DOCSLIB.ORG

Effects of Somatostatin on the Growth Hormone-Insulin-Like Growth Factor

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effects of Somatostatin on the Growth Hormone-Insulin-Like Growth Factor Available online at www.sciencedirect.com Aquaculture 273 (2007) 312–319 www.elsevier.com/locate/aqua-online Effects of somatostatin on the growth hormone-insulin-like growth factor axis and seawater adaptation of rainbow trout (Oncorhynchus mykiss) ⁎ Jayson Poppinga a, Jeffrey Kittilson a, Stephen D. McCormick b, Mark A. Sheridan a, a Department of Biological Sciences and Regulatory Biosciences Center, North Dakota State University, Fargo, ND 58105, USA b USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376, USA Abstract Growth hormone (GH) has been shown to contribute to the seawater (SW) adaptability of euryhaline fish both directly and indirectly through insulin-like growth factor-1 (IGF-1). This study examined the role of somatostatin-14 (SS-14), a potent inhibitor of GH, on the GH–IGF-1 axis and seawater adaptation. Juvenile rainbow trout (Oncorhynchus mykiss) were injected intraperitoneally with SS-14 or saline and transferred to 20 ppt seawater. A slight elevation in plasma chloride levels was accompanied by significantly reduced gill Na+,K+-ATPase activity in SS-14-treated fish compared to control fish 12 h after SW transfer. Seawater increased hepatic mRNA levels of GH receptor 1 (GHR 1; 239%), GHR 2 (48%), and IGF-1 (103%) in control fish 12 h after transfer. Levels of GHR 1 (155%), GHR 2 (121%), IGF-1 (200%), IGF-1 receptor A (IGFR1A; 62%), and IGFR1B (157%) increased in the gills of control fish 12 h after transfer. SS-14 abolished or attenuated SW-induced changes in the expression of GHR, IGF-1, and IGFR mRNAs in liver and gill. These results indicate that SS-14 reduces seawater adaptability by inhibiting the GH–IGF-1 axis. © 2007 Elsevier B.V. All rights reserved. Keywords: Osmoregulation; Somatostatin; Growth hormone; Growth hormone receptor; Insulin-like growth factor 1. Introduction insulin-like growth factor-1 (IGF-1), cortisol, and thyroid hormones accompanied by decreases in prolac- Euryhaline teleosts rely upon a variety of internal tin (PRL) (Young et al., 1989; McCormick, 2001; signaling mechanisms to coordinate the physiological Evans, 2002). adjustments necessary to respond to changes in Increasing attention has been given to the GH– environmental salinity. Considerable research has insulin-like growth factor-1 (IGF-1) axis and its role in shown that seawater adaptability is associated with promoting readiness to osmoregulate in seawater. The alterations in numerous hormones, including increases role of GH in ion regulation appears separate from the in plasma concentrations of growth hormone (GH), growth-promoting effects of the hormone. Increases in plasma GH and IGF-1 following transfer to seawater are ⁎ Corresponding author. Tel.: +1 701 231 8110; fax: +1 701 231 accompanied by increased mRNA expression of the 7149. hormones (Sakamoto et al., 1990; McCormick et al., E-mail address: [email protected] (M.A. Sheridan). 2000; Agustsson et al., 2001). A connection between 0044-8486/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2007.10.021 J. Poppinga et al. / Aquaculture 273 (2007) 312–319 313 IGF-1 mRNA production and GH was demonstrated in cold SEI buffer (250 mM sucrose, 10 mM Na2EDTA, 50 mM the gill and kidney of trout in response to increases in imidazole) and frozen on dry ice for later assay of Na+,K+- environmental salinity (Sakamoto and Hirano, 1993). ATPase. Liver and gill filament samples were removed and Both GH and IGF-1 can increase salinity tolerance and placed in 2-ml microfuge tubes and immediately placed on dry − gill Na+,K+-ATPase activity in several teleost species ice and stored at 80 °C until later analysis of RNA. (McCormick et al., 1991; Mancera and McCormick, 2.3. Plasma chloride and Na+,K+-ATPase 1998), and a synergistic relationship between the two + + hormones in controlling gill Na ,K-ATPase activity Plasma chloride was determined by silver titration using a has been suggested by Madsen and Bern (1993). Buchler-Cotlove Chloridometer. Gill Na+/K+-ATPase activity Somatostatin (SS), originally discovered in 1973 was determined as described previously (McCormick, 1993). (Brazeau et al., 1973), has numerous effects on the growth, development, reproduction, and metabolism of 2.4. Quantitative real-time PCR vertebrates (Sheridan, 1994; Sheridan et al., 2000; Total RNA was extracted from frozen tissue samples by Sheridan and Kittilson, 2004; Nelson and Sheridan, homogenization in the presence of 500 μl TRI Reagent® 2005; Klein and Sheridan, in press). Given that SS inhibits (Molecular Research Center Inc., Cincinnati, OH) based on the release of numerous pituitary factors, including GH manufacturer's protocol. Each RNA pellet was resuspended in and thyroid stimulating hormone, the possibility exists 100 μl RNase free deionized water and quantified by that SS also may play a role in seawater adaptability and ultraviolet (A260) spectrophotometry. osmoregulation. The aim of this study was to examine the RNA was reverse transcribed in 10 μl reactions using 200 ng effects of SS on the GH–IGF-1 axis during acclimation to total RNA (2 μl) and 8 μl TaqMan® reverse transcription reagents μ μ seawater and to provide further insight into the role of SS (which included 5.5 mM MgCl2, 500 M each dNTP, 2.5 M μ on organismal growth and seawater adaptability. oligo d(T)16 primer, 0.4 U/ l RNase inhibitor, and 3.125 U/ml of MultiScribe reverse transcriptase) according to the manufac- 2. Materials and methods turer's protocol (Applied Biosystems, Foster City, CA). Reac- tions without reverse transcriptase were included as negative 2.1. Animals controls; no amplification was detected in negative controls. mRNA levels of GH receptor 1 (GHR 1), GHR 2, IGF-1, IGF Juvenile rainbow trout of both sexes were obtained from receptor 1a (IGFR1a), and IGFR1b were determined by real- Dakota Trout Ranch near Carrington, ND, USA and time PCR using TaqMan® chemistry and an ABI PRISM® 7000 transported to North Dakota State University. Fish were Sequence Detection System (Applied Biosystems). Real-time maintained in well-aerated, 800-l circular tanks supplied with reactions were carried out for samples, standards, and no- recirculated (10% make-up volume per day) dechlorinated template controls in a 10-μl volume, containing 2 μl cDNA from municipal water at 12 °C with 12:12 L:D photoperiod. Fish the reverse transcription reaction, 5 μl TaqMan Universal PCR were fed twice daily to satiety with AquaMax™ pellets (PMI Master Mix, and 1 μl of each forward primer, reverse primer, and Nutrition International, Brentwood, MO), except 24 h prior to probe at concentrations optimized for the mRNA species to be and during experimental trials. measured. The gene-specific primer and probe sequences used for GHR 1, GHR 2, and β-actin have been reported previously 2.2. Experimental conditions (Slagter et al., 2004; Very et al., 2005). The gene-specific nucleotides used for IGF-1 quantification were as follows: Fish (95.1±1.5 g mean body weight) acclimated to forward 5′ GTGGACACGCTGCAGTTTGT 3′ (900 nM), freshwater were anesthetized with 0.05% (v/v) 2-phenoxyethanol reverse 5′ CATACCCCGTTGGTTTACTGAAA 3′ (900 nM), in 20‰ (w/v, InstantOcean®, Aquarium Systems Inc., Mentor, and probe 5′ FAM-AAAGCCTCTCTCTCCA 3′ (150 nM). OH), weighed, and injected intraperitoneally (10 μl/g body The sequences used for IGFR1a were forward 5′ AGAGAA- weight) with either somatostatin-14 (SS-14; 1×10−11 mol/g CACATCCAGCCAGGTT 3′ (600 nM), reverse 5′ TCCTG- body weight; Sigma, St. Louis, MO) or saline (0.75%, w/v), and CCATCTGGATCATCTT 3′ (600 nM), and probe 5′ FAM- placed into 100-l circular experimental tanks. Experimental tanks TGCCCCCGCTGAA 3′ (150 nM), and for IGFR1b were were supplied with 20‰ seawater (100% turnover rate per 24- forward 5′ CCTGAGGTCACTACGGGCTAAA 3′ (600 nM), hour period) at 12 °C under a 12:12 L:D photoperiod. Fish were reverse 5′ TCAGAGGAGGGAGGTTGAGACT 3′ (600 nM), sampled at 0, 6, 12, 24, 48, and 72 h following injection and and probe 5′ FAM-ATCCGTCCCAGTCCT 3′ (150 nM). seawater transfer. Following anesthesia as described above, Cycling parameters were set as follows: 95 °C for 10 min and sampled fish were weighed and measured for length. Blood was 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Cross reaction collected from the severed caudal vessels and the plasma was was assessed by substituting alternate primer/probe sets in separated from blood cells by centrifugation (11,000 g for 3 min) TaqMan assays for each standard; no amplification was observed andstoredat−80 °C for later analyses. One intact gill arch from under these conditions. Sample copy number was calculated each fish was placed in 1.5-ml microfuge tubes containing ice- from the threshold cycle number (CT) and relating CT to a gene- 314 J. Poppinga et al. / Aquaculture 273 (2007) 312–319 Fig. 1. Effects of somatostatin-14 (SS-14) on plasma chloride concentration and gill Na+/K+-ATPase activity in rainbow trout during acclimation to 20‰ seawater. Data are presented as mean±SEM. Within a treatment (saline or SS-14), groups with different letters are significantly different ( pb0.05); ⁎ indicates a significant difference ( pb0.05) between the control- and SS-14-treated groups. specific standard curve (Very et al., 2005) followed by (Fig. 1). While plasma chloride showed a significant transitory normalization to β-actin levels within each time group increase compared to time 0 in both the saline- and SS-14- (Sakamoto and Hirano, 1993). injected fish, reaching maximum levels 24 h after transfer, the temporal profiles of the two treatment groups were somewhat 2.5. Statistical analyses different. Notably, plasma chloride levels in the SS-14-injected fish were significantly elevated by 12 h after transfer, while Data are expressed as mean±SEM.
Load more

Recommended publications
  • The Endocrine System Brightside July, 2019 by Dr
    The Endocrine System Brightside July, 2019 By Dr. Derek Conte How does the body regulate and balance itself from minute to minute, hour to hour and month to month? What is it that allows the food we eat to be utilized for growth, healing and energy? What causes the female egg to drop each month or a mother’s milk to flow? The answer is the endocrine system, which is comprised of the hypothalamus, pituitary gland, pineal gland, thyroid and parathyroid glands, thymus gland, the adrenals, pancreas, ovaries and testes. The brain signals these specialized glands to release hormones to initiate essential chemical actions that sustain life. The word “endocrine” literally means “to cry inside” and that is exactly what happens when the endocrine system works. An example is growth hormone (GH) or somatotropin, responsible for growth and tissue repair. During exercise or when we have low blood sugar or high blood amino acid levels, the hypothalamus leaks (“cries”) growth hormone releasing hormone (GHRH) through very small vessels into the anterior pituitary gland which then leaks growth hormone into the general circulation, acting on cells for growth or replacement of old or damaged tissues. Pro ballplayers looking for an edge have been using growth hormone. The hormone that shuts this process off is called growth hormone inhibiting hormone (GHIH) or somatostatin (“growth stop”), released when blood sugar levels are high. If there ever is an excess of growth hormone, it can result in gigantism or acromegaly depending on whether its onset occurred before or after the growth plates in the bones have closed around the age of 17.
    [Show full text]
  • Growth Hormone Booklet
    GROWTH HORMONE AND PRADER-WILLISECOND EDITION SYNDROME A REFerence For FaMILies and Care ProViders Donald G. Goranson, Jr., Editor Growth Hormone and Prader-Willi Syndrome — Second Edition Published By: Prader-Willi Syndrome Association (Usa) 8588 Potter Park Drive, Suite 500 Sarasota, Florida 34238 Toll Free: 800-926-4797 Local: 941-312-0400 Fax: 941-312-0142 www.pwsausa.org © Copyright 2011 A Reference for Families and Care Providers Growth HORMONE AND PraderSECOND-WILLI EDITION Syndrome A REFerence For FaMILies and Care ProViders Donald G. Goranson, Jr., Editor Growth Hormone and Prader-Willi Syndrome — Second Edition A Reference for Families and Care Providers CONTENTS Acknowledgments....................................................................... 5 Introduction and History .............................................................. 7 Prader-Willi Syndrome and Growth ...................................................... 9 Effects of Growth Hormone Treatment in Children with PWS ................................ 20 What Is Involved in Growth Hormone Treatment? .......................................... 26 Questions, Wisdom and Survey Data from our Families ..................................... 34 Appendix: A. Overview of Prader-Willi Syndrome................................................ 40 B. Information Resources on Prader-Willi Syndrome .................................... 42 C. Information Resources on Growth Hormone Use and Products ........................ 43 D. Glossary of Terms ............................................................
    [Show full text]
  • Growth and Growth Hormone I
    Pediat. Res. 2: 43-63 (1968) Dwarfism, constitutional hypoglycemia dwarfism, psychosocial insulin gonadal dysgenesis maternal depriva- growth hormone tion syndrome growth retardation panhypopituitarism Growth and Growth Hormone I. Changes in Serum Level of Growth Hormone Following Hypoglycemia in 134 Children with Growth Retardation S.L.KAPLAN, C.A.L.ABRAMS, J.J.BELL, F.A.CONTE and M.M.GRUMBACH[41] Department of Pediatrics, University of California, San Francisco Medical Center, San Francisco, California, and College of Physicians and Surgeons, Columbia University, New York, New York, USA Extract The change in levels of growth hormone in serum (SGH) following insulin-induced hypoglycemia was evaluated in 134 prepubertal children with growth retardation and 10 control subjects with normal growth patterns by radioimmunoassay, utilizing 131I-HGH and rabbit antiserum to human growth hormone. Mean maximum growth hormone concentration (m^g/ml) at any time during the test was: 10 Control subjects 12.4 53 Hypopituitarism 2.5 m^g or less in 52/53 20 Constitutional shortness of stature 12.5 22 Primordial dwarfism 12.1 9 XO gonadal dysgenesis 13.4 5 Delayed adolescence 11.8 5 Maternal deprivation 16.7 9 Psychosocial dwarfism 10.9 11 Miscellaneous disorders 7.0 Among factors found to affect the SGH response to insulin-induced hypoglycemia were: a) elevated fasting concentration of SGH which appeared to alter the responsiveness to stimulation; and b) age. The mean maximum SGH concentration of the control subjects following insulin-induced hypo- glycemia was 12.4 m^Mg/ml. In 52/53 patients with hypopituitarism, the SGH concentration was 1 m/*g or less at rest, with no increase or an increase to a maximum of 2.5 m^Mg/ml following hypoglycemia.
    [Show full text]
  • HORMONES and SPORT Insulin, Growth Hormone and Sport
    13 HORMONES AND SPORT Insulin, growth hormone and sport P H Sonksen Guy’s, King’s and St Thomas’ School of Medicine, St Thomas’ Hospital, London SE1 7EH, UK; Email: [email protected] Abstract This review examines some interesting ‘new’ histories of blood rather than urine samples. The first method has a insulin and reviews our current understanding of its window of opportunity lasting about 24 h after an injec- physiological actions and synergy with GH in the regu- tion and is most suitable for ‘out of competition’ testing. lation of metabolism and body composition. It reviews the The second method has reasonable sensitivity for as long as history of GH abuse that antedates by many years the 2 weeks after the last injection of GH and is uninfluenced awareness of endocrinologists to its potent anabolic actions. by extreme exercise and suitable for post-competition Promising methods for detection of GH abuse have been samples. This method has a greater sensitivity in men than developed but have yet to be sufficiently well validated to in women. The specificity of both methods seems accept- be ready for introduction into competitive sport. So far, ably high but lawyers need to decide what level of there are two promising avenues for detecting GH abuse. scientific probability is needed to obtain a conviction. Both The first uses immunoassays that can distinguish the methods need further validation before implementation. isomers of pituitary-derived GH from the monomer of Research work carried out as part of the fight against recombinant human GH. The second works through doping in sport has opened up a new and exciting area of demonstrating circulating concentrations of one or more endocrinology.
    [Show full text]
  • Regulatory Mechanisms of Somatostatin Expression
    International Journal of Molecular Sciences Review Regulatory Mechanisms of Somatostatin Expression Emmanuel Ampofo * , Lisa Nalbach, Michael D. Menger and Matthias W. Laschke Institute for Clinical & Experimental Surgery, Saarland University, 66421 Homburg/Saar, Germany; [email protected] (L.N.); [email protected] (M.D.M.); [email protected] (M.W.L.) * Correspondence: [email protected]; Tel.: +49-6841-162-6561; Fax: +49-6841-162-6553 Received: 25 May 2020; Accepted: 9 June 2020; Published: 11 June 2020 Abstract: Somatostatin is a peptide hormone, which most commonly is produced by endocrine cells and the central nervous system. In mammals, somatostatin originates from pre-prosomatostatin and is processed to a shorter form, i.e., somatostatin-14, and a longer form, i.e., somatostatin-28. The two peptides repress growth hormone secretion and are involved in the regulation of glucagon and insulin synthesis in the pancreas. In recent years, the processing and secretion of somatostatin have been studied intensively. However, little attention has been paid to the regulatory mechanisms that control its expression. This review provides an up-to-date overview of these mechanisms. In particular, it focuses on the role of enhancers and silencers within the promoter region as well as on the binding of modulatory transcription factors to these elements. Moreover, it addresses extracellular factors, which trigger key signaling pathways, leading to an enhanced somatostatin expression in health and disease. Keywords: somatostatin; pre-prosomatostatin; δ-cells; central nervous system (CNS); gut; hypothalamus; cAMP resonse element (CRE); pancreas/duodenum homeobox protein (PDX)1; paired box protein (PAX)6; growth hormone (GH); brain-derived neurotrophic factor (BDNF); glutamateric system; pancreas 1.
    [Show full text]
  • Hypothalamic-Pituitary Axes
    Hypothalamic-Pituitary Axes Hypothalamic Factors Releasing/Inhibiting Pituitary Anterior Pituitary Hormones Circulating ACTH PRL GH Hormones February 11, 2008 LH FSH TSH Posterior Target Pituitary Gland and Hormones Tissue Effects ADH, oxytocin The GH/IGF-I Axis Growth Hormone Somatostatin GHRH Hypothalamus • Synthesized in the anterior lobe of the pituitary gland in somatotroph cells PITUITARY • ~75% of GH in the pituitary and in circulation is Ghrelin 191 amino acid single chain peptide, 2 intra-molecular disulfide bonds GH Weight; 22kD • Amount of GH secreted: IGF-I Women: 500 µg/m2/day Synthesis IGF- I Men: 350 µg/m2/day LIVER Local IGF-I Synthesis CIRCULATION GH Secretion: Primarily Pulsatile Pattern of GH Secretion Regulation by two hypothalamic in a Healthy Adult hormones 25 Sleep 20 Growth - SMS Hormone 15 Somatostatin Releasing GHRH + GH (µg/L) Hormone Inhibitory of 10 Stimulatory of GH Secretion GH Secretion 05 0 GHRH induces GH Somatostatin: Decreases to allow 0900 2100 0900 synthesis and secretion Clocktime GH secretory in somatotrophs Bursts GH From: “Acromegaly” by Alan G. Harris, M.D. 1 Other Physiological Regulators of GH Secretion Pharmacologic Agents Used to Stimulate GH Secretion Amino Sleep Exercise Stress Acids Fasting Glucose Stimulate hypothalamic GHRH or Inhibit Somatostatin Hypothalamus GHRH SMS Hypoglycemia(Insulin) Pituitary L-dopa Arginine Clonidine GHRH + - SMS Pyridostigmine GH Target Tissues Metabolic & Growth Promoting GH Effects IGF-I Insulin-like growth factor I (IGF-I) Major Determinants of Circulating
    [Show full text]
  • Influence of the Endocrine System on Growth and Development R
    331. INFLUENCE OF THE ENDOCRINE SYSTEM ON GROWTH AND DEVELOPMENT R. J. GERRITS A. R. S., U. S. D. A. Introduction The field of endocrinology cannot be defined in a manner entirely acceptable to all biologists or animal scientists. This is understandable as there are many points of view and many voids in our knowledge in this area. It is very hard to give a precise definition for an endocrine gland because all cells possess some secretory capacity and therefore contribute to the internal environment of the organism. For the most part the term "hormone" is probably applied too loosely and to a great variety of unrelated substances. Hormones can be identified as chemical agents which are synthesized by circumscribed parts of the body, generally specialized ductless glands, and are carried by the circulatory system to another part of the body where they evoke systemic adjustments by acting on rather specific target tissues or organs (Turner, 1966). In general, hormones regulate many processes such as growth, regeneration, reproduction, blood chemistry, metabolic rate, etc. Hormones act on the organs and tissues of the body by regulating the rate of specific metabolic reactions without contributing much at all to the constituent cell. It can be said that ad- justments to hormone levels require duration rather than speed, as opposed to the rapid coordinations of the body that are controlled by the nervous system. These biochemical adjustments are accomplished at the cellular level by virtue of their power to augwnt or restrain special enzyme sys- tems. It is important that hormones be released at the right time and in the proper amounts of the normal organism if they are to accomplish their specific mission.
    [Show full text]
  • Human Growth Hormone: Endogenous Production and Lifelong Health Benefits
    Human Growth Hormone: Endogenous Production and Lifelong Health Benefits Jason D. Martinez Advisor: Robert Davidson, Ph.D. November 29, 2012 Abstract Objective: To present a clear explanation of the purpose of Human Growth Hormone (hgH). Inform the reader of ways to naturally increase hgH. Increase awareness as to what benefits this hormone holds. Decrease the negative connotation surrounding hgH. Methods: Published literature on the topic of Human Growth Hormone (hgH) was collected and reviewed. Search subjects included, but were not limited to, endogenous production of hgH, nutritional considerations, and the effects of exercise on production of hgH. Results: An increase in endogenous secretion elicits a greater capacity for cell regeneration. Deep sleep is one of the highest yielding states for our bodies to be in for the production of the hormone. Some studies have shown that modifications of diet and exercise can push hgH production to it’s limits. Unfortunately, it is almost impossible to detect exogenous sources with current drug testing methods. Conclusions: In light of the medicinal use of human growth hormone (hgH) there are many other ways we can utilize the benefits surrounding this substance. Short wave sleep patterns, as well as good nutrition is an important diurnal approach to exogenous production of the hormone. The amino acid leucine holds a very important secondary role in the longevity of hgH in the blood by decreasing oxidation of the hormone. Lastly, intense exercise that requires forced and negative repetition training also invokes an enormous response of acute stress which in turn requires the central nervous system to boost production.
    [Show full text]
  • Growth Hormone-Releasing Hormone in Lung Physiology and Pulmonary Disease
    cells Review Growth Hormone-Releasing Hormone in Lung Physiology and Pulmonary Disease Chongxu Zhang 1, Tengjiao Cui 1, Renzhi Cai 1, Medhi Wangpaichitr 1, Mehdi Mirsaeidi 1,2 , Andrew V. Schally 1,2,3 and Robert M. Jackson 1,2,* 1 Research Service, Miami VAHS, Miami, FL 33125, USA; [email protected] (C.Z.); [email protected] (T.C.); [email protected] (R.C.); [email protected] (M.W.); [email protected] (M.M.); [email protected] (A.V.S.) 2 Department of Medicine, University of Miami Miller School of Medicine, Miami, FL 33101, USA 3 Department of Pathology and Sylvester Cancer Center, University of Miami Miller School of Medicine, Miami, FL 33101, USA * Correspondence: [email protected]; Tel.: +305-575-3548 or +305-632-2687 Received: 25 August 2020; Accepted: 17 October 2020; Published: 21 October 2020 Abstract: Growth hormone-releasing hormone (GHRH) is secreted primarily from the hypothalamus, but other tissues, including the lungs, produce it locally. GHRH stimulates the release and secretion of growth hormone (GH) by the pituitary and regulates the production of GH and hepatic insulin-like growth factor-1 (IGF-1). Pituitary-type GHRH-receptors (GHRH-R) are expressed in human lungs, indicating that GHRH or GH could participate in lung development, growth, and repair. GHRH-R antagonists (i.e., synthetic peptides), which we have tested in various models, exert growth-inhibitory effects in lung cancer cells in vitro and in vivo in addition to having anti-inflammatory, anti-oxidative, and pro-apoptotic effects. One antagonist of the GHRH-R used in recent studies reviewed here, MIA-602, lessens both inflammation and fibrosis in a mouse model of bleomycin lung injury.
    [Show full text]
  • The Effect of Growth Hormone on Growth Hormone Binding
    International Journal of Obesity (2000) 24, Suppl 2, S160±S161 ß 2000 Macmillan Publishers Ltd All rights reserved 0307±0565/00 $15.00 www.nature.com/ijo The]> effect of growth hormone on growth hormone binding protein, leptin and body composition in hypopituitary adults{ CM Florkowski1*, R Barnard2, JH Livesey1, T Veveris3, EA Espiner1 and RA Donald1 1Department of Endocrinology, Christchurch Hospital, Christchurch, New Zealand; 2Co-operative Research Centre for Diagnostic Technologies; and 3Centre for Molecular Biology, Queensland University of Technology, Brisbane, Queensland, Australia International Journal of Obesity (2000) 24, Suppl 2, S160±S161 Keywords: growth hormone; growth hormone binding protein; leptin; hypopituitarism Introduction compared using Pearson product moment correlation coef®cients. Growth hormone binding protein (GHBP) corresponds to the extracellular domain of the GH receptor (GHR) and is closely related to body fat.1,2 The increased fat Results mass and decreased lean muscle mass associated with hypopituitarism in adults can be improved with GH The changes in body fat and leptin in response to GH treatment, and we shown that the reduction in body fat have been reported previously.3 Baseline plasma stores with GH replacement in this group results in a leptin showed a signi®cant correlation with baseline reduction in serum leptin.3 We examined the relation- BMI, r 0.67, P < 0.005 and baseline percentage ship between GHBP, leptin and body composition in total body fat, r 0.81, P < 0.0001.3 There was a GH-de®cient adults, the response of GHBP to GH strong correlation between baseline GHBP and per- replacement in this group and whether baseline GHBP centage total body fat, r 0.83, P < 0.0001, although predicts IGF-I response.
    [Show full text]
  • Insulin As a Growth Factor
    003 1-3998/85/1909-0879$02.00/0 PEDIATRIC RESEARCH Vol. 19, No. 9, 1985 Copyright O 1985 International Pediatric Research Foundation, Inc Printed in U.S. A. Insulin as a Growth Factor D. J. HILL AND R. D. G. MILNER Departrnenl c!j'Pucdiutricc, Unive,:sitj. of Sl~effield,Cliildren :s Hospital, Shefic~ld,England ABSTRACT. Insulin is a potent mitogen for many cell attention than its well known, acute metabolic actions. Insulin types in vitro. During tissue culture, supraphysiological also can influence growth in vivo. The poor growth of a chilld concentrations of insulin are necessary to promote cell with diabetes (1) contrasts with the overgrowth of the hyperin- replication in connective or musculoskeletal tissues. Insulin sulinemic infant of a diabetic mother (2). The growth-promoting promotes the growth of these cells by binding, with low effect of insulin in vivo was demonstrated experimentally by affinity, to the type I insulin-like growth factor (IGF) Salter and Best in 1953 (3); these investigators restored growth receptor, not through the high affinity insulin receptor. In to hypophysectomized rats by treatment with insulin and a high other cell types, such as hepatocytes, embryonal carcinoma carbohydrate diet. Rats given insulin grew as well as those given cells, or mammary tumor cells, the type I IGF receptor is growth hormone but consumed substantially more food. Any virtually absent, and insulin stimulates the growth of these analysis of the action of insulin in promoting growth must clearly cells at physiological concentrations by binding to the high separate those effects which are due to anabolism resulting frc~m affinity insulin receptor.
    [Show full text]
  • JO Jorgensen, TK Hansen
    PROJECT REVIEW “A Newly Discovered Growth Hormone Stimulating Peptide” J.O Jorgensen, T.K. Hansen (Department, Aarhus University Hospital and Institute of Experimental Clinical Research, Denmark) Growth hormone secretagogues (GHS) are small synthetic molecules that stimulate the release of growth hormone (GH) from the pituitary. In 1996 the GHS-receptor was cloned’, and in 1999 Kojima et al. discovered Ghrelin, the endogenous ligand of the GHS-receptor. Ghrelin is a peptide hormone that is synthesized in the stomach. It strongly stimulates the production and release of GH from the pituitary, with only minor effects on other pituitary hormones. The regulation and physiological significance of ghrelin is only gradually being revealed. It appears, that the hormone plays a major role in the regulation of the growth hormone axis and in the central regulation of appetite, but so far data on plasma levels of ghrelin 2 have only been reported in the original paper by Kojima . The International Olympic Committee bans administration of GH by athletes to enhance performance, but there is currently no approved method of detection. Measurement of serum GH itself is of limited use because recombinant GH and endogenous GH have identical amino acid sequences, and therefore markers of GH action are being investigated as potential tests for GH abuse. The rationale for the abuse of GH by athletes to enhance performance is that GH, at least in studies of GH-deficient adults, has been shown to reduce fat mass and to increase lean body mass, skeletal muscle mass, muscle force and aerobic performance. The abuse is limited by the high cost of recombinant GH and by the need of parenteral administration.
    [Show full text]