DOCSLIB.ORG

Characterization of a Mutation in a Family with Saposin B Deficiency

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of a Mutation in a Family with Saposin B Deficiency Proc. Nadl. Acad. Sci. USA Vol. 87, pp. 2541-2544, April 1990 Genetics Characterization of a mutation in a family with saposin B deficiency: A glycosylation site defect (sphingolipid activator protein/SAP-1/metachromatic leukodystrophy/arylsulfatase A) KEITH A. KRETZ*, GEOFFREY S. CARSON*, SATOSHI MORIMOTO*t, YASUO KISHIMOTO*, ARVAN L. FLUHARTYt, AND JOHN S. O'BPUEN*§ *Department of Neurosciences and Center for Molecular Genetics, University of California, San Diego, School of Medicine, M-034J, La Jolla, CA 92093; and tUniversity of California, Los Angeles, Mental Retardation Research Center Group at Lanterman Developmental Center, Pomona, CA 91766 Communicated by Dan L. Lindsley, January 19, 1990 ABSTRACT Saposins are small, heat-stable glycoproteins these four saposin proteins has now been isolated and their required for the hydrolysis of sphingolipids by specific lyso- activating properties have been determined (3-14). somal hydrolases. Saposins A, B, C, and D are derived by Saposins A and C specifically activate hydrolysis of glu- proteolytic processing from a single precursor protein named cocerebroside byB-glucosylceramidase (D-glucosyl-N-acyl- prosaposin. Saposin B, previously known as SAP-1 and sul- sphingosine glucohydrolase; EC 3.2.1.45) and ofgalactocere- fatide activator, stimulates the hydrolysis of a wide variety of broside by galactosylceramidase (D-galactosyl-N-acyl- substrates including cerebroside sulfate, GM1 ganglioside, and sphingosine galactohydrolase; EC 3.2.1.46) (3, 4). Saposin D globotriaosylceramide by arylsulfatase A, acid 8-galacto- specifically activates the hydrolysis of sphingomyelin by sidase, and a-galactosidase, respectively. Human saposin B sphingomyelin phosphodiesterase (sphingomyelin choline- deficiency, transmitted as an autosomal recessive trait, results phosphohydrolase; EC 3.1.4.12) (5). Saposins A, C, and D in tissue accumulation of cerebroside sulfate and a clinical appear to exert their activities by binding to the respective picture resembling metachromatic leukodystrophy (activator- enzymes, raising the maximal velocity of hydrolysis and deficient metachromatic leukodystrophy). We have examined lowering the Michaelis constant (5, 6) (S.M. and Y.K., transformed lymphoblasts from the initially reported saposin unpublished data). B-deficient patient and found normal amounts ofsaposins A, C, Saposin B, previously designated by several different and D. After preparing first-strand cDNA from lymphoblast terms (7, 10, 14, 15), stimulates the hydrolysis of galacto- total RNA, we used the polymerase chain reaction to amplify cerebroside sulfate by arylsulfatase A (aryl-sulfate sulfohy- the prosaposin cDNA. The patient's mRNA differed from the drolase; EC 3.1.6.1) (7-9), GM1 ganglioside by acid 13- normal sequence by only one C -- T transition in the 23rd galactosidase (J3-D-galactoside galactohydrolase; EC 3.2. codon ofsaposin B, resulting in a threonine to isoleucine amino 1.23) (10, 11), and globotriaosylceramide by a-galacto- sidase A (a-D-galactoside galactohydrolase; EC 3.2.1.22) (12, acid substitution. An affected male sibling has the same mu- 13). This activator protein may have even broader substrate tation as the proband and their heterozygous mother carries specificity since it also is an activator of glycerolipid hydrol- both the normal and mutant sequences, providing additional ysis (14). Saposin B activates by a mechanism different from evidence that this base change is the disease-causing mutation. saposins A, C, and D; it interacts with lipid substrates This base change results in the replacement of a polar amino solubilizing them for enzymatic hydrolysis. The physiologi- acid (threonine) with a nonpolar amino acid (isoleucine) and, cal significance of saposin B is underscored by the discovery more importantly, eliminates the glycosylation signal in this of its absence in a variant form of metachromatic leukodys- activator protein. One explanation for the deficiency ofsaposin trophy (activator-deficient metachromatic leukodystrophy) B in this disease is that the mutation may increase the degra- (16-18). In this report, we present evidence for a single base dation ofsaposin B by exposing a potential proteolytic cleavage change as the molecular defect in activator-deficient meta- site (arginine) two amino acids to the amino-terminal side ofthe chromatic leukodystrophy found in two siblings of consan- glycosylation site when the carbohydrate side chain is absent. guineous parents and propose that this mutation gives rise to a glycosylation site defect. These results were previously The lysosomal hydrolysis of sphingolipids is catalyzed by the presented independently in preliminary form by our group sequential action of acid hydrolases. Several small heat- and by Wenger et al. (19, 20). stable glycoproteins called sphingolipid activator proteins have been discovered that act as natural nonspecific deter- MATERIALS AND METHODS gents, or stimulate a specific hydrolase, or both. The com- plete nucleotide sequence of a cDNA encoding prosaposin, Quantitation of Saposins. A HPLC method was developed the precursor ofsaposins A, B, C, and D, has been elucidated to quantitate the levels of saposins. Transformed lympho- (1, 2). Prosaposin is a 524-amino acid glycoprotein and blasts from proband YF with saposin B deficiency and a examination of its amino acid sequence reveals four saposin normal control were grown in suspension culture and col- domains. Each domain is -80 amino acid residues long; has lected by precipitation. After washing in phosphate-buffered nearly identical saline the cell pellets were lyophilized, resuspended, homog- placement ofcysteine residues, glycosylation enized, boiled, and centrifuged. Supernatant proteins were sites, and helical regions; and is flanked by potential prote- fractionated by HPLC sequentially on two columns, a hy- olytic cleavage sites (lysine or arginine). Proteolytic cleavage drophobic Vydac C4 column (The Separations Group, Hes- of prosaposin at or near these dibasic amino acids was peria, CA) using an acetonitrile predicted to give rise to four saposin proteins (1). Each of gradient followed by an Abbreviation: PCR, polymerase chain reaction. The publication costs of this article were defrayed in part by page charge tPresent address: Faculty of Pharmaceutical Sciences, Kyushu payment. This article must therefore be hereby marked "advertisement" University, Fukuoka 812, Japan. in accordance with 18 U.S.C. §1734 solely to indicate this fact. §To whom reprint requests should be addressed. 2541 Downloaded by guest on October 2, 2021 2542 Genetics: Kretz et al. Proc. Natl. Acad. Sci. USA 87 (1990) P5 Si S2 S3 S4 S5 P3 -4 -4 -4 -4 -4 I B -3 1-. A B C D 500 1000 1500 2000 2500 FIG. 1. Structure ofprosaposin cDNA and location ofPCR and sequencing primers. Open box represents the prosaposin open reading frame and lines represent untranslated sequence (from refs. 1 and 2). Hatched areas represent the four saposin regions, as indicated (1, 2). The PCR primers are labeled P5 and P3 and their sequences are as follows: P5, ACGTACTCTAGACGCGCTATGTACGCCCTCTT; P3, ATCGAT- (GAGCTCCACTGATGTCCCAAGCCACCA. The underlined portions of the PCR primers are restriction sites engineered in the primers (Xba I for P5 and Sac I for P3). The positions of the sequencing primers (S1-S5) are also shown. anion-exchange Aquapore AX-300 column (Western Analyt- prosaposin open reading frame and some 3' flanking se- ical Products, Temecula, CA) using a salt gradient. On the quence totaling 2170 base pairs could be analyzed (Fig. 1). first column, saposins A, C, and D were collected as clus- Initially, the product from patient YF was cloned into the tered peaks and on the second column, they were separated phagemid pBS II and several clones were sequenced. A as individual peaks, which were quantified. Details of this single C -- T transition was found in the 23rd codon of method will be given in a separate report (S.M. and Y.K., saposin B (Fig. 2), a single base change resulting in the unpublished data). Saposin B had previously been shown to replacement of a threonine residue by an isoleucine residue be nearly absent in cultured cells from patient YF by a (Fig. 3). No other base changes were found after sequencing quantitative immunologic method (17). We also could not the entire prosaposin open reading frame. These results are detect saposin B in lymphoblasts from patient YF after in accord with those recently reported by Wenger et al. (20). SDS/PAGE and immunoblotting with monospecific anti- To provide additional evidence that this base substitution saposin B antibodies. is the disease-causing mutation, we amplified prosaposin Polymerase Chain Reaction (PCR) Amplification of Prosa- cDNA from fibroblast RNA from the affected brother of the posin cDNA. Total RNA was isolated from transformed proband (EF), her mother, and several controls, sequencing lymphoblasts of the index patient by using the RNA isolation the PCR products directly. As expected, EF has the same kit (Invitrogen, San Diego, CA) according to the manufac- base change as YF, and her mother has two bands of turer's instructions. First-strand cDNA was then prepared by using the Red Module (Invitrogen) and oligo(dT) as primer approximately equal intensity at this position, representing according to the manufacturer's instructions. PCR was per- the normal and mutant alleles (Fig. 2). Samples from three formed as described by Saiki et al. (21). Frozen cell culture normal subjects each gave the normal sequence at
Load more

Recommended publications
  • Sphingolipid Metabolism Diseases ⁎ Thomas Kolter, Konrad Sandhoff
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1758 (2006) 2057–2079 www.elsevier.com/locate/bbamem Review Sphingolipid metabolism diseases ⁎ Thomas Kolter, Konrad Sandhoff Kekulé-Institut für Organische Chemie und Biochemie der Universität, Gerhard-Domagk-Str. 1, D-53121 Bonn, Germany Received 23 December 2005; received in revised form 26 April 2006; accepted 23 May 2006 Available online 14 June 2006 Abstract Human diseases caused by alterations in the metabolism of sphingolipids or glycosphingolipids are mainly disorders of the degradation of these compounds. The sphingolipidoses are a group of monogenic inherited diseases caused by defects in the system of lysosomal sphingolipid degradation, with subsequent accumulation of non-degradable storage material in one or more organs. Most sphingolipidoses are associated with high mortality. Both, the ratio of substrate influx into the lysosomes and the reduced degradative capacity can be addressed by therapeutic approaches. In addition to symptomatic treatments, the current strategies for restoration of the reduced substrate degradation within the lysosome are enzyme replacement therapy (ERT), cell-mediated therapy (CMT) including bone marrow transplantation (BMT) and cell-mediated “cross correction”, gene therapy, and enzyme-enhancement therapy with chemical chaperones. The reduction of substrate influx into the lysosomes can be achieved by substrate reduction therapy. Patients suffering from the attenuated form (type 1) of Gaucher disease and from Fabry disease have been successfully treated with ERT. © 2006 Elsevier B.V. All rights reserved. Keywords: Ceramide; Lysosomal storage disease; Saposin; Sphingolipidose Contents 1. Sphingolipid structure, function and biosynthesis ..........................................2058 1.1.
    [Show full text]
  • A Saposin Deficiency Model in Drosophila: Lysosomal Storage, Progressive Neurodegeneration and Sensory Physiological Decline
    This is a repository copy of A saposin deficiency model in Drosophila: Lysosomal storage, progressive neurodegeneration and sensory physiological decline. White Rose Research Online URL for this paper: https://eprints.whiterose.ac.uk/109579/ Version: Published Version Article: Elliott, Christopher John Hazell orcid.org/0000-0002-5805-3645 and Sweeney, Sean orcid.org/0000-0003-2673-9578 (2017) A saposin deficiency model in Drosophila: Lysosomal storage, progressive neurodegeneration and sensory physiological decline. Neurobiology of disease. pp. 77-87. ISSN 1095-953X https://doi.org/10.1016/j.nbd.2016.11.012 Reuse This article is distributed under the terms of the Creative Commons Attribution (CC BY) licence. This licence allows you to distribute, remix, tweak, and build upon the work, even commercially, as long as you credit the authors for the original work. More information and the full terms of the licence here: https://creativecommons.org/licenses/ Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ Neurobiology of Disease 98 (2017) 77–87 Contents lists available at ScienceDirect Neurobiology of Disease journal homepage: www.elsevier.com/locate/ynbdi Asaposindeficiency model in Drosophila: Lysosomal storage, progressive neurodegeneration and sensory physiological decline Samantha J. Hindle a,1, Sarita Hebbar b,2,DominikSchwudkeb,3, Christopher J.H. Elliott a, Sean T. Sweeney a,⁎ a Department of Biology, University of York, York YO10 5DD, UK b National Centre for Biological Sciences, Tata Institute of Fundamental Research, Bangalore, Karnataka 560065, India article info abstract Article history: Saposin deficiency is a childhood neurodegenerative lysosomal storage disorder (LSD) that can cause premature Received 1 September 2016 death within three months of life.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Structure of Saposin a Lipoprotein Discs
    Structure of saposin A lipoprotein discs Konstantin Popovica, John Holyoakeb,c, Régis Pomèsb,d, and Gilbert G. Privéa,c,d,1 aDepartment of Medical Biophysics, University of Toronto, Toronto, ON, Canada M5G 2M9; bMolecular Structure and Function, Hospital for Sick Children, Toronto, ON, Canada M5G 1X8; cOntario Cancer Institute, Campbell Family Institute for Cancer Research, Toronto, ON, Canada M5G 1L7; and dDepartment of Biochemistry, University of Toronto, Toronto, ON, Canada, M5S 1A8 Edited by Donald Engelman, Yale University, New Haven, CT, and approved December 17, 2011 (received for review September 23, 2011) The saposins are small, membrane-active proteins that exist in both functions to activate the sphingolipid hydrolysis reaction. How- soluble and lipid-bound states. Saposin A has roles in sphingolipid ever, structural flexibility is a crucial feature for the membrane catabolism and transport and is required for the breakdown of surface binding and lipid-solubilizing abilities of the saposin pro- galactosylceramide by β-galactosylceramidase. In the absence of teins (3, 18, 19). lipid, saposin A adopts a closed monomeric apo conformation Here, we characterize the interactions of saposin A with var- typical of this family. To study a lipid-bound state of this protein, ious amphiphiles. Saposin A undergoes a conformational change we determined the crystal structure of saposin A in the presence of in the presence of lipids and detergents and forms small lipo- detergent to 1.9 Å resolution. The structure reveals two chains of protein particles with a wide range of lipids. The 1.9 Å crystal saposin A in an open conformation encapsulating 40 internally structure of saposin A in complex with zwitterionic detergent bound detergent molecules organized in a highly ordered bilayer- lauryldimethylamine-N-oxide (LDAO) reveals two saposin chains like hydrophobic core.
    [Show full text]
  • 2016 Mock Exam General Pathology Answer Sheet
    Name___________________________ 2016 Mock Exam General Pathology 1. You have 1 HOUR to complete this 50-question multiple choice exam. 2. Write your name on all pages of the exam packet. 3. Use capital letters on the answer sheet. 4. For each question, select the ONE best answer and mark it on the answer sheet. 5. Credit will be given only for correct answers recorded on the answer sheet. 6. All questions for which more than one answer is marked will be recorded as incorrect. 7. No credit will be awarded or deducted for incorrect answers. 8. Turn in the entire exam packet when you are done. 2016 Mock Exam General Pathology Answer sheet 1. ______ 26. ______ 2. ______ 27. ______ 3. ______ 28. ______ 4. ______ 29. ______ 5. ______ 30. ______ 6. ______ 31. ______ 7. ______ 32. ______ 8. ______ 33. ______ 9. ______ 34. ______ 10. ______ 35. ______ 11. ______ 36. ______ 12. ______ 37. ______ 13. ______ 38. ______ 14. ______ 39. ______ 15. ______ 40. ______ 16. ______ 41. ______ 17. ______ 42. ______ 18. ______ 43. ______ 19. ______ 44. ______ 20. ______ 45. ______ 21. ______ 46. ______ 22. ______ 47. ______ 23. ______ 48. ______ 24. ______ 49. ______ 25. ______ 50. ______ ii 2016 Mock Exam Name___________________________ General Pathology 1. Which of the following toxins reaches its target cell using retrograde axonal transport? a. tetanospasmin b. botulinum toxin c. syntaxin d. SNAP-25 2. All of the following EXCEPT which are true regarding high mobility group box protein 1 (HMGB-1)? a.
    [Show full text]
  • Structural Study of the Acid Sphingomyelinase Protein Family
    Structural Study of the Acid Sphingomyelinase Protein Family Alexei Gorelik Department of Biochemistry McGill University, Montreal August 2017 A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Doctor of Philosophy © Alexei Gorelik, 2017 Abstract The acid sphingomyelinase (ASMase) converts the lipid sphingomyelin (SM) to ceramide. This protein participates in lysosomal lipid metabolism and plays an additional role in signal transduction at the cell surface by cleaving the abundant SM to ceramide, thus modulating membrane properties. These functions are enabled by the enzyme’s lipid- and membrane- interacting saposin domain. ASMase is part of a small family along with the poorly characterized ASMase-like phosphodiesterases 3A and 3B (SMPDL3A,B). SMPDL3A does not hydrolyze SM but degrades extracellular nucleotides, and is potentially involved in purinergic signaling. SMPDL3B is a regulator of the innate immune response and podocyte function, and displays a partially defined lipid- and membrane-modifying activity. I carried out structural studies to gain insight into substrate recognition and molecular functions of the ASMase family of proteins. Crystal structures of SMPDL3A uncovered the helical fold of a novel C-terminal subdomain, a slightly distinct catalytic mechanism, and a nucleotide-binding mode without specific contacts to their nucleoside moiety. The ASMase investigation revealed a conformational flexibility of its saposin domain: this module can switch from a detached, closed conformation to an open form which establishes a hydrophobic interface to the catalytic domain. This open configuration represents the active form of the enzyme, likely allowing lipid access to the active site. The SMPDL3B structure showed a narrow, boot-shaped substrate binding site that accommodates the head group of SM.
    [Show full text]
  • A Possible Role for Arylsulfatase G in Dermatan Sulfate Metabolism
    International Journal of Molecular Sciences Article A Possible Role for Arylsulfatase G in Dermatan Sulfate Metabolism Aleksandra Poterala-Hejmo 1,*, Adam Golda 2 , Marcin Pacholczyk 1 , Sebastian Student 1, Anna Tylki-Szyma´nska 3 and Anna Lalik 1,* 1 Department of Systems Biology and Engineering, Silesian University of Technology, 44-100 Gliwice, Poland; [email protected] (M.P.); [email protected] (S.S.) 2 Department of Cardiology, 4th Municipal Hospital, 44-100 Gliwice, Poland; [email protected] 3 Department of Pediatrics, Nutrition and Metabolic Diseases, The Children’s Memorial Health Institute, 04-730 Warsaw, Poland; [email protected] * Correspondence: [email protected] (A.P.-H.); [email protected] (A.L.); Tel.: +48-32-2371168 (A.P.-H.); +48-32-2372769 (A.L.) Received: 2 June 2020; Accepted: 6 July 2020; Published: 12 July 2020 Abstract: Perturbations of glycosaminoglycan metabolism lead to mucopolysaccharidoses (MPS)—lysosomal storage diseases. One type of MPS (type VI) is associated with a deficiency of arylsulfatase B (ARSB), for which we previously established a cellular model using pulmonary artery endothelial cells with a silenced ARSB gene. Here, we explored the effects of silencing the ARSB gene on the growth of human pulmonary artery smooth muscle cells in the presence of different concentrations of dermatan sulfate (DS). The viability of pulmonary artery smooth muscle cells with a silenced ARSB gene was stimulated by the dermatan sulfate. In contrast, the growth of pulmonary artery endothelial cells was not affected. As shown by microarray analysis, the expression of the arylsulfatase G (ARSG) in pulmonary artery smooth muscle cells increased after silencing the arylsulfatase B gene, but the expression of genes encoding other enzymes involved in the degradation of dermatan sulfate did not.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Lab Dept: Chemistry Test Name: ARYLSULFATASE A, LEUKOCYTES
    Lab Dept: Chemistry Test Name: ARYLSULFATASE A, LEUKOCYTES General Information Lab Order Codes: ARYL Synonyms: Metachromic Leukodystrophy; Mucolipidoses, Types II and III; ARS-A (Arylsulfatase A); WBC Aryl Sulfatase A CPT Codes: 82657 – Enzyme activity in blood cells, cultured cells, or tissue, not elsewhere specified; nonradioactive substrate Test Includes: Arylsulfatase A, Leukocyte level reported in nmol/h/mg. Logistics Test Indications: Leukocyte assay is the preferred test to order first to rule out metachromatic leukodystrophy. Not reliable in identifying carriers due both to analytical variation and unusual genetic variants. The urine assay should be used in confirming leukocyte results. Lab Testing Sections: Chemistry - Sendouts Referred to: Mayo Medical Laboratories (MML Test: ARSAW) Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: Daily, 24 hours (Specimen must be received by reference lab within 96 hours of collection and must be received 1 day prior to assay day for processing) Turnaround Time: 8 – 15 days; test set up Tuesday Special Instructions: Specimen must arrive within 48 hours of draw. Obtain special collection tube from the laboratory. Specimen Specimen Type: Whole blood Container: Yellow top (ACD Solution B) tube available from laboratory Alternate: Yellow top (ACD Solution A) Draw Volume: 6 mL (Minimum: 5 mL) ACD Whole blood Processed Volume: Same as Draw Volume Collection: Routine blood collection Special Processing: Lab Staff: Do Not process specimen, leave in original draw container.
    [Show full text]
  • Impaired Prosaposin Lysosomal Trafficking in Frontotemporal Lobar
    ARTICLE Received 30 Sep 2016 | Accepted 15 Mar 2017 | Published 25 May 2017 DOI: 10.1038/ncomms15277 OPEN Impaired prosaposin lysosomal trafficking in frontotemporal lobar degeneration due to progranulin mutations Xiaolai Zhou1, Lirong Sun1,2, Oliver Bracko3, Ji Whae Choi1, Yan Jia1, Alissa L. Nana4, Owen Adam Brady1, Jean C. Cruz Hernandez3, Nozomi Nishimura3, William W. Seeley4,5 & Fenghua Hu1 Haploinsufficiency of progranulin (PGRN) due to mutations in the granulin (GRN) gene causes frontotemporal lobar degeneration (FTLD), and complete loss of PGRN leads to a lysosomal storage disorder, neuronal ceroid lipofuscinosis (NCL). Accumulating evidence suggests that PGRN is essential for proper lysosomal function, but the precise mechanisms involved are not known. Here, we show that PGRN facilitates neuronal uptake and lysosomal delivery of prosaposin (PSAP), the precursor of saposin peptides that are essential for lysosomal glycosphingolipid degradation. We found reduced levels of PSAP in neurons both in mice deficient in PGRN and in human samples from FTLD patients due to GRN mutations. Furthermore, mice with reduced PSAP expression demonstrated FTLD-like pathology and behavioural changes. Thus, our data demonstrate a role of PGRN in PSAP lysosomal trafficking and suggest that impaired lysosomal trafficking of PSAP is an underlying disease mechanism for NCL and FTLD due to GRN mutations. 1 Department of Molecular Biology and Genetics, Weill Institute for Cell and Molecular Biology, Cornell University, Ithaca, New York 14853, USA. 2 Department of Neurobiology, School of Basic Medical Sciences, Southern Medical University, Guangzhou 510515, China. 3 Nancy E. and Peter C. Meinig School of Biomedical Engineering, Cornell University, Ithaca, New York 14853, USA.
    [Show full text]
  • Impaired Β-Glucocerebrosidase Activity and Processing in Frontotemporal Dementia Due to Progranulin Mutations Andrew E
    Arrant et al. Acta Neuropathologica Communications (2019) 7:218 https://doi.org/10.1186/s40478-019-0872-6 RESEARCH Open Access Impaired β-glucocerebrosidase activity and processing in frontotemporal dementia due to progranulin mutations Andrew E. Arrant1,2*, Jonathan R. Roth1, Nicholas R. Boyle1, Shreya N. Kashyap1, Madelyn Q. Hoffmann1, Charles F. Murchison1,3, Eliana Marisa Ramos4, Alissa L. Nana5, Salvatore Spina5, Lea T. Grinberg5,6, Bruce L. Miller5, William W. Seeley5,6 and Erik D. Roberson1,7* Abstract Loss-of-function mutations in progranulin (GRN) are a major autosomal dominant cause of frontotemporal dementia. Most pathogenic GRN mutations result in progranulin haploinsufficiency, which is thought to cause frontotemporal dementia in GRN mutation carriers. Progranulin haploinsufficiency may drive frontotemporal dementia pathogenesis by disrupting lysosomal function, as patients with GRN mutations on both alleles develop the lysosomal storage disorder neuronal ceroid lipofuscinosis, and frontotemporal dementia patients with GRN mutations (FTD-GRN) also accumulate lipofuscin. The specific lysosomal deficits caused by progranulin insufficiency remain unclear, but emerging data indicate that progranulin insufficiency may impair lysosomal sphingolipid- metabolizing enzymes. We investigated the effects of progranulin insufficiency on sphingolipid-metabolizing enzymes in the inferior frontal gyrus of FTD-GRN patients using fluorogenic activity assays, biochemical profiling of enzyme levels and posttranslational modifications, and quantitative neuropathology. Of the enzymes studied, only β-glucocerebrosidase exhibited impairment in FTD-GRN patients. Brains from FTD-GRN patients had lower activity than controls, which was associated with lower levels of mature β-glucocerebrosidase protein and accumulation of insoluble, incompletely glycosylated β-glucocerebrosidase. Immunostaining revealed loss of neuronal β- glucocerebrosidase in FTD-GRN patients.
    [Show full text]
  • The Parkinson's-Disease-Associated Receptor GPR37 Undergoes
    © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 1366-1377 doi:10.1242/jcs.176115 RESEARCH ARTICLE The Parkinson’s-disease-associated receptor GPR37 undergoes metalloproteinase-mediated N-terminal cleavage and ectodomain shedding S. Orvokki Mattila, Jussi T. Tuusa* and Ulla E. Petäjä-Repo‡ ABSTRACT like receptor [Pael receptor (Imai et al., 2001)]. Mutations in the PARK2 The G-protein-coupled receptor 37 ( GPR37) has been implicated in gene leading to the loss of the ubiquitin ligase activity of the juvenile form of Parkinson’s disease, in dopamine signalling and parkin are the most common causes of AR-JP (Kitada et al., 1998). in the survival of dopaminergic cells in animal models. The structure An insoluble form of GPR37 has been reported to accumulate in the and function of the receptor, however, have remained enigmatic. brains of AR-JP patients (Imai et al., 2001) and also in the core of ’ Here, we demonstrate that although GPR37 matures and is exported Lewy bodies of Parkinson s disease patients in general (Murakami from the endoplasmic reticulum in a normal manner upon et al., 2004). Thus, the intracellular aggregation and impaired heterologous expression in HEK293 and SH-SY5Y cells, its long ubiquitylation of unfolded GPR37 by parkin have been proposed to extracellular N-terminus is subject to metalloproteinase-mediated be linked with the death of dopaminergic neurons characteristic of ’ limited proteolysis between E167 and Q168. The proteolytic Parkinson s disease (Imai et al., 2001; Kitao et al., 2007). Based on processing is a rapid and efficient process that occurs constitutively.
    [Show full text]