DOCSLIB.ORG

ALDH Expression in Pca Cell Lines C4 C4-2 C4-2B PC-3 PC-3M- Pro4luc PC-3M- Pro4lucbiii DU145 ALDH1A1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ALDH Expression in Pca Cell Lines C4 C4-2 C4-2B PC-3 PC-3M- Pro4luc PC-3M- Pro4lucbiii DU145 ALDH1A1 ALDH Expression in PCa Cell lines C4 C4-2 C4-2B PC-3 PC-3M- PC-3M- DU145 Pro4luc Pro4lucBIII ALDH1A1 - - +++ ++ - ++ ++ ALDH2 +++ +++ +++ - - - + ALDH3A1 - + - + - - + ALDH3A2 ++++ ++++ ++++ +++ +++ +++ +++ ALDH4A1 +++ +++ +++ + + + ++ ALDH5A1 ++ ++ +++ + + + + ALDH6A1 ++++ +++ +++ + + + + ALDH7A1 + + ++ +++ ++ +++ +++ ALDH8A1 + - - - - - - ALDH9A1 +++ +++ +++ ++ ++ +++ ++ ALDH16A1 + + ++ + - + - ALDH18A1 +++ ++++ ++++ ++ +++ +++ +++ Supplementary Table I. Expression levels of ALDH isoforms in prostate cancer cell lines. Expression levels of the ALDH isoforms were assessed with real time qPCR in prostate cancer cell lines Data are classified in levels according to their relative transcript abundance (RTA: 10000/2^ΔCt). RTA <1 = - (Ct value ~38); RTA 1-20 = + (Ct value ~34); RTA 21-100 = ++ (Ct value ~30); RTA 101-500 = +++ (Ct value ~26); RTA > 500 =++++ ( housekeeping gene level Ct value ~22). ND = not determined, not-significant amounts of material. ALDH Expression in Prostate Cancer PCa primary tumor PCa primary cultures #44 #99 #62#69 123 583 697 233 549 069B 567B ALDH1A1 ++ + ND ND ++++ ND ND ND ND ND ND ALDH2 + ++ ND ND ++++ ND ND ND ND ND ND ALDH3A1 ++++ ++++ +++ ++ ++ +++ ++++ ++++ +++ ++ + ALDH3A2 +++ +++ +++ ++++ + ++++ ++++ ++++ ++++ ++++ ++++ ALDH4A1 ++ +++ ++ ++ +++ ND ND ND ND ND ND ALDH5A1 ++ +++ ++ ++ - ND ND ND ND ND ND ALDH6A1 ++ + ND ND ++++ ND ND ND ND ND ND ALDH7A1 ++++ ++++ +++ +++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ALDH8A1 + + ND ND + ND ND ND ND ND ND ALDH9A1 ++ ++ ND ND ++++ ND ND ND ND ND ND ALDH16A1 +++ ++ ND ND ++++ ND ND ND ND ND ND ALDH18A1 - - +++ +++ - ++++ ++++ ++++ ++++ +++++++ Supplementary Table II. Expression levels of ALDH isoforms in primary prostate cancer tissue samples and primary cultures. Expression levels of the ALDH isoforms were assessed with real time qPCR in primary prostate cancer tissue samples (left panel) and primary cultures (right panel). Data are classified in levels according to their relative transcript abundance. RTA <1 = - (Ct value ~38); RTA 1-20 = + (Ct value ~34); RTA 21-100 = ++ (Ct value ~30); RTA 101-500 = +++ (Ct value ~26); RTA > 500 =++++ ( housekeeping gene level Ct value ~22). ND = not determined, not-significant amounts of material. Supplemental Table III. IHC antibodies Primary antibody Antigen retrieval Dilution Supplier Mouse monoclonal anti- Not necessary 1:100 BD Biosciences human ALDH1A1 Rabbit polyclonal anti- Heating samples in 0.1 M citrate 1:50 Sigma ATLAS human ALDH3A2 buffer, pH6, in a microwave oven for 10 min Rabbit monoclonal anti- Not necessary 1:100 AbCaM human ALDH7A1 Rabbit polyclonal anti- Heating samples in 0.1 M citrate 1:50 Sigma ATLAS human ALDH18A1 buffer, pH6, in a microwave oven for 10 min Supplementary Table III. ALDH antibodies used for Immunohistochemical analysis with the necessary antigen retrieval methods, required dilution and suppliers. Table IV. Real time-qPCR primers Gene 5’ Sequence 3’ Sequence ALDH1A1 TGGCTTATCAGCAGGAGTGT GCAATTCACCCACACTGTTC ALDH2 CGAGGTCTTCTGCAACCAG GCCTTGTCCACATCTTCCTT ALDH3A1 CAGGACGAGCTCTACATCCA GGCTTGAGGACCACTGAGTT ALDH3A2 CCCCTTCGTTCTCACCATTC CTGAGGGAGAAGCTTTGCCA ALDH4A1 GGACGTGCAGTACCAAGTGT TAGGCTTCAGGTCCCACTCT ALDH5A1 AAGGATGACCTTGCCAGAAT GGCTTCCTCAGAGAACCACT ALDH6A1 CTGCAGGTTTCTTCCAAGGT ATTTCCCACCAATGAAGAGC ALDH7A1 CAACGAGCCAATAGCAAGAG GCATCGCCAATCTGTCTTAC ALDH8A1 GCAGAGTGCCAAATAGTGGA AACTCCTCCAGGGACTGCT ALDH9A1 GCTGCCAGGATAATAAGGGA GAAATGTCAATGTCCAAGCG ALDH16A1 AGGATCCCATCACAGGAGAG ACTCCAGCCCTTAAATGCC ALDH18A1 ATCAGTGCTGCAGAATCAGG TGGAATTGCCATTTCTTTCA TMPRSS:ERG CAGGAGGCGGAGGCGGA GGCGTTGTAGCTGGGGGTGAG CD44 TGGCACCCGCTATGTCCAG GTAGCAGGGATTCTGTCTG α2 integrin TTTGGTAGTGTGCTGTGTTC GACTCTTCCTTCCTCTTTCTTTAG CD133 AGAGCTTGCACCAACAAAGTACAC AAGCACAGAGGGTCATTGAGAGA GAPDH GACAGTCAGCCGCATCTTC GCAACAATATCCACTTTACCAGAG Supplementary Table IV. Exon-spanning real time-PCR primers designed with Primer Express software (Applied Biosystems, Rotkreuz, Switzerland) .
Load more

Recommended publications
  • (ALDH1A3) for the Maintenance of Non-Small Cell Lung Cancer Stem Cells Is Associated with the STAT3 Pathway
    Author Manuscript Published OnlineFirst on June 6, 2014; DOI: 10.1158/1078-0432.CCR-13-3292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Essential role of aldehyde dehydrogenase 1A3 (ALDH1A3) for the maintenance of non-small cell lung cancer stem cells is associated with the STAT3 pathway Chunli Shao1,2, James P. Sullivan3, Luc Girard1,2, Alexander Augustyn1,2, Paul Yenerall1,2, Jaime Rodriguez4, Hui Liu4, Carmen Behrens4, Jerry W. Shay5, Ignacio I. Wistuba4, John D. Minna 1,2,6,7 1Hamon Center for Therapeutic Oncology Research, 2Simmons Comprehensive Cancer Center, 3Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts, 02114, 4Department of Translational Molecular Pathology, University of Texas M.D. Anderson Cancer Center, Houston, Texas, 77054, 5Department of Cell Biology, 6Department of Pharmacology, 7Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas, 75390, USA. Running Title: ALDH1A3 in non-small cell lung cancer stem cells Keywords: Lung cancer, cancer stem cells, ALDH1A3, STAT3, Stattic Financial Support This project was supported by CPRIT, NCI SPORE P50CA70907, UTSW Cancer Center Support Grant 5P30-CA142543, and the Gillson-Longenbaugh Foundation. Address Correspondence: John D. Minna, M.D. 6000 Harry Hines Blvd Dallas, TX 75390-8593 Hamon Center for Therapeutic Oncology Research UT Southwestern Medical Center Phone: 214-648-4900; Fax: 214-648-4940 [email protected] Disclosure of Potential Conflict of Interest The authors indicate no potential conflicts of interest. Word count: 4583 Total number of figures and tables: 6 figures Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2014 American Association for Cancer Research.
    [Show full text]
  • ATAP00021-Recombinant Human ALDH1A1 Protein
    ATAGENIX LABORATORIES Catalog Number:ATAP00021 Recombinant Human ALDH1A1 protein Product Details Summary English name Recombinant Human ALDH1A1 protein Purity >90% as determined by SDS-PAGE Endotoxin level Please contact with the lab for this information. Construction A DNA sequence encoding the human ALDH1A1 (Met1-Ser501) was fused with His tag Accession # P00352 Host E.coli Species Homo sapiens (Human) Predicted Molecular Mass 52.58 kDa Formulation Supplied as solution form in PBS pH 7.5 or lyophilized from PBS pH 7.5. Shipping In general, proteins are provided as lyophilized powder/frozen liquid. They are shipped out with dry ice/blue ice unless customers require otherwise. Stability &Storage Use a manual defrost freezer and avoid repeated freeze thaw cycles. Store at 2 to 8 °C for one week . Store at -20 to -80 °C for twelve months from the date of receipt. Reconstitution Reconstitute in sterile water for a stock solution.A copy of datasheet will be provided with the products, please refer to it for details. Background Background Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1 (RALDH1), is an enzyme that is expressed at high levels in stem cells and that has been suggested to regulate stem cell function. The retinaldehyde dehydrogenase (RALDH) subfamily of ALDHs, composed of ALDH1A1, ALDH1A2, ALDH1A3, and ALDH8A1, regulate development by catalyzing retinoic acid biosynthesis. The ALDH1A1 protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH1A1 also belongs to the group of corneal crystallins that Web:www.atagenix.com E-mail: [email protected] Tel: 027-87433958 ATAGENIX LABORATORIES Catalog Number:ATAP00021 Recombinant Human ALDH1A1 protein help maintain the transparency of the cornea.
    [Show full text]
  • Overall Survival of Pancreatic Ductal Adenocarcinoma Is Doubled by Aldh7a1 Deletion in the KPC Mouse
    Overall survival of pancreatic ductal adenocarcinoma is doubled by Aldh7a1 deletion in the KPC mouse Jae-Seon Lee1,2*, Ho Lee3*, Sang Myung Woo4, Hyonchol Jang1, Yoon Jeon1, Hee Yeon Kim1, Jaewhan Song2, Woo Jin Lee4, Eun Kyung Hong5, Sang-Jae Park4, Sung- Sik Han4§§ and Soo-Youl Kim1§ 1Division of Cancer Biology, Research Institute, National Cancer Center, Goyang, Republic of Korea. 2Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul, Republic of Korea. 3Graduate School of Cancer Science and Policy, 4Department of Surgery, Center for Liver and Pancreatobiliary Cancer and 5Department of Pathology, National Cancer Center, Goyang, Republic of Korea. Correspondence §Corresponding author: [email protected] (S.-Y.K.) §§Co-corresponding author: [email protected] (S.-S.H.) *These authors contributed equally to this work 1 Abstract Rationale: The activity of aldehyde dehydrogenase 7A1 (ALDH7A1), an enzyme that catalyzes the lipid peroxidation of fatty aldehydes was found to be upregulated in pancreatic ductal adenocarcinoma (PDAC). ALDH7A1 knockdown significantly reduced tumor formation in PDAC. We raised a question how ALDH7A1 contributes to cancer progression. Methods: To answer the question, the role of ALDH7A1 in energy metabolism was investigated by knocking down and knockdown gene in mouse model, because the role of ALDH7A1 has been reported as a catabolic enzyme catalyzing fatty aldehyde from lipid peroxidation to fatty acid. Oxygen consumption rate (OCR), ATP production, mitochondrial membrane potential, proliferation assay and immunoblotting were performed. In in vivo study, two human PDAC cell lines were used for pre-clinical xenograft model as well as spontaneous PDAC model of KPC mice was also employed for anti-cancer therapeutic effect.
    [Show full text]
  • Insights Into Aldehyde Dehydrogenase Enzymes: a Structural Perspective
    REVIEW published: 14 May 2021 doi: 10.3389/fmolb.2021.659550 Insights into Aldehyde Dehydrogenase Enzymes: A Structural Perspective Kim Shortall, Ahmed Djeghader, Edmond Magner and Tewfik Soulimane* Department of Chemical Sciences, Bernal Institute, University of Limerick, Limerick, Ireland Aldehyde dehydrogenases engage in many cellular functions, however their dysfunction resulting in accumulation of their substrates can be cytotoxic. ALDHs are responsible for the NAD(P)-dependent oxidation of aldehydes to carboxylic acids, participating in detoxification, biosynthesis, antioxidant and regulatory functions. Severe diseases, including alcohol intolerance, cancer, cardiovascular and neurological diseases, were linked to dysfunctional ALDH enzymes, relating back to key enzyme structure. An in-depth understanding of the ALDH structure-function relationship and mechanism of action is key to the understanding of associated diseases. Principal structural features 1) cofactor binding domain, 2) active site and 3) oligomerization mechanism proved critical in maintaining ALDH normal activity. Emerging research based on the combination of structural, functional and biophysical studies of bacterial and eukaryotic ALDHs contributed to the appreciation of diversity within the superfamily. Herewith, we Edited by: discuss these studies and provide our interpretation for a global understanding of Ashley M Buckle, ALDH structure and its purpose–including correct function and role in disease. Our Monash University, Australia analysis provides a synopsis
    [Show full text]
  • A Novel ALDH1A1 Inhibitor Targets Cells with Stem Cell Characteristics in Ovarian Cancer
    cancers Article A Novel ALDH1A1 Inhibitor Targets Cells with Stem Cell Characteristics in Ovarian Cancer Nkechiyere G. Nwani 1, Salvatore Condello 2 , Yinu Wang 1, Wendy M. Swetzig 1, Emma Barber 1, Thomas Hurley 3,4 and Daniela Matei 1,5,6,* 1 Department of Obstetrics and Gynecology, Northwestern University, Chicago, IL 60611, USA; [email protected] (N.G.N.); [email protected] (Y.W.); [email protected] (W.M.S.); [email protected] (E.B.) 2 Department of Obstetrics and Gynecology, Indiana University, Indianapolis, IN 46202, USA; [email protected] 3 Department of Biochemistry and molecular Biology, Indiana University, Indianapolis, IN 46202, USA; [email protected] 4 Melvin and Bren Simon Cancer Center, Indianapolis, IN 46202, USA 5 Robert H Lurie Comprehensive Cancer Center, Chicago, IL 60611, USA 6 Jesse Brown VA Medical Center, Chicago, IL 60612, USA * Correspondence: [email protected] Received: 8 February 2019; Accepted: 3 April 2019; Published: 8 April 2019 Abstract: A small of population of slow cycling and chemo-resistant cells referred to as cancer stem cells (CSC) have been implicated in cancer recurrence. There is emerging interest in developing targeted therapeutics to eradicate CSCs. Aldehyde-dehydrogenase (ALDH) activity was shown to be a functional marker of CSCs in ovarian cancer (OC). ALDH activity is increased in cells grown as spheres versus monolayer cultures under differentiating conditions and in OC cells after treatment with platinum. Here, we describe the activity of CM37, a newly identified small molecule with inhibitory activity against ALDH1A1, in OC models enriched in CSCs. Treatment with CM37 reduced OC cells’ proliferation as spheroids under low attachment growth conditions and the expression of stemness-associated markers (OCT4 and SOX2) in ALDH+ cells fluorescence-activated cell sorting (FACS)-sorted from cell lines and malignant OC ascites.
    [Show full text]
  • Aldehyde Dehydrogenase, Liver Disease and Cancer Wenjun Wang1, Chunguang Wang2, Hongxin Xu1, Yanhang Gao1
    Int. J. Biol. Sci. 2020, Vol. 16 921 Ivyspring International Publisher International Journal of Biological Sciences 2020; 16(6): 921-934. doi: 10.7150/ijbs.42300 Review Aldehyde Dehydrogenase, Liver Disease and Cancer Wenjun Wang1, Chunguang Wang2, Hongxin Xu1, Yanhang Gao1 1. Department of Hepatology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin, 130021, China. 2. Department of Thoracic & Cardiovascular Surgery, Second Clinical College, Jilin University, Changchun, 130041, China. Corresponding author: Yanhang Gao, MD., PhD., Department of Hepatology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin, 130021, China. Email: [email protected]. Tel: +86 15804303019; +86 431 81875121; +86 431 81875106; Fax number: 0431-81875106. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.11.20; Accepted: 2020.01.03; Published: 2020.01.22 Abstract Acetaldehyde dehydrogenase 2 (ALDH2) is the key enzyme responsible for metabolism of the alcohol metabolite acetaldehyde in the liver. In addition to conversion of the acetaldehyde molecule, ALDH is also involved in other cellular functions. Recently, many studies have investigated the involvement of ALDH expression in viral hepatitis, alcoholic liver disease (ALD), non-alcoholic fatty liver disease (NAFLD), liver fibrosis, and liver cancer. Notably, ALDH2 expression has been linked with liver cancer risk, as well as pathogenesis and prognosis, and has emerged as a promising therapeutic target. Of note, approximately 8% of the world’s population, and approximately 30-40% of the population in East Asia carry an inactive ALDH2 gene.
    [Show full text]
  • ALDH1A2 Is a Candidate Tumor Suppressor Gene in Ovarian Cancer
    Supplementary Materials ALDH1A2 is a Candidate Tumor Suppressor Gene in Ovarian Cancer Jung-A Choi, Hyunja Kwon, Hanbyoul Cho*, Joon-Yong Chung, Stephen M. Hewitt and Jae-Hoon Kim Figure S1. Transfection efficiency after pCMV-tagB-Flag-ALDH1A2 transfection in RMG-I, SKOV3, and OVCA433 cells. Cells were grown on coverslips and transfected with pCMV-tagB-Flag- ALDH1A2 using Lipofectamine® 2000. Cells were then immunostained with primary antibodies for Flag and visualized by confocal microscopy (A). Transfection efficiency (%) was evaluated by counting cells expressing Flag. Figure S2. Effect of ALDH1A2 overexpression on cell cycle distribution and cell death in ovarian cancer. (A-B) Cells were transfected with pCMV-tagB-Flag-ALDH1A2 using Lipofectamine® 2000. After 24 h, the cells were harvested, fixed in ice-cold 70% ethanol, and stained with propidium iodide. Cell-cycle distribution (A) and cell death (B) were analyzed by fluorescence-activated cell sorting (FACS). Apoptotic cells were quantified for DNA content after propidium iodide staining; the sub- G 1 fraction (%) represents the proportion of apoptotic cells. Statistical significance was assessed using an unpaired t test. **p < 0.05, ***p < 0.005 . 1 Figure S3. Annexin V/PI staining in RMG-I, SKOV3, and OVCA433 cells overexpressing ALDH1A2. (A-B) Cells were transfected with pCMV-tagB-Flag-ALDH1A2 using Lipofectamine® 2000. After the indicated time, cells were immediately stained with Annexin V-FITC and PI, subjected to flow cytometry analyses (A). Quantitative results of cell death were determined using Annexin V/PI (B). 2 Figure S4. Methylation status of ALDH1A2 genes in public datasets, Methylation and Expression Database of Normal and Tumor Tissues (MENT; http://mgrc.kribb.re.kr:8080/MENT/).
    [Show full text]
  • The Cancer Stem Cell Marker Aldehyde Dehydrogenase Is Required to Maintain a Drug-Tolerant Tumor Cell Subpopulation
    Published OnlineFirst May 8, 2014; DOI: 10.1158/0008-5472.CAN-13-3456 Cancer Therapeutics, Targets, and Chemical Biology Research The Cancer Stem Cell Marker Aldehyde Dehydrogenase Is Required to Maintain a Drug-Tolerant Tumor Cell Subpopulation Debasish Raha1, Timothy R. Wilson1, Jing Peng2, David Peterson2, Peng Yue3, Marie Evangelista1, Catherine Wilson1, Mark Merchant2, and Jeff Settleman1 Abstract Selective kinase inhibitors have emerged as an important class of cancer therapeutics, and several such drugs are now routinely used to treat advanced-stage disease. However, their clinical benefit is typically short-lived because of the relatively rapid acquisition of drug resistance following treatment response. Accumulating preclinical and clinical data point to a role for a heterogeneous response to treatment within a subpopulation of tumor cells that are intrinsically drug-resistant, such as cancer stem cells. We have previously described an epigenetically determined reversibly drug-tolerant subpopulation of cancer cells that share some properties with cancer stem cells. Here, we define a requirement for the previously established cancer stem cell marker ALDH (aldehyde dehydrogenase) in the maintenance of this drug-tolerant subpopulation. We find that ALDH protects the drug-tolerant subpopulation from the potentially toxic effects of elevated levels of reactive oxygen species (ROS) in these cells, and pharmacologic disruption of ALDH activity leads to accumulation of ROS to toxic levels, consequent DNA damage, and apoptosis specifically within the drug-tolerant subpopulation. Combining ALDH inhibition with other kinase-directed treatments delayed treatment relapse in vitro and in vivo, revealing a novel combination treatment strategy for cancers that might otherwise rapidly relapse following single-agent therapy.
    [Show full text]
  • Cells in Diabetic Mice
    ARTICLE Received 12 Jan 2016 | Accepted 18 Jul 2016 | Published 30 Aug 2016 DOI: 10.1038/ncomms12631 OPEN Aldehyde dehydrogenase 1a3 defines a subset of failing pancreatic b cells in diabetic mice Ja Young Kim-Muller1,*, Jason Fan1,2,*, Young Jung R. Kim2, Seung-Ah Lee1, Emi Ishida1, William S. Blaner1 & Domenico Accili1 Insulin-producing b cells become dedifferentiated during diabetes progression. An impaired ability to select substrates for oxidative phosphorylation, or metabolic inflexibility, initiates progression from b-cell dysfunction to b-cell dedifferentiation. The identification of pathways involved in dedifferentiation may provide clues to its reversal. Here we isolate and functionally characterize failing b cells from various experimental models of diabetes and report a striking enrichment in the expression of aldehyde dehydrogenase 1 isoform A3 (ALDH þ )asb cells become dedifferentiated. Flow-sorted ALDH þ islet cells demonstrate impaired glucose- induced insulin secretion, are depleted of Foxo1 and MafA, and include a Neurogenin3- positive subset. RNA sequencing analysis demonstrates that ALDH þ cells are characterized by: (i) impaired oxidative phosphorylation and mitochondrial complex I, IV and V; (ii) activated RICTOR; and (iii) progenitor cell markers. We propose that impaired mitochondrial function marks the progression from metabolic inflexibility to dedifferentiation in the natural history of b-cell failure. 1 Naomi Berrie Diabetes Center and Department of Medicine, Columbia University, New York, New York 10032, USA. 2 Department of Genetics and Integrated Program in Cellular, Molecular and Biomedical Studies, Columbia University, New York, New York 10032, USA. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to D.A.
    [Show full text]
  • Metabolic Network-Based Stratification of Hepatocellular Carcinoma Reveals Three Distinct Tumor Subtypes
    Metabolic network-based stratification of hepatocellular carcinoma reveals three distinct tumor subtypes Gholamreza Bidkhoria,b,1, Rui Benfeitasa,1, Martina Klevstigc,d, Cheng Zhanga, Jens Nielsene, Mathias Uhlena, Jan Borenc,d, and Adil Mardinoglua,b,e,2 aScience for Life Laboratory, KTH Royal Institute of Technology, SE-17121 Stockholm, Sweden; bCentre for Host-Microbiome Interactions, Dental Institute, King’s College London, SE1 9RT London, United Kingdom; cDepartment of Molecular and Clinical Medicine, University of Gothenburg, SE-41345 Gothenburg, Sweden; dThe Wallenberg Laboratory, Sahlgrenska University Hospital, SE-41345 Gothenburg, Sweden; and eDepartment of Biology and Biological Engineering, Chalmers University of Technology, SE-41296 Gothenburg, Sweden Edited by Sang Yup Lee, Korea Advanced Institute of Science and Technology, Daejeon, Republic of Korea, and approved November 1, 2018 (received for review April 27, 2018) Hepatocellular carcinoma (HCC) is one of the most frequent forms of of markers associated with recurrence and poor prognosis (13–15). liver cancer, and effective treatment methods are limited due to Moreover, genome-scale metabolic models (GEMs), collections tumor heterogeneity. There is a great need for comprehensive of biochemical reactions, and associated enzymes and transporters approaches to stratify HCC patients, gain biological insights into have been successfully used to characterize the metabolism of subtypes, and ultimately identify effective therapeutic targets. We HCC, as well as identify drug targets for HCC patients (11, 16–18). stratified HCC patients and characterized each subtype using tran- For instance, HCC tumors have been stratified based on the uti- scriptomics data, genome-scale metabolic networks and network lization of acetate (11). Analysis of HCC metabolism has also led topology/controllability analysis.
    [Show full text]
  • Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
    BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases.
    [Show full text]
  • ALDH1A3 Is the Key Isoform That Contributes to Aldehyde Dehydrogenase Activity and Affects in Vitro Proliferation in Cardiac Atrial Appendage Progenitor Cells
    ORIGINAL RESEARCH published: 24 July 2018 doi: 10.3389/fcvm.2018.00090 ALDH1A3 Is the Key Isoform That Contributes to Aldehyde Dehydrogenase Activity and Affects in Vitro Proliferation in Cardiac Atrial Appendage Progenitor Cells Stefania Puttini 1, Isabelle Plaisance 1, Lucio Barile 2, Elisabetta Cervio 2, Giuseppina Milano 1,2, Paola Marcato 3, Thierry Pedrazzini 1 and Giuseppe Vassalli 1,2* 1 Cardiovascular Department, CHUV University Hospital, Lausanne, Switzerland, 2 Cardiocentro Ticino Foundation and Swiss Institute for Regenerative Medicine, Lugano, Switzerland, 3 Departments of Pathology, Microbiology and Immunology, Dalhousie University, Halifax, NS, Canada Edited by: Rajesh Katare, hi University of Otago, New Zealand High aldehyde dehydrogenase (ALDH ) activity has been reported in normal and cancer hi Reviewed by: stem cells. We and others have shown previously that human ALDH cardiac atrial Daniele Torella, appendage cells are enriched with stem/progenitor cells. The role of ALDH in these cells Università degli studi Magna Græcia di Catanzaro, Italy is poorly understood but it may come down to the specific ALDH isoform(s) expressed. Parul Dixit, This study aimed to compare ALDHhi and ALDHlo atrial cells and to identify the isoform(s) Bristol Heart Institute, United Kingdom that contribute to ALDH activity, and their functional role. *Correspondence: Giuseppe Vassalli Methods and Results: Cells were isolated from atrial appendage specimens from [email protected] patients with ischemic and/or valvular heart disease undergoing heart surgery. ALDHhi activity assessed with the Aldefluor reagent coincided with primitive surface marker Specialty section: + hi This article was submitted to expression (CD34 ). Depending on their ALDH activity, RT-PCR analysis of ALDH and Cardiovascular Biologics and ALDHlo cells demonstrated a differential pattern of pluripotency genes (Oct 4, Nanog) Regenerative Medicine, hi a section of the journal and genes for more established cardiac lineages (Nkx2.5, Tbx5, Mef2c, GATA4).
    [Show full text]