’ and D17M100b – 5’-agcacatgtacttactcatatacgtgc-3’).

Reproduced and adapted with permission from DeAndrade MP, Johnson RL, Unger EL, Zhang L, van Groen T, Gamble KL, Li Y (2012a) Motor restlessness, sleep disturbances, thermal sensory alterations and elevated serum iron levels in Btbd9 mutant mice. Hum Mol Genet 21:3984-3992.

The size of PCR products from 129/SvJ strain is 129 bp, which represents that of the mutant allele from the ES cell, while those from C57BL/6J is 119 bp, which represents that of the wild-type allele from the backcross. To determine the location of the gene trap vector within the sixth intron of the Btbd9 gene, we used long and accurate (LA)-

PCR. With LA-PCR we were able to successfully amplify sequences up to

approximately 20 kb, which was important as the length of the sixth intron of the Btbd9

gene is approximately 179.2 kb long. We synthesized primer sets at approximately 10

kb intervals within the sixth intron (Table 4-1), and then serially amplified approximately

10 kb fragments and screened for failure of LA-PCR reactions using genomic template

DNA isolated from the homozygous mutant mice. We were able to narrow down the

approximate location of the gene trap in the sixth intron to a 13.2 kb region between

approximately 89.3 kb and 102.5 kb from the start of the sixth intron. Next, we

synthesized primer sets at approximately 500 bp intervals in this region and conducted

PCR (Table 4-1). This narrowed the possible insertion site further to 102,000 to 102,501

bp from the start of the sixth intron (Figure 4-1A). Lastly, we generated a primer set

located at 102,200 bp from the start of the sixth intron and conducted PCR (Table 4-1).

This narrowed the insertion site to between 102,200 and 102,501 bp from the start of

the sixth intron (Figure 4-1A). Mice were backcrossed to the C57BL/6 background.

Interbreeding heterozygous Btbd9 mutant mice resulted in a non-Mendelian ratio

at weaning, with a decrease in both heterozygous and homozygous Btbd9 mutant mice

(p < 0.05, Table 4-3). There were no obvious abnormalities in these mice, including

weight at time of experiment, ability to right themselves, and gait. To determine how

effective the gene trap was in terminating transcription, we used reverse transcriptase

(RT)-PCR with the forward primer located in the exon before the gene trap and the reverse primer located in the exon after the gene trap. The WT mice, in contrast to the homozygous Btbd9 mutant mice, produced a strong RT-PCR fragment (Figure 4-3A).

This suggests that the gene trap efficiently knocked out the Btbd9 gene. Furthermore,

as there are currently no high-quality commercially available antibodies for Btbd9 in

mice, we took advantage of the mutant mice having the bacterial lacZ gene inserted into

the Btbd9 gene as part of the gene trap, which produces a β-galactosidase-neomycin

fusion protein. Using an antibody against β-galactosidase, we were able to identify that

Btbd9 is normally expressed in the hippocampus of mice (Figure 4-3B). The Btbd9 mutant mice produced two bands compared to one band by the positive control, which could be attributed to alternate splicing of the Btbd9 gene (Flicek et al., 2008). The expression of the Btbd9 gene in the hippocampus of mice is similar to the result produced by the Allen Mouse Brain Atlas using in situ hybridization of Btbd9 mRNA

(Lein et al., 2007).

Motor Restlessness in Btbd9 Knockout Mice

A cardinal feature of RLS is an urge to move. Previously, phenotypic mouse

models of RLS exhibited altered activity levels, including hyperactivity and periodic leg

movement-like phenomena (Ondo et al., 2000b; Clemens and Hochman, 2004; Esteves

et al., 2004). Therefore, to assess the total activity levels of the Btbd9 knockout mice,

we measured activity using an open field activity chamber. We observed an increased

total distance traveled in the homozygous Btbd9 knockout mice compared to WT mice

(Figure 4-4A, p < 0.05). Furthermore, we observed an increase in counterclockwise

circling in the homozygous Btbd9 knockout mice (Figure 4-4B, p = 0.05), while no

statistical difference in clockwise (CW) circling compared to WT mice (Figure 4-4B, p >

0.05). Lastly, we observed no statistical differences in stereotypical behavior or anxiety levels in the homozygous Btbd9 knockout mice compared to WT mice (Table 4-4).

These results suggest that the homozygous Btbd9 knockout mice are hyperactive.

Furthermore, alterations in circling behavior in mice have been linked in other studies to

imbalances in the dopaminergic system (Kim et al., 2000; Viggiano et al., 2003).

Next, we assessed wheel running activity, which measures voluntary activity in a

home cage (Figure 4-5). In normal 12 hour light, 12 hour dark conditions (LD),

homozygous Btbd9 knockout mice exhibited a strong trend of increase in total counts,

which are the counts during both day and night (Table 4-5, p = 0.06), and a trend of

increase in counts during the lights on phase, when the mice would normally be resting

or sleeping (Table 4-5, p = 0.08). Next, the mice were placed in constant darkness (DD),

which mice typically respond with increased activity. The homozygous Btbd9 knockout

mice exhibited an increased locomotor activity compared to WT mice (Table 4-6, p <

0.05). Additionally, we observed no significant alterations in circadian parameters,

including period, alpha, or amplitude in either normal LD or DD (p > 0.05, Table 4-5,

Table 4-6). This data, taken together, suggest an increase in voluntary activity, which

corroborates the total activity being increased in the open field test, in the homozygous

Btbd9 mutant mice (Figure 4-4A).

Thermal Sensory Alterations in Btbd9 Knockout Mice

Commonly associated with the urge to move in RLS patients are uncomfortable

sensations in the legs. Therefore, we tested the Btbd9 mutant mice for abnormalities in

the sensory system using the tail flick test. We observed a 27% decrease in the latency

to respond for the heterozygous Btbd9 knockout compared to WT mice (Figure 4-6A, p

< 0.05). Furthermore, we observed a 53.4% decrease in time to respond to the warm

stimulus in the homozygous Btbd9 knockout compared to WT mice (Figure 4-6A, p <

0.01). We further analyzed this sensory alteration in the heterozygous Btbd9 knockout

mice, as they may represent more of the RLS population, and showed an intermediary

deficit. We observed no significant sensory alteration in the heterozygous Btbd9

knockout mice compared to WT mice during the middle of the active phase (Figure 4-

6B, Midnight, p > 0.05). However, we observed a significant sensory alteration in the

heterozygous Btbd9 knockout mice during the middle of the rest phase in comparison to

WT mice (Figure 4-6B, Midday, p < 0.01), suggesting a circadian or diurnal component

to the sensory deficit. Next, we administered intraperitoneally 0.1 mg/kg of ropinirole, a common D2 receptor-like dopaminergic agonist given to RLS patients, to WT and heterozygous Btbd9 knockout mice (Allen and Ritchie, 2008; Zintzaras et al., 2010).

After this treatment, we observed no difference in latency to respond to the warm stimuli

15 minutes post-injection (PI), 30 minutes PI, and 60 minutes PI (Figure 4-6B, p > 0.05) between the homozygous Btbd9 knockout and WT mice. This suggests a circadian-

dependent sensory deficit in the Btbd9 knockout mice and the sensory deficit is

responsive to dopaminergic treatment.

Sleep Structure Alterations in Btbd9 Knockout Mice

Due to the uncomfortable sensations in the legs and the uncontrollable urge to

move, patients with RLS often will have fragmented sleep (Brand et al., 2011; Scholz et

al., 2011; Yngman-Uhlin et al., 2011). To investigate if similar sleep disruptions occur in

the homozygous Btbd9 knockout mice, we implanted homozygous Btbd9 knockout mice

and WT mice with a wireless telemetry system capable of electroencephalographic

(EEG) and electromyographic (EMG) recordings of the right tibialis cranialis, which is

equivalent to the tibialis anterior muscle in humans. We observed that during the rest

phase the homozygous Btbd9 knockout mice had decreased slow-wave sleep (SWS)

(Table 4-7, p < 0.01), no statistical difference in REM sleep (Table 4-7, p > 0.05), and an increased awake time (Table 4-7, p < 0.05) compared to WT mice. Furthermore, we observed an increase in arousals in the homozygous Btbd9 knockout mice compared to

WT mice (Table 4-7, p < 0.05), but no significant alteration in latency to sleep or REM sleep (Table 4-7, p > 0.05). These results suggest a fragmented sleep in the Btbd9 knockout mice, similar to RLS patients.

Altered Iron Metabolism in Btbd9 Knockout Mice

Analysis of the iron system has been an emphasis of RLS research. Therefore to test whether there is an alteration in iron homeostasis in the Btbd9 knockout mice, we measured serum iron using a colorimetric assay. Homozygous Btbd9 knockout mice exhibited increased iron levels in the serum (Figure 4-7A, p < 0.01). We then sacrificed and dissected the striatum from homozygous Btbd9 knockout and WT mice. After homogenizing these samples, we performed atomic absorption (AA) spectroscopy on the homogenates. We observed no statistical difference in striatal brain iron levels between homozygous Btbd9 knockout and WT mice (Figure 4-7B, p > 0.05). These results suggest that there is an imbalance in iron homeostasis, at least in the periphery, of the Btbd9 knockout mice.

Altered Serotonergic Metabolism in Btbd9 Knockout Mice

We analyzed the striatum of homozygous Btbd9 knockout mice using high HPLC for alterations in dopamine, serotonin, and their metabolites DOPAC, HVA, and 5-HIAA.

We observed no statistical difference between homozygous Btbd9 knockout and WT mice in dopamine, serotonin, DOPAC, or HVA (Table 4-8, p > 0.05). However, we did observe an increase in 5-HIAA, a metabolite of serotonin, in the homozygous Btbd9

mutant mice compared to WT (Table 4-8, p < 0.05). This suggests that the gross levels of dopamine and serotonin are not altered, but alterations in the metabolism of the monoamine neurotransmitters in the striatum exist.

Figure 4-1. Location of the β-geo vector insertion site and PCR map. (A) Schematic diagram of PCR reactions that were used to narrow the β-geo vector insertion site to between 102,250 and 102,501. Reaction 1 produced PCR products at the appropriate base pair (bp) length, whereas Reaction 2 failed to produce reactions of the appropriate size, thereby narrowing the location to between 102,000 to 102,501. This was further confirmed by Reaction 3, which failed to produce reactions of the appropriate size. This region was further broken down, with Reactions 4 and 5. Reaction 4 produced PCR products at the appropriate bp length, whereas Reaction 5 failed to produce reactions of the appropriate size, thereby narrowing the location to 102,200 to 102,501. (B) Schematic diagram of PCR primer locations used to genotype mice. A set of primers detects the wild-type allele, and a different set of primers detects the mutant allele. Base pair numbers are relative to the start of the sixth intron of the Btbd9 gene. Thick line represents β-geo gene trap, and thin line represents the sixth intron of the Btbd9 gene.

Figure 4-2. Generation and genotyping of Btbd9 knockout mice. (A) The normal wild- type (WT) allele of the Btbd9 gene contains 12 exons. A commercially available mutant allele of the Btbd9 gene has a β-geo gene trap inserted into the sixth intron. Filled vertical rectangles represent coding exons; open vertical rectangles represent non-coding exons. (B) To genotype the mice a two-step process was taken. First, primers were used to detect specifically the β-geo gene trap vector, which produced a fragment of approximately 311 bp in length with an internal control fragment of approximately 200 bp in length. Second, primers were used to detect specifically a WT allele, which would produce a fragment of approximately 500 bp in length and an internal control β-geo fragment of 311 bp in length.

Figure 4-3. Confirmation of loss of WT mRNA and fusion protein expression in hippocampus of Btbd9 knockout mice. (A) The WT mice, in contrast to the homozygous Btbd9 knockout mice, produced a strong RT-PCR fragment of the Btbd9 gene. (B) The Btbd9 protein is expressed in the hippocampus of adult mice. Antibody against β-galactosidase detected β-geo fusion proteins from both the homozygous Btbd9 knockout and a positive control mouse that had a gene trap insertion in a different gene, while no band was observed in the WT control.

Figure 4-4. Open field test to measure total activity. (A) Homozygous Btbd9 knockout mice showed an increased total activity compared to WT mice. (B) Homozygous Btbd9 knockout mice showed no alteration in clockwise (CW) circling, but did show an increase in counterclockwise (CCW) circling. Bars represent means with standard errors of the mean. * p ≤ 0.05.

Figure 4-5. Wheel running analysis to measure voluntary activity. (A) Homozygous Btbd9 knockout mice showed a trend of increased activity during the normal light, dark cycle (LD). The light was on between ZT 0 and 12. (B) Actograms of WT and homozygous Btbd9 knockout mice. Yellow shaded region represents when the lights were on.

Figure 4-6. Tail flick test to determine sensory perception to warm stimuli. (A) Heterozygous Btbd9 mutant mice and homozygous Btbd9 mutant mice showed a dramatic decrease in latency to respond to a warm stimulus. (B) Heterozygous Btbd9 mutant mice showed no sensory alteration during the middle of the active phase (midnight), but showed a sensory alteration during the middle of the rest phase (midday). Top schematic describes the experimental design and setup. Bottom graph shows that after a 0.1 mg/kg injection of ropinirole, a dopamine receptor agonist, there was no statistical difference in latency to respond 15 minutes post-injection (PI), 30 minutes PI, or 60 minutes PI. Bars represent means with standard errors of the mean. * p < 0.05, ** p < 0.01.

Figure 4-7. Iron concentrations in the serum and striatum. (A) Homozygous Btbd9 mutant mice showed a significant increase in iron levels in blood serum compared to WT mice. (B) However, there was no significant alteration in iron levels in the striatum between homozygous Btbd9 mutant mice and WT mice. Bars represent means with standard errors of the mean. ** p < 0.01.

Table 4-1. Primers located in the sixth of the Btbd9 gene. Primer Forward (5' → 3') Reverse (5'→ 3') Length Location of Forward Name Exon6 TTGAAGTGTCCATGGACGAACTTGATTGGA TCCAATCAAGTTCGTCCATGGACACTTCAA 30 -103 to -74 10139 gagcaccaagccctacactgtttcacaatggga tcccattgtgaaacagtgtagggcttggtgctc 33 10,139 to 10,171 6A tactctgggaattcttacaccaatgaactgc gcagttcattggtgtaagaattcccagagta 31 22,003 to 22,033 29572 tctggataatcgtgccgtttaaaaccaagca tgcttggttttaaacggcacgattatccaga 31 29,572 to 29,602 6B gtacaataggtcccgcgttagaagtcgaa ttcgacttctaacgcgggacctattgtac 29 37,001 to 37,029 40880 tgatggttaagcatactgaagcagctttagc gctaaagctgcttcagtatgcttaaccatca 31 40,880 to 40,910 51316 gacaggggcatttattctggtatcatga tcatgataccagaataaatgcccctgtc 28 51,316 to 51,343 6C tatagagtaagaagagcaaacgtgggagca tgctcccacgtttgctcttcttactctata 30 59,997 to 60,026 68504 gctcatctgattactggctactatactgtc gacagtatagtagccagtaatcagatgagc 30 68,504 to 68,533 6D tcaaacatgcctaagataccttacctggatca tgatccaggtaaggtatcttaggcatgtttga 32 77,042 to 77,073 89304 gtacaccaacaatggaaaacatgacacactcc ggagtgtgtcatgttttccattgttggtgtac 32 89,304 to 89,335 100500 gagccgccctacccaacagttctcctcagc gctgaggagaactgttgggtagggcggctc 30 100,525 to 100,554 101500 gaatactgccttgctctggttccgtccaaatccc gggatttggacggaaccagagcaaggcagtattc 34 101,501 to 101,534 102000A ctgagatgattaacaagagctgagggct agccctcagctcttgttaatcatctcag 28 102,007 to 102,034 102000B agatgattaacaagagctgagggct agccctcagctcttgttaatcatct 25 102,010 to 102,034 102200 tcatgtgcacccgtgggaaagcttagtgt acactaagctttcccacgggtgcacat 29 102,195 to 102,223 6E tgaaccattacatttagaagacgtggctga tcagccacgtcttctaaatgtaatggttca 30 102,501 to 102,530 6EA aaccattacatttagaagacgtggctga tcagccacgtcttctaaatgtaatggtt 28 102,503 to 102,530 110510 tgctctcaactcctttcctcctgtactgc gcagtacaggaggaaaggagttgagagca 29 110,510 to 110,538 6F gtcctaccttatgattcaatcttagctgtc gacagctaagattgaatcataaggtaggac 30 118,494 to 118,523 131246 gacatgagtcatagtataagaggggaatca tgattcccctcttatactatgactcatgtc 30 131,246 to 131,275 6G gagtgttaaagatccctaaaggcttaagta tacttaagcctttagggatctttaacactc 30 144,007 to 144,036 153043 gaagaaacgacgatggcctgttgaggttga tcaacctcaacaggccatcgtcgtttcttc 30 153,043 to 153,072 6H ggaatctcctttgtacttttgctgccctgtac gtacagggcagcaaaagtacaaaggagattcc 32 162,001 to 162,032 170481 gtgcagtgagcccctccacacagacaacatc gatgttgtctgtgtggaggggctcactgcac 31 170,481 to 170,511 Exon7 GGACTCACAACACAGTGAACAAGATTTTC GAAAATCTTGTTCACTGTGTTGTGAGTCC 29 179,241 to 179,269

Table 4-2. Primers located in the β-geo gene trap vector. Name Forward (5' → 3') Reverse (5' → 3') Length v1531 GGTCCCAGGTCCCGAAAACCAAAGAAGA TCTTCTTTGGTTTTCGGGACCTGGGACC 28 v1525 CAACCAGGTCCCAGGTCCCGAAAACCAAAGAAG CTTCTTTGGTTTTCGGGACCTGGGACCTGGTTG 33 v1842 GCGATCTTCCTGAGGCCGATACTGT ACAGTATCGGCCTCAGGAAGATCGC 25 v5472 CCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGC GCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGG 34

Table 4-3. Non-Mendelian ratios of pups from heterozygous Btbd9 mutant mice interbreeding. Genotype Expected Observed Chi-square value p-value WT 20.5 35 - - Het 41 34 9.391 0.0022 * KO 20.5 13 10.083 0.0015 * Total 82 82 14.195 0.0008** WT, Wild-type mice; Het heterozygous Btbd9 knockout mice; KO, homozygous Btbd9 knockout mice; * p < 0.05, ** p < 0.001.

Table 4-4. No alterations in anxiety or stereotypical behaviors in open field. Parameter WT KO p-value Vertical Activity 181.45 ± 32.76 179.12 ± 55.86 0.97 Center Time 302.77 ± 59.27 271.09 ± 101.07 0.81 Center:Marginal Distance 0.321 ± 0.070 0.372 ± 0.120 0.74 Stereotypy Count 1653 ± 238 1555 ± 407 0.85 Vertical activity is presented as the number of beam breaks. Center time is presented in s. The ratio of center distance to marginal distance is presented in cm. Stereotypy count is presented as the number of counts. WT, wild-type mice; KO, homozygous Btbd9 knockout mice.

Table 4-5. Wheel running activity parameters during normal 12:12 light, dark cycle (LD). Parameter WT KO p-value Alpha 12.3 ± 1.9 13.6 ± 0.6 0.519 Light Counts 55.0 ± 16.2 112.8 ± 23.7 0.067 Dark Counts 7,518 ± 1,829 13,440 ± 2,510 0.081 Total Counts 7,573 ± 1,845 13,552 ± 2,532 0.081 Alpha (activity period length) is presented in hours ± SEM. Light counts, dark counts, and total counts as number of counts ± SEM. WT, wild-type mice; KO, homozygous Btbd9 knockout mice. * p < 0.05.

Table 4-6. Wheel running activity parameters during constant darkness (DD). Parameter WT KO p-value Period 23.73 ± 0.05 23.80 ± 0.04 0.289 Amplitude 1,543.7 ± 256.8 1,812.3 ± 292.9 0.504 Alpha 11.5 ± 0.6 11.4 ± 0.6 0.853 Average Counts 4.9 ± 2.2 11.1 ± 1.4 0.032* Alpha (activity period length) and chi-square periodogram-determined period is presented in hours ± SEM. Average counts are presented as number of counts ± SEM. WT, wild-type mice; KO, homozygous Btbd9 knockout mice. * p < 0.05.

Table 4-7. Polysomnographic sleep parameters during the rest phase. Parameter WT KO p-value Awake 5.50 ± 1.10 15.26 ± 2.36 0.020* SWS 93.05 ± 1.58 79.04 ± 1.23 0.002** REM 1.44 ± 1.05 5.70 ± 3.03 0.255 Sleep Onset 0.27 ± 0.27 1.43 ± 2.36 0.42 REM Onset 141.00 ± 115.17 9.60 ± 4.86 0.32 WASO 5.15 ± 1.43 15.08 ± 2.50 0.03* Arousal Index 11.59 ± 1.24 24.93 ± 2.69 0.01* TW:TS 5.85 ± 1.22 18.19 ± 3.35 0.03* Awake, slow-wave sleep (SWS), rapid-eye movement (REM), sleep onset, and rapid-eye movement (REM) onset were normalized to total time and are presented in percentage of time ± SEM. Wake after sleep onset (WASO) is the time awake after the initial sleep bout and is normalized to total time and is presented in percentage of time ± SEM. Arousal index is the number of wake bouts per hour ± SEM. Total awake to total asleep (TW:TS) is the ratio of total awake time to total asleep time ± SEM. WT, wild-type mice; KO, homozygous Btbd9 knockout mice. * p < 0.05, ** p < 0.01.

Table 4-8. Levels of dopamine, serotonin, and their metabolites in the striatum. Neurochemical WT KO p-value Epinephrine 3.62 ± 1.468 3.21 ± 0.53 0.61 Dopamine (DA) 44.05 ± 5.85 41.28 ± 4.53 0.25 Serotonin (5-HT) 1.30 ± 0.04 1.40 ± 0.07 0.5 DOPAC 15.60 ± 0.98 17.12 ± 1.40 0.74 5-HIAA 0.26 ± 0.04 0.47 ± 0.07 0.04 * HVA 20.20 ± 2.21 22.29 ± 1.57 0.8 DOPAC/DA 0.37 ± 0.08 0.43 ± 0.04 0.68 HVA/DA 0.43 ± 0.03 0.56 ± 0.05 0.11 5-HIAA/5-HT 0.20 ± 0.03 0.34 ± 0.06 0.07 The values of neurochemicals represent means ± SEM in pmol/g of tissue. The turnover of metabolites is shown as ratios of neurochemicals. WT, wild-type mice; KO, homozygous Btbd9 knockout mice. * p < 0.05.

CHAPTER 5 PART 3: ENHANCED HIPPOCAMPAL LONG-TERM POTENTIATION AND FEAR MEMORY IN BTBD9 KNOCKOUT MICE

Field Recordings of Btbd9 Knockout Mice

As the hippocampus is involved in learning and memory and extensively studied using electrophysiological techniques, we performed field recordings in hippocampal slices in the CA1 region to determine whether loss of the Btbd9 protein results in alterations in synaptic plasticity and/or neurotransmission. To test for post-synaptic deficits in the homozygous Btbd9 knockout mice, we obtained input-output curves, which measure the post-synaptic potential slope versus varying stimulus intensities.

Homozygous Btbd9 knockout mice showed no change in their input-output relationship at individual stimulus intensity values and no change in the distribution of the curve compared to WT mice (p > 0.05; Figure 5-1A). Next, to examine short-term plasticity in the homozygous Btbd9 knockout mice, we looked at paired-pulse ratios (PPRs), which test the ability of two stimuli separated by varying time intervals to elicit an increased post-synaptic response. PPRs at three different inter-stimulus intervals were significantly enhanced in the homozygous Btbd9 knockout mice compared to WT mice

(p < 0.05; Figure 5-1B). This suggests a decreased probability of synaptic vesicle release from the pre-synaptic terminal in the Btbd9 knockout mice. Next, to examine long-term plasticity in the Btbd9 knockout mice, we examined long-term potentiation

(LTP). We observed a significant enhancement in late CA1 LTP in homozygous Btbd9

Reproduced and adapted with permission from DeAndrade MP, Zhang L, Doroodchi A, Yokoi F, Cheetham CC, Chen HX, Roper SN, Sweatt JD, Li Y (2012b) Enhanced hippocampal long-term potentiation and fear memory in Btbd9 mutant mice. PLoS One 7:e35518.

knockout mice compared to WT mice (p < 0.05; Figure 5-1C). This suggests an enhancement in long-term plasticity in the Btbd9 knockout mice.

Whole-cell Recording of Btbd9 Knockout Mice

To further explore these alterations, we examined miniature excitatory post- synaptic currents (mEPSC) for alterations in amplitude, frequency, and rise and decay times. We found an increased frequency and decreased amplitude of mEPSC events in the homozygous Btbd9 knockout mice compared to WT mice (p < 0.01, Figure 5-2B),

but no alteration in the rise and decay times (p > 0.05, Figure 5-2C). Increased frequency suggests that the number of vesicles released from the presynaptic terminal

at rest is increased. Decreased amplitude suggests that the amount of glutamate per

synaptic vesicle, the post-synaptic response to a single synaptic vesicle, or both, could

be decreased. Additionally, we observed no change in the kinetics of the post-synaptic

receptors, such as opening and closing of their respective channels.

Fear Memory in Btbd9 Knockout Mice

As alterations in hippocampal long-term potentiation are associated with alterations in hippocampal learning and memory, we performed a classical fear conditioning to test both cued fear memory, freezing behavior caused by an auditory stimulus, and contextual fear memory, freezing behavior caused by recall of the environment or context. The homozygous Btbd9 knockout mice exhibited no difference in behavioral response to the shock during the training period (p > 0.05, Figure 5-3A).

Moreover, we observed no difference in the electrical shock required to elicit flinching, jumping, and vocalization behaviors between the homozygous Btbd9 knockout and WT mice (p > 0.05, Figure 5-3B). This suggests that the perception to the electrical shock is not different between homozygous Btbd9 knockout and WT mice. However, we

observed that the homozygous Btbd9 knockout mice had an enhancement of both cued

(p < 0.05, Figure 5-4B) and contextual (p < 0.05, Figure 5-4B) fear memory, indicated

by increased freezing behavior. This suggests that the Btbd9 mutant mice have an

enhancement in learning and memory that correlates with the enhanced LTP.

Analysis of Proteins Involved in Synaptic Transmission in the Btbd9 Knockout Mice

To explore the molecular basis for the pre-synaptic alteration in the Btbd9 mutant mice, we performed western blot analyses to determine the level of several proteins involved in the Soluble NSF Attachment Protein Receptor (SNARE) complex, which are involved in synaptic vesicle docking, fusion, and endocytosis. We first determined the levels of the target-SNAREs syntaxin-1 and SNAP-25 and the vesicular-SNAREs synaptotagmin-1 and synaptobrevin-2. We also examined the levels of endocytosis proteins synaptophysin and dynamin 1. We found no statistical difference in the protein levels of synataxin-1, SNAP-25, synaptobrevin-2, synaptotagmin-1, or synaptophysin, suggesting there is no functional alteration in vesicular docking or fusion events (p >

0.05, Figure 5-5A-E). However, the Btbd9 knockout mice exhibited increased levels of dynamin 1 compared to WT mice (p = 0.05, Figure 5-5F).

Figure 5-1. Hippocampal CA1 electrophysiological field recordings. (A) Homozygous Btbd9 knockout mice showed no differences in input-output relationships. Small inset graph is a representative trace with varying stimulus intensities. (B) Homozygous Btbd9 knockout mice showed enhanced paired-pulse ratios at three inter-stimuli values. Panel above graph are representative traces at the three inter-stimuli values that were significantly different between Btbd9 mutant and WT mice. (C) Homozygous Btbd9 knockout mice showed enhanced late long-term potentiation. Small inset graphs are representative traces, with red signifying before LTP induction and black signifying after LTP induction. Circles represent means ± SEM. * p < 0.05.

Figure 5-2. Hippocampal CA1 electrophysiological whole-cell recordings. (A) Representative traces of mEPSC recording from WT and homozygous Btbd9 knockout mice. (B) Homozygous Btbd9 knockout mice showed an increase in frequency and a decrease in amplitude of mEPSC events compared to WT mice. (C) Homozygous Btbd9 knockout mice showed no difference from WT in rise and decay times of mEPSC events. Bars represent means ± SEM ** p < 0.01.

Figure 5-3. Response to electric shocks. (A) Homozygous Btbd9 knockout mice showed no difference in their threshold to electrical shock in any of three measured behaviors – flinching, jumping, or vocalization. (B) Homozygous Btbd9 knockout mice showed no difference in behavioral response on a rating scale of 1 to 5 to either of the electric shocks during the training phase of the fear conditioning experiment. (C) Homozygous Btbd9 knockout mice showed no difference in freezing behavior in the first 3 minutes of the cued fear conditioning test. Bars represent means ± SEM.

Figure 5-4. Freezing behavior in fear conditioning experiment. (A) Homozygous Btbd9 knockout mice and WT mice were conditioned to two 30-second tones followed by an electric shock, with a shock interval of 120 seconds. Solid black rectangle represents the period of tone. The vertical line at represents the period of the shock. (B) Homozygous Btbd9 knockout mice had increased percentage of freezing behavior in both contextual and cued fear conditioning, suggesting that the homozygous Btbd9 knockout mice had enhanced fear memory. Vertical bars represent means ± SEM. * p < 0.05.

Figure 5-5. Western blot analyses of synaptic proteins from hippocampal synaptosome fractions. Representative Western blot images and quantitative analysis of syntaxin-1 (A), SNAP-25 (B), synaptotagmin-1 (C), synaptobrevin-2 (D), synaptophysin (E), and dynamin 1 (F). Bars represent means ± SEM. * p = 0.05.

CHAPTER 6 CONCLUSION

Rapid-Onset Dystonia-Parkinsonism

Previously, our laboratory and others generated animal models of DYT1 and

DYT11 dystonias (Dang et al., 2005; Sharma et al., 2005; Dang et al., 2006a; Yokoi et al., 2006; Grundmann et al., 2007; Yokoi et al., 2010), and tested for motor deficits,

hyperactivity, and levels of neurotransmitters in the striatum. Therefore, we set forth

characterize the first genotypic model of rapid-onset dystonia-parkinsonism using

Atp1a3 mutant mice.

Similar to human patients, we demonstrated that motor deficits could be triggered

in female heterozygous Atp1a3 knockout mice by stress. Furthermore, we

demonstrated that these motor deficits do not arise from a muscular weakness, in line

with the origins of dystonia being in the central nervous system (Muller et al., 2002).

While previous studies of mouse models of DYT1 and DYT11 dystonias showed similar

decreases in motor performance between WT and mutant mice these mouse models do

not shown a female bias of deficits similar to our results (Dang et al., 2005; Sharma et

al., 2005; Dang et al., 2006a; Yokoi et al., 2006; Grundmann et al., 2007; Yokoi et al.,

2008; Yokoi et al., 2010),. Moreover, investigations to date do not reveal a female bias

in RDP patients. We hypothesize that restraint stress effects females more than males,

which is supported by other studies (Koehl et al., 2006). Therefore, we failed to trigger

motor deficits in male Atp1a3 mutant mice, because they did not receive a strong

enough stressor.

Previously, Brashear and colleagues observed decreased levels of HVA in the

CSF of RDP patients (Brashear et al., 1998a). However, we observed no difference in

dopamine, serotonin, or their metabolites between stressed heterozygous Atp1a3 knockout and WT mice. It is important to note that Brashear and colleagues did not study the level of neurochemicals in the striatum of post-mortem tissue from RDP patients. Therefore, the discrepancy between our results and theirs could be due difference in the site of measurement (CSF versus striatum).

The sensory system in animal models of dystonia is not well studied. However, dystonia patients exhibit alterations in temporal and spatial discrimination and integration of sensory signals (Tinazzi et al., 1999; Sanger et al., 2001; Tinazzi et al.,

2002; Aglioti et al., 2003; Molloy et al., 2003; Tinazzi et al., 2004; Fiorio et al., 2007).

Similarly, stressed female heterozygous Atp1a3 knockout mice exhibited a hyposensitivity in the tail flick test. Investigators hypothesize sensory alterations in

Parkinson’s disease and dystonia arise due to changes in the basal ganglia that disrupts the integration of sensory and motor information (Kaji et al., 2005; Peller et al.,

2006).

Lastly, we conducted a wheel running experiment to measure voluntary activity levels. We hypothesized that mice exhibiting dystonic-like and/or parkinsonian symptoms would have decreased voluntary activity levels, due to the physical discomfort of running. Interestingly, stressed female heterozygous Atp1a3 knockout mice diverged into a hyperactive and a hypoactive group compared to stressed female

WT mice. We hypothesize that these two groups likely represent a behaviorally penetrant group (hypoactive animals) and a behaviorally non-penetrant group

(hyperactive group). We are actively conducting experiments to examine this hypothesis further.

Overall, stressed female Atp1a3 mutant mice model several key behavioral characteristics of RLS (DeAndrade et al., 2011). Therefore, future studies can be developed to understand the pathophysiology underlying RDP dystonia using Atp1a3 mutant mice.

Restless Legs Syndrome

We generated a line of Btbd9 knockout mice to explore its utility as the first

genotypic mouse model of RLS, with clear etiology to RLS (DeAndrade et al., 2012a;

DeAndrade et al., 2012b). As direct application of standard diagnostic methods for RLS

(e.g. IRLSSG rating scale) are not feasible, we thoroughly examined the Btbd9

knockout mice for similar, relevant phenotypes. We found that the Btbd9 knockout mice

exhibited motor restlessness, both in voluntary activity and total activity. Additionally, the

Btbd9 knockout mice displayed hypersensitivity to warm stimuli that was likely limited to

the rest phase. Additionally, the hypersensitivity could be rescued using the common

RLS treatment ropinirole, a D2-like dopaminergic agonist. Furthermore, we observed

decreased sleep time and increased wake time during the rest phase in the

homozygous Btbd9 knockout mice. Lastly, we found elevated levels of iron in the serum

and alterations in the monoamine neurotransmitter system in the homozygous Btbd9

knockout mice. Therefore, these results suggest that the loss of Btbd9 in mice results in

several behavioral and biochemical abnormalities that have particular relevance to RLS,

including motor activity, sensory, and levels of monoamine neurotransmitters. Moreover,

these results taken together suggest that BTBD9 is involved in RLS, and further studies

of the Btbd9 KO mice are warranted to examine its role in RLS pathophysiology.

Next, we analyzed the Btbd9 KO mice for alterations in synaptic plasticity and

neurotransmission in the hippocampus, a brain region critical for learning and memory.

We found that the Btbd9 knockout mice exhibited enhanced hippocampal late long-term

potentiation (LTP). Late LTP, unlike early LTP, is believed to be protein synthesis-

dependent due to its extended time period (Frey et al., 1988; Frey et al., 1996).

Additionally, we observed enhanced cued and contextual fear memory in the Btbd9

knockout mice compared to WT mice. Furthermore, in the electrophysiological

recordings we observed enhanced paired-pulse ratios (PPR), a measure of neural

facilitation, in the Btbd9 knockout mice. PPRs measure the ability of a second impulse

to evoke the further release of synaptic vesicles from the pre-synaptic terminal. PPRs

are on the order of milliseconds and seconds and therefore are a measure of short-term

plasticity. PPRs are associated with an inverse probability of synaptic vesicle release,

where increases in PPRs are indicative of a decreased probability of synaptic vesicle

release and vice versa. Therefore, to determine if there are alterations in synaptic

vesicle release we measured miniature excitatory post-synaptic currents (mEPSCs).

The Btbd9 knockout mice exhibited decreased amplitude and increased frequency of

mEPSC events. Decreased amplitude of mEPSC events suggest a decrease in quantal

size of vesicular glutamate, a decrease in unit post-synaptic response, or both.

Increased frequency of mEPSC events suggests that there is an increase in synaptic

vesicle release at rest, which is opposite to our PPR results would suggest. It is worth

noting that Kavalali and colleagues postulated that evoked responses, such as input-

output relationships, and spontaneous responses, such as mEPSC, may not be directly

compared due to different synaptic mechanisms underlying them (Kavalali et al., 2011).

To determine the molecular mechanisms underlying the observed changes , we

measured the level of proteins that are involved in synaptic transmission and plasticity.

Btbd9 knockout mice exhibited an elevated level of dynamin 1. Dynamin is a GTPase associated with the cleavage of vesicles from the plasma membrane during endocytosis

(Sweitzer and Hinshaw, 1998). Dynamin 1 knockout mice exhibit a decrease in synaptic vesicle recycling, possibly due to an inability of vesicles to be cleaved from the plasma membrane (Ferguson et al., 2007). Additionally, decreases in dynamin 1 levels correlated with the degree of memory impairment in a rat model of Alzheimer’s disease

(Watanabe et al., 2010). Furthermore, treatment of these rats with memantine, a classic

NMDA antagonist used to treat Alzheimer’s disease, resulted in decreased dynamin 1 degradation and increased memory performance (Watanabe et al., 2010).

Recently, Fà and colleagues demonstrated that dynamin 1 knockout mice exhibit reduced LTP, neurotransmitter release, and contextual fear memory (Fa et al., 2014).

This work supports our hypothesis that the alterations in dynamin 1 are integral to the

alterations in synaptic plasticity and neurotransmission in the Btbd9 knockout mice. It is

possible that like other proteins with BTB domains, BTBD9 is involved in ubiquitination,

and one of its targets is dynamin 1. Therefore, loss of BTBD9 results in impaired

dynamin 1 ubiquitination, which causes an increase in dynamin 1 levels. Future work to

understand the function of BTBD9 will need to be conducted.

Of particular relevance, RLS patients have a decrease in pain threshold and

temporal summation of heat pain, which has been hypothesized to be attributed to an

alteration in the processing centers in the nervous system (Edwards et al. 2011).

Furthermore, several studies have suggested that an enhanced synaptic plasticity in

nociceptive pathways can cause heightened pain awareness (Gong et al. 2010; Ito et al.

2001; Nakamura et al. 2010; Ruscheweyh et al. 2011). In particular, nociceptive nerves

can undergo long-term potentiation, which has been suggested as a possible mechanism underlying hyperalgesia (Ikeda et al. 2003). The Btbd9 KO mice had altered short- and LTP and neurotransmission in the hippocampus (DeAndrade et al. 2012b).

While the hippocampus is not traditionally seen as involved in sensory processing, we

hypothesize that similar synaptic alterations may be present in sensory centers, such as

the thalamus or the spinal cord, which in turn can lead to an altered sensory perception

and the odd sensations in RLS patients.

Future Directions

Rapid-onset Dystonia-Parkinsonism

Electromyographic characterization of Atp1a3 mutant mice

To date, no genotypic animal model of any type of dystonia exhibits overt dystonia. This has led to uncertainty over the validity of these mice as models of dystonia. Previously, Chiken and colleagues analyzed a transgenic mouse model overexpressing human DYT1 ΔGAG using a neuron-specific enolase promoter, a model of DYT1 dystonia, for alterations in EMG activity of the forelimb tricep and bicep brachii muscles (Chiken et al., 2008). The transgenic mice exhibited coactivation of these muscles and sustained muscle contractions greater than 10 seconds (Chiken et al.,

2008). However, the authors noted that the findings of their report could be due to other effects besides the overexpression of DYT1 ΔGAG, since their behavioral findings are not consistent with other overexpression models or the knock-in models of DYT1 dystonia. Further complicating the study, the authors utilized mice ranging from 5 to 28 weeks of age, non-littermate controls, and only mice exhibiting severe behavioral deficits (approximately 40% of mutant mice) (Chiken et al., 2008).

Therefore, we examined the EMG traces of Dyt1 ΔGAG knock-in mice, a different model of DYT1 dystonia that mimics the most prevalent mutation observed in patients, and WT mice during the active phase of the mice (ZT 12 to 24). We detected

sustained contractions in all of the Dyt1 ΔGAG KI mice (Figure 6-1B, Table 6-1).

However, none of the WT mice showed sustained contractions (Figure 6-1A, Table 6-1).

Notably, we observed a wide range of sustained contractions in individual Dyt1 ΔGAG

KI mice, which could be attributable to penetrance and severity of the disease.

Furthermore, this suggests that the Dyt1 ΔGAG KI mice do have the hallmark feature of

dystonia, which are sustained contractions. The next step is to conduct EMG analysis of

the heterozygous Atp1a3 knockout mice similar to the Dyt1 ΔGAG mice. We expect to

see similar sustained contractions in these mice.

Generation and characterization of conditional knockout mice

The α subunit (α1, α2, and α3) of the Na+/K+-ATPase has a selective inhibitor,

ouabain, which is a naturally produced steroid hormone. Infusion of oubain into the

cerebellum resulted in dystonic postures, while infusion of oubain into the basal ganglia

resulted in parkinsonism (Calderon et al., 2011). However, it is important to note that

ouabain as a natural steroid hormone has other targets, though to a much lesser degree

than the α subunit, including MAP kinase phosphorylation (Haas et al., 2000),

intracellular calcium signaling cascades (Aizman et al., 2001; Yuan et al., 2005), and

NF-κB (Kawamoto et al., 2012). As signaling pathways in the cell undergo signal

amplification, even very minor alterations in activation of these pathways could result in

unintended and misappropriated phenotypes.

Therefore, selectively knocking out the Atp1a3 gene in certain brain regions

would be a better approach. One method to generate selective knockout uses Cre-loxP

technology. Both Cre and the loxP site are derived from the P1 bacteriophage. Cre is a

member of the λ integrase superfamily, which when expressed will cleave DNA at one

loxP site and ligate it to another cleaved loxP site through a Holliday junction. This will result in a contiguous strand of DNA with absolute fidelity. An advantage of the Cre-loxP system is that no additional proteins or cofactors are necessary for the recombination to occur. Moreover, the cre gene and loxP sequences are not naturally found in the mouse

genome. Using genetic targeting, loxP sites can be inserted around a crucial exon of the

Atp1a3 gene in the preceding and proceeding intronic sequences. Furthermore, these

loxP sites are often inserted in a manner to cause a frame-shift mutation upon Cre

mediated recombination, which will disrupt the transcription of the gene. Atp1a3 loxP mice can then be bred with mice expressing Cre in certain brain regions or cell populations. For instance, our laboratory previously generated the Rgs9L-cre mice, which expresses Cre primarily in medium spiny neurons of the striatum (Dang et al.,

2006b), and Emx1-cre, which limits Cre expression to the cerebral cortex and hippocampus (Guo et al., 2000). Another important Cre line that could potentially be used is the Pcp2-cre line, which expresses Cre in the Purkinje cells of the cerebellum

(Barski et al., 2000). Another method of causing Cre mediated recombination is to inject the gene encoding Cre recombinase using adeno-associated virus into target regions

(Ogasawara et al., 1999; Kaspar et al., 2002). The advantage of this system is that it

can broadly cause Cre recombination in both neuronal and non-neuronal cells of the

region of interest.

Restless Legs Syndrome

Magnetic resonance imaging of Btbd9 KO mice

Research in the 1970s through the 1990s led to the development of magnetic resonance imaging (MRI) and its utilization for in vivo analysis of tissue. This technique uses a strong magnet to align the protons of a desired tissue, e.g. the brain, and then a radio frequency electromagnetic pulse is used to alter this alignment. After the pulse is turned off, the protons will realign to the magnet at different rates depending on the dynamics of that tissue, which can be detected by a receiver. The first paramagnetic ion used to enhance MRI images was manganese (Lauterbur, 1973). Manganese (Mn2+) enters the cell primarily through voltage gated calcium (Ca2+) channels. Therefore, after

a systemic injection of manganese, neurons that are more active will take up more

manganese, whereas neurons that are less active will take up less manganese. We

hypothesized that different brain regions are differentially activated or inactivated in the

Btbd9 knockout mice compared to WT mice. The significance of this study is that it may

lead to an understanding of how different brain regions contribute to the pathogenesis of

RLS.

In collaboration with Dr. Marcelo Febo, we imaged 6 WT mice (2 males, 4

females), 6 Btbd9 knockout mice (2 males, 4 females) 24 hours after injection with

approximately 70 mg of manganese chloride per kilogram of body weight. Additionally,

we imaged 1 WT mouse with no prior injection of manganese as a negative control.

After processing and aligning to a standard mouse atlas, we examined individual brain

regions for activation levels. Overall, we observed a decrease in manganese signal in

the Btbd9 knockout mice compared to WT mice (Figure 6-2). In particular we observed

decreased signal in the hippocampus and the brainstem of Btbd9 knockout mice

(Student’s t-test, p < 0.05, Figure 6-3). Therefore, this suggest there is a decrease in

neuronal activity at baseline in the Btbd9 knockout mice in the hippocampus and

brainstem, which fits our finding of enhanced LTP in the Btbd9 knockout mice. We plan

to conduct additional MRI experiments to elucidate how different brain regions

contribute to RLS.

Electrophysiological characterization of the spinal cord in Btbd9 KO mice

In addition to the hypothesis that RLS originates in the basal ganglia, another

hypothesis suggest that RLS originates in subcortical or spinal regions (Clemens and

Hochman, 2004; Clemens et al., 2006; Trotti et al., 2008; Mahowald et al., 2010;

Zwartbol et al., 2013). Therefore, we investigated Btbd9 knockout mice for alterations at

the spinal cord level. In collaboration with Dr. Stefan Clemens of East Carolina

University, we preliminarily analyzed the Btbd9 knockout mice for alterations in spinal

reflex. Complete spinal cords were isolated from P14 old WT mice (n=4), heterozygous

Btbd9 knockout mice (n=9), Btbd9 homozygous knockout mice (n=2), and baseline

spinal reflex amplitudes were measured according to a previous study (Clemens and

Hochman, 2004). Next, either dopamine or the quinpirole, a D2-like agonist, was

applied to the spinal cords through the bath solution. We observed that when dopamine

(10 μM) was applied, the WT mice responded with an increase in spinal reflex

amplitude, whereas the homozygous Btbd9 knockout mice responded with a decrease

in response (Student’s t-test, p < 0.001, Figure 6-4A). The heterozygous Btbd9

knockout mice had an intermediary phenotype (Student’s t-test, p < 0.001, Figure 6-4A).

Similarly, when quinpirole (10 μM) was applied, the WT mice responded with increased

amplitude (Student’s t-test, p < 0.05, Figure 6-4B), and the homozygous Btbd9 knockout

mice responded with a decrease in response. While this result opens up the possibility

of local spinal cord deficits in the Btbd9 knockout mice, it does not rule out the possibility of long-lasting descending modulation from cortex or other brain regions.

Furthermore, these studies will need to be replicated in a larger sample size for validation purposes.

Generation and characterization of conditional knockout mice

Similar to modeling rapid-onset dystonia-parkinsonism in mice using conditional knockout mice, modeling restless legs syndrome could be benefited by similar studies.

Our laboratory and others have proposed the centrality of the basal ganglia to restless legs syndrome. Using Btbd9 knockout mice we can attempt to answer this. If selectively knocking out the Btbd9 gene in the basal ganglia results in RLS-like phenotypes, this would suggest loss of Btbd9 in that region is important in the development of those phenotypes. The European Mutant Mouse Archive previously generated a line of Btbd9 loxP mice. We imported this line and crossed it with the Rgs9L-cre line of mice to generate striatum-specific Btbd9 conditional knockout mice. As expected, there is

significant reduction of Btbd9 mRNA in the striatum compared to control littermates (p <

0.01, Figure 6-5), but not in the cerebral cortex or cerebellum (data not shown). It is

worth noting that remaining Btbd9 expression in the striatum can be accounted for by

the small subset of neurons (<5%) that do not express Cre, and non-neuronal cells such

as glia. In a preliminary study, we examined 13 Btbd9 loxP-/- (6 males, 7 females) and

19 homozygous striatum-specific Btbd9 conditional knockout mice (7 males, 12

females) for behavior alterations. We observed hyperactivity in the striatum-specific

Btbd9 conditional knockout mice compared to the WT mice in the open field apparatus

(mixed-model ANOVA, p < 0.05, Figure 6-6). Further examination of locomotor and

sensory phenotypes will be necessary.

Common Themes

Disease Perspective

While disparate diseases, several common themes exist between rapid-onset dystonia-parkinsonism and restless legs syndrome. Pathogenesis of both diseases is

hypothesized to involve dysfunction of the dopaminergic system. Additionally, a recent

study demonstrated that 44% of patients with cervical dystonia have impaired sleep

quality, and 19% have restless legs syndrome (Paus et al., 2011). Both diseases may

also encompass some aspect of sensory or nociception dysfunction. In cervical dystonia

patients, the frequency of pain was 68 to 75% (Chan et al., 1991; Jankovic et al., 1991).

In patients with blepharospasm, a type of focal dystonia affecting the muscles of the

eye, an increase in photosensitivity has been reported (Stamelou et al., 2012). Sensory

symptoms have been reported in a number of studies on RLS patients (Stiasny-Kolster

et al., 2004a; Möller et al., 2010; Rizzo et al., 2010; Hornyak et al., 2011; Picchietti et

al., 2011) (Happe and Zeitlhofer, 2003; Bachmann et al., 2010).

Interestingly, a case report of a single patient with restless legs syndrome

associated with generalized dystonia could be treated using deep brain stimulation

(DBS). The symptoms for restless legs syndrome and dystonia were reported to be

clearly distinguishable, and after bilateral DBS of the globus pallidus interna (GPi) there

was resolution of the RLS symptoms (urge to move and uncomfortable sensations) and

the dystonic symptoms (dystonic spasms and associated pain) (Okun et al., 2005). As

both diseases are hyperkinetic disorders, similar alterations could underlie the

pathogenesis, perhaps in the basal ganglia.

Animal Model Perspective

Prior to these studies, no animal model of rapid-onset dystonia-parkinsonism had been reported. Therefore the methods to comprehensively assess a mouse line as a model of the disease had to be developed. We did this by adapting previously established models of other genotypic models of dystonia to the specific needs of rapid- onset dystonia-parkinsonism. Similarly, prior to our studies in restless legs syndrome, no single study comprehensively studied a potential mouse model of RLS. However, several studies have proposed methods to test a mouse model of RLS, but in our opinion were still incomplete, and therefore additional tests were needed. In both animal models, we utilized similar techniques. For instance, in both animal models we used the open field and wheel running tests to measure locomotor activity, and the tail flick test was used to identify sensory alterations to warm stimuli. While neither the Atp1a3 heterozygous knockout mice nor the Btbd9 homozygous knockout mice completely model all aspects of their respective disease, we believe that these animals model certain perspectives of the disease and could be used to elucidate pathophysiology and develop novel therapeutics in future studies.

Figure 6-1. Electromyographic traces of the bicep femoris muscle. (A) Representative trace from a wild-type mouse. (B) Representative trace from a Dyt1 ΔGAG mouse with a sustained contraction. Analysis revealed that sustained contractions were only present in Dyt1 ΔGAG mice, but never observed in wild-type mice.

Figure 6-2. MEMRI scans. We scanned Btbd9 knockout and WT mice an aligned it to a mouse brain atlas. Next, we generated Z score maps of Btbd9 knockout and WT mice, and observed a general decrease in MRI signal in Btbd9 knockout mice.

Figure 6-3. Quantification of MEMRI signals. (A) Normalized signal intensity and (B) volume of MEMRI signals revealed decreased signal in the brainstem and hippocampus of Btbd9 knockout mice compared to WT mice. Bars represent means ± SEM. * p < 0.05, ** p < 0.01.

Figure 6-4. Spinal reflex amplitude in response to dopamine and the D2-like agonist quinpirole. (A) WT mice showed an increase in amplitude in response to dopamine, whereas the homozygous Btbd9 KO mice showed a decrease in response to dopamine. (B) WT mice showed an increase in amplitude in response to quinpirole, whereas the homozygous Btbd9 KO mice showed a decrease in response to quinpirole. Bars represent means ± SEM. * p < 0.05, *** p < 0.001.

Figure 6-5. Quantitative RT-PCR revealed a specific reduction of Btbd9 mRNA in the striatum of the Btbd9 sKO mice. Bars represent means ± SEM. ** p < 0.01.

Figure 6-6. Open field activity. Open field activity showed that the Btbd9 sKO mice are hyperactive compared to Btbd9 loxP control animals. Bars represent means ± SEM. * p < 0.05.

Table 6-1. Sustained contractions in wild-type and Dyt1 KI mice. Protocol 1 Protocol 2 Protocol 3 Animal (5 times baseline) (4 times baseline) (3 times baseline) Wild-type 1 0 0 0 Wild-type 2 0 0 0 Wild-type 3 0 0 0 Knock-in 1 1 4 41 Knock-in 2 5 16 134 Knock-in 3 0 0 23 Numbers represent the number of sustained contractions present in each individual animal. Protocol 1: Sustained contractions are defined as contractions that are 20 μV or greater for at least 10 s with a joint interval of 2 s. Protocol 2: Sustained contractions are defined as contractions that are 16 μV or greater for at least 10 s with a joint interval of 2 s. Protocol 3: Sustained contractions are defined as contractions that are 12 μV or greater for at least 10 s with a joint interval of 2 s.

LIST OF REFERENCES

Abetz L, Allen R, Follet A, Washburn T, Earley C, Kirsch J, Knight H (2004) Evaluating the quality of life of patients with restless legs syndrome. Clin Ther 26:925-935.

Aglioti SM, Fiorio M, Forster B, Tinazzi M (2003) Temporal discrimination of cross- modal and unimodal stimuli in generalized dystonia. Neurology 60:782-785.

Aizman O, Uhlén P, Lal M, Brismar H, Aperia A (2001) Ouabain, a steroid hormone that signals with slow calcium oscillations. Proc Natl Acad Sci U S A 98:13420-13424.

Albanese A, Bhatia K, Bressman SB, Delong MR, Fahn S, Fung VS, Hallett M, Jankovic J, Jinnah HA, Klein C, Lang AE, Mink JW, Teller JK (2013) Phenomenology and classification of dystonia: a consensus update. Mov Disord 28:863-873.

Allen RP, Barker PB, Wehrl F, Song HK, Earley CJ (2001) MRI measurement of brain iron in patients with restless legs syndrome. Neurology 56:263-265.

Allen RP, Ritchie SY (2008) Clinical efficacy of ropinirole for restless legs syndrome is not affected by age at symptom onset. Sleep Med 9:899-902.

Araujo SM, de Bruin VM, Nepomuceno LA, Maximo ML, Daher EeF, Correia Ferrer DP, de Bruin PF (2010) Restless legs syndrome in end-stage renal disease: Clinical characteristics and associated comorbidities. Sleep Med 11:785-790.

Bachmann CG, Rolke R, Scheidt U, Stadelmann C, Sommer M, Pavlakovic G, Happe S, Treede RD, Paulus W (2010) Thermal hypoaesthesia differentiates secondary restless legs syndrome associated with small fibre neuropathy from primary restless legs syndrome. Brain 133:762-770.

Baier PC, Winkelmann J, Höhne A, Lancel M, Trenkwalder C (2002) Assessment of spontaneously occurring periodic limb movements in sleep in the rat. J Neurol Sci 198:71-77.

Barski JJ, Dethleffsen K, Meyer M (2000) Cre recombinase expression in cerebellar Purkinje cells. Genesis 28:93-98.

Ben-Sreti MM, Gonzalez JP, Sewell RD (1983) Differential effects of SKF 38393 and LY 141865 on nociception and morphine analgesia. Life Sci 33 Suppl 1:665-668.

Bhandal N, Russell R (2006) Intravenous versus oral iron therapy for postpartum anaemia. Bjog 113:1248-1252.

Brand S, Beck J, Hatzinger M, Savic M, Holsboer-Trachsler E (2011) Unfavorable polysomnographic sleep patterns predict poor sleep and poor psychological functioning 3 years later in patients with restless legs syndrome. Neuropsychobiology 63:92-102.

100

Brashear A, DeLeon D, Bressman SB, Thyagarajan D, Farlow MR, Dobyns WB (1997) Rapid-onset dystonia-parkinsonism in a second family. Neurology 48:1066-1069.

Brashear A, Butler IJ, Hyland K, Farlow MR, Dobyns WB (1998a) Cerebrospinal fluid homovanillic acid levels in rapid-onset dystonia-parkinsonism. Ann Neurol 43:521-526.

Brashear A, Butler IJ, Ozelius LJ, Kramer PI, Farlow MR, Breakefield XO, Dobyns WB (1998b) Rapid-onset dystonia-parkinsonism: a report of clinical, biochemical, and genetic studies in two families. Adv Neurol 78:335-339.

Brashear A, Mulholland GK, Zheng QH, Farlow MR, Siemers ER, Hutchins GD (1999) PET imaging of the pre-synaptic dopamine uptake sites in rapid-onset dystonia- parkinsonism (RDP). Mov Disord 14:132-137.

Brashear A, Dobyns WB, de Carvalho Aguiar P, Borg M, Frijns CJ, Gollamudi S, Green A, Guimaraes J, Haake BC, Klein C, Linazasoro G, Munchau A, Raymond D, Riley D, Saunders-Pullman R, Tijssen MA, Webb D, Zaremba J, Bressman SB, Ozelius LJ (2007) The phenotypic spectrum of rapid-onset dystonia-parkinsonism (RDP) and mutations in the ATP1A3 gene. Brain 130:828-835.

Brashear A, Ozelius LJ, Sweadner KJ (2014) ATP1A3 mutations: What is the phenotype? Neurology 82:468-469.

Breakefield XO, Blood AJ, Li Y, Hallett M, Hanson PI, Standaert DG (2008) The pathophysiological basis of dystonias. Nat Rev Neurosci 9:222-234.

Budhiraja P, Budhiraja R, Goodwin JL, Allen RP, Newman AB, Koo BB, Quan SF (2012) Incidence of restless legs syndrome and its correlates. J Clin Sleep Med 8:119-124.

Calderon DP, Fremont R, Kraenzlin F, Khodakhah K (2011) The neural substrates of rapid-onset Dystonia-Parkinsonism. Nat Neurosci 14:357-365.

Cannon SC (2006) Pathomechanisms in channelopathies of skeletal muscle and brain. Annu Rev Neurosci 29:387-415.

Cao BJ, Li Y (2002) Reduced anxiety-- and depression-like behaviors in Emx1 homozygous mutant mice. Brain Res 937:32-40.

Capecchi MR (1994) Targeted gene replacement. Sci Am 270:52-59.

Carter RJ, Lione LA, Humby T, Mangiarini L, Mahal A, Bates GP, Dunnett SB, Morton AJ (1999) Characterization of progressive motor deficits in mice transgenic for the human Huntington's disease mutation. J Neurosci 19:3248-3257.

Carter RJ, Morton, A.J., and Dunnett, S.B. (2001) Locomotor Behavior. In: Current Protocols in Neuroscience (Crawley J, ed). Canada: Wiley.

101

Chan J, Brin MF, Fahn S (1991) Idiopathic cervical dystonia: clinical characteristics. Mov Disord 6:119-126.

Chiken S, Shashidharan P, Nambu A (2008) Cortically evoked long-lasting inhibition of pallidal neurons in a transgenic mouse model of dystonia. J Neurosci 28:13967- 13977.

Ciarleglio CM, Gamble KL, Axley JC, Strauss BR, Cohen JY, Colwell CS, McMahon DG (2009) Population encoding by circadian clock neurons organizes circadian behavior. J Neurosci 29:1670-1676.

Clapcote SJ, Duffy S, Xie G, Kirshenbaum G, Bechard AR, Rodacker Schack V, Petersen J, Sinai L, Saab BJ, Lerch JP, Minassian BA, Ackerley CA, Sled JG, Cortez MA, Henderson JT, Vilsen B, Roder JC (2009) Mutation I810N in the alpha3 isoform of Na+,K+-ATPase causes impairments in the sodium pump and hyperexcitability in the CNS. Proc Natl Acad Sci U S A 106:14085-14090.

Clemens S, Hochman S (2004) Conversion of the modulatory actions of dopamine on spinal reflexes from depression to facilitation in D3 receptor knock-out mice. J Neurosci 24:11337-11345.

Clemens S, Rye D, Hochman S (2006) Restless legs syndrome: revisiting the dopamine hypothesis from the spinal cord perspective. Neurology 67:125-130.

Connor JR (2008) Pathophysiology of restless legs syndrome: evidence for iron involvement. Curr Neurol Neurosci Rep 8:162-166.

Cortese S, Konofal E, Lecendreux M, Arnulf I, Mouren MC, Darra F, Dalla Bernardina B (2005) Restless legs syndrome and attention-deficit/hyperactivity disorder: a review of the literature. Sleep 28:1007-1013.

Dang MT, Yokoi F, McNaught KS, Jengelley TA, Jackson T, Li J, Li Y (2005) Generation and characterization of Dyt1 DeltaGAG knock-in mouse as a model for early-onset dystonia. Exp Neurol 196:452-463.

Dang MT, Yokoi F, Pence MA, Li Y (2006a) Motor deficits and hyperactivity in Dyt1 knockdown mice. Neurosci Res 56:470-474.

Dang MT, Yokoi F, Yin HH, Lovinger DM, Wang Y, Li Y (2006b) Disrupted motor learning and long-term synaptic plasticity in mice lacking NMDAR1 in the striatum. Proc Natl Acad Sci U S A 103:15254-15259.

Dang MT, Yokoi F, Cheetham CC, Lu J, Vo V, Lovinger DM, Li Y (2012) An anticholinergic reverses motor control and corticostriatal LTD deficits in Dyt1 ΔGAG knock-in mice. Behav Brain Res 226:465-472.

102

de Carvalho Aguiar P, Sweadner KJ, Penniston JT, Zaremba J, Liu L, Caton M, Linazasoro G, Borg M, Tijssen MA, Bressman SB, Dobyns WB, Brashear A, Ozelius LJ (2004) Mutations in the Na+/K+ -ATPase alpha3 gene ATP1A3 are associated with rapid-onset dystonia parkinsonism. Neuron 43:169-175.

DeAndrade MP, Yokoi F, van Groen T, Lingrel JB, Li Y (2011) Characterization of Atp1a3 mutant mice as a model of rapid-onset dystonia with parkinsonism. Behav Brain Res 216:659-665.

DeAndrade MP, Johnson RL, Unger EL, Zhang L, van Groen T, Gamble KL, Li Y (2012a) Motor restlessness, sleep disturbances, thermal sensory alterations and elevated serum iron levels in Btbd9 mutant mice. Hum Mol Genet 21:3984-3992.

DeAndrade MP, Zhang L, Doroodchi A, Yokoi F, Cheetham CC, Chen HX, Roper SN, Sweatt JD, Li Y (2012b) Enhanced hippocampal long-term potentiation and fear memory in Btbd9 mutant mice. PLoS One 7:e35518.

Dobretsov M, Stimers JR (2005) Neuronal function and alpha3 isoform of the Na/K- ATPase. Front Biosci 10:2373-2396.

Dobyns WB, Ozelius LJ, Kramer PL, Brashear A, Farlow MR, Perry TR, Walsh LE, Kasarskis EJ, Butler IJ, Breakefield XO (1993) Rapid-onset dystonia- parkinsonism. Neurology 43:2596-2602.

Earley CJ, Connor JR, Beard JL, Malecki EA, Epstein DK, Allen RP (2000) Abnormalities in CSF concentrations of ferritin and transferrin in restless legs syndrome. Neurology 54:1698-1700.

Earley CJ, Hyland K, Allen RP (2001) CSF dopamine, serotonin, and biopterin metabolites in patients with restless legs syndrome. Mov Disord 16:144-149.

Earley CJ, Heckler D, Allen RP (2005) Repeated IV doses of iron provides effective supplemental treatment of restless legs syndrome. Sleep Med 6:301-305.

Earley CJ, Hyland K, Allen RP (2006) Circadian changes in CSF dopaminergic measures in restless legs syndrome. Sleep Med 7:263-268.

Earley CJ, Allen RP, Connor JR, Ferrucci L, Troncoso J (2009) The dopaminergic neurons of the A11 system in RLS autopsy brains appear normal. Sleep Med 10:1155-1157.

Earley CJ, Kuwabara H, Wong DF, Gamaldo C, Salas RE, Brašić JR, Ravert HT, Dannals RF, Allen RP (2013) Increased synaptic dopamine in the putamen in restless legs syndrome. Sleep 36:51-57.

Edwards RR, Quartana PJ, Allen RP, Greenbaum S, Earley CJ, Smith MT (2011) Alterations in pain responses in treated and untreated patients with restless legs syndrome: Associations with sleep disruption. In: Sleep Med, pp 603-609.

103

Erikson KM, Jones BC, Hess EJ, Zhang Q, Beard JL (2001) Iron deficiency decreases dopamine D1 and D2 receptors in rat brain. Pharmacol Biochem Behav 69:409- 418.

Esteves AM, de Mello MT, Lancellotti CL, Natal CL, Tufik S (2004) Occurrence of limb movement during sleep in rats with spinal cord injury. Brain Res 1017:32-38.

Fa M, Staniszewski A, Saeed F, Francis YI, Arancio O (2014) Dynamin 1 is required for memory formation. PLoS One 9:e91954.

Ferguson SM, Brasnjo G, Hayashi M, Wolfel M, Collesi C, Giovedi S, Raimondi A, Gong LW, Ariel P, Paradise S, O'Toole E, Flavell R, Cremona O, Miesenbock G, Ryan TA, De Camilli P (2007) A selective activity-dependent requirement for dynamin 1 in synaptic vesicle endocytosis. In: Science, pp 570-574. United States.

Fiorio M, Gambarin M, Valente EM, Liberini P, Loi M, Cossu G, Moretto G, Bhatia KP, Defazio G, Aglioti SM, Fiaschi A, Tinazzi M (2007) Defective temporal processing of sensory stimuli in DYT1 mutation carriers: a new endophenotype of dystonia? Brain 130:134-142.

Flicek P et al. (2008) Ensembl 2008. In: Nucleic Acids Res, pp D707-714. England.

Frey U, Krug M, Reymann KG, Matthies H (1988) Anisomycin, an inhibitor of protein synthesis, blocks late phases of LTP phenomena in the hippocampal CA1 region in vitro. Brain Res 452:57-65.

Frey U, Frey S, Schollmeier F, Krug M (1996) Influence of actinomycin D, a RNA synthesis inhibitor, on long-term potentiation in rat hippocampal neurons in vivo and in vitro. J Physiol 490 ( Pt 3):703-711.

Gamble KL, Allen GC, Zhou T, McMahon DG (2007) Gastrin-releasing peptide mediates light-like resetting of the suprachiasmatic nucleus circadian pacemaker through cAMP response element-binding protein and Per1 activation. J Neurosci 27:12078-12087.

Gao X, Zhang YQ, Wu GC (2000) Effects of dopaminergic agents on carrageenan hyperalgesia in rats. European Journal of Pharmacology 406:53-58.

Gong QJ, Li YY, Xin WJ, Wei XH, Cui Y, Wang J, Liu Y, Liu CC, Liu XG (2010) Differential effects of adenosine A1 receptor on pain-related behavior in normal and nerve-injured rats. In: Brain Res, pp 23-30.

Grimm D (2006) Mouse genetics. A mouse for every gene. In: Science, pp 1862-1866. United States.

104

Grundmann K, Reischmann B, Vanhoutte G, Hubener J, Teismann P, Hauser TK, Bonin M, Wilbertz J, Horn S, Nguyen HP, Kuhn M, Chanarat S, Wolburg H, Van der Linden A, Riess O (2007) Overexpression of human wildtype torsinA and human DeltaGAG torsinA in a transgenic mouse model causes phenotypic abnormalities. Neurobiol Dis 27:190-206.

Guo H, Hong S, Jin XL, Chen RS, Avasthi PP, Tu YT, Ivanco TL, Li Y (2000) Specificity and efficiency of Cre-mediated recombination in Emx1-Cre knock-in mice. Biochem Biophys Res Commun 273:661-665.

Haas M, Askari A, Xie Z (2000) Involvement of Src and epidermal growth factor receptor in the signal-transducing function of Na+/K+-ATPase. J Biol Chem 275:27832- 27837.

Haba-Rubio J, Staner L, Petiau C, Erb G, Schunck T, Macher JP (2005) Restless legs syndrome and low brain iron levels in patients with haemochromatosis. J Neurol Neurosurg Psychiatry 76:1009-1010.

Hall B, Limaye A, Kulkarni AB (2009) Overview: generation of gene knockout mice. Curr Protoc Cell Biol Chapter 19:Unit 19.12 19.12.11-17.

Hallett PJ, Collins TL, Standaert DG, Dunah AW (2008) Biochemical fractionation of brain tissue for studies of receptor distribution and trafficking. Curr Protoc Neurosci Chapter 1:Unit 1.16.

Happe S, Zeitlhofer J (2003) Abnormal cutaneous thermal thresholds in patients with restless legs syndrome. J Neurol 250:362-365.

Heinzen EL et al. (2012) De novo mutations in ATP1A3 cause alternating hemiplegia of childhood. Nat Genet 44:1030-1034.

Holstege JC, Van Dijken H, Buijs RM, Goedknegt H, Gosens T, Bongers CM (1996) Distribution of dopamine immunoreactivity in the rat, cat and monkey spinal cord. J Comp Neurol 376:631-652.

Hore SK, Dumka VK, Kumar D, Tripathi HC, Tandan SK (1997) Central noradrenergic & dopaminergic modulation of Brewer's yeast-induced inflammation & nociception in rats. Indian Journal of Medical Research 105:93-97.

Hornyak M, Sohr M, Busse M, Groups aS (2011) Evaluation of painful sensory symptoms in restless legs syndrome: experience from two clinical trials. Sleep Med 12:186-189.

Ikeda H, Heinke B, Ruscheweyh R, Sandkuhler J (2003) Synaptic plasticity in spinal lamina I projection neurons that mediate hyperalgesia. In: Science, pp 1237- 1240.

105

Ishii A, Saito Y, Mitsui J, Ishiura H, Yoshimura J, Arai H, Yamashita S, Kimura S, Oguni H, Morishita S, Tsuji S, Sasaki M, Hirose S (2013) Identification of ATP1A3 mutations by exome sequencing as the cause of alternating hemiplegia of childhood in Japanese patients. PLoS One 8:e56120.

Ito Y, Tabata K, Makimura M, Fukuda H (2001) Acute and chronic intracerebroventricular morphine infusions affect long-term potentiation differently in the lateral perforant path. Pharmacol Biochem Behav 70:353-358.

Jankovic J, Leder S, Warner D, Schwartz K (1991) Cervical dystonia: clinical findings and associated movement disorders. Neurology 41:1088-1091.

Jankovic J (2008) Parkinson's disease: clinical features and diagnosis. J Neurol Neurosurg Psychiatry 79:368-376.

Kaji R, Urushihara R, Murase N, Shimazu H, Goto S (2005) Abnormal sensory gating in basal ganglia disorders. J Neurol 252 Suppl 4:IV13-IV16.

Kamm C, Boston H, Hewett J, Wilbur J, Corey DP, Hanson PI, Ramesh V, Breakefield XO (2004) The early onset dystonia protein torsinA interacts with kinesin light chain 1. J Biol Chem 279:19882-19892.

Kaspar BK, Vissel B, Bengoechea T, Crone S, Randolph-Moore L, Muller R, Brandon EP, Schaffer D, Verma IM, Lee KF, Heinemann SF, Gage FH (2002) Adeno- associated virus effectively mediates conditional gene modification in the brain. Proc Natl Acad Sci U S A 99:2320-2325.

Kavalali ET, Chung C, Khvotchev M, Leitz J, Nosyreva E, Raingo J, Ramirez DM (2011) Spontaneous neurotransmission: an independent pathway for neuronal signaling? Physiology (Bethesda) 26:45-53.

Kawamoto EM, Lima LS, Munhoz CD, Yshii LM, Kinoshita PF, Amara FG, Pestana RR, Orellana AM, Cipolla-Neto J, Britto LR, Avellar MC, Rossoni LV, Scavone C (2012) Influence of N-methyl-D-aspartate receptors on ouabain activation of nuclear factor-κB in the rat hippocampus. J Neurosci Res 90:213-228.

Kerr S, McKinon W, Bentley A (2012) Descriptors of restless legs syndrome sensations. Sleep Med 13:409-413.

Kim DS, Szczypka MS, Palmiter RD (2000) Dopamine-deficient mice are hypersensitive to dopamine receptor agonists. J Neurosci 20:4405-4413.

Kim KW, Jhoo JH, Lee SB, Lee SD, Kim TH, Kim SE, Kim YK, Yoon IY (2012) Increased striatal dopamine transporter density in moderately severe old restless legs syndrome patients. Eur J Neurol 19:1213-1218.

Koehl M, Battle S, Meerlo P (2006) Sex differences in sleep: the response to sleep deprivation and restraint stress in mice. Sleep 29:1224-1231.

106

Lauterbur P (1973) Image Formation by Induced Local Interactions: Examples Employing Nuclear Magnetic Resonance. Nature 242:190-191.

Lazzarini A, Walters AS, Hickey K, Coccagna G, Lugaresi E, Ehrenberg BL, Picchietti DL, Brin MF, Stenroos ES, Verrico T, Johnson WG (1999) Studies of penetrance and anticipation in five autosomal-dominant restless legs syndrome pedigrees. Mov Disord 14:111-116.

Lein ES et al. (2007) Genome-wide atlas of gene expression in the adult mouse brain. In: Nature, pp 168-176. England.

Levenson JM, O'Riordan KJ, Brown KD, Trinh MA, Molfese DL, Sweatt JD (2004) Regulation of histone acetylation during memory formation in the hippocampus. In: J Biol Chem, pp 40545-40559. United States: 2004 American Society for Biochemistry and Molecular Biology, Inc.

LeWitt PA, Galloway MP, Matson W, Milbury P, McDermott M, Srivastava DK, Oakes D (1992) Markers of dopamine metabolism in Parkinson's disease. The Parkinson Study Group. Neurology 42:2111-2117.

Linazasoro G, Indakoetxea B, Ruiz J, Van Blercom N, Lasa A (2002) Possible sporadic rapid-onset dystonia-parkinsonism. Mov Disord 17:608-609.

Lindsey JW, Jung AE, Narayanan TK, Ritchie GD (1998) Acute effects of a bicyclophosphate neuroconvulsant on monoamine neurotransmitter and metabolite levels in the rat brain. J Toxicol Environ Health A 54:421-429.

Lingrel JB, Kuntzweiler T (1994) Na+,K(+)-ATPase. J Biol Chem 269:19659-19662.

Lingrel JB, Williams MT, Vorhees CV, Moseley AE (2007) Na,K-ATPase and the role of alpha isoforms in behavior. J Bioenerg Biomembr 39:385-389.

Linke R, Eisensehr I, Wetter TC, Gildehaus FJ, Pöpperl G, Trenkwalder C, Noachtar S, Tatsch K (2004) Presynaptic dopaminergic function in patients with restless legs syndrome: are there common features with early Parkinson's disease? Mov Disord 19:1158-1162.

Lohmann K, Klein C (2013) Genetics of dystonia: what's known? What's new? What's next? Mov Disord 28:899-905.

Lopes C, Esteves AM, Frussa-Filho R, Tufik S, de Mello MT (2012) Evaluation of periodic limb movements in a putative animal model of restless leg syndrome. Mov Disord 27:413-420.

Luo F, Li C, Ondo WG, Xu P, Xie W, Le W (2011) The long-term effects of the dopamine agonist pramipexole in a proposed restless legs syndrome animal model. Sleep Med 12:41-46.

107

Mahowald MW, Cramer Bornemann MA, Schenck CH (2010) A case of reversible restless legs syndrome (RLS) and sleep-related eating disorder relapse triggered by acute right leg herpes zoster infection: literature review of spinal cord and peripheral nervous system contributions to RLS. Sleep Med 11:583-585.

Manconi M, Ferri R, Zucconi M, Oldani A, Fantini ML, Castronovo V, Ferini-Strambi L (2007) First night efficacy of pramipexole in restless legs syndrome and periodic leg movements. Sleep Med 8:491-497.

Mansour SL, Thomas KR, Capecchi MR (1988) Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes. Nature 336:348-352.

Michaud M, Soucy JP, Chabli A, Lavigne G, Montplaisir J (2002) SPECT imaging of striatal pre- and postsynaptic dopaminergic status in restless legs syndrome with periodic leg movements in sleep. J Neurol 249:164-170.

Ming X, Walters AS (2009) Autism spectrum disorders, attention deficit/hyperactivity disorder, and sleep disorders. Curr Opin Pulm Med.

Mizuno S, Mihara T, Miyaoka T, Inagaki T, Horiguchi J (2005) CSF iron, ferritin and transferrin levels in restless legs syndrome. J Sleep Res 14:43-47.

Molloy FM, Carr TD, Zeuner KE, Dambrosia JM, Hallett M (2003) Abnormalities of spatial discrimination in focal and generalized dystonia. Brain 126:2175-2182.

Montplaisir J, Boucher S, Poirier G, Lavigne G, Lapierre O, Lespérance P (1997) Clinical, polysomnographic, and genetic characteristics of restless legs syndrome: a study of 133 patients diagnosed with new standard criteria. Mov Disord 12:61-65.

Moseley AE, Williams MT, Schaefer TL, Bohanan CS, Neumann JC, Behbehani MM, Vorhees CV, Lingrel JB (2007) Deficiency in Na,K-ATPase alpha isoform genes alters spatial learning, motor activity, and anxiety in mice. J Neurosci 27:616-626.

Muller B, Hedrich K, Kock N, Dragasevic N, Svetel M, Garrels J, Landt O, Nitschke M, Pramstaller PP, Reik W, Schwinger E, Sperner J, Ozelius L, Kostic V, Klein C (2002) Evidence that paternal expression of the epsilon-sarcoglycan gene accounts for reduced penetrance in myoclonus-dystonia. Am J Hum Genet 71:1303-1311.

Möller C, Wetter TC, Köster J, Stiasny-Kolster K (2010) Differential diagnosis of unpleasant sensations in the legs: prevalence of restless legs syndrome in a primary care population. Sleep Med 11:161-166.

Nakamura H, Katayama Y, Kawakami Y (2010) Hippocampal CA1/subiculum-prefrontal cortical pathways induce plastic changes of nociceptive responses in cingulate and prelimbic areas. In: BMC Neurosci, p 100.

108

Ogasawara Y, Mizukami H, Urabe M, Kume A, Kanegae Y, Saito I, Monahan J, Ozawa K (1999) Highly regulated expression of adeno-associated virus large Rep proteins in stable 293 cell lines using the Cre/loxP switching system. J Gen Virol 80 ( Pt 9):2477-2480.

Okun MS, Fernandez HH, Foote KD (2005) Deep brain stimulation of the GPi treats restless legs syndrome associated with dystonia. Mov Disord 20:500-501.

Ondo WG, He Y, Rajasekaran S, Le WD (2000a) Clinical correlates of 6- hydroxydopamine injections into A11 dopaminergic neurons in rats: a possible model for restless legs syndrome. Mov Disord 15:154-158.

Ondo WG, Vuong KD, Wang Q (2000b) Restless legs syndrome in monozygotic twins: clinical correlates. Neurology 55:1404-1406.

Ozelius LJ (2012) Clinical spectrum of disease associated with ATP1A3 mutations. In: Lancet Neurol, pp 741-743. England.

Paus S, Gross J, Moll-Müller M, Hentschel F, Spottke A, Wabbels B, Klockgether T, Abele M (2011) Impaired sleep quality and restless legs syndrome in idiopathic focal dystonia: a controlled study. J Neurol 258:1835-1840.

Peeraully T, Tan EK (2012) Linking restless legs syndrome with Parkinson's disease: clinical, imaging and genetic evidence. Transl Neurodegener 1:6.

Peller M, Zeuner KE, Munchau A, Quartarone A, Weiss M, Knutzen A, Hallett M, Deuschl G, Siebner HR (2006) The basal ganglia are hyperactive during the discrimination of tactile stimuli in writer's cramp. Brain 129:2697-2708.

Picchietti DL, Arbuckle RA, Abetz L, Durmer JS, Ivanenko A, Owens JA, Croenlein J, Allen RP, Walters AS (2011) Pediatric restless legs syndrome: analysis of symptom descriptions and drawings. J Child Neurol 26:1365-1376.

Pittock SJ, Joyce C, O'Keane V, Hugle B, Hardiman MO, Brett F, Green AJ, Barton DE, King MD, Webb DW (2000) Rapid-onset dystonia-parkinsonism: a clinical and genetic analysis of a new kindred. Neurology 55:991-995.

Piñero DJ, Li NQ, Connor JR, Beard JL (2000) Variations in dietary iron alter brain iron metabolism in developing rats. J Nutr 130:254-263.

Polter A, Beurel E, Yang S, Garner R, Song L, Miller CA, Sweatt JD, McMahon L, Bartolucci AA, Li X, Jope RS (2010) Deficiency in the inhibitory serine- phosphorylation of glycogen synthase kinase-3 increases sensitivity to mood disturbances. Neuropsychopharmacology 35:1761-1774.

Qu S, Le W, Zhang X, Xie W, Zhang A, Ondo WG (2007) Locomotion is increased in a11-lesioned mice with iron deprivation: a possible animal model for restless legs syndrome. J Neuropathol Exp Neurol 66:383-388.

109

Quinn C, Uzbeck M, Saleem I, Cotter P, Ali J, O'Malley G, Gilmartin JJ, O'Keeffe ST (2011) Iron status and chronic kidney disease predict restless legs syndrome in an older hospital population. Sleep Med 12:295-301.

Rizzo V, Aricò I, Liotta G, Ricciardi L, Mastroeni C, Morgante F, Allegra R, Condurso R, Girlanda P, Silvestri R, Quartarone A (2010) Impairment of sensory-motor integration in patients affected by RLS. J Neurol 257:1979-1985.

Rooney KF, Sewell RD (1989) Evaluation of selective actions of dopamine D-1 and D-2 receptor agonists and antagonists on opioid antinociception. Eur J Pharmacol 168:329-336.

Rosewich H, Thiele H, Ohlenbusch A, Maschke U, Altmuller J, Frommolt P, Zirn B, Ebinger F, Siemes H, Nurnberg P, Brockmann K, Gartner J (2012) Heterozygous de-novo mutations in ATP1A3 in patients with alternating hemiplegia of childhood: a whole-exome sequencing gene-identification study. Lancet Neurol 11:764-773.

Ruottinen HM, Partinen M, Hublin C, Bergman J, Haaparanta M, Solin O, Rinne JO (2000) An FDOPA PET study in patients with periodic limb movement disorder and restless legs syndrome. Neurology 54:502-504.

Ruscheweyh R, Wilder-Smith O, Drdla R, Liu XG, Sandkuhler J (2011) Long-term potentiation in spinal nociceptive pathways as a novel target for pain therapy. In: Mol Pain, p 20. England.

Sanger TD, Tarsy D, Pascual-Leone A (2001) Abnormalities of spatial and temporal sensory discrimination in writer's cramp. Mov Disord 16:94-99.

Sasaki M, Ishii A, Saito Y, Hirose S (2014a) Intermediate form between alternating hemiplegia of childhood and rapid-onset dystonia-parkinsonism. Mov Disord 29:153-154.

Sasaki M et al. (2014b) Genotype-phenotype correlations in alternating hemiplegia of childhood. Neurology.

Schlesinger I, Erikh I, Avizohar O, Sprecher E, Yarnitsky D (2009) Cardiovascular risk factors in restless legs syndrome. Mov Disord 24:1587-1592.

Scholz H, Benes H, Happe S, Bengel J, Kohnen R, Hornyak M (2011) Psychological distress of patients suffering from restless legs syndrome: a cross-sectional study. Health Qual Life Outcomes 9:73.

Schwartzberg PL, Goff SP, Robertson EJ (1989) Germ-line transmission of a c-abl mutation produced by targeted gene disruption in ES cells. Science 246:799-803.

110

Shalin SC, Hernandez CM, Dougherty MK, Morrison DK, Sweatt JD (2006) Kinase suppressor of Ras1 compartmentalizes hippocampal signal transduction and subserves synaptic plasticity and memory formation. Neuron 50:765-779.

Sharma N, Baxter MG, Petravicz J, Bragg DC, Schienda A, Standaert DG, Breakefield XO (2005) Impaired motor learning in mice expressing torsinA with the DYT1 dystonia mutation. J Neurosci 25:5351-5355.

Shashidharan P, Sandu D, Potla U, Armata IA, Walker RH, McNaught KS, Weisz D, Sreenath T, Brin MF, Olanow CW (2005) Transgenic mouse model of early-onset DYT1 dystonia. Hum Mol Genet 14:125-133.

Staedt J, Wassmuth F, Ziemann U, Hajak G, Rüther E, Stoppe G (1997) Pergolide: treatment of choice in restless legs syndrome (RLS) and nocturnal myoclonus syndrome (NMS). A double-blind randomized crossover trial of pergolide versus L-Dopa. J Neural Transm 104:461-468.

Stamelou M, Edwards MJ, Hallett M, Bhatia KP (2012) The non-motor syndrome of primary dystonia: clinical and pathophysiological implications. Brain 135:1668- 1681.

Stefansson H et al. (2007) A genetic risk factor for periodic limb movements in sleep. N Engl J Med 357:639-647.

Stiasny-Kolster K, Magerl W, Oertel WH, Möller JC, Treede RD (2004a) Static mechanical hyperalgesia without dynamic tactile allodynia in patients with restless legs syndrome. Brain 127:773-782.

Stiasny-Kolster K, Möller JC, Zschocke J, Bandmann O, Cassel W, Oertel WH, Hoffmann GF (2004b) Normal dopaminergic and serotonergic metabolites in cerebrospinal fluid and blood of restless legs syndrome patients. Mov Disord 19:192-196.

Svetel M, Ozelius LJ, Buckley A, Lohmann K, Brajkovic L, Klein C, Kostic VS (2010) Rapid-onset dystonia-parkinsonism: case report. J Neurol 257:472-474.

Sweitzer SM, Hinshaw JE (1998) Dynamin undergoes a GTP-dependent conformational change causing vesiculation. Cell 93:1021-1029.

Tinazzi M, Frasson E, Bertolasi L, Fiaschi A, Aglioti S (1999) Temporal discrimination of somesthetic stimuli is impaired in dystonic patients. Neuroreport 10:1547-1550.

Tinazzi M, Rosso T, Fiaschi A, Gambina G, Farina S, Fiorio SM, Aglioti SM (2002) The role of somatosensory feedback in dystonia: a psychophysical [correction of psycophysical] evaluation. Neurol Sci 23 Suppl 2:S113-114.

Tinazzi M, Fiorio M, Bertolasi L, Aglioti SM (2004) Timing of tactile and visuo-tactile events is impaired in patients with cervical dystonia. J Neurol 251:85-90.

111

Trenkwalder C, Seidel VC, Gasser T, Oertel WH (1996) Clinical symptoms and possible anticipation in a large kindred of familial restless legs syndrome. Mov Disord 11:389-394.

Trenkwalder C, Paulus W, Walters AS (2005) The restless legs syndrome. Lancet Neurol 4:465-475.

Trotti L, Bhadriraju S, Rye D (2008) An update on the pathophysiology and genetics of restless legs syndrome. Curr Neurol Neurosci Rep 8:281-287.

Turjanski N, Lees AJ, Brooks DJ (1999) Striatal dopaminergic function in restless legs syndrome: 18F-dopa and 11C-raclopride PET studies. Neurology 52:932-937.

Tzonova D, Larrosa O, Calvo E, Granizo JJ, Williams AM, de la Llave Y, García- Borreguero D (2012) Breakthrough symptoms during the daytime in patients with restless legs syndrome (Willis-Ekbom disease). Sleep Med 13:151-155.

Verma A, Kulkarni SK (1993) Modulatory role of D-1 and D-2 dopamine receptor subtypes in nociception in mice. J Psychopharmacol 7:270-275.

Viggiano D, Ruocco LA, Sadile AG (2003) Dopamine phenotype and behaviour in animal models: in relation to attention deficit hyperactivity disorder. Neurosci Biobehav Rev 27:623-637.

Walters AS (1995) Toward a better definition of the restless legs syndrome. The International Restless Legs Syndrome Study Group. Mov Disord 10:634-642.

Walters AS, Hickey K, Maltzman J, Verrico T, Joseph D, Hening W, Wilson V, Chokroverty S (1996) A questionnaire study of 138 patients with restless legs syndrome: the 'Night-Walkers' survey. Neurology 46:92-95.

Watanabe T, Iwasaki K, Takasaki K, Yamagata N, Fujino M, Nogami A, Ii M, Katsurabayashi S, Mishima K, Fujiwara M (2010) Dynamin 1 depletion and memory deficits in rats treated with Abeta and cerebral ischemia. J Neurosci Res 88:1908-1917.

White JK et al. (2013) Genome-wide generation and systematic phenotyping of knockout mice reveals new roles for many genes. Cell 154:452-464.

Winkelmann J, Muller-Myhsok B, Wittchen HU, Hock B, Prager M, Pfister H, Strohle A, Eisensehr I, Dichgans M, Gasser T, Trenkwalder C (2002) Complex segregation analysis of restless legs syndrome provides evidence for an autosomal dominant mode of inheritance in early age at onset families. Ann Neurol 52:297-302.

Winkelmann J et al. (2007) Genome-wide association study of restless legs syndrome identifies common variants in three genomic regions. Nat Genet 39:1000-1006.

112

Yngman-Uhlin P, Johansson A, Fernström A, Börjeson S, Edéll-Gustafsson U (2011) Fragmented sleep: an unrevealed problem in peritoneal dialysis patients. Scand J Urol Nephrol 45:206-215.

Yokoi F, Dang MT, Li J, Li Y (2006) Myoclonus, motor deficits, alterations in emotional responses and monoamine metabolism in epsilon-sarcoglycan deficient mice. J Biochem (Tokyo) 140:141-146.

Yokoi F, Dang MT, Mitsui S, Li J, Li Y (2008) Motor Deficits and Hyperactivity in Cerebral Cortex-specific Dyt1 Conditional Knockout Mice. J Biochem 143:39-47.

Yokoi F, Dang MT, Miller CA, Marshall AG, Campbell SL, Sweatt JD, Li Y (2009) Increased c-fos expression in the central nucleus of the amygdala and enhancement of cued fear memory in Dyt1 DeltaGAG knock-in mice. Neurosci Res 65:228-235.

Yokoi F, Yang G, Li J, DeAndrade MP, Zhou T, Li Y (2010) Earlier onset of motor deficits in mice with double mutations in Dyt1 and Sgce. J Biochem 148:459-466.

Yokoi F, Dang MT, Zhou T, Li Y (2012) Abnormal nuclear envelopes in the striatum and motor deficits in DYT11 myoclonus-dystonia mouse models. Hum Mol Genet 21:916-925.

Yuan Z, Cai T, Tian J, Ivanov AV, Giovannucci DR, Xie Z (2005) Na/K-ATPase tethers phospholipase C and IP3 receptor into a calcium-regulatory complex. Mol Biol Cell 16:4034-4045.

Zanotti-Fregonara P, Vidailhet M, Kas A, Ozelius LJ, Clot F, Hindie E, Ravasi L, Devaux JY, Roze E (2008) [123I]-FP-CIT and [99mTc]-HMPAO single photon emission computed tomography in a new sporadic case of rapid-onset dystonia- parkinsonism. J Neurol Sci 273:148-151.

Zaremba J, Mierzewska H, Lysiak Z, Kramer P, Ozelius LJ, Brashear A (2004) Rapid- onset dystonia-parkinsonism: a fourth family consistent with linkage to chromosome 19q13. Mov Disord 19:1506-1510.

Zarrindast MR, Moghaddampour E (1989) Opposing influences of D-1 and D-2 dopamine receptors activation on morphine-induced antinociception. Arch Int Pharmacodyn Ther 300:37-50.

Zarrindast MR, Nassiri-Rad S, Pazouki M (1999) Effects of dopaminergic agents on antinociception in formalin test. General Pharmacology-the Vascular System 32:517-522.

Zhao H, Zhu W, Pan T, Xie W, Zhang A, Ondo WG, Le W (2007) Spinal cord dopamine receptor expression and function in mice with 6-OHDA lesion of the A11 nucleus and dietary iron deprivation. J Neurosci Res 85:1065-1076.

113

Zintzaras E, Kitsios GD, Papathanasiou AA, Konitsiotis S, Miligkos M, Rodopoulou P, Hadjigeorgiou GM (2010) Randomized trials of dopamine agonists in restless legs syndrome: a systematic review, quality assessment, and meta-analysis. Clin Ther 32:221-237.

Zwartbol RT, Jellema K, Boiten J, Rijsman R (2013) Acute exacerbation of restless legs due to cervical spinal cord ischaemia. BMJ Case Rep 2013.

114

BIOGRAPHICAL SKETCH

Mark DeAndrade was born in Montgomery, Alabama and is the youngest of three

children. He graduated high school at the Alabama School of Math and Science, and

attended the University of Alabama at Birmingham for his undergraduate studies. While

there, Mark joined the laboratory of Dr. Yuqing Li to gain research experience. Mark fell

in love with research and its constant pursuit to push the boundaries of knowledge, and

decided to do a concurrent Master of Science while pursuing his Bachelor of Science.

Upon graduation in May of 2010 with both degrees, Mark decided to continue his

research endeavors by continuing with a doctorate degree, and started the following

semester. In the fall of 2010, Dr. Li was recruited to the University of Florida, and Mark

quickly followed to continue his doctorate studies and research in the spring of 2011.

Mark has had the opportunity to publish his research in Human Molecular Genetics,

PLoS ONE, and Behavioural Brain Research. In the spring of 2014, Mark received his

PhD from the University of Florida.

115