9, Radl 7, and RAD24 Are Required for S Phase Regulation in Saccharomyces Cerevisiae in Response to DNA Damage

-9, RADl 7, and RAD24 Are Required for S Phase Regulation in Saccharomyces cerevisiae in Response to DNA Damage

A. G. Paulovich, R. U. Margulies, B. M. Garvik and L. H. Hartwell Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 Manuscript received July 30, 1996 Accepted for publication October 1, 1996

ABSTRACT We have previously shown that a checkpoint dependent on MECl and RAD53 slows the rate of S phase progression in Saccharomyces cereuisiae in response to alkylation damage. Whereas wild-type cells exhibit a slow S phase in response to damage,mal-1 and rad53 mutants replicate rapidly in the presence or absence of DNA damage. In this report, we show that other genes (RAD9, RADl 7, RAD24) involved in the DNA damage checkpoint pathway also play a role in regulating S phase in response to DNA damage. Furthermore,RAD9, RAD1 7, and RAD24 fall into two groups with respect to both sensitivity to alkylation and regulation of S phase. We also demonstrate that the more dramatic defect in S phase regulation in the mecl-l and rad53 mutants is epistatic to a less severe defect seen in rad9A, radl 7A, and rad24A. Furthermore, the triple rad9A radl 7A rad24A mutant also has a less severe defect than mcl-1 or rad53 mutants. Finally, we demonstrate the specificity of this phenotype by showing that the DNA repair and/or checkpoint mutants mgtlA, magla, apnlA, rev3A, radl8A, radl6A, dud-A100, sad4-1, tellA,rad26A, rad5lA, rad52-1, rad54A,radl4A, radlA, p0130-46, p0130-52, mad3A, pdslA/esp2A, pmlA, mlhlA, and mh2A are all proficient at S phase regulation, even though some of these mutations confersensitivity to alkylation.

ANY types of cells havebeen shown to respond to ESP2 (YAMAMOTOet al. 1996a,b). How these same genes M DNA damage by regulating progression through participate in seemingly different checkpointsat differ- the ensuingmitotic cell cycle (HARTWELLand WEINERT ent cell cycle stages is still a mystery. However, recent 1989; CARR 1995; MURRAY1995). Regulation of cell cy- evidence suggests the possibility that checkpoint genes cle transitions in response to damageis a result of signal may encodeproteins involved directly in detection transduction pathways called “checkpoints” (HART- and/or processing of DNA lesions (LYDALLand WEIN- WELL and WEINERT1989). In Saccharomycescereuisim, ERT 1995, 1996). checkpoint pathways responding to DNA damage or to We recently demonstrated that in wild-type S. cereuis- inhibition of DNA replication regulate the entry into iae the rate of ongoing S phase is slowed, although not and progression through S phase and mitosis. Interest- blocked, when cells are subjected to alkylation damage ingly, many of the checkpoint genes that have been by exposure to sublethal doses of the monofunctional identified in yeast are necessary for controlling more alkylating agent methyl methanesulfonate (MMS) than one cell cycle transition. For example, the G1-S (PAULOVICHand HARTWELL 1995).Furthermore, we phase DNA damage checkpointis dependent onRAD9 showed that the slowing of S phase progression in re- (SIEDEet al. 1993, 1994), RAD24 (SIEDEet al. 1994), sponse to alkylation damage in yeast is dependent on and RAD53/MEC2/SPKl/SADl (ALLEN et al. 1994) (G1 the MECl and the RALl53 checkpoint genes (PAULOV- checkpoint status in mcl-1 and radl 7A has not been ICH and HARTWELL 1995); mcl-1or rad53mutants repli- determined), the SM checkpoint that inhibits mitosis cate damaged and undamaged DNA at comparable when cells are blocked in S phase is dependent on rates, ruling out a model in which lesions alone are MECl (WEINERTet al. 1994), RAD53 (ALLEN et al. 1994; able to slow replication and demonstratingthat the WEINERTet al. 1994), andPOLE (NAVASet al. 1995), and slowing of S phase is an active process. the G2-M DNA damage checkpoint is dependent on Inhibition of DNA replication in response to DNA damagehad previously beendemonstrated in Esche- RAD9 (WEINERTand HARTWELL 1988, 1990, 1993;), RADl 7 (WEINERTand HARTWELL1993; WEINERTet al. richia coli (CAIRNEs and DAVERN1966) as well asin mam- 1994), RAD24 (WEINERTet at. 1994), MECI/ESRI malian cells (PAINTERand YOUNG 1980; YOUNGand PAINTER1989; LARNER et aZ. 1994). This inhibition is (WEINERTet aZ. 1994), RAD53 (ALLEN et aZ. 1994; WEIN- due notonly to a decrease inthe initiation of replicons, ERT et al. 1994), MEc3 (WEINERTet al. 1994), andPDSI/ but also to a decrease in the rate of elongation of preex- isting nascentstrands (PAINTERand YOUNG 1980; Cmesponding authw; Lee Hartwell, Fred Hutchinson Cancer Re- search Center, 11124 Columbia St., Seattle, WA 98104. LARNER et al. 1994). Cells isolated from patients afflicted E-mail: [email protected] by the cancer-prone, neurodegenerative disorderataxia

Genetics 145 45-62 (January, 1997) 46 A. G. Paulovich et al.

TABLE 1 Yeast strains

Strain Genotype 7830-2-4a MATa ura3 leu2 trpl his3 yMP10177 MATa ura3 leu2 trpl his3 rad9::LEU2 yMP10247 MATa ade2 ade3-130 leul-12 ura3-52 canl cyh2 SCR.:URA3 sap3 rad52-1 yMP10252 MATa ura3 leu2 trpl his3 mecl-l::HIS3 smll yMP10261 MATa ade2 ade3-130 ura3-52 canl cyh2 SCR.:URA3 sap3 trpl radlA yMP10318 MATa ura3 leu2 trpl his3 rad9A::LEU2 rad24A::TRPl yMP10333 MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR:URA3 mgtlA::LEU2 yMP10359 MATa ura3 leu2 trpl his3 rad9A::HISjr rad24A::TRPl radl 7A::LEU2 yMP10365 MATa ura3 leu2 trpl his3 radl 7A::L.EU2 yMP10366 MATa ura3 leu2 trpl his3 rad24A::TRPl yMP10381 MATa ade2 ade3-I30 ura3 leu2 trpl cyh2 SCR:URA3 yMP10382 MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR:URA3 rm3A::LEU2 yMP10425 MATa ade2 ade3-130 ura3 leu2 trpl qh2 SCR:URA3 radl8A::LEUZ yMP10428 MATa ura3 leu2 trpl his3 rad5lA::LEU2 yMP10447 MATa ura3 leu2 trpl his3 radl6A::URA3 yMP10464 MATa ura3 leu2 trpl his3 rad9A::LEU2 mec2-l::URA3 yMP10507 MATa ura3 leu2 trpl his3 rad24A::URA3 yMP10519 MATa his3 radl4A::HIS3 yMP10521 MATa ade2 ade3-I30 ura3 leu2 trpl cyh2 SCR.:URA3 mshZA::URA3 yMP10537 MATa ura3 leu2 trpl his3 rad9A::HIS3 radl 7A::LEU2 yMP10538 MATa ura3 leu2 trpl his3 rad24A::TRPl radl 7A::LEU2 yMP10590 MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR:URA3 apnlA::LEU2 yMP10788 MATa ura3 leu2 trpl his3 rad53 yMP10789 MATa ura3 leu2 trpl his3 rad9A::TRPl yMP10796 MATa ura3 leu2 trpl his3 radl 7A::LEU2 rad53 yMP10798 MATa ura3 leu2 trpl his3 radl 7A::LEU2 rad53 yMP10801 MATa ura3 leu2 trpl his3 rad24A::TRPl rad53 yMP10844 MATa ura3 leu2 trpl his3 mecl-l smll yMP10845 MATa ura3 leu2 trpl his3 radl 7A::LEU2 smll yMP10847 MATa ura3 leu2 trpl his3 mecl-l smll yMP10848 MATa ura3 leu2 trpl his3 mecl-1 smll yMP10850 MATa ura3 leu2 trpl his3 radl 7A::LEU2 mecl-1 smll yMP10852 MATa ura3 leu2 trpl his3 radl 7A::LEUZ smll yMP10853 MATa ura3 leu2 trpl his3 radl 7A::LEU2 mecl-1 smll yMP10856 MATa ura3 leu2 trpI his3 radl 7A::LEUZ mecl-1 smll yMP10860 MATa ura3 leu2 trpl his3 smll yMP10863 MATa ura3 leu2 trpl his3 smll yMP10882 MATa ura3 leu2 trpl his3 rad9A::HIS3 mecl-1 smll yMP10884 MATa ura3 leu2 trpl his3 rad9A::HIS3 mecl-l smll yMP10886 MATa ura3 leu2 trpl his3 rad9A::HIS3 mecl-1 smll yMP10887 MATa ura3 leu2 trpl his3 rad9A::HIS3 smll yMP10889 MATa ura3 leu2 trpl his3 rad9A::HISjr smll yMP10903 MATa ura3 leu2 trpl his3 mecl-1 rad53 smll yMP10904 MATa ura3 leu2 trpl his3 mecl-1 rad53 smll yMP10910 MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR::URA3 rad54A::LEU2 yMP10931 MATa ura3 leu2 trpl his3 mecl-1 rad24A::TRPl smll yMP10932 MATa ura3 leu2 trpl his3 rad24A::TRPl smll yMP10934 MATa ura3 leu2 trpl his3 rad24A::TRPl smll yMP10936 MATa ura3 leu2 trpl his3 mecl-1 rad24A::TRPl smll yMP10942 MATa ura3 leu2 trpl his3 mecl-l rad24A::TRPl smll yMP10943 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 yMPlO944 MATa ura3 leu2 trpl his3 rad53 yMP10947 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 yMP10949 MATa ura3 leu2 trpl his3 rad53 yMP10951 MATa ura3 leu2 trpl his3 rad53 yMP10952 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 yMP10953 MATa ura3 leu2 trpl his3 radYA::HIS3 rad53 yMP10954 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 yMP10955 MATa ura3 bu2 trbl his3 rad53 S Phase Regulation in S. cereuisiae 47

TABLE 1 Continued

Strain Genotype yMP10956 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 yMP10961 MATa ura3 leu2 trpl his3 rad24A::TRPl rad53 yMP10964 MATa ura3 leu2 trpl his3 rad24A::TRPl rad53 yMP10983 MATa ade2 ade3-I30 ura3 leu2 tql cyh2 SCfi:URA3 m1hlA::TRPl yMPllO58 MATa ura3 leu2 trpl mad3A::LEU2 yMP11069 MATa ura3 leu2 trpl his3 rad53 smll yMP11070 MATa ura3 leu2 trpl his3 rad53 smll yMP11071 MATa ura3 leu2 trpl his3 rad53 smll yMP11072 MATa ura3 leu2 trpl his3 rad53 smll yMPllO73 MATa ura3 leu2 trpl his3 rad53 smll yMP11074 MATa ura3 leu2 trpl his3 rad53 smll yMPllO82 MATa ade2ade3-130 ura3 leu2 trpl cyh2 SCfi:URA3pmlA::LEU2 Y202 MATa canl-100 ade2-1 hsi3-11,15 leu2-3,112 tql-1 ura3-IO0 Y286 MATa canl-100 ade2-l his3-11,15 leu2-3,112 trpl-I ura3-100 dunI-A100::HIS3 Y80 MATa ura3-1 his3-11,15 leu2-3,112 trpl-I ade2-1 cad-100 sad4 MATa ura3-l his3-11,15 leu2-3,112 trpl-I ade2-1 cad-100 sad4-1 TELl MATa ade2 his3 trpl ura3 leu2 tell MATa ade2ura3 his3 trpl leu2 PY38 MATa ura3-52 tqlA901 leu2-3,112 canl po130Al+pBL2II-POL30 p0130-46 MATa ura3-52 trplA901 leu2-3,112 canl po13OAl + p230-46 ~0130-52 MATa ura3-52 trplA 901 leu2-3,112 canl po130AI + p230-52 telangiectasia(AT) fail to inhibit both theinitiation Yeast strains: Allyeast strains with the designation yMP (Table l),and also strain 7830-24a, are in the A364a back- and elongation of DNA replicons in response to DNA ground. rad9A, radl 7A, rad24A, mecl-1, and rad53 single mu- damage (PAINTERand YOUNG1980), leadingto the hy- tants in the A364a background were kindly provided by TED pothesis that ATcells lacka factor or process thatdelays WEINERT(WEINERT and HARTWELL 1990; WEINERTet al. 1994; replication in normalcells after DNA damage (PAINTER LYDALLand WEINERT1995) and subsequently crossed toother and YOUNG1980). Interestingly, MECl is a homologue mutants in the A364a background during the course of this of ATM (AT-mutated), thegene mutated in AT patients study to generate the double and triple mutants described herein. The rad53 allele used in this study was originally is* (SAVITSKYet al. 1995a,b). lated as mec2-l (WEINERTet al. 1994). The radlA mutant was In this report, we describe further genetic character- described previously (KADYK and HARTWELL 1993). The ization of the role of the DNA damage checkpoint in radl4A mutant was constructed by one-step gene replacement controlling S phase progression. We examine the con- (ROTHSTEIN1983) using the EcoRV-SpeI fragment of plasmid tributions of other known checkpoint genes to pro-this pBRWSradl4::HZS3, missing the HindlII-Sac1 fragment of RADl4, kindly provided by W. SIEDEand E. FRIEDBERG.The cess and find that RAD9, 7, and RAD24 are all RAD1 radl6A mutant was constructed by one-step gene replacement involved in controlling the S phase rate, although to a (ROTHSTEIN1983) using the huII fragment of plasmid lesser extent than MECl and RAD53. A role for RAD9, pBLY22, kindly provided by C. LAURENT (SCHILDet al. 1992). RAD1 7, and RAD24 in the controlof S phase was unex- The radl8A mutant was constructed by one-step gene replace- pected, since none of these genes appears to be re- ment (ROTHSTEIN1983) using the BamHI-Hpd fragment of quired for the control of mitosis in response to HU plasmid radl8A1, kindly provided by F. FABRE.The rad26A mutant was constructed by one-step gene replacement exposure or Cdc8plimitation (WEINERTand HARTWELL (ROTHSTEIN 1983) usingthe DraI fragment of plasmid pra- 1993; WEINERTet al. 1994). (The possibility that some d26:: URA3, kindly provided by J. BROUWER(VAN MOLet al. unrecognized aspects of the cell cycle continue in HU- 1994). The rad5lA mutant was constructed by one-step gene treated rad9, radl 7, or rad24 mutants cannot be ex- replacement (ROTHSTEIN1983) usingthe Bad1fragment of cluded.) We also survey a collection of DNA repair mu- plasmid rad5lALEU2, kindly provided byF. FABRE.The tants, including representatives from nucleotide exci- rad54A mutant was constructed by PCR-based gene replacement (BAUDINet al. 1993) using oligonucleotides designed to sionrepair, base excision repair, recombinational delete over 90% of the coding sequence. [Oligonucleotides repair, postreplication repair,and mismatch repair,and contained sequences internal to RAD54 and sequences flank- find that notall mutants sensitive to MMS are defective ing LEU2. PCR using pRS305 (SIKORSKIand HIETER1989) as a in S phase regulation, demonstrating the specificity of template generated an intact LEU2 gene flanked by sequence the DNA damage checkpoint in the controlof S phase. homology to RAD54. oligo 1: 5'-ACAGAC CAC CAA ATG GAATAGGAGCCGGTGAACGGCCGAGAGCGGTCT MATERIALS AND METHODS AAG GCG CCT GAT-3'; oligo 2: 5'-CCA AGT TGT CGC ATC Media and growth conditions: YEPD and dropout media ACCATATAACATTGCAGG GGCTCT CGGAAC TTT have been described (SHERMANet al. 1981).Y"1 is described CAC CAT TAT GGG-3'1. The apnlA mutant was constructed in HARTWELL (1967). byPCR-based gene replacement (BAUDINet al. 1993) using 48 A. G. Paulovich et al. oligonucleotides designed to delete over 90% of the coding Y"1 + 2% glucose, 10 ml were removed for flow cytometry, sequence. [Oligonucleotides contained sequences internal to and the remainderof the culture was synchronized in the G1 APNl and sequences flanking LEU2. PCR using pRS305 (SI- phase by the addition of alpha factor to a final concentration KORSKI and HIETER1989) as a template generated an intact of 3 p~.After 2 hr of incubation at 30°, the culture was split LEU2 gene flanked by sequence homology to APNI. oligo 1: in half, and one half was treated with 667 pL of 5% MMS in 5"GGC ATA TCG GAA CCA TCG TAA TGC CTT CGA CAC Y"1 (0.033% final concentration of MMS). The incubation CTA GCT TAG CGG TCT AAG GCG CCT GAT-3'; oligo 2: was continued at 30" for an additional 30 min, afterwhich 10 5"TTCTTCTCGCTTCTCATTATTCTTTCTTAGTCT ml were removed (t = 0) for cell cycle analysis. The cultures TCC TCT TGG AAC TTT CACCAT TAT GGGS'].The were harvested and released into the cell cycle by resuspen- nzaglA mutant was constructed by one-step gene replacement sion in 100 ml YM-I + 2% glucose + 0.1 mg/ml pronase, 2 (ROTHSTEIN1983) using the EcoRI fragment of plasmid pUC 0.033% MMS final concentration. At the indicated times after 5.1, kindly provided byL. SAMSON(CHEN et al. 1990). The release, samples were removed for viability assessment and/ mgtlA mutant was constructed by one-step gene replacement or cell cycle analysis. (ROTHSTEIN1983) using the Hind111 fragment of plasmid MMS kill curves: Cells (2.9 X loH)were harvested from a pYMTA, kindly provided by L. SAMSON(XMO et at. 1991). The log phase culture grown overnight at 30" in Y"1 + 2% glu- msh2A mutant was constructed by one-step gene replacement cose. Cells were resuspended in 60 ml Y"1 + 2% glucose + (ROTHSTEIN1983) using the AatII-PuuII fragment of plasmid 0.03% MMS (final concentration). One MMS solution was pEN63, kindly provided by R. KOLODNER.The pmslA mutant used for all strains in a given experiment to assure identical was constructed by one-step gene replacement (ROTHSTEIN MMS concentrations between cultures. Cultures were incu- 1983) using the A@-MluI fragment of plasmid PAM58, kindly bated at 30°, and samples were removed at t = 1, 2, 3, and 4 provided by A. SUCINO(MORRISON et al. 1993). The rm3A hr. For the kill curves in Figure lH, 1 ml was harvested, soni- mutant was constructed by one-step genereplacement cated, and used for viability assessment. For the kill curves (ROTHSTEIN1983) using the Sad-SmaI fragment of plasmid shown in Figure 4, at various times afterresuspension in pRS101, kindly provided by C. LAWRENCE (MORRISON et al. 0.03% MMS, 10 ml were harvested, resuspended in 1 ml 5% 1989). The mad3A mutant was constructed using one-step sodium thiosulfate to inactivate the MMS, sonicated, and used gene replacement (ROTHSTEIN1983) to delete the genomic for viability assessment. Initial viabilities (t = 0) were deter- interval from -14 to +1427 nucleotides of MAD3 coding se- mined from the starting culture, before exposure to MMS. quence (D. TOCZYSKI,personal communication). The mlhIA Viability assessment: Following sonication and dilution of mutant was constructed by PCR-based genereplacement the sample into normal saline, cell concentration was deter- (BAUDINet al. 1993) using oligonucleotides designed to delete mined using a Coulter Channelizer.Viable cells/ml was deter- over 90% of the coding sequence.(Oligonucleotides contain mined by plating serial dilutions of cultures onto C plates and sequences internal to MLHl and sequences flanking TRPI. scoring the number of colony-forming units (CFU) after 2- PCR using pRS304 (SIKORSKIand HIETER1989) as a template 3 days at 30". Viability was calculated as CFU/total cells. generated an intact TRPl gene flanked by sequence homol- Statistical analysis of data: So that the kill curve data could ogy to "1. oligo 1: 5'CGA GAA ATT AGC AGT TTT CGG be accurately represented using a logarithmic yaxis,the mean TGT TTA GTA ATC GCG CTA GAG ATT GTA CTG AGA and the standarddeviation calculations were done as follows. GTG CAC-3'; oligo 2: 5'-GTA TAG ATC TGG AAG GTT GGC Let y( t) = percentage of cells surviving at time t. TAT TTC CAC GAC ATC CTT GCT GTG CGG TAT TTC CFU per mL at time t ACA CCG3'. The pdslA mutant was constructed byPCR- Y(0 = ] x 100. based gene replacement (BAUDINet al. 1993) using oligonu- total cells per mL at time t cleotides designedto delete over 90% of the codingsequence. For n independent experiments, [Oligonucleotides contain sequences internal to PDSl and sequences flanking LEU2. PCR using pJ250 (JONES andPu- I Log yx( t) mean Log y(t) = x:= KASH 1990) as a template was used to generate an intact L!?U2 n gene flanked by sequence homology to PDSI. oligo 1: 5'-CTA GAT TAA GTG CTA GAT AAT AAA CCT TTA TGA TGC The ordinates of the kill curves in Figure 1H and Figure 4 CAG CAG GAA ACA GCT ATG ACC ATG3'; oligo 2: 5'-ATG are mean r(t) = 1pCatl 1.1% v(0 AGC AGT GGA TCT AAG TAA CTA AGT CCT CTA GTT Standard deviation (SD) Log y( t) CTT CGT TGT AAA ACG ACG GCC ACT-3'1. Genomic struc- tures of all mutants were confirmed using either Southern - [Log mean y(t) - Log yx(t)12 blot analysis or PCR followed by diagnostic restriction map- n ping (data not shown).dun1 (ZHOU and ELLEDCE1993), sad4 (STEVEELLEDGE), telIA (GREENWELLet al. 1995), and pol?O Finally, error bars were determined as follows: Error y(t) = (AWACARIet al. 1995) mutants, as well as congenic wildtype 10[mcan Log v(r).-soL,ogv(/~] parental controls, were kindly provided by other labs (as refer- Flow cytometry: For flow cytometry, 10-mi samples were enced) and are not in the A364a background. harvested and cells were fixed in 70% ethanol for 12-24 hr MMS-asynchrony experiment: Cells (2.9 x 10') were har- at 4". Samples were then washed once with 5 ml50 mM sodium vested from a log phaseculture grown overnight at 30" in Y" citrate pH 7.5, and resuspended in 1 ml50 mM sodium citrate. 1 + 2% glucose. Cells were resuspended in 60 ml Y"1 + Cell concentration was determined using a Coulter Channel- 2% glucose + 0.03% MMS (final concentration). One MMS izer, 8 X lo6 cells were transferred to a new tube, and the solution was used for all strainsin a given experiment to total volume was adjusted to 1 ml with 50 mM sodium citrate. assure identical MMS concentrations between cultures. Cul- Twenty-five microliters of 10 mg/ml RNase A was added to tures were incubated at 30", and at various times after resus- each sample, and after a 1-hr incubation at 50", 50 pl of 20 pension in 0.03% MMS samples of 11 ml were removed for mg/ml proteinase K was added. The incubation was contin- cell cycle analysis and viability assessment. ued an additional 1 hr at 50", after which 1 ml of 50 mM MMS-synchronyexperiment: Cells (1 X 10') were har- sodium citrate containing 16 pg/ml propidium iodide was vested from log phase cultures grown overnight at 30" in Y" added. Samples were incubated in thedark for 12-48 hr 1 medium + 2% glucose. Cells were resuspended in 210 ml at 4" and analyzed using a Becton-Dickinson fluorescence- activated cell analyzer. Fifteen thous;uld cells were analyzed for each histogram.

RESCLTS

rad9A, rad1 7A, and rad24A mutants are defective in S phase regulation, althoughto a lesser extent than mecl-1 and rad53 \Ye previorlsly showed that when a logarithmically growing population of wild-type yeast cells is exposed to a sublethaldose (0.015%) of the monofunctional alkylating agent MMS, the distribution of cells in the cell cycle is dramatically altered (PM~I.O\- I<:11 and H,\KITYIXL.199.5). Cell division is inhibited within one cell cycle time, and cells accumulate with a large-budded morphology, indicating that they have passed "start." Concomitant with the large-budded arrest, cells accumulate first with a G1, and then with an S phase content of DNA, and replication continues at WT a slower than normal rate in response to the damage. As a standard to compare with the mutants examined herein, thiseffect is reproduced in Figure lA, at a higherdose (0.033%) than was previously used 17A 9A (0.015%). Wild-type cells were grown to mid-log phase, 24 A harvested, andresuspended in mediumcontaining 17A24A 0.033% MMS. The culture was placed at 30", and sam- 9A17A ples were withdrawn at hourly intervals. Cells were re- 9Al7A24A moved from the MMS, and one aliquot was fixed for 9 A24A flow cvtometric analysis (Figure 1A) whereas a second 0.01 *, aliquot was plated onto rich medium to determine via- 0 1 2 3 4 5 bility (Figure IH). The wild-type cells first accumulate Hours in MMS with a Gl/earlv S phase DNA content, and then pro- FIGL'RI:I.-CeII cycle redistrihution and viahilit\. following ceed throng11 a greatly extended S phase: replication conlintlous exposure of asynchronous populations of wild-~pe in the absence of MMS takes fewer than 30 min (see or checkpoint mrltmt yewt cells to MMS. Exponentially grow Figure 2). whereasreplication in thepresence of ing populations of wild type (7830-24). mrcl-1 (yMP10848). rod53 (yblP10788),mdl7A (yMP1036.5),rrrr124A (yMP10366), 0.015% MMS takes -3-4 hr (P,WI.O\~ICIIand HAKT- rd9A (yMP10789),md9A rod1 7A (yMP10537), rndM rnd24A MWL 199.5), and in the presence of 0.033% MMS takes (yW"p03I8), rndl7A md24A (yMPI0.',38). or md9A rndl7A even longer (Figure 1A). d24A (yMP10359) were subjected to continuolts exposure to M'e previously reported three controls (PAUI.O\~I<:FI 0.03% MMS. At the indicated times after exposure, samples and HAKTIVIXI.199.5) that demonstrated that thepeak- were removed, plated for determination of \iahiIity, ;~ndana- Iyxd hy flow cytomety. (A-C;) Each panel contains two histo- shifting we observe in our flow cytometry histograms is grams. Shaded histograms represent the cell cycle distrihution a reflection of chromosomal DNA synthesis antl not an of the as!mchronous culture, before addition of MUS. Overlaid artifact of prolonged cell cycle arrest at the G1 check- histograms represent the cell cycle distrihution at various times point or of MMS treatment. First, the slow shifting of after addition of MMS. Uponexposure to MltS, all strains accumulated with a uniform large-hudded morpholop (Pt\r- the flow cytometry histogram from G1 to G2 positions 1.0\7(:11 and HARTNTIJ,1995; A. G. P,.\L'I.O\W:ll, R. U. MARGL'- in cells treated with MMS is inhibited by alpha factor, I.IES antl 1.. H. HAK~\TI.I.,unpuhlished result?). (H) Each kill which induces GI arrest but allows cells to continue curve represents the mean of at least three independent expcri- growing. Second, the slow shifting of the histogram is ments, and SDs (see \~I;\TI.:Rl;\ISANI) AII.:TIIOI)S) are shown for inhibited by hvdroxy~rea(HU), which inhibits replica- each data point. tive DNA synthesis. Finally, the slow shifting is associ- ated with the slow acquisition of a G2 level of X-ray 2), that the slowing of S phase in response to MMS is resistance, unequivocally demonstrating that thesewild- dependent on MlK*I and RAD53, since cells mutant for type cells completedchromosomal replication, and either of these hvo genes are sensitive to MMS and allowing us to conclude that theflow cytometry profiles replicate at comparable rates in the presence or ab- we obtain from MMStreated cells accurately reflect nu- sence of DNA damage. To assess whether other check- clear DNA content. pointgenes are necessan, for S phaseregulation in M'e also demonstrated previously, andreproduce response to alkylation damage, we performedthese herefor comparison (Figure 1, R and C; seeFigure same experiments on rud9A, rndl7A, and rnd24A mu- 50 A. G. Paulovich e/ nl. WT mecl-1 rad174rad24A rad9A94244 MMS: - + -+ -+ -+ -+ -+

FIGURE:Z.-Determination of S phase progression rate in synchronized populations of wild-type and checkpoint mutant cells. Cells were synchronized in GI and released in either the presence or the absence of 0.033% MMS. Shaded histograms represent the cell cycle distribution of the asynchronous culture, before alpha factor treatment. Overlaid histograms represent the cell cycle distribution after release from alpha factor into 20.033% MMS for the indicated times. Viabilities determined 120 min after alpha factor release into MMS were as follows: wild-type (7830-2-4a), viability 22%; mecl-I (yMP10252), viability <0.05%; rnd17A (yMP10365), viability 0.5%; rud24A (yMP10366), viability 0.7%; md9A (yMP10177), viability 2.4%; rud9Arnd24A (yMP10318), viability 0.07%. tants. As with wild type, all three mutants show an initial RAD17 and RAD24, as determined by the sensitivity of accumulation in G1 and early S phase 1 hr after expo- the double andtriple mutants to MMS. rad9A, radl 7A, sure to 0.033% MMS (Figure 1, D-F). Also similar to and rad24A single mutants, as well as a radl 7Arad24A the wild type, S phase is lengthened in response to the double mutant, are30-60 times more sensitive to MMS MMS; rad9A, rad1 7A,and rad24A barely complete one than the wild type (Figure lH, 4hr timepoints). How- full round of replication throughout this entire 4hr ever, rad9A radl 7Aand rad9A rad24Adouble mutants, exposure (Figure 1, D-F), whereas replication is nor- as well as the rad9A radl 7A rad24A triple mutant, are mally completed within 15-30 minutes (see Figure 2). 200-300 times more sensitive than the wild type (Figure However, the extent to which S phase is inhibited in lH, 4hr timepoints).These quantitative data are in thesethree checkpoint mutants is clearly much less agreement with the previous qualitative report of LY- than the extent of inhibition in wild-type cells, since DALL and WEINERT (1995). the wild type is only approximately halfway through The rad9A radl 7A d24Atriple mutantis only par- S phase after four hours (Figure 1A). Hence, rad9A, tially defective at S phase regulation: The partial de- rad1 7A, and rad24A show attenuated, although notab- fects in S phase regulation in rad9A,radI7A, and sent (as in mcl-I and rad53), S phase regulation in rad24A as compared to the complete defect in mcl-1 response to MMS. In addition to the partial defect in and rad53could indicate thatRAD9, RAD17, and RAD24 S phase regulation, rad9A, rad1 7A, and rad24A have are each necessary for only a subset of functions that intermediate sensitivity to MMS; they are 30-60 times are dependent onmecl-1 and rad53 and that areneces- more sensitive than the wild type, and 10-180 times sary for thewild-type level ofS phase regulation. If each more resistant than the mcl-I and rad53 mutants (see were involved in a different subset of functions, rad9A, Figure 4, 4-hr timepoints). rudl7A, and rad24A double or triple mutants might RAD9 is in a different epistasis group from RAD1 7 have a complete defect in S phase regulation, similar to and RAD24: RAD9is in a different epistasis group from mecl-1 and md53. To test this possibility, we constructed S Phase Regulation in S. cereuisiae 51 rad9A radl 7A, radl 7A rad24A, and rad9A radl 70 is much less than the degree to which it is slowed in rad24A mutants and assessed their ability to regulate S the wild type. For example, 105 min after release into phase progression in response to MMS exposure. Nei- MMS, radl7A and rad24A have completed S phase, ther double mutant (data not shown) nor the triple whereas the wild type still shows significant accumula- rad9A radl 7A rad24A (Figure 1G) mutant showed the tion in the S phase (Figure 2). Note thesubtle, yet complete defect inS phase regulation displayed by the very reproducible (data not shown) difference between mecl-1 and rad53 mutants. The triple mutant may have rad9A and radl 7A or rad24A; rad9Acompletes S phase a slightly faster S phase than any of the single mutants slightly more slowly than radl 7A or rad24A (compare (compare Figure 1, D-G), although this reproducible 45-105-min timepoints, Figure 2). This difference is effect is at the limits of resolution for this assay. intriguing given that RAD9 is in a different epistasis Synchronization of cells in G1 before challengewith group from RAD17and RAD24 (FIGURE1H; LYDALLand MMS yields similar results and reveals thatrad1 7A and WEINERT1995), and it could be due either to different d24A progress through the cell cycle slightly faster requirements for these two epistasis groups within the than rad9A: It is possible that the apparent ability of S phase, to different requirements in G1, or both. For a particular mutantto regulate the rate of S phase pro- example, in addition to showing slightlyfaster progres- gression appropriately in response to MMS is affected sion to G2, radl 7A and rad24A may also showa slightly by the position of the cells in the cell cycle when the attenuated G1 delay than rad9A in response to MMS; cells are exposed to MMS. In fact, we have seen such an 15 min after release into MMS, all mutants and the wild effectwith other mutants(see Figure 5, radl8A mutant; type have a similar fraction of cells in G1,but at30 min A. G. PAULOVICH,R. U. MARGULIES and L. H. HART- after release, radl 7A and rad24A reproducibly have a WELL, unpublished observations). Therefore, to com- slightly smaller fraction of cells in the G1 peak than pare theS phase rates of these mutants morerigorously, does rad9A. However, one cannot distinguish G1 from we repeated these experiments with cells synchronized early S phase using this assay. To determine whether in the G1 phase and then released into the cell cycle combining mutations from the two epistasis groups in either the presence or the absence of MMS (Figure (Figure 1H) would result in a mecl-1- or rad53like com- 2). As previouslyshown (PAULOVICH and HARTWELL plete defect in S phase regulation, we constructed a 1995),wild-type cellssynchronized in G1 by alpha factor rad9A rad24A double mutant and tested its ability to treatment and then released into the cell cycle in the regulate S phase. The rad9Arad24A double mutant presence of MMS replicate their DNA more slowly than shows a defect in S phase regulation comparable to control cells that were not exposed to MMS. Cells com- the rad24A single mutant, consistent with results we plete replication within 30 min in the absence of MMS, obtained with the rad9.A radl 7A rad24A triple mutant whereas cells replicating in the presence of 0.033% (Figure lG). We conclude that doublemutants between MMS have still not completed replication 180 min after the two epistasis groups do not have the complete de- release from alpha factor arrest (Figure 2). Note that fect in S phase regulation seen in mal-l and rad53. S phase progression appears to be less slowed in this mecl-1 is lethal in the A364a background, and mecl-1 synchrony experiment than it was in the asynchrony strains in this background contain a second-site bypass experiment at the same dose of MMS (compare Figure suppressorof the essential function of mecl-1: We 1A and Figure 2,0.033% MMS). This is most likely due wished to combine mecl-1 with rad9.4, radl 7A, and to the fact that most cells would experience more le- rad24A mutations for a series of experiments described sions before entering S phase in the asynchrony experi- below. Whilecrossing mecl-1 strains to a variety ofother ment (Figure 1) than in the synchrony experiment (Fig- strains, we noted a preponderance of tetrads showing ure 2) for the same dose of MMS. Unlike cells in the 3:l segregation of viability (Table 2, cross one). The one synchrony experiment (Figure 2), the majority of cells dead segregant formed alarge (>50 cells) microcolony in the asynchronous culture spend at least 1 hr in MMS and was almost always inferred to have inherited a mcl- before entering S phase (Figure 1A). In fact, if the dose- 1 allele, based on the segregation of the hydroxyurea- response is compared between two synchrony experi- sensitive phenotype in the three viable spore products. ments, as well as between two asynchrony experiments, Likewise, in tetrads giving rise to only two viable segreg- it is clear that the degree towhich S phase is prolonged ants, the two dead segregants were almost always in- is directly proportional to the dose of MMS delivered ferred to be mecl-1. We hypothesized that mcl-1 is a (PAULOVICHand HARTWELL 1995; data not shown). lethal mutation that could be suppressed by a second- The rad9A, radl7A, and rad24A mutants behave sim- site mutation. To test this hypothesis, we obtained two ilarly in this synchrony experiment to theirbehavior in MECl (hydroxyurea-resistant) segregants from a tetrad the asynchrony experiment. All three mutants show a segregating 2:2 for viability (derived from a mecl-1 X G1 delay in response to MMS (Figure 2, compare 15- MECl diploid; see Table 2, cross one), assumed that min timepoints ? MMS), and all three mutants show these two segregants must have inherited the putative some slowing of S phase progression in MMS. However, suppressor, and crossed both to a mcl-1 strain (see the degree to which S phase is slowed in the mutants Table 2, crosses two and three). If the suppressor hy- 52 A. G. Paulovich et al.

TABLE 2 physically blocking DNA polymerase, thereby resulting The mecl-1 mutation is lethal in A364a in slowing of S phase progression. If the residual slowing of S phase progression in rad9A,radl7A, and Cross one: mal-1 X wt 22 X 4 viablespore tetrads (vst) rad24A were due to regulation, then the slowing would 52 X 3 vst require MECl and RAD53. However, if the slowing were 10 x 2 vsta due to the accumulation ofpolymerase-blocking le- 5 x 1 vst Cross two: mecl-1 X 38 X 4 vst sions, the slowing would not require MECl and RAD53. MECl spore #1 9 x 3 VSt To determine whether the slowing of S phase in these (suppressor?) 1 x 2 vst mutants was checkpoint-dependent, we constructed all 0 x 1 vst possible double mutant combinations between mecl-1, Cross three: mecl-1 X 36 X 4 vst rad53, rad9A, radl74, and rad24A and tested their abil- MECl spore #2 8 x 3 vst (suppressor?) 0 x 2 VSt ity to regulate S phase progression in response to MMS. 1 x 1 vst Cells were grown to mid-log phase, harvested, and resuspended in medium containing 0.033% MMS. Cul- a Both MECl viable spores from one of these tetrads showing 2:2 segregation for viability were crossedto a mecl-1 strain, tures were placed at 30°, and samples were withdrawn and the results are shown under cross two and cross three at hourly intervals. Under these conditions, examina- above. tion of the flow cytometry profiles after 2 and 4 hr of incubation with MMS allows the wild-type response to pothesis were correct, these diploids should behomozy- be distinguished from the mecl-I or rad53 responses gous for the presence of the suppressor and therefore and from the rad9A, radl7A, or rad24A responses (see should give riseto a preponderance of four viable spore also Figure 1, 2- 4hr timepoints); at the2-hr timepoint, tetrads. As can be seen from the datain Table 2 (crosses wild-type cells are predominantly in the early S phase, two and three),this is indeed the case. The majority of whereas radl 74 and rad24A are predominantly in late tetrads from both crosses contained four viable spores S phase and mecl-1 and rad53 are predominantly in the (38/48 and 36/45). We conclude that mecl-1 is lethal G2 phase (Figure 1, A-E and Figure 3). At the 4hr in the A364a background, but thatits essential function timepoint, wild-typecells remain in mid-S phase, can be bypassed by a second site suppressor, which we whereas radl 7A and rad24A mutant cells are now pre- call smll buppressor of mecl lethality). Furthermore, dominantly in the G2 phase (Figure 1, A-E and Figure the ability of smll to suppress mecl-1 is not dependent 3), and rad9A mutant cells are in late S phase. As can on RAD53, RAD9,RAD1 7, or RAD24 (see Figure 3). be seen in Figure 3, A and B, the more severe defects smll can also rescue the inviability of a meclA deletion of mecl-1 and rad53 are epistatic to the partial defects allele (E. FOSSand L. H. HARTWELL, unpublished obser- of rad9A, radl 7A, and rad24A, leading us to conclude vations). Hence smll bypasses the essential function of that the partial slowing of S phase progression in the MECI, but not its checkpoint function, showing that rad9A, radl 74, and rad24A mutants is indeed the re- the checkpoint function and the essential function of sult of a MECI- and RAD53dependent control. MECl can be genetically separated. MMS-sensitivityconferred by mecl-1 and rad9A is Aside from suppressingmecl-1, there is no other known additive: To determine whetherMECl acts in the same phenotype conferred by smll. Specifically, smll single mu- or in different pathways as the other checkpoint genes tants grow at wild-type rates, are not sensitive toHU, MMS, in responding to MMS, we assayed the sensitivity of all or UV-irradiation, do not have a meiotic defect, and show possible double mutants to MMS exposure. The smll wild-type levels of S phase regulation in responseto MMS mutation was present in each of these strains. In addi- (Figure 3; A. G. PAULOVICH,R U. MARGULIES and L. H. tion, to control for any other unknown modifiers that WWLL,unpublished data). Nonetheless, it was for- might be segregating in crossesamong these genetically mally possiblethat smZl could unexpectedlyconfer a phe- unstable mutants, two or three independent isolates of notype whencombined with other checkpoint mutations. each genotype were examined. The mecl-1 rad9A dou- To control for any such effects, allexperiments described ble mutant is 22 times more sensitive to MMS than the below in which mecl-1 is combined with another check- mecl-1 single mutant following 4 hr of exposure (Figure point mutation have been appropriately controlled for 44). In contrast, mecl-1 radl 74 (Figure 4B), mecl-I the presence of smll (Figure 3), such that all single and rad24A (Figure 4C), and mecl-I rad53 (Figure 4D) dou- double mutants being compared contain the smll muta- ble mutants all show sensitivities to MMS comparable tion (see Figure 3, Figure 4, A-D). to that of the mecl-1 single mutant, although mecl-1 The more severedefect of mecl-1 and rad53 mutants rad24A may be slightly more sensitive to MMS than is epistatic to the partialdefects of radSA, radl7A or mecl-1 (Figure 4C). We conclude that in response to rud24A: It was possible that the residual S phase slow- MMS, RAD9must haveat least one function notentirely ing in rad9A, radl 70, and rad24A was not a result of dependent onMECI. This greater effect of rad9A than regulation. For example, these mutations may result in radl 7Aor rad240 on the MMSsensitivity in the double the accumulation of DNA lesions that are capable of mutant is consistent with RAD9s being in a different S Phase Regulation in S. cprpvisim 53 B kA WT mecl-1 WT rad53

rad94 rad9il rad53rad9.4

radl 73 mecl-lradl74 radl 7~1 rad53radlz I

rad24-4 rad53rad24~ 2 Hr. 4 Hr. 2 Hr. 4 Hr. 2 Hr. 4 Hr.

FIGURE3.-The mcl-1 and rad53 phenotypes are epistatic to the rad9A, md17A, and md24A phenotypes. Exponentially growing populations of wild-type or checkpoint mutant cells were exposed to 0.03% MMS. Following 2 and 4 hr of continuous exposure, samples were removed and analyzed by flow cytometry. Each panel contains two histograms. Shaded histograms represent the cell cycle distribution of the asynchronous culture, before addition of MMS. Overlaid histograms represent the cell cycle distribution at various times after addition of MMS. All strains in B contain the smll supressor of mecl-1 lethality. Strains used are as follows: (A) wild type (7830-2-4a), md9A (yMP10789), rad17A (yMPI0365), md24A (yMP10366), rad53 (yMP10788), rad53 rad9A (yMP10952). rad53 rad17A (yMPI0796), rad53 rad24A (yMPl0961). (B) wildtype (yMP10863), md9A (yMP10887), rad17A (yMP10852), rad24A (yMPI0934), mcl-1 (vMP10844), mecl-I md9A (yMP10882), mpcl-1 rad17A (yMP10856), mcl-I md24A (yMP10936). epistasis group from RADl7 and RAD24 (Figure lH, shown in parentheses. Nucleotide excision repair-clefec- Figure 2; LYDALLand WEINERT 1995). tive mutants (mdlA, rad14A, rdl6A, rad26A) are Given that A4ECI and RAD53 are in the same epistasis relatively resistant to MMS and show significant accumu- group (Figure 4D), we expected RAD53 to show the lation within the S phase in response to MMS, similar to same epistatic relationship toRAD9, RADl 7, and RAD24 the wild-type control. Recombination-defective mutant$ as does MECI. Consistent with this expectation, rad53 (rd5lA, rad52-1, and rd54A) are considerably more rad9A double mutants are more sensitive to MMS than sensitive to MMS than the wild type, although each shows is the rad53 single mutant(Figure 4E), and rad53 accumulation within the S pha$e similar to the wild type radl 7A (Figure 4F) and rad53 rad24A(Figure 4G) dou- in response to MMS. rcull8A, involved in postreplication ble mutants have sensitivity to MMS that is comparable repair, showssensitivity to MMS comparable to mcl-1 to, although slightly greater than, the rad53 single mu- and rd53, yet shows wild-type S phase regulation. [Al- tant. though at the4hr timepoint this mutant appears to have Defects inS phase regulation are specific to checkpoint a defect in S phase regulation similar to rd24A, we have mutants: To determine whether all mutations that con- followed up thisstudy with careful synchrony experi- ferred sensitivity to MMS showed a defect in S phase ments (data not shown) that clearly demonstrate normal regulation, we surveyed a large collection of DNA repair S phase regulation in this mutant in response to MMS. mutants using the protocol in Figure 3. The results are We suspect that the apparentdifference between rd18A shown in Figure 5, which is organized such that the first and the wild type in this asynchrony experiment may be column shows the 2- and 4-hr timepoints for A364a wild- due to differences in the cell cycle distribution of the type and checkpoint mutant strains, the second and third starting cultures of these two strains, and therefore any columns show the corresponding timepoints for a panel mutant showing an apparentdefect in S phase regulation of DNA repair mutants that we constructed in the A364a in an asynchrony experiment was examined in a syn- background for direct comparisons with known check- chrony experiment (Figure 2)]. point mutants. The fourth and fifth columns show the One quantitatively minor (SINGER and GRUNRERGER same timepoints for several mutants we obtained from 1983) yet highly mutagenic lesion (reviewed in other labs, in addition to a congenic wild-type control for FRIEDBERGet al. 1995) induced by MMS is 06methyl- each. The viability ofeach mutant at the 2-hr timepoint is panine. This lesion is removed by an 06methylgua- 54 A. G. Paulovich et al.

rad9A rad53 rad53 rad9A "-{ , , f\,j mecl rad9A 0.0001 012345 012345 Hours In MMS Hours In MMS B F

WT WT

rad 174 rad77A

rad53 mecl rad53 radl7A mecl rad1 76 0.001 i o.wo1 I 0.0001 I 012345 012365 Hours in YPS Hours in MMS C G

radZ4A rad53 rad53 radZ4A .-$ .-$ mecl rad24A Onol 1 I O.M)Ol,, O.M)Ol,, 012345 012395 Hours in MMS Hours in MMS

W 5- n 5 8 rad53 mecl rad53 mecl

0.m1 I 012345 Hours in MMS S Phase Regulation in S. cmeuisiue 55 nine DNA repair methyltransferase, which reverses the by the APNl gene (POPOFF et al. 1990; RAMOTAR et al. damage by transferring the methyl group to a cysteine 1991). To determine whetherthis pathway of base exci- residue of the protein, thereby permanently inactivat- sion repair was necessary for S phase regulation in re- ing its methyltransferase activity (reviewedin FRIEDBERG sponse to MMS,we constructed maglA and apnlA et al. 1995). To determine whetherthis activity was nec- strains and examined their responses to MMS. Neither essary for S phase regulation, we disrupted the MGTl mutant replicated rapidly in the presence of MMS, and gene, which encodes the yeast 06-methylguanine meth- in fact, both seemed to progress more slowly than the yltransferase (XLAOet al. 1991). During the course of wild type (Figure 5; data not shown). We conclude that our experiments, we noticed that the mgtlA mutant MAGl and APNl are not necessary for S phase regula- failed to grow at 36" but was viable at 30". The tempera- tion in response to MMS. ture-sensitivity cosegregated with mgtlA in over 100 tet- The slower progression of these mutants is likely ex- rads examined from several independent crosses (A. G. plained by the fact that they are removing lesions at a PAULOVICHand L. H. WWLL,unpublished observa- slower rate than wildtype and therefore experience tions). [Upon shifting to the nonpermissive tempera- more lesions. However, we know that the merepresence ture for 5 hr, a log phase starting cultureof mgtlA cells of lesions is not sufficient to slow S phase progression; became uniformly arrested with a G1 DNA content but mecl-1 and rad53 mutants replicate rapidly in the pres- remained viable, and no induction of mutation oc- ence of MMS. Therefore, other functions (possibly re- curred (A. G. PAULOVICH,R. U. MARGULIES and L. H. pair machinery) must be able to interact with lesions HARTWELL, data not shown) .] At the permissive temper- to slow down S phase progression in the absence of ature (30"), the mgtlA mutant showed an S phase re- MAGI- and APNldependent base excision repair. The sponse comparable to thewild type (Figure 5). We con- maglA and apnlA mutants have intermediate sensitiv- clude that MGTl is essential for the Gl-S transition at ity to MMS (Figure 5), consistent with the existence of 36", but is not essential for S phase regulation at 30" in other pathways for dealing with these lesions. response to MMS. Therefore, despite our observation that BER-defi- The most abundant lesion induced by MMS is N7- cient mutants defective in removing MMSinduced le- methylguanine (SINGERand GRUNBERGER1983). An- sions are nonetheless proficient at S phase regulation, other N-alkylpurine, 3-methyladenine, is also induced it is still possible that lesion removal is responsible for by MMS (SINGER and GRUNBERGER1983). Although this the slowing of S phase progression in response to MMS. is a minor lesion quantitatively (SINGERand GRUNB This is because it is probable that several pathways are ERGER 1983), itis believed to be biologically important responsible for removing lesions, such that asignificant because it blocks the passage of a DNA polymerase in amount of repair might be occurringin any givensingle vitro (BOITEUXet al. 1984). These lesions are removed repair mutant. Infact, there is precedent for alternative by a baseexcision repair pathway (BER) in which a modes of repair of alkylation damage in E. coli (SAMSON DNAglycosylase removes the alkylated base, thereby et al. 1988; VOIGTet al. 1989). We constructed a radlA formingan abasicsite (reviewed in FRIEDBERGet al. maglA mgtlA triple mutant, defective in both nucleo- 1995). The abasic site is recognized by an apurinic/ tide and base excision repair as well as the direct rever- apyrimidinic (A€')-endonuclease,which nicks the DNA sal of 06-methylguanine, and determined its S phase backbone 5' to the abasic site and leads to its removal response to MMS. The triple mutant exhibited S phase (reviewed in FRIEDBERGet al. 1995). In S. cermisiae, the regulation; in fact, it showed an even greater slowing glycosylase activity isencoded by the MAGl gene (CHEN of cell cycle progression than the wild type (data not et al. 1989, 1990), and the A€'-endonuclease is encoded shown), similar to the maglA single mutant. We con-

FIGURE4.-MMS kill curves of checkpoint single and double mutants. Exponentially growing populations of yeast cells were subjected to continuous exposure to 0.03% MMS. At the indicated times after exposure, samples were removed, diluted, and plated for determination of viability. All kill curves are the mean of at least two or three independent experiments, mostly performed on independent segregants (as indicated below), and the range or the SD (see MATERIALS AND METHODS) is shown for each data point. Note that all strains in graphs containing mecl-1 carry the smll suppressor. (A) Wild type [yMP10860 (4X); yMP10863(4X)], rud9A [yMP10887(1X);yMPl0889(1X)], mecl-l [yMP10844(2X);yMP10847(2X)], mecl-1rud9A [yMP10882(1X); yMP10884(1X); yMP10886(1X)]. (B) Wildtype [yMP10860 (4X); yMP10863(4X)], rudl7A [yMP10852(1X); yMP10845(1X)], mecl-1 [yMP10844(2X); yMP10847(2X)], mecl-1 rudl7A [yMP10850(1X); yMP10853(1X)]. (C) Wildtype [yMP10860 (4X); yMP10863(4X)], rud24A [yMPl0932(1X); yMP10934(1X)], mecl-1 [yMP10844(2X); yMPlO847(2X)], mecl-1 rud24A [yMP10931(1X);yMP10936(1X); yMP10942(1X)]. (D) Wildtype [yMP10860(4X);yMP10863(4X)], mecl-1 [yMP10844(2X);yMP10847(2X)], rad53 [yMPl1069(1X);yMP11070(2X); yMP11071(1X);yMP11072(1X); yMP11073(1X); yMPl1074(1X)], mecl-1 rud53 [yMP10903(1X); yMP10904(1X)]. (E) Wild type [7830-2-4a(4X)], rud9A [yMP10177(5X)], rad53 [yMP10944(1X);yMP10949(1X); yMP10951(1X); yMP10955(1X)], rad53rud9A [yMP10943(1X);yMP10947(1X); yMP10952(1X);yMP10953(1X); yMP10954(1X); yMP10956(1X)]. (F) Wildtype [7830-2-4a(4X)], rudl7A [yMPl0365(4X)], rud53 [yMP10944(1X); yMP10949(1X); yMP10951(1X); yMP10955(1X)],rad53 rudl7A [yMP10796(2X); yMP10798(1X)]. (G) Wild type [7830-24a(4X)], rud24A [yMP10366(4X)], rad53 [yMP10944(1X); yMP10949(1X); yMP10951(1X); yMP10955(1X)], rad53 rud24A [yMP10801(2X); yMP10961(1X); yMP10964(1X)]. 56 A. G. Paulovich PI crl.

A364A A364A Mutants Controls: Surveyed: Other Backgrounds:

rad24A (4Yo) rad784 (<0.01%) mgtld (43%) Sad$-7 (6'10) 2 Hr. 4 Hr.

mad3 (59%) m/h7(55%)

2 Hr. 4 Hr. 2 Hr. 4 Hr.

FIGURE5.--General survey of mutants for defects in S phase regulation. Exponentially growing populations of wild-type or mutant cells were subjected to continuous exposure to0.03% MMS. Following 2 and 4 hr of continuous exposure, samples were removed and analyzed by flow cytometry. Each panel contains two histograms. Shaded histograms represent the cell cycle distribution of the asynchronous culture, before addition of MMS. Overlaid histograms represent the cell cycle distribution at various times after addition of MMS. For comparison, profiles of wild type (7830-24a and yMP10381), mwl-I (vMPI0848), and md24A (yMP10366) are reproduced in column one. The viability of each strain at the 2-hr timepoint is shown in parentheses. All strains in columns 1-3 were constructed in this laboratory and are in the A364a background. All strains in columns 4 and 5 were obtained from other laboratories (as indicated in Table l), and the appropriate parental wild-type controls are shown above each mutant. Strains used were as follows: wild type (7830-24 and vMPl0381),mPrl-I (yMP10848), md24A (vMPlO366), mdlA (yMP10261), ~nd14A(yMP10519), ~ndl6A(yMP10447), yndl8A (vMP10425), md26A (vMP10507), md51A (yMP10428), md52-I (yMP10247), mnd3A (yM11058), md54A (yMP10910), nplA (yMP10590), mnglA (vMP10464), mgtlA (yMPl0333), mh2A (yMP10521), PmslA (yMP11082), ym3A (vMP10382). mlhlA (yMP10983). DUN1 (Y202), dunl-AI00 (Y286), SAD4 (Y80), snd4-I (sad4-l), TELI (TELl), 1d1A (tell), POL30 (W38+pRLP1 l), po130-46 (W38+p230-46), po13O-52 (PY38+p230-42). Phase RegulationS Phase in S. cerevisiae 57 clude that itis neither the presenceof RAD1-dependent tive to HU, and its checkpoint status has not been well nucleotide excision repair northe presence of 06 characterized (ALLEN et al. 1994; STEVEELLEDGE, per- methylguanine DNA methyltransferase that slows S sonal communication). Talhas functions that arepar- phase progression in maglA mutants. tially redundant with MECl (MORROW et al. 1995); al- It was possible that the residual S phase slowing in though tellA single mutants have no known checkpoint the repairdefective mutants was not a result of regula- defect, tell shows several genetic interactions with mecl tion. For example, these mutants may experience the (MORROWet al. 1995; SANCHEZet al. 1996). POL30 en- accumulation of DNA lesions that are capable of physi- codes the s. cerevisiae proliferating cell nuclear antigen cally blocking DNA polymerase, thereby resulting in (PCNA) (BAUERand BURGERS1990), a processivity fac- slowing of S phase progression. To determine whether tor for Pol6 and Pole that has also been shown in mam- the slowing ofS phase in these mutants was checkpoint- malian cells to function in excision repair (NICHOLS dependent, we constructed mecl-1 mgtlA, rad53 apnlA, and SANCAR 1992; SHIVJIet al. 1992). Mutant alleles of and rad53 rad5lA doublemutants and determined POL30 that confer sensitivity to MMS have been isolated their responses to MMS. All three representative double (AWAGARIet al. 1995). We show that Po130-46, Po130-52, mutants behaved like the mecl-1 and rad53 single mu- sad4-1, and tellA are not required for S phase regula- tants, showing no significant accumulation of cells tion in response to MMS (Figure 5). Interestingly, the within the S phase (data not shown).We conclude that p0130-52 mutant, which is 200 times more sensitive to the slowing of S phase in these repair mutants is the MMS thanthe wildtype (Figure 5, 2-hr timepoint), result of a MECI- and RADSMependent control. shows slower cell cycle progression than the wild type. REV3 encodes a putative DNA polymerase in S. cermis- This phenotype is reminiscent of the maglA and apnlA iae (MORRISONet al. 1989). Although rm3A mutants are mutants, and is consistent with all ofthese genes playing viable, they do not give rise to mutations following UV- a role in the removal of MMSinduced lesions. While irradiation, leading to the hypothesis that Rev3pis a dunl-A100 clearly does not show a mecl-like complete DNA polymerase that allows cellsto replicate using muta- defect in S phase regulation, it may replicate slightly genic trans-lesion synthesisin the presence of DNA dam- faster than its wild-type control. This observation may age (MORRISONet al. 1989; NELSONet al. 1996).We con- be worth following up on, especially since DUN1 is be- sidered the possibility that Rev3p mayreplace the normal lieved to be a downstream effector of RAD53 (ALLEN et replicative polymerase when replication is occurring in al. 1994). the presence of MMS damage, and therefore that REV3 Yeast cells encountering DNA damage during the S might become essential for DNA replication in the pres- phase experience the induction of replication-depen- ence of MMS or may even be a target for mechanisms dent sister chromatid exchange (KADYKand HARTWELL slowing down S phase progression in response to MMS. 1993) as well as the induction of mutations (OSTROFF However, we constructed a rm3A mutant in the A364a and SCLAFANI1995). Mutations are thought to occur background and found its S phase response to MMS to when DNA polymerase replicates across a DNA lesion be similar to that of the wild type (Figure 5). We con- capable of mispairing with a noncognate base (reviewed clude that REV3 is neither required for replication in in NAEGLI1994). This so-calledtrans-lesion synthesis the presence of MMS, nor required for regulation of S is believed to be dependent on REV3 in S. cermisiae phase progression in response to MMS. (MORRISON et al. 1989; NELSONet al. 1996). Replication- Methyldirected mismatch repair is an established ex- dependent sister chromatid exchange is believed to oc- ample of coupling between DNA replication and DNA cur when DNA polymerase encounters a lesion that is repair (reviewed in FRIEDBERGet al. 1995). We wished either capable of blocking the polymerase or of induc- to test the possibility that the yeast mismatch repair ing it to switch DNA templates (reviewed in NAEGLI system played a role in S phase regulation. We con- 1994). These sister chromatid exchange events, at least structed msh2A, PmslA, and mlhlA mutants and deter- in response to W-irradiation, are dependent on theS. mined their cell cycle response to MMS exposure. All cermisiae RALI52 gene ( KADYKand HARTWELL 1993).We three of these mutants show significant accumulation hypothesized that these two potentially special modes within the S phase in response to MMS (Figure 5). We of replication, and therefore that at least one of the concludethat MSH2,PMSI, and MLHl arenot re- RAD52 and REV3 genes, might be necessary for replica- quired for S phase regulation in response to MMS. tion in the presence of MMS. However, we constructed Finally, we tested four mutants obtained from other a rev3A rad52-1 double mutant and determined that it labs for S phase regulation defects: Dunlp is a protein had an S phase response to MMS that was comparable kinase that is phosphorylated in response to DNA dam- to the wild type (data not shown). age (ZHOU and ELLEDGE1993). Its phosphorylation is Not all mutations conferring checkpoint defects re- dependent onRAD53 and results in the transcriptional sult in loss of S phase regulation: MAD3 is necessary induction of a variety of genes in response to DNA for thespindle assembly checkpoint thatmonitors chro- damage (ALLEN et al. 1994). However, this mutant has mosome alignment and the structure of the mitotic no known checkpoint defect. The sad4 mutant is sensi- spindle (LI and MURRAY1991). mad3A mutant cells are 58 A. G. Paulovich et al. no more sensitive to MMS than the wild type and show remove DNA damage more efficiently or to tolerate wild-type S phase regulation in the presence of MMS DNA damage more efficiently than would be possible (Figure 5). We conclude that MAD3 is not necessary during an unrestrained S phase. for S phase regulation in response to MMS. The molecular basis of the difference between the PDSl/ESP2 was identified as a Ts- mutant that is complete and the partial defect in S phase regulation: sensitive to transient exposure to microtubule inhibi- In this report, we demonstrate that rad9A, radl 7A, and tors as a result of precocious separation of sister chro- rad24A all are defective in S phase regulation, although matids and the formation of aploid cells (YAMAMOTOet to a lesser extent than mcl-1 or rad53. The difference al. 1996a,b). PDSl is also necessary to block anaphase between these two phenotypes could be quantitative or at therestrictive temperature in cdclb, cdc20, cdc23, and qualitative. One example of a quantitative difference is cdcl3, and this is the first gene shown to play a role in that rad9A, radl 74, and rad24A could be capable of the control of mitosis in response to both spindle and responding to all of the signals that induce slowing of DNA defects (YAMAMOTO et al. 1996a,b). The pdslA S phase in the wild type, but that the efficiency of the mutant is inviable at 37", but viable at 23" (YAMAMOTO response is attenuated. For example, the rad9A, et al. 1996a,b; A. G. PAULOVICH,E. JENSEN, S. FRIEND radl 70, and rad24A mutants may be less efficient at and L. H. HARTWELL, data not shown). We constructed detecting lesions than the wild type, whereasmecl-1 and a pdslA mutant in the A364a background and found rad53 could be completely defectivein detecting le- its S phase response to be comparable to the wild type sions. Alternatively, the replication fork might be de- during continuous exposure to 0.01% MMS at 23" (A. layed every time it encounters a lesion. If mcl-l and G. PAULOVICH,R. U. MARGULIES and L. H. HARTWELL, rad53 mutants did not pause at all, whereas both the unpublished observations). We conclude that PDSl is wild type and the rad9A, radl 7A, and rad24A mutants not necessary for S phase regulation in response to are able to pause, but the length of time over which MMS. Hence, PDSl is the first example of a geneneces- the delay can be maintained is longer in the wild type sary for the regulation of mitosis in response to DNA than in the mutants, this quantitative difference might damage that is not necessary for the controlof S phase manifest itself as a partial defect in S phase regulation. in response to DNA damage. Alternatively, the different phenotypic classes might be due to qualitative differences in the ability of the DISCUSSION mutants to respond to DNA damage, as illustrated in the following four models. The basisof S phase regulation: We recently demon- First, different genes might be necessary for detecting strated that in wild-type s. cerevisiae the rate of ongoing different types of DNA lesions. Exposureto MMS induces S phase is slowed, although notblocked, when the DNA a variety of DNA lesions, both directly (N7"methylgua- is subjected to alkylation damage by exposure to MMS nine, OGmethylguanine, %methyladenine) and as a re- (PAULOVICHand HARTWFLLL1995). In contrast, mcl-1 sult of lesion processing (abasic sites, nicks, gaps,double- or rad53 mutants replicate damaged and undamaged strand breaks). Each of these lesions may be recognized DNA at comparable rates, ruling out a model in which by a distinct repair complex that, once bound to the lesions alone are able to slow replication and demon- lesion, activatesa signal transduction pathway and results strating that the slowing of S phase is an active process. in the slowingof S phaseprogression. If MECl and In this report, we extend these findings by demonstra- RAD53 were necessary for recognizing all types of lesions ting that other genes involved in the DNA damage and if RAD9, RADl 7, and RAD24 were only necessary for checkpoint (RAD9,RADl 7, and RAD24) also playa role detecting a subset of lesions, one would predict the two in regulating the S phase rate, although to a lesser ex- phenotypic classes that we observe. There is a precedent tent than MECl and RAD53. for lesionspecificity in activating a RADPdependent These results raise three related issues: (1) What is checkpoint; wild-type cells delay in the G1 phase in re- the purpose of the slowed S phase? (2) What is the sponse to UV-irradiation. This delay is RADPdependent molecular basis of the slowed S phase? (3) What is the in an excision repair-proficient background, but RAD9 basis of the difference between the dramatic defect seen independent in an excision repairdefective background, in mecl-1 and rad53 and the partial defect seen in leading to the hypothesis that excision tracts but not un- rad9A, radl 74, and rad24A? Since mutations that par- excised dimers activate the RADPdependent checkpoint tially or completely eliminate S phase regulation confer pathway (SIEDEet al. 1994). sensitivity to MMS and since thedegree to which a Second, different genes might be necessary for de- mutant is sensitive correlates with the severity of the S tecting lesions in different topographical regions of phase defect (Figures 2 and 4), we suggest that the chromosomes. For example, MECl and RAD53 might slowingdown of S phase progression allowscells to be necessary to recognize lesions anywhere along the better survive DNA damage. Since we presume that it length of the chromosome to activate a signal to slow is the DNA lesions that are causing the lethality, we S phase. In contrast, if RAD9 wereonly required to propose that S phase regulation allows cells either to recognize lesions in telomeric regions, the mecl-1 or Phase Regulation in Regulation S Phase S. cmevisiae 59 rad53 mutants would send no signal to the replication G1-S and the G2-M boundaries are dependent on the apparatus in response to global DNA damage, whereas same genes that regulate S phase progression is that rud9A would send an attenuated signal, potentially re- these genes may be DNA repair proteins involved in sulting in the two observed phenotypic classes. generating the signal for cell cycle arrest (LMALLand Third,different genes might be necessary for de- WEINERT1995). The demonstration that the accumula- tecting lesions in different functional regions of chro- tion of single-stranded DNA at telomeric regions in a mosomes. For example, transcribed and untranscribed cdcl? mutant incubated at the nonpermissive tempera- strands of DNA have been shown in many organisms, ture is dependent on RAD24 provides support for this including yeast (SMERDONand THOMA1990; SWEDER hypothesis (LYDALL and WEINERT1995). and HANAWALT 1992), to be differentially repaired fol- Relationship between regulationof S phase rate and lowing some types ofDNA damage. Transcribed strands the HU-responsive S-M checkpoint: In addition to the are repaired more rapidly than untranscribed strands, checkpoint that slows the rate of S phase progression and this more rapid repair, called transcription-repair in response to DNA lesions, yeast cells have a second coupling, is dependent in yeast on RNA polymerase I1 checkpoint control within the S phase. When wild-type activity as well as other NER genes (SWEDERand HANA- cells are treatedwith HU, replication ceases, cellsarrest WALT 1992, 1994; VAN GOOLet ul. 1994). If checkpoint within S phase, the mitotic spindle does not elongate, genes were differentially necessary for processing le- and cells remain arrested and viable over many hours. sions in different functional regions of chromosomes, In contrast, when mecl-1 or rad53 cells are treated with such as transcribed us. nontranscribed regions, two phe- HU, replication ceases, cells arrest in mid-S phase, but notypic classes might be predicted. the mitotic spindle does elongate, resulting in a mitotic Fourth, different genes might be necessary for con- catastrophy and cell death (ALLEN et al. 1994; WEINERT trolling initiation and elongation during the S phase. et al. 1994). Therefore,in HU, Meclp andRad53p must It is possible that regulation of replication rate in re- target the mitotic apparatus to inhibit spindle elonga- sponse to damage is the result of a delay of late replication. In contrast, when wild-type cells are treated with tion origin firing within S phase, a decrease in the num- sublethal doses of MMS, the replication rate is slowed ber of origins used, a decrease in the rate of elongation by a MECI- and RALl53dependent control, indicating of nascent DNA strands, or some combination of the that in MMS, Meclp and Rad53p must target the repli- above. Technical limitations make it difficult to distin- cation machinery either directly or indirectly to slow S guish among these possibilities. If the regulated S phase phase progression. DNA polymerase (Pole) senses progression that we have described is due to both inhi- stalled replication in HU and sends a signal, potentially bition of origin firing and inhibition of elongation, and via MECl and RALl53, to inhibit anaphase (NAVASet al. if these two processes have differential requirements 1995). In response to MMS, a polymerase may or may for checkpoint genes, two phenotypic classes might be not be a sensor of damage, yet it is almost certainly, predicted. Another related possibility is that the mu- either directly or indirectly, a target of MECI and tants showing the subtle defect might be deficient in RAD5Mependent mechanisms that slow S phase pro- the G1 DNA damage checkpoint, whereas mcl-1 and gression. rud53might be defective in both theG1 and the S phase The dependenceof both of these seemingly different controls. controls on MECl and RAD53 raises the possibility that Relationship betweenS phase regulationand G1 and both targets, the mitotic apparatus and the replication C2 checkpoints: DNA damage-induced delays at the machinery are inhibited in a h4EC1- and RAD53depen- GI5 and the G2-M boundaries are also dependent on dent mannerwhenever wild-type cellsare treated either these same checkpoint genes, raising the issue of how with HU or with MMS (ie., that Meclp and Rad53p these genes function at so many intervals in the cell target the replication machinery in addition to the mi- cycle. One possibility was that the G1 and G2 check- totic apparatus in cellstreated with HU, and that Meclp points are actually the extreme beginning and the ex- and Rad53p target the mitotic apparatus in addition to treme end of S phase, and that all delays actuallyoccur the replication machinery in cells treated with MMS). during the S phase. This hypothesis is apparently ruled It is possible that we may only appreciate one or the out by experiments that have mapped the G1 check- other of the targets in HU or MMS because of the point upstream of the cdc7arrest (SIEDEet al. 1994) and nature of the experiments and the drugs being used. the G2 checkpoint downstream of nocodazole arrest For example, it may be impossible to detect differences (ALLEN et al. 1994). However, chromosome I11 se- in S phase rates in HU-treated cells and impossible to quences have been found to replicate in cells arrested detect differences in the timing of anaphase relative to at cdc7 (REYNOLDS et al. 1989), and,while it is true that DNA replication in MMStreated cells. This is because nocodazole-arrested cells have a G2DNA content as HU inhibits ribonucleotide reductase, resulting in a assayed by flow cytometry, it is formally possible that a depletion of deoxyribonucleotides (YARBRO 1992) that small amount of replication has not been completed. may cause replication to cease altogether due to a lack Another possibility for why checkpoint delays at the of nucleotides. This effect would make it impossible to 60 A. G. Paulovich et al. assay effects ofmcl-1 or rad53mutations on the S phase single-stranded regions by the action of a putative rate in HU. Similarly, mecl-1 and rad53 mutants repli- RAD17-, RAD24-, and “dependent exonuclease, cate so rapidly in MMS that it is impossible to determine the activity of which is antagonized by RAD9 (LYDALL the relative timing of completion of replication and and WEINERT1995). The role of these genes in pro- spindle elongation. Hence, theHU and theMMS exper- cessing DNA lesions could explain why they function iments may be complementary in that each may assay in regulating S phase in response to MMS but are not an aspect of the control that cannot be detectedusing necessary for cell cycle arrest in response to HU. It is the other. possible that MMS, but not HU (LYDALLand WEINERT Consistent with the idea that MECI and RAD53 play 1995),induces lesions that must be processed in a a role within the S phase in HU (in addition to the RAD9-, RADl7-, and RADBMependent manner to gen- inhibition of mitosis), the fission yeast husl mutation, erate an activating signal for MECI- and RAD53depen- which confers HU-sensitivity and a defect in SM con- dent S phase regulation. trol, causes lethality in HU before the onset of mitosis, In contrast to the budding yeast, the majority of fis- leading to thesuggestion that this gene might also have sion yeast checkpoint genes are required for both the a function within S phase (ENOCHet al. 1992). Itwould S” and the G2-M checkpoints, and there areeven dis- be interesting to determine whetherlower doses of HU crepancies between homologues from the two species that slow, yet do not halt, DNA replication in the wild in their roles in the checkpoints. For example, radl 7A typewould also slow DNA replication in mcl-1 and from S. cereuisiae is not defective in the S” checkpoint rad53. in response to HU (WEINERTet al. 1994), whereas its Our findings that RAD9, RADl 7, and RAD24 play a Schizosaccharomyces pornbe homologue, radl+, is required role in regulating S phase progression in response to for the S” checkpoint (AL-KHODAIRY and CARR 1992; MMS provide another distinction between the check- ENOCHet al. 1992; ROWLEYet al. 1992). Our finding that point controlling S phase progression in response to RAD9, RADl7, and RAD24 do play a role in regulating S damage and thecheckpoint that inhibits anaphase phase progression was unexpected since these genes when DNA replication is inhibited by HU or by Cdc8p had not previously been shown to play a role in check- limitation. rad9A, radl 7A, and rad24A mutants have point controlwithin the S phase in s. cereuisiae. Whether no known defect in the SM checkpoint in response to the newfound requirements for RAD9, RADl7, and HU (WEINERTet al. 1994); however, they all havepartial RAD24 for control within the S phase in S. cereuisiae defects in regulating S phase progression in response may help address this apparent incongruence between to MMS. Hence, mutants that are completely defective budding and fissionyeast checkpoints (LYDALLand in S phase regulation in response to MMS (mecl-I and WEINERT1995) remains to be seen. rad53) are also defective at inhibiting mitosis when rep We thank TEDWEINERT and DAVID LYDALLfor providing strains lication is stalled with HU, whereas mutants thatconfer and for discussions, STEVE BELLand BRUCESTILLMAN for the flow only partial defects in S phase regulation in response cytometty protocol, members of the L. HARTWELL lab for comments to MMS (rad9A, radl 7A, and rad24A) are proficient on the manuscript, and especially DAVEToc~rj~l for providing the at inhibiting anaphase in response to HU (although mad3A mutant and for many formative discussions and ERICFOSS the possibility that some unrecognized aspects of the for helpful comments on this manuscript and for allowing us to cite unpublished results. We also thank STEVEFRIEND, ELIZABETH JENSEN cell cycle continue in HU-treated rad9, radl 7, or rad24 and BRIANTHORNTON of the Seattle Project for providingthe mlhlA, mutants cannot be excluded). This correlation may be pmslA, and pdslA mutants, STEVEELLEDGE for providing dun1 and due to differential requirements for processing of HU- sad4 mutants, PETERBURGERS for providing pot30mutants,TOM FETES and MMSinduced lesions. for providing the tellA mutant, RODNEYROTHSTEIN for suggesting RAD9 and RAD24 have been shown to affect the pro- the sml acronym, KINGSHUK CHOUDHURYand JOE FEISENSTEINfor help with statistical analysis, and MAIJA MEEKSfor tetrad dissection. cessing at least one type of DNA lesion (LYDALLand This workwas supported by the National Institutesof Health, General WEINERT1995). The temperature-sensitive cdcl3 mu- Medical Sciences grant GM-17709 and the American Cancer Society tantundergoes a RADP, RADl7-, RAD24, MECI-, (to L.H.H.) and a Merck Distinguished Fellow Awardand anM.S.T.P. RAD53, PDSl- and MECMependent G2 arrest at the Award (to A.G.P.). restrictive temperature (WEINERTand HARTWELL 1993; WEINERTet al. 1994). Arrested cells undergo a strand- LITERATURE CITED specific accumulation of single-stranded DNA (ssDNA) AL-KHODAIRY,F., and A.M. CARR,1992 DNA repair mutants defin- at telomeres ( GARVIKet al. 1995), leading to thehypoth- ing G2 checkpoint pathways in Schimsaccharomyces pornbe. EMBO esis that ssDNA constitutes a signal for activation of the J. 11: 1343-1350. ALLEN,J. B., 2. ZHOU,W. SIEDE,E. C. FRIEDBERCand S. J. ELLEDGE, checkpoint (GARVIKet al. 1995). Whereas cdc13 rad9A 1994 The SADl/RAD53protein kinase controls multiple check- mutants accumulate ssDNA earlier than the wild type, points and DNA damage-induced transcription in yeast. Genes cdcl3 rad24A mutants do not accumulate measurable Dev. 8: 2416-2428. AWAGARI,R., K. J. IMPELLIZZERI,B. L. YODER,S. L. GARY and P. M. J. ssDNA at all (LYDALLand WEINERT1995). These results BURGERS,1995 A mutational analysis of the yeast proliferating have led to a model inwhich cdcl3induced DNA cell nuclear antigen indicates distinct roles in DNA replication damage results in lesions that are processed into large and DNA repair. Mol. Cell. Biol. 15: 4420-4429. Ph ase RegulationS Phase in S. cerevisiae 61

BAUDIN,A., 0. OZIER-KALOGEROPOULOS,A. DENOUEL, F. LACROUTE thymine dimer bypass by yeast DNA polymerase z. Science 272: and C. CULLIN,1993 A simple and efficient method for direct 1646-1649. gene deletion in Saccharomyces cm.iae. Nucleic Acids Res. 21: NICHOLS,A. F., and A.SANCAR, 1992 Purification of PCNA as a 3329-3330. nucleotide excision repair protein. Nucleic Acids Res. 20 2441- BAUER,G. A,, and P. M. J. BURGERS,1990 Molecular cloning, struc- 2446. ture andexpression ofthe yeast proliferating cell nuclear antigen OSTROFF,R. M., and R.A. SCLAFANI, 1995 Cell cycle regulation of gene. Nucleic Acids Res. 18: 261-265. induced mutagenesis in yeast. Mutat. Res. 329 143-152. BOITEUX,S., 0. HUISMANand J. LAVAL,1984 3"ethyladenine resi- PAINTER,R. B., and B.R. YOUNG, 1980 Radiosensitivity in ataxia- dues in DNA induce the SOS function s$A in Escherichia coli. telangiectasia: a new explanation. Proc. Natl. Acad. Sci. USA 77: EMBO J. 3 2569-2573. 7315-7317. WRNES,J., and C. I. DAVERN,1966 Effect of 32P decay upon DNA PAULOVICH,A. G., and L. H. HARTWELL,1995 A checkpoint regu- synthesis by a radiation-sensitive strain of Escherichia coli. J. Mol. lates the rate of progression through S phase in S. cereuisiae in Biol. 17: 418-427. response to DNA damage. Cell 82: 841-847. CARR, A.M., 1995 DNA structure checkpoints in fission yeast. POPOFF,S. C., A. I. SPIRA,A. W. JOHNSON and B. DEMPLE,1990 Yeast Semin. Cell Biol. 6: 65-72. structural gene (APNI) for the major apurinic endonuclease: CHEN,J., B. DERFLER,A. MASKATI and L. SAMSON,1989 Cloning a homology to Escherichia coli endonuclease lV. Proc. Natl. Acad. eukaryotic DNA glycosylase repair gene by the suppression of a Sci. USA 87: 4193-4197. DNA repair defect in Escherichia coli. Proc. Natl. Acad. Sci. USA RAMOTAR,D., S. C. POPOFF, E. B. GuuandB. DEMPLE,1991 Cellu- 86: 7961-7965. lar role of yeast Apnl apurinic endonuclease/3'diesterase: re- CHEN,J., B. DERFLERand L. SAMSON,1990 Saccharomyces cereuisiae 3- pair of oxidative and alkylation DNA damage and control of methyladenine DNA glycosylasehas homology to the AlkA glyco- spontaneous mutation. Mol. Cell. Biol. 11: 4537-4544. sylase of E. coli and is induced in response to DNA alkylation REYNOLDS,A. E., R. M. MCCARROLL,C. S. NEWLONand W. L. FANG damage. EMBO J. 9: 4569-4575. MAN,1989 Time of replication of ARS elementsalong yeast ENOCH,T., A. M. CARR and P. NURSE,1992 Fission yeast genes in- chromosome 111. Mol. Cell. Biol. 9: 4488-4494. volved in coupling mitosis to completion of DNA replication. ROTHSTEIN,R. J., 1983 One-step gene disruption in yeast. Methods Genes Dev. 6: 2035-2046. Enzymol. 101: 202-211. FRIEDBERG,E. C., G. C. WALKERand W. SIEDE,1995 DNA Rgbair and ROWLEY, R.,S. SUBRAMANIand P. G. YOUNG,1992 Checkpoint con- Mutagenesis. ASM Press, Washington, DC. trols in Schizosaccharomycespombe: radl. EMBO J. 11: 1335-1342. GARVIK,B., M. CARSON and L. HARTWELL,1995 Single-stranded SMSON, L., J. THOMALEand M. F. RAJEWSKY, 1988 Alternative path- DNA arising at telomeres in cdcl3 mutants may constitute a spe- ways for the in vivo repair of OGaIkylguanine and 04alkylthym- cific signal for the RAD9 checkpoint. Mol. Cell. Blol. 15: 6128- ine in Escherichia coli: the adaptive response and nucleotide exci- 6138. sion repair. EMBO J. 7: 2261-2267. GREENWELL,P. W., S. L. KRONMAL, S. E. PORTER,J. GASSENHUBER,B. SANCHEZ,Y., B. A. DESANY,W. J. JONES, Q. LIU, B. WANGet al., 1996 OBERMAIER et aZ., 1995 TELI, a gene involved in controlling Regulation of RAD53 by the ATMlike kinases h4ECl and TELl telomere length in S. cereuisiae, is homologous to the human in yeast cell cycle checkpoint pathways. Science 271: 357-360. ataxia telangiectasia gene. Cell 82 823-829. SAVITSKY,R, A. BAR-SHIM,S. GIIAD,G. ROTMAN,Y. ZIVet al., 1995a HARTWELL, L. H.,1967 Macromolecule synthesis intemperature- A single ataxia telangiectasia gene with a product similar to PI- sensitive mutants of yeast. J. Bacteriol. 93 1662-1670. 3 kinase. Science 268 1749-1753. HARTWELL, L. H., and T. A. WEINERT,1989 Checkpoints: controls SAVITSKY,R, S. SFEZ,D. A. TAGLE,Y. ZN, A. SARTIELet al., 1995b that ensure the orderof cell cycle events. Science 246: 629-634. The complete sequenceof the coding region of the ATM gene JONES,J. S., and L. PRAKASH, 1990 Yeast Saccharomycescereuisiae se- reveals similarity to cell cycle regulators in different species. lectable markers in pUCl8 polylinkers. Yeast 6: 363-366. Hum. Mol. Genet. 4: 2025-2032. KADYK, L. C., and L. H. HARTWELL, 1993 Replicationdependent sis- SCHILD,D., B. J. GLASSNER,R. K. MORTIMER,M. CARLSON and B. C. ter chromatid recombination in radl mutants of Saccharomyces LAURENT,1992 Identification of RADIG, a yeast excision repair cereuisiae. Genetics 133: 469-487. gene homologousto the recombinational repair gene RAD54 LARNER,J. M., H. LEE and J. L. HAMLIN,1994 Radiation effects on and to the SW.2 gene involved in transcriptional activation. Yeast DNA synthesis in a defined chromosomal replicon. Mol. Cell. 8: 385-395. Biol. 14: 1901-1908. SHERMAN, F.,G. R. FINKand J. B. HICKS,1981 Methods in Yeast Genet- LI, R., and A. W. MURRAY,1991 Feedback control of mitosis in bud- ics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. ding yeast. Cell 66: 519-531. SHWI, R K., M. R KENNY and R. D. WOOD,1992 Proliferating cell LYDALL,D., and T. WEINERT,1995 Yeast checkpoint genes in DNA nuclear antigen is required for DNA excision repair. Cell 69: damage processing: implications for repair and arrest. Science 367-374. 270 1488-1491. SIEDE,W., A. S. FRIEDBERGand E. C. FRIEDBERG,1993 RADPdepen- LYDALL, D.,and T. WEINERT,1996 From DNA damage to cell cycle dent G1 arrest defines a second checkpoint for damaged DNA arrestand suicide: a budding yeast perspective. Curr.Opin. in the cell cycle of Saccharomyces cereuisiae. Proc. Natl. Acad. Sci. Genet. Dev. 6 4-11. USA 90: 7985-7989. MORRISON, A., R. B. CHRISTENSEN,J. ALLEY, A. K BECK,E. G. BERNS SIEDE,W., A. S. FRIEDBERG,I. DIANOVAand E. C. FRIEDBERG,1994 TINE et al., 1989 mv3,a Saccharomyces cereuisiae gene whose func- Characterization of G1 checkpoint control in the yeast Saccharo- tion is required for inducedmutagenesis, is predicted to encode myces cereuisiae following exposure to DNAdamagingagents. Ge- a nonessential DNA polymerase. J. Bacteriol. 171: 5659-5667. netics 138: 271-281. MORRISON,A,, A. L. JOHNSON,L. H. JOHNSTON and A. SUGINO,1993 SIKORSKI, R.S., and P. HIETER,1989 A system of shuttle vectors and Pathway correcting DNA replication errors in Saccharomyces cere- yeast host strains designed for efficient manipulation of DNA in uisiae. EMBO J. 12 1467-1473. Saccharomycescereuisiae. Genetics 122: 19-27. MORROW, D. M., D. A. TAGLE,Y. SHILOH,F. S. COLLINSand P. HIETER, SINGER,B., and D. GRUNBERGER,1983 Molecular Biology ofMutagens 1995 TELI, an S. cereuisiae homologue of the human gene mu- and Carcinogens. Plenum Press, New York. tated in ataxia telangiectasia, is functionally related to the yeast SMERDON,M. J., and F. THOMA,1990 Site-specific DNA repair at the checkpoint gene MECl. Cell 82 831-840. nucleosome level in a yeast minichromosome. Cell 61: 675-684. MURRAY,A. W., 1995 The genetics of cell cycle checkpoints. Curr. SWEDER,K. S., and P. C. HANAWALT,1992 Preferential repair of Opin. Genet. Dev. 5: 5-11. cyclobutane dimers in the transcribed strand of a gene in yeast NAEGELI,H., 1994 Roadblocks and detours duringDNA replication: chromosomes and plasmids is dependent on transcription. Proc. mechanisms of mutagenesis in mammalian cells. Bioessays 16: Natl. Acad. Sci. USA 89: 10696-10700. 557-564. SWEDER,K. S., and P. C. HANAWALT, 1994 The COOH terminus of NAVAS,T. A,, Z. ZHOU and S. J. ELLEDGE,1995 DNA Polymerase e suppressor of stem loop (SSL2/RAD25) in yeast is essential for links the DNA replication machinery to the S phase checkpoint. overall genomic excision repair and transcription-coupled re- Cell 80: 29-39. pair. J. Biol. Chem. 269: 1852-1857. NELSON,J. R.,C. W. LAWRENCE and D.C. HINKLE,1996 Thymine- VAN GOOL,A. J., R. VERHAGE,S. M. A. SWAGEMAKERS,P. VAN DE PUTTE, 62 A. G. Paulovich et al.

J. BROUWERet al., 1994 RAD26, the functional S. cerevisiaehomo- XMO, W., B. DERFLER,J. CHENand L. SAMSON,1991 Primary se- logue of the Cockayne syndrome B gene ERCC6. EMBO J. 13: quence and biological functions of a Saccharomyces cerevisiae 06 5361-5369. methylguanine/O4methylthymine DNA repair methyltransfer- VOIGT,J. M., B. VAN HOUTENand M. D. TOPAL,1989 Repair of 06 ase gene. EMBO J. 10: 2179-2186. methylguanine by ABC exinuclease of Escherichia coli in vitro. J. YAMAMOTO,A,, V. GUACCIand D. KOSHLAND,1996a Pdslp is re- Biol. Chem. 264 5172-5176. quired for faithful execution of anaphase in the yeast, Saccharo- WEINERT,T. A,, and L. H. HARTWELL,1988 The RAD9gene controls myces cermisiae. J. Cell Biol. 133: 85-97. the cell cycle response to DNA damage inSaccharomyces cereuisiae. YAMAMOTO,A., V. GUACCIand D. KOSHLAND,1996b Pdslp, an inhib Science 241: 317-322. itor of anaphase in buddingyeast, plays a critical role in theAPC WEINERT,T. A., and L. H. HARTWELL,1990 Characterization of and checkpoint pathways. J. Cell Biol. 133: 99-110. RAD9 of Saccharomycescereuisiae and evidence that its function YARBRO,J. W., 1992 Mechanism of action of hydroxyurea. Semin. acts posttranslationally in cell cycle arrest after DNA damage. Oncol. 19 (Suppl. 9): 1-10. Mol. Cell. Biol. 10 6554-6564. YOUNG,B. R., and R. B. PAINTER,1989 Radioresistant DNA synthesis WEINERT,T. A,, and L. H. HARTWELI.,1993 Cell cycle arrest of cdc and human genetic diseases. Hum. Genet. 82 113-1 17. mutants and specificity of the RAD9 checkpoint. Genetics 134: ZHOU,Z., and S. J. ELLEDGE, 1993 DUN1 encodes a protein kinase 63-80. that controls the DNA damage response in yeast. Cell 75: 1119- WEINERT,T. A,, G. L. USERand L. H. HARTWELL, 1994 Mitotic 1127. checkpoint genes in buddingyeast and the dependenceof mitosis on DNA replication and repair. Genes Dev. 8: 652-665. Communicating editor: D. BOTSTEIN