Proc. Nadl. Acad. Sci. USA Vol. 87, pp. 2541-2544, April 1990 Genetics Characterization of a mutation in a family with saposin B deficiency: A glycosylation site defect (sphingolipid activator protein/SAP-1/metachromatic leukodystrophy/arylsulfatase A) KEITH A. KRETZ*, GEOFFREY S. CARSON*, SATOSHI MORIMOTO*t, YASUO KISHIMOTO*, ARVAN L. FLUHARTYt, AND JOHN S. O'BPUEN*§ *Department of Neurosciences and Center for Molecular Genetics, University of California, San Diego, School of Medicine, M-034J, La Jolla, CA 92093; and tUniversity of California, Los Angeles, Mental Retardation Research Center Group at Lanterman Developmental Center, Pomona, CA 91766 Communicated by Dan L. Lindsley, January 19, 1990 ABSTRACT Saposins are small, heat-stable glycoproteins these four saposin proteins has now been isolated and their required for the hydrolysis of sphingolipids by specific lyso- activating properties have been determined (3-14). somal hydrolases. Saposins A, B, C, and D are derived by Saposins A and C specifically activate hydrolysis of glu- proteolytic processing from a single precursor protein named cocerebroside byB-glucosylceramidase (D-glucosyl-N-acyl- prosaposin. Saposin B, previously known as SAP-1 and sul- sphingosine glucohydrolase; EC 3.2.1.45) and ofgalactocere- fatide activator, stimulates the hydrolysis of a wide variety of broside by galactosylceramidase (D-galactosyl-N-acyl- substrates including cerebroside sulfate, GM1 ganglioside, and sphingosine galactohydrolase; EC 3.2.1.46) (3, 4). Saposin D globotriaosylceramide by arylsulfatase A, acid 8-galacto- specifically activates the hydrolysis of sphingomyelin by sidase, and a-galactosidase, respectively. Human saposin B sphingomyelin phosphodiesterase (sphingomyelin choline- deficiency, transmitted as an autosomal recessive trait, results phosphohydrolase; EC 3.1.4.12) (5). Saposins A, C, and D in tissue accumulation of cerebroside sulfate and a clinical appear to exert their activities by binding to the respective picture resembling metachromatic leukodystrophy (activator- enzymes, raising the maximal velocity of hydrolysis and deficient metachromatic leukodystrophy). We have examined lowering the Michaelis constant (5, 6) (S.M. and Y.K., transformed lymphoblasts from the initially reported saposin unpublished data). B-deficient patient and found normal amounts ofsaposins A, C, Saposin B, previously designated by several different and D. After preparing first-strand cDNA from lymphoblast terms (7, 10, 14, 15), stimulates the hydrolysis of galacto- total RNA, we used the polymerase chain reaction to amplify cerebroside sulfate by arylsulfatase A (aryl-sulfate sulfohy- the prosaposin cDNA. The patient's mRNA differed from the drolase; EC 3.1.6.1) (7-9), GM1 ganglioside by acid 13- normal sequence by only one C -- T transition in the 23rd galactosidase (J3-D-galactoside galactohydrolase; EC 3.2. codon ofsaposin B, resulting in a threonine to isoleucine amino 1.23) (10, 11), and globotriaosylceramide by a-galacto- sidase A (a-D-galactoside galactohydrolase; EC 3.2.1.22) (12, acid substitution. An affected male sibling has the same mu- 13). This activator protein may have even broader substrate tation as the proband and their heterozygous mother carries specificity since it also is an activator of glycerolipid hydrol- both the normal and mutant sequences, providing additional ysis (14). Saposin B activates by a mechanism different from evidence that this base change is the disease-causing mutation. saposins A, C, and D; it interacts with lipid substrates This base change results in the replacement of a polar amino solubilizing them for enzymatic hydrolysis. The physiologi- acid (threonine) with a nonpolar amino acid (isoleucine) and, cal significance of saposin B is underscored by the discovery more importantly, eliminates the glycosylation signal in this of its absence in a variant form of metachromatic leukodys- activator protein. One explanation for the deficiency ofsaposin trophy (activator-deficient metachromatic leukodystrophy) B in this disease is that the mutation may increase the degra- (16-18). In this report, we present evidence for a single base dation ofsaposin B by exposing a potential proteolytic cleavage change as the molecular defect in activator-deficient meta- site (arginine) two amino acids to the amino-terminal side ofthe chromatic leukodystrophy found in two siblings of consan- glycosylation site when the carbohydrate side chain is absent. guineous parents and propose that this mutation gives rise to a glycosylation site defect. These results were previously The lysosomal hydrolysis of sphingolipids is catalyzed by the presented independently in preliminary form by our group sequential action of acid hydrolases. Several small heat- and by Wenger et al. (19, 20). stable glycoproteins called sphingolipid activator proteins have been discovered that act as natural nonspecific deter- MATERIALS AND METHODS gents, or stimulate a specific hydrolase, or both. The com- plete nucleotide sequence of a cDNA encoding prosaposin, Quantitation of Saposins. A HPLC method was developed the precursor ofsaposins A, B, C, and D, has been elucidated to quantitate the levels of saposins. Transformed lympho- (1, 2). Prosaposin is a 524-amino acid glycoprotein and blasts from proband YF with saposin B deficiency and a examination of its amino acid sequence reveals four saposin normal control were grown in suspension culture and col- domains. Each domain is -80 amino acid residues long; has lected by precipitation. After washing in phosphate-buffered nearly identical saline the cell pellets were lyophilized, resuspended, homog- placement ofcysteine residues, glycosylation enized, boiled, and centrifuged. Supernatant proteins were sites, and helical regions; and is flanked by potential prote- fractionated by HPLC sequentially on two columns, a hy- olytic cleavage sites (lysine or arginine). Proteolytic cleavage drophobic Vydac C4 column (The Separations Group, Hes- of prosaposin at or near these dibasic amino acids was peria, CA) using an acetonitrile predicted to give rise to four saposin proteins (1). Each of gradient followed by an Abbreviation: PCR, polymerase chain reaction. The publication costs of this article were defrayed in part by page charge tPresent address: Faculty of Pharmaceutical Sciences, Kyushu payment. This article must therefore be hereby marked "advertisement" University, Fukuoka 812, Japan. in accordance with 18 U.S.C. §1734 solely to indicate this fact. §To whom reprint requests should be addressed. 2541 Downloaded by guest on October 2, 2021 2542 Genetics: Kretz et al. Proc. Natl. Acad. Sci. USA 87 (1990) P5 Si S2 S3 S4 S5 P3 -4 -4 -4 -4 -4 I B -3 1-. A B C D 500 1000 1500 2000 2500 FIG. 1. Structure ofprosaposin cDNA and location ofPCR and sequencing primers. Open box represents the prosaposin open reading frame and lines represent untranslated sequence (from refs. 1 and 2). Hatched areas represent the four saposin regions, as indicated (1, 2). The PCR primers are labeled P5 and P3 and their sequences are as follows: P5, ACGTACTCTAGACGCGCTATGTACGCCCTCTT; P3, ATCGAT- (GAGCTCCACTGATGTCCCAAGCCACCA. The underlined portions of the PCR primers are restriction sites engineered in the primers (Xba I for P5 and Sac I for P3). The positions of the sequencing primers (S1-S5) are also shown. anion-exchange Aquapore AX-300 column (Western Analyt- prosaposin open reading frame and some 3' flanking se- ical Products, Temecula, CA) using a salt gradient. On the quence totaling 2170 base pairs could be analyzed (Fig. 1). first column, saposins A, C, and D were collected as clus- Initially, the product from patient YF was cloned into the tered peaks and on the second column, they were separated phagemid pBS II and several clones were sequenced. A as individual peaks, which were quantified. Details of this single C -- T transition was found in the 23rd codon of method will be given in a separate report (S.M. and Y.K., saposin B (Fig. 2), a single base change resulting in the unpublished data). Saposin B had previously been shown to replacement of a threonine residue by an isoleucine residue be nearly absent in cultured cells from patient YF by a (Fig. 3). No other base changes were found after sequencing quantitative immunologic method (17). We also could not the entire prosaposin open reading frame. These results are detect saposin B in lymphoblasts from patient YF after in accord with those recently reported by Wenger et al. (20). SDS/PAGE and immunoblotting with monospecific anti- To provide additional evidence that this base substitution saposin B antibodies. is the disease-causing mutation, we amplified prosaposin Polymerase Chain Reaction (PCR) Amplification of Prosa- cDNA from fibroblast RNA from the affected brother of the posin cDNA. Total RNA was isolated from transformed proband (EF), her mother, and several controls, sequencing lymphoblasts of the index patient by using the RNA isolation the PCR products directly. As expected, EF has the same kit (Invitrogen, San Diego, CA) according to the manufac- base change as YF, and her mother has two bands of turer's instructions. First-strand cDNA was then prepared by using the Red Module (Invitrogen) and oligo(dT) as primer approximately equal intensity at this position, representing according to the manufacturer's instructions. PCR was per- the normal and mutant alleles (Fig. 2). Samples from three formed as described by Saiki et al. (21). Frozen cell culture normal subjects each gave the normal sequence at