ARTICLE

https://doi.org/10.1038/s41467-019-11978-0 OPEN Gut microbiota confers host resistance to obesity by metabolizing dietary polyunsaturated fatty acids

Junki Miyamoto1,2, Miki Igarashi1, Keita Watanabe1, Shin-ichiro Karaki3, Hiromi Mukouyama1, Shigenobu Kishino 4, Xuan Li1, Atsuhiko Ichimura 5,6, Junichiro Irie 2,7, Yukihiko Sugimoto 2,8, Tetsuya Mizutani9, Tatsuya Sugawara 10, Takashi Miki 11, Jun Ogawa4, Daniel J. Drucker12, Makoto Arita13,14, Hiroshi Itoh2,7 & Ikuo Kimura 1,2

1234567890():,; Gut microbiota mediates the effects of diet, thereby modifying host metabolism and the incidence of metabolic disorders. Increased consumption of omega-6 polyunsaturated fatty acid (PUFA) that is abundant in Western diet contributes to obesity and related diseases. Although gut-microbiota-related metabolic pathways of dietary PUFAs were recently eluci- dated, the effects on host physiological function remain unclear. Here, we demonstrate that gut microbiota confers host resistance to high-fat diet (HFD)-induced obesity by modulating dietary PUFAs metabolism. Supplementation of 10-hydroxy-cis-12-octadecenoic acid (HYA), an initial linoleic acid-related gut-microbial metabolite, attenuates HFD-induced obesity in mice without eliciting arachidonic acid-mediated adipose inflammation and by improving metabolic condition via free fatty acid receptors. Moreover, Lactobacillus-colonized mice show similar effects with elevated HYA levels. Our findings illustrate the interplay between gut microbiota and host energy metabolism via the metabolites of dietary omega-6-FAs thereby shedding light on the prevention and treatment of metabolic disorders by targeting gut microbial metabolites.

1 Department of Applied Biological Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Fuchu-shi, Tokyo 183-8509, Japan. 2 AMED-CREST, Japan Agency for Medical Research and Development, Chiyoda-ku, Tokyo 100-0004, Japan. 3 Laboratory of Physiology, Department of Environmental and Life Sciences, University of Shizuoka, Shizuoka 422-8526, Japan. 4 Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan. 5 Department of Biological Chemistry, Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto 606-8501, Japan. 6 K-CONNEX, Keihanshin Consortium for Fostering the Next Generation of Global Leaders in Research, Kyoto 606- 8501, Japan. 7 Department of Endocrinology, Metabolism and Nephrology, School of Medicine, Keio University, Shinjuku-ku, Tokyo 160-8582, Japan. 8 Department of Pharmaceutical Biochemistry, Graduate School of Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan. 9 Research and Education Center for Prevention of Global Infectious Diseases of Animals, Faculty of Agriculture, Tokyo University of Agriculture and Technology, Fuchu-shi, Tokyo 183-0045, Japan. 10 Division of Applied Biosciences, Graduate School of Agriculture, Kyoto University, Kyoto 606-8502, Japan. 11 Department of Medical Physiology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan. 12 Department of Medicine, Lunenfeld Tanenbaum Research Institute, Mount Sinai Hospital, University of Toronto, Toronto ON M5S 2J7, Canada. 13 Division of Physiological Chemistry and Metabolism, Faculty of Pharmacy, Keio University, 1-5-30, Shibakoen, Minato-ku, Tokyo 105-0011, Japan. 14 Laboratory for Metabolomics, RIKEN Center for Integrative Medical Sciences, Kanagawa 230-0045, Japan. Correspondence and requests for materials should be addressed to I.K. (email: [email protected])

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0

iet is the most important factor affecting host nutrition microbial PUFA-metabolite profiles in the cecum of normal chow Dand metabolism; however, dysregulation of energy (NC)-fed and HFD-fed mice, finding that LA-derived metabolites homeostasis due to excess food intake leads to obesity. existed at predominantly higher levels as compared with those Obesity progression occurs due to a long-term imbalance between associated with αLA-derived metabolites (Supplementary Fig. 1c), energy intake and expenditure that influences multiple pathways with 10-hydroxy-cis-12-octadecenoic acid (HYA), 10- via metabolites and hormones. Excess food intake, especially hydroxyoctadecanoic acid (HYB), 10-hydoroxy-trans-11-octade- high-calorie diets, such as high-fat and high-sugar diets, is con- cenoic acid (HYC), 10-oxo-cis-12-octadecenoic acid (KetoA), sidered the greatest risk factor in the development of obesity1. 10-oxo-octadecanoic acid (KetoB), and 10-oxo-trans-11-octade- Especially, high-fat diet (HFD)-induced obesity results in changes cenoic acid (KetoC) in LA-derived metabolites specifically atte- in gut-microbial composition, as well as reductions in microbial nuated by HFD-feeding for 2 weeks (Fig. 1a). Moreover, by diversity and changes in specific bacterial taxa2–5, despite gut comparing these LA-derived metabolites (HYA, HYB, HYC, microbiota is a key interface for energy acquisition because it can KetoA, KetoB, and KetoC) in the cecum of NC- and HFD-fed convert dietary substrates to host nutrition in a composition- mice, we observed a significantly reduced level of these metabo- dependent manner2,6. lites in mice fed a HFD for 2 weeks (Fig. 1b). However, HFD During the previous three decades, total fat and saturated-fat supplemented with LA increased cecal levels of HYA (the initial intake as a percentage of total calories continued to decrease in gut-microbial PUFA-metabolite derived from LA) and KetoA, Western diets7,8. However, the intake of omega-6 fat that includes whereas levels of all metabolites were markedly decreased in both primarily the essential fatty acid (FA) linoleic acid (LA), has NC- and HFD-fed germ-free (GF) mice (Fig. 1b). Moreover, 16 S increased, whereas intake of the omega-3 fat that includes other rRNA gene amplicon sequencing confirmed that HFD supple- essential FAs alpha-linolenic acid (αLA) has decreased, thereby mented with LA altered the relative abundance of the major phyla significantly increasing the omega-6/omega-3 ratio over 20:19. constituting the gut microbiota (Fig. 1c). Specifically, in agree- This change in the composition of polyunsaturated FAs (PUFAs) ment with previous studies6, the abundance of Firmicutes substantially increases the incidence and prevalence of overweight markedly increased and that of Bacteroidetes markedly decreased and obesity7. Regarding the physiological effects of these FAs, in HFD-fed mice; however, the abundance of Firmicutes was recent studies demonstrate that PUFA-related metabolic effects decreased by LA supplementation (Fig. 1c). Additionally, we not only promote the synthesis of eicosanoids, which act as lipid confirmed that HFD feeding altered gut microbiota composition, mediators and are utilized as an energy source, but also affect the as indicated by principal coordinate analysis (PCoA) based on free-FA-specific receptors free fatty acid receptor (FFAR)1 and taxonomic datasets (Fig. 1d). Moreover, hierarchical clustering of FFAR4 [also known as G-protein-coupled receptor (GPCR) individual families confirmed the effect of HFD and LA- GPR40 and GPR120, respectively]10. supplemented HFD on the gut microbiome (Fig. 1e). Although GPR40 is a receptor for medium- and long-chain FAs (LCFAs) HFD feeding was associated with a drastically decreased abun- that include PUFAs, whereas GPR120 is a receptor exclusively for dance of the Lactobacillaceae family belonging to Firmicutes, LCFAs. These receptors couple with the Gq family of G proteins, interestingly, LA supplementation contributed to an increase in leading to elevated levels of intracellular calcium ([Ca2+]i)11. the abundance of Lactobacillaceae (Fig. 1e) and a significant GPR40 is highly expressed in pancreatic insulin-producing β cells, expansion of the Lactobacillus genus (Fig. 2a). Moreover, we and LCFAs strongly promote glucose-stimulated insulin secretion examined what species were related to HYA production in the via GPR4012. Dysfunction of GPR120, which is expressed in Lactobacillus genus by in vitro bacterial-culture screening. Lac- adipose tissues, leads to obesity, resulting in glucose intolerance tobacillus salivarius and Lactobacillus gasseri efficiently produced and fatty liver accompanied by decreased adipocyte differentia- HYA from LA in 22 Lactobacillus strains, whereas Lactobacillus tion and lipogenesis, as well as enhanced hepatic lipogenesis13. acidophilus and Lactobacillus johnsonii produced very little HYA Moreover, GPR120 activation by docosahexaenoic acid exerts (Supplementary Table 1). Similarly, L. salivarius and L. gasseri,as anti-inflammatory effects in macrophages14. Furthermore, both HYA-producing bacteria, were markedly decreased in HFD-fed receptors are expressed in enteroendocrine L cells, and LCFAs mice and significantly increased following LA supplementation, promote the secretion of gut hormone, glucagon-like peptide-1 whereas L. acidophilus and L. johnsonii, as HYA non-producing (GLP-1) via these receptors15. bacteria, did not change following LA supplementation (Fig. 2b). Gut microbiota mediate saturation of PUFAs derived from Furthermore, we observed suppressed expression of Cla-hy, a key dietary fat as a detoxifying mechanism in the gastrointestinal LA-metabolizing enzyme characterized in gut microbes (Supple- tract16. To date, various bacteria, including gut microbes, have mentary Fig. 1a), in HFD-fed mice and that this suppression was been identified as producing PUFA-derived intermediate meta- alleviated by LA supplementation, whereas levels of Cla-dh and bolites17–20. Furthermore, in vitro stimulation by and in vivo Cla-er (Supplementary Fig. 1a) did not change following LA administration of PUFA-derived bacterial intermediate metabo- supplementation (Fig. 2c). These findings collectively demon- lites result in anti-obesity and anti-inflammatory effects21–24; strated that HFD feeding altered gut microbial composition and however, the relationship between host influence, the physiolo- inhibited the production of PUFA metabolites by the gut gical functions of these intermediate metabolites, and gut microbes; however, PUFA supplementation restored the abun- microbiota remains unclear. In this study, we show that gut dance of the Lactobacillus and the gut microbial PUFA- microbiota confers host resistance to HFD-induced obesity metabolite HYA. through the production of PUFA metabolites by investigating the integrated role of gut-microbial PUFA metabolites in host energy regulation in mice. Microbial PUFA metabolites improve host metabolic condi- tion. We then examined the effects of gut-microbial PUFA metabolites on host energy regulation in a mouse model of HFD- Results induced obesity. HYA is an initial product of gut-microbial Dietary PUFA-derived gut microbial metabolites. Microbes metabolites from dietary LA (Supplementary Fig. 1a). In this transform PUFAs into a variety of FAs, such as LA-derived experiment, 4-week-old mice were fed HFD (control) or HFD metabolites (Supplementary Fig. 1a)17 and αLA-derived meta- supplemented with either 1% HYA as a gut-microbial metabolite bolites (Supplementary Fig. 1b)18.Wefirst examined the gut- or 1% LA, a precursor of HYA for 12 weeks (Supplementary

2 NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 ARTICLE

a NC HFD b LA HYA HYB HYC * CLA1_CLA3 25 150 1.5 CLA2 20 100 1 KetoA 15 10 KetoB 50 0.5 5 KetoC in cecal contents 0 0 0

z-score (pmol/mg) acids Fatty HYA (–)GF (–) +LA GF (–)GF (–) +LA GF (–)GF (–) +LA GF 2 HYB NC HFD NC HFD NC HFD 1 HYC 0 OA KetoA KetoB KetoC –1 * 0.1 1000 2.5 –2 t10-18:1 0.08 800 2 αLA 0.06 600 1.5 CALA1_CALA3 0.04 400 1 CALA2 0.02 200 0.5 αHYA_αHYC 0 0 0 (–)GF (–) +LA GF (–)GF (–) +LA GF (–)GF (–) +LA GF αHYB NC HFD NC HFD NC HFD αKetoA_αKetoC αKetoB

ce

100 Verrucomicrobia HFD 80 Tenericutes

Saccharibacteria NC (–) LA -value 60 Proteobacteria q HFD vs HFD+LA Bifidobacteriaceae Firmicutes Coriobacteriaceae Deferribacteres 40 Bacteroidaceae Cyanobacteria Bacteroidales S24-7 group Bacteroidetes 20 Porphyromonadaceae

Relative abundance (%) abundance Relative Actinobacteria Prevotellaceae 0 Rikenellaceae NC (–) LA Deferribacteraceae HFD Bacillales Family XI z-score Carnobacteriaceae Enterococcaceae d 2 Lactobacillaceae 1 Streptococcaceae Christensenellaceae 0 2 Clostridiaceae 1 –1 Clostridiales vadinBB60 group –2 Eubacteriaceae 0 Clostridiales Family XIII q-value Gracilibacteraceae Lachnospiraceae PC2 (18.8%) 0.06 NC Peptococcaceae 0.04 –2 HFD Peptostreptococcaceae HFD+LA 0.02 Ruminococcaceae 0 Erysipelotrichaceae –2 0 2 Phyllobacteriaceae PC1 (28.1%) Rhodospirillaceae Alcaligenaceae Desulfovibrionaceae Helicobacteraceae Enterobacteriaceae Verrucomicrobiaceae

Fig. 1 Effects of dietary PUFAs on gut microbiota composition and PUFA metabolites. a Heat map of gut microbial PUFA metabolites in cecal content (n = 8 per group). b LA-derived gut microbial PUFA metabolites in cecal content were quantified (n = 7, 10, 8, 8, and 8 per group for HYA; n = 8,10, 8, 8, and 8 per group for HYB; n = 7, 10, 8, 8, and 10 per group for HYC; n = 8, 10, 8, 8, and 10 per group for KetoA; n = 7, 10, 7, 8, and 8 per group for KetoB; n = 8, 9, 8, 8, and 8 per group for KetoC). *P < 0.05 (Tukey–Kramer test). c–e Gut microbial composition was evaluated in order to determine the relative abundance of microbial taxa (c), diversity (d), and abundance of the bacterial domain at the family level (e)(n = 8, 10, and 7 per group). (−)_NC represents normal chow-fed mice, and (−)_HFD represents high-fat diet-fed mice. q < 0.05. Results are presented as means ± SE. Source data are provided as a Source Data file 1

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 3 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0

a 5 4

genus in 3 **, ## copies/ng DNA

3 2

1 **

Lactobacillus 0 NC (–) LA cecum ×10

HFD

b L. salivarius L. gasseri L. johnsonii L. acidophilus P = 0.0896 0.0004 0.012 0.0012 0.08 ## 0.0003 0.06 0.008 0.0008 0.0002 # 0.04 ** ** 0.004 0.0004 copies/ng DNA copies/ng

3 0.0001 0.02 ** ×10 0 0 0 0 NC (–) LA NC (–) LA NC (–) LA NC (–) LA

HFD HFD HFD HFD

c Cla-hy Cla-dh Cla-er 1.5 1.5 1.5 * )

16S 1 1 **,# 1 ** **

0.5 ** 0.5 0.5 Relative mRNA Relative expression (/ 0 0 0 NC (–) LA NC (–) LA NC (–) LA

HFD HFD HFD

Fig. 2 HYA-producing lactic acid bacteria. a The abundance of Lactobacillus was analyzed by qPCR (n = 9, 8, and 9 per group). b The abundance of the Lactobacillus strains (n = 7, 8, and 7 per group) and c the relative mRNA expression of metabolite-synthesizing enzymes (Cla-hy, Cla-dh, and Cla-er; see Supplementary Fig. 1) (n = 7 per group for Cla-hy; n = 8 per group for Cla-dh and Cla-er) in cecum were analyzed by qPCR and qRT-PCR. **P < 0.01, *P < 0.05 vs. NC (Tukey–Kramer test). ##P < 0.01; #P < 0.05 vs. (−) (Tukey–Kramer test). (−)_HFD represents high-fat diet-fed mice. Results are presented as means ± SE. Source data are provided as a Source Data file 2

Table 2). We found that the body weight of HYA-fed mice was suggested that HYA supplementation suppressed appetite and significantly lower as compared with that of control and LA-fed improved metabolic condition, thereby inducing greater resis- mice during growth (Fig. 3a). In addition, the fat mass of white tance to HFD-induced obesity, even in the presence of PUFAs. In adipose tissue (WAT) was significantly lower in HYA-fed mice addition, we performed the same experiment under 0.5% HYA- than in control and LA-fed mice at 16 weeks of age (Fig. 3b). supplemented HFD-fed conditions equivalent to physiologically Moreover, we found a significant decrease in WAT adipocyte size relevant concentrations of HYA in the cecum of NC-fed mice in HYA-fed mice (Fig. 3c), and the food intake of HYA- and LA- (Supplementary Fig. 2a). The results showed that 0.5% HYA fed mice was significantly lower than that of control mice supplementation suppressed appetite and improved metabolic (Fig. 3d). Furthermore, HFD-induced insulin resistance and condition, thereby inducing greater resistance to HFD-induced impaired glucose tolerance, as determined by the insulin tolerance obesity, similar to 1% HYA supplementation (Supplementary test (ITT) and glucose tolerance test (GTT), respectively, were Fig. 2b–m). significantly attenuated in HYA-fed mice as compared with control and LA-fed mice (Fig. 3e, f). Moreover, the plasma glu- cose and total cholesterol levels of HYA-fed mice were sig- Microbial PUFA metabolites and adipose inflammatory nificantly lower than those of control mice (Fig. 3g, h), whereas response. We also examined the influence of HYA- or LA-feeding triglyceride levels were similar among control, HYA-, and LA-fed on host lipid metabolism over a period of 12 weeks. Interestingly, mice (Fig. 3i). Additionally, we found that levels of the plasma long-term HFD-feeding for 12 weeks compared with NC feeding peptide YY (PYY) were significantly higher in HYA-fed mice resulted in elevated KetoB and HYB levels in the cecum relative to than in control mice (Fig. 3j), and similarly, that plasma GLP-1 levels observed resulting from HFD-feeding for 2 weeks, whereas levels were markedly higher in HYA-fed mice than in control and long-term HFD-feeding for 12 weeks, similar to HFD-feeding for LA-fed mice (Fig. 3k), whereas the plasma insulin levels of HYA- 2 weeks, resulted in decreased HYA levels (Supplementary Fig. fed mice were significantly lower than those of control mice (Fig. 3a). In addition, long-term HFD-feeding for 12 weeks, similar to 3l). Furthermore, we observed a significant increase in the level of HFD-feeding for 2 weeks, suppressed Cla-hy expression, whereas fecal triglycerides of HYA-fed mice (Fig. 3m). These findings long-term HFD-feeding for 12 weeks increased Cla-dh and Cla-er

4 NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 ARTICLE

ab45 Control Control HYA LA 1.6 HYA ** # 35 # ## LA 1.2 ** 25 0.8 WAT (g) WAT

Body weight (g) weight Body ** 0.4

15 epiWAT 0 0 epi peri sub 4 8 12 16 Weeks of age c d 12,000 4 Control HYA LA

) *, # 2 * m 3 ** μ 8000 ** 2 4000 1 (g/mouse/day) Adipocyte ( Adipocyte 0 0 (g) 7 weeks intake Food Control HYA LA Control HYA LA

efg 250 600 240 200 ** 400 # 220 150 # * ## ** 100 # 200 Control 200 Control ** HYA 180 50 * HYA ** ** ** LA LA Blood glucose (mg/dL) Blood glucose (mg/dL) 0 0 160

0 15 30 60 120 01530 60 120 Blood glucose (mg/dL) 0 Control HYA LA Time (min) after insulin i.p. Time (min) after glucose i.p.

h i j 60 3 240 *

200 40 2 * 160 20 1

120 (ng/mL) PYY

0 (mg/dL) Triglycerides 0 0 Total cholesterol (mg/dL) Control HYA LA Control HYA LA Control HYA LA

k P < 0.0087 l m P = 0.0639 8 12 ** 90 ** 6 8 60 4 4 * 2 30 GLP-1 (pM) Insulin (ng/mL)

0 0 0

Control HYA LA Control HYA LA (mg/g) Fecal triglycerides Control HYA LA

Fig. 3 Gut microbial PUFA metabolites improve host metabolic conditions. Changes in a body weight and b representative macroscopic appearance and tissue weights (n = 14 per group). Scale bar; 1 cm. epi, epididymal; peri, perirenal; sub, subcutaneous. c Hematoxylin–eosin (H&E)–stained WAT and the mean area of adipocytes (n = 8 per group). Scale bar, 400 μm. d Daily food intake measured at 7 weeks of age (n = 5 per group). e ITT (n = 10 per group) and f GTT (n = 10 per group) were analyzed at 13–14 weeks of age. g Blood glucose (n = 14 per group), h total plasma cholesterol (n = 10, 9, and 10 per group), i triglyceride (n = 10 per group), j PYY (n = 10, 9, and 8 per group), k GLP-1 (n = 8, 9, and 9 per group), and l insulin (n = 7, 8, and 8 per group) levels were measured at the end of the experimental period. m Fecal triglyceride levels were measured at 16 weeks of age (n = 10 per group). **P < 0.01; *P < 0.05 vs. control (Tukey–Kramer test). ##P < 0.01; #P < 0.05 vs. HYA (Tukey–Kramer test). Results are presented as means ± SE. Source data are provided as a Source Data file 3 expression as compared with HFD-feeding for 2 weeks (Supple- (Supplementary Fig. 3c). Interestingly, we found that HYA sup- mentary Fig. 3b). Examination of the 16S gene-base cecal plementation increased Lactobacillaceae abundance to a greater microbiome showed that long-term HFD-feeding, similar to LA- extent than LA supplementation (Supplementary Fig. 3c), with supplemented HFD feeding for 2 weeks, increased the abundance hierarchical clustering of individual families confirming the effect of the Lactobacillaceae family relative to that in controls of HFD, LA-supplemented HFD, and HYA-supplemented HFD

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 5 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0

ab PUFAs metabolites Arachidonic acid cascade Ileum Plasma 3 1.2

2 M) 0.8 μ Control HYA LA Control HYA LA 1 0.4 LA Arachidonic acid ( HYA

CLA1 PGE2 (pmol/mg)HYA CLA2 PGD2 0 0 CLA3 15-keto-PGE2 Control HYA LA Control HYA LA HYA 15-deoxy-PGJ2 HYB PGF2a HYC 6-keto-PGF1a c KetoA TXB2 Ileum Ileum 16 *, ## 12 *, # KetoB 5-HETE KetoC 5,6-DHT 12 OA 8-HETE 8 t10-18:1 9-HETE 8 (pg/mg) αLA 8,9-DHT 2 4 CALA1 11-HETE 4 AA (nmol/mg) CALA2 12-HETE PGE CALA3 11,12-EET 0 0 αHYA 11,12-DHT Control HYA LA Control HYA LA αHYB 15-HETE αHYC 14,15-EET d Control αKetoA 14,15-DHT αKetoB 16-HETE α 60 KetoC 17-HETE ## 9c,15c 18-HETE 10t, 15c 20-HETE 40 * HYA 15-oxo-ETE /DAPI (%) /DAPI 5,15-diHETE + 20 8,15-diHETE F4/80 z-score 0 Control HYA LA 1 0.50 –0.5 LA

ef 500 *, # F4/80 Tnf Mcp1 4 ## 400 5 *, ## 2 *, ## 4 300 3 1.5 ** ) 3 200 2 1 18S (pg/mg WAT) (pg/mg

(/ 2 2 100 1 1 0.5 PGE 0 0 0 0 Control HYA LA Control HYA LA Control HYA LA Control HYA LA Relative mRNA expression mRNA Relative Fig. 4 Gut microbial PUFA metabolites and adipose inflammatory response. a Heat map of FA profiles in the ileum (n = 4 per group). b HYA was detected in the ileum (left) and plasma (right) (n = 9 per group in the ileum; n = 9, 8, and 9 per group in the plasma). c Arachidonic acid (left) and PGE2 (right) were quantified in the ileum (n = 9 per group for arachidonic acid; n = 8, 9, and 9 per group for PGE2). d WAT sections were labeled by F4/80 (green), caveolin- 1 (red), and DAPI (blue), and F4/80-positive cells were measured (n = 7 per group). Scale bar, 400 μm. e Levels of adipose PGE2 (n = 10 per group). f mRNA expression of F4/80, Tnfα, and Mcp1 in the WAT of HFD-induced obese mice (n = 10 per group). **P < 0.01; *P < 0.05 vs. control (Tukey–Kramer test). ##P < 0.01; #P < 0.05 vs. HYA (Tukey–Kramer test). Results are presented as means ± SE. Source data are provided as a Source Data file 4 feeding on the gut microbiome (Supplementary Fig. 3d). LCFAs, levels in LA-fed mice were significantly increased as compared such as PUFAs, are mainly absorbed in the small intestine; with those in control mice, whereas levels in HYA-fed mice were therefore, we next examined the tissue-transferred FA profile in similar to those in control mice (Fig. 4c). Since prostaglandins the ileum by lipid-metabolome analysis, finding that HYA sup- and thromboxane via the AA cascade are considered to be lipid plementation increased KetoA levels in LA-derived gut microbial mediators of the inflammatory response25, we examined whether metabolites in the ileum (Fig. 4a) and significantly increased HYA LA supplementation augmented the adipose inflammation levels in ileum and plasma (Fig. 4b). Subsequently, we found that response via the AA cascade. As anticipated, we found a sig- LA-supplementation increased the abundance of FA metabolites nificant increase in F4/80-positive macrophages in the WAT of related to the arachidonic acid (AA) cascade as compared with LA-fed mice as compared with that of HYA-fed mice (Fig. 4d). In that observed in control mice, although levels of these FA addition, adipose PGE2 levels in LA-fed mice were significantly metabolites in HYA-fed mice were similar to those in control higher than those in control mice, whereas comparable levels mice or slightly decreased (Fig. 4a). Moreover, based on quanti- were observed between control and HYA-fed mice (Fig. 4e). tative analysis in the ileum, AA and prostaglandin E2 (PGE2) Furthermore, we found that the expression of F4/80, the

6 NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 ARTICLE

a Plasma Ileum Colon 9 1.2 0.01 0.008

M) 6 0.8

μ 0.006 0.004 3 0.4 HYA ( HYA 0.002 HYA (nmol/mg)HYA HYA (nmol/mg) HYA 0 0 0 0 60 120 180 240 060120 180 240 060120180 240 Time (min) after HYA p.o. Time (min) after HYA p.o. Time (min) after HYA p.o.

b c d Control 400 1200 160 ** Control HYA ** LA HYA 140 * 300 * # LA ** P = 0.0597 800 120 **, # **, ## P = 0.0524 Control 200 # 100 **, # HYA 400

GLP-1(%) LA 80 100 Insulin (pg/mL) 0 Blood glucose (mg/dL) 0 0 0 30 60 120 180 240 –120 0 30 60 120 0 3060 120 Time (min) after FAs p.o. Time (min) after glucose p.o. Time (min) after glucose p.o.

e 5 f ** **

4 ** ** 120 ** ** ** **

** 3 ** ** ** ** * 80 M)

** ** μ 2 * GLP-1(nM) 0.15 FAs ( 1 0.1 0.05 0 0 A L toA toB None LA HYA HYB HYC KetoA KetoB KetoC CLA1 CLA2 CLA3 HYA HYB HYC e Ke K KetoC

Fig. 5 HYA directly regulates glucose homeostasis and GLP-1 release. Individual FAs (HYA and LA; 1 g/kg) were administered by gavage, followed by a HYA quantification in plasma (left), ileum (center), and colon (right) (n = 8 animals). b Time-course changes in plasma GLP-1 from the tail vein was measured after oral administration of FAs (n = 7 animals per group). Basal GLP-1 concentration at time 0 was set as 100%. c OGTT was analyzed 2 h after individual FA administration (HYA and LA; 1 g/kg) by gavage (n = 8 animals per group). d Individual FAs were administered, and 2 h later, time-course changes in plasma insulin from the tail vein were measured after oral administration of glucose (n = 8 animals per group). **P < 0.01; *P < 0.05 vs. control (Tukey–Kramer test). ##P < 0.01; #P < 0.05 vs. HYA (Tukey–Kramer test). Results are presented as means ± SE. e STC-1 cells were treated with LA-derived gut microbial metabolites [in a dose-dependent manner (20, 100, and 200 μM)], and GLP-1 concentration was measured in culture medium (n = 6 independent cultures from three biological replicates). **P < 0.01; *P < 0.05 vs. None (Tukey–Kramer test). f LA-derived gut microbial metabolites were detected in plasma of NC-fed mice (n = 8 animals). Results are presented as means ± SE. Source data are provided as a Source Data file 5 inflammatory marker tumor necrosis factor α (TNF-α), and following both HYA and LA administration also peaked 1 h after monocyte chemoattractant protein-1 (MCP-1; also known as administration, with the peak plasma GLP-1 levels following CCL2) was markedly increased in LA-fed mice as compared with HYA administration higher than those in controls and LA- control and HYA-fed mice (Fig. 4f). Therefore, in contrast to administered mice from 0.5 h to 3 h (Fig. 5b). Therefore, we HYA supplementation, LA supplementation promoted the pro- performed oral GTT (OGTT) and intraperitoneal GTT (IPGTT) gression of adipose inflammation via the AA cascade. based on increases in GLP-1 levels following HYA administration at 1 h. Following oral administration of LA or HYA and after oral or intraperitoneal administration of glucose 2-h later, we found HYA directly regulates glucose homeostasis and GLP-1 release. that HYA administration significantly suppressed increases in We then investigated the effects of the gut microbial PUFA- blood glucose as compared with that found in control and LA- metabolite HYA on GLP-1 secretion and glucose homeostasis. administered mice (Fig. 5c and Supplementary Fig. 4b). More- The incretin GLP-1, gut hormone that stimulates glucose-induced over, plasma insulin levels following glucose administration insulin secretion and inhibits food intake, is secreted from peaked at 30 min, and glucose-induced insulin secretion levels in enteroendocrine L cells, which are primarily found in the ileum HYA-administered mice were higher than those in control and and colon26. Following oral administration of HYA (1 g/kg), LA-administered mice (Fig. 5d). Next, we examined whether HYA concentrations peaked 1 h after administration in plasma HYA induces GLP-1 secretion using the mouse intestinal secretin and the ileum, and 3 h after administration in the colon (Fig. 5a). tumor-cell line STC-1. We found that the LA-derived gut In addition, HYA administration increased gut microbial HYA microbial PUFA metabolites KetoA, KetoC, and HYA, in parti- metabolites, such as HYC, KetoA, and KetoC, as well as HYA cular, strongly induced GLP-1 secretion in a dose-dependent concentration in the ileum (Supplementary Fig. 4a). Similar to the manner in STC-1 cells, whereas HYB and KetoB hardly induced peak time in the ileum, we found that plasma GLP-1 levels these effects (Fig. 5e). In addition, LA-derived gut microbial

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 7 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0

PUFA metabolites including HYA, exhibited similar effects in HYA (+) Lactobacillus contributes to host metabolic benefits. GLUTag cells, an intestinal murine L-cell line (Supplementary We then performed microbial transplantation experiments using Fig. 4c). Under physiological conditions, although HYA levels HYA-producing gut microbes in order to clarify whether HYA were the highest among HYA, HYC, KetoA, and KetoC production by gut microbiota contributes to host metabolic levels in plasma, we found that the levels of all of them were improvement. Based on HYA yield (Supplementary Table 1), we markedly lower than those of LA in plasma (Fig. 5f). Our findings selected L. salivarius (JCM1044, JCM1042, and JCM1231) as the indicated that acute administration of HYA promoted GLP-1 HYA (+) strain and L. johnsonii (JCM1022 and JCM8791) and L. secretion in the intestinal environment and improved glucose acidophilus (JCM1229) as HYA (−) strains and confirmed their homeostasis. intestinal-bacterial colonization (Supplementary Fig. 9a, b). Five weeks after colonization, we found that the fecal HYA levels in HYA (+)-colonized mice were significantly higher than that in HYA contributes to host metabolic condition via GPCRs.We GF mice, with no discernable change in this level observed further investigated HYA-mediated GLP-1 secretion signaling. A between groups (Supplementary Fig. 9c). After feeding an HFD to previous study reported that PUFAs promote GLP-1 secretion via Lactobacillus-colonized 4-week-old mice for 12 weeks, we found GPR40 and GPR120 as FFARs27. Using a heterologous expression that body weight during growth and fat mass at 16 weeks of age in system, we found that HYA, KetoA, and KetoC rather than HYC, HYA (+)-colonized mice significantly decreased as compared HYB, or KetoB strongly increased [Ca2+]i levels as compared to with those in HYA (−)-colonized mice (Fig. 7a, b). Similar to our LA in both GPR40- and GPR120-overexpressing HEK293 cells, observations in HYA-supplemented HFD-fed mice, plasma glu- whereas these effects were not observed in doxycycline (−) cose levels in HYA (+)-colonized mice were also significantly control HEK293 cells (Fig. 6a, b). Treatment of STC-1 cells with lower than those in HYA (−)-colonized mice (Fig. 7c), whereas small-interfering (si)RNAs for GPR40 and GPR120 (Supple- total cholesterol and triglyceride levels were similar between these mentary Fig. 5) significantly inhibited HYA- or LA-induced GLP- groups (Fig. 7d, e). Moreover, GLP-1 levels were significantly 1 secretion, whereas HYB exhibited no effects (Fig. 6c). We then higher in HYA (+)-colonized mice relative to those in HYA examined the intracellular signaling mechanism whereby HYA (−)-colonized mice (Fig. 7f), whereas plasma insulin levels in mediates GLP-1 secretion through GPR40 and GPR120. Because HYA ( + )-colonized mice were significantly lower than those in GPR40 and GPR120 couple with Gq, these receptors elevate the HYA (−)-colonized mice (Fig. 7g). In addition, we found sig- level of [Ca2+]i and activate phospholipase C (PLC)28. We found nificantly decreased adipose Tnfα expression and increased fecal that HYA- or LA-mediated GLP-1 secretion was effectively triglycerides in HYA (+)-colonized mice relative to these levels in blocked by treatment with the mitogen-activated protein kinase HYA (−)-colonized mice (Fig. 7h, i), and that glucose clearance (MAPK) kinase inhibitor U0126 (Fig. 6d) and the PLC inhibitor as assessed by OGTT was improved in HYA (+)-colonized mice U73122 (Fig. 6e) but not with the CaM kinase II inhibitor KN-62 as compared with HYA (−)-colonized mice (Fig. 7j). Further- (Fig. 6f). Therefore, HYA-mediated GLP-1 secretion was medi- more, cecal HYA levels in HYA (+)-colonized mice were sig- ated through a GPR40– and GPR120–PLC–MAPK cascade rather nificantly higher than those in GF and HYA (−)-colonized mice than via Ca signaling. Next, we generated GPR40- and GPR120- and similar to those in conventionally raised mice (Fig. 7k). deficient mice using the CRISPR/Cas9 system in order to examine Therefore, we found that HYA-producing gut microbial Lacto- the effects of HYA via GPR40 and GPR120 in vivo (Supple- bacilli improved metabolic conditions. In addition, although in mentary Fig. 6a–c and Supplementary Fig. 7a–c). As expected, we fecal microbiota-transplantation (FMT) experiments, OGTT was found that the HYA-induced increase in GLP-1 secretion in wild- significantly improved in FMT mice from long-term HYA-sup- type mice was abolished in both GPR40- and GPR120-deficient plemented HFD-fed mice as compared with FMT mice from mice (Fig. 6g). Moreover, suppression of the increase in blood control HFD-fed mice (Supplementary Fig. 9d), HYA- glucose level following glucose administration by HYA pre-oral supplemented HFD feeding also significantly suppressed weight administration in wild-type mice was also abolished in both gain as compared with control HFD feeding during growth under GPR40- and GPR120-deficient mice (Fig. 6h). Therefore, HYA metabolic cage bleeding in order to exclude the influence of administration promoted GLP-1 secretion and improved glucose coprophagy (Supplementary Fig. 9e). These results indicated that homeostasis via activation of GPR40 and GPR120. In addition, in addition to HYA direct effects, HYA-mediated changes in gut we examined the mechanism of HYA-mediated suppression of microbial composition also influenced to the host metabolic lipid absorption in the gut. The PGE2 regulates intestinal peri- condition. Collectively, our results indicated that gut microbiota stalsis via the EP3 receptor29, and administration of an EP3 conferred host resistance to obesity by metabolizing dietary agonist promotes intestinal peristalsis (Supplementary Fig. 8a). PUFAs into HYA, which functioned to improve host metabolic Interestingly, we found that HYA was a low-affinity ligand for homeostasis. EP3, and that the observed effect of its administration was higher as compared with that observed with LA (Supplementary Fig. 8b). Moreover, we found that HYA promoted Gq-coupled EP3- Discussion mediated elevation in [Ca2+]i in EP3-overexpressing Chem- Excessive intake of dietary PUFAs, especially omega-6 FAs, such 1 cells. Furthermore, oral administration of HYA and LA as LAs, and unbalances the omega-6/omega-3 ratio contribute to significantly promoted intestinal peristalsis as compared with that metabolic disease along with chronic inflammation. Recently, observed in controls, with the effect of HYA greater than that of several metabolic pathways of dietary PUFAs by gut microbiota LA (Supplementary Fig. 8c). In the presence of piroxicam, the have been identified; however, an integrated understanding of the addition of an EP3 agonist induced frequent contractions that effects of these PUFA metabolites on host physiological function mimicked spontaneous giant contractions (GCs), and we found remains unavailable. In this study, we found that gut microbiota that the frequency and amplitude of HYA-induced GC-like conferred host resistance to HFD-induced obesity through the contractions increased in a dose-dependent manner, with these production of PUFA metabolites (Fig. 8). effects blocked by treatment with an EP3 antagonist (Supple- Using lipid-metabolome analysis, we found minimal gut- mentary Fig. 8d). Our findings indicated that HYA promoted microbial PUFA metabolites from omega-3 FAs under physio- intestinal peristalsis by acting as a low-affinity EP3 agonist to logical conditions in the cecum of NC-fed mice; however, we suppress lipid absorption in the gut. found robust levels of omega-6 FA-derived gut-microbial PUFA

8 NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 ARTICLE

a LA (EC50; 15.19 μM) CLA1 (EC50, 24.3 μM) KetoA (EC50, 1.111 μM) HYA (EC50; 7.508 μM) CLA2 (ND) KetoB (EC50; 86.57 μM) HYB (ND) CLA3 (EC50, 9.719 μM) 400 KetoC (EC50, 3.078 μM) HYC (ND) 400 400 trans-10–18 : 1 (ND)

300 300 300

200 200 200 intensity

2+

Ca 100 100 100

0 0 0 0.1 1 10 100 0.1 1 10 100 0.1 1 10 100 Ligand conc. (μM) Ligand conc. (μM) Ligand conc. (μM)

b LA (EC50; 18.86 μM) CLA1 (EC50, 16.97 µM) KetoA (EC50, 2.027 μM) HYA (EC50; 8.101 μM) CLA2 (ND) KetoB (EC50; 44.15 μM) HYB (ND) CLA3 (EC50, 11.25 µM) 250 300 KetoC (EC50, 2.593 μM) 250 HYC (ND) trans-10–18 : 1 (ND) 200 200 200 150 150 intensity 100 100 2+ 100

Ca 50 50

0 0 0 0.1 1 10 100 0.1 1 10 100 0.1 1 10 100 Ligand conc. (μM) Ligand conc. (μM) Ligand conc. (μM)

c de5 5 600 ** ** ** ** 4 4 ** ** 400 3 3 ## ## $$ ## $$ ## $$ 2 2 $$ GLP-1 (nM) 200 GLP-1 (nM)

Active GLP-1/ Active 1 1

total expression (%) GLP-1 0 0 0 NoneLAHYAHYB(–) LA HYAHYB(–) LAHYA HYB None LA HYA HYB(–) LA HYA HYB None LA HYA HYB(–) LA HYA HYB Gpr40 Gpr120 U0126 U73122 siRNA siRNA

f g P < 0.001 NS P < 0.001 P < 0.001 5 15 ** ** ** 4 10 ** 3

2 5 GLP-1 (pM) GLP-1 GLP-1 (nM) 1

0 0 None LA HYAHYB (–) LA HYAHYB (–) LAHYA (–)LA HYA (–)LA HYA KN-62 Wild-type Gpr40–/– Gpr120–/–

h Wild-type Gpr40–/– Gpr120–/– 400 500 500 Control LA 400 400 300 HYA ** **, # 300 300

200 ** 200 200

100 100 100 Blood glucose (mg/dL) 0 0 0 –120 0 30 60 120 -120 0 30 60 120 –120 0 30 60 120 Time (min) after glucose p.o. Time (min) after glucose p.o. Time (min) after glucose p.o. metabolites. Moreover, among all omega-6 FA-derived metabo- increases in KetoB and HYB levels. In addition, we observed that lites, HYA, HYB, HYC, KetoA, KetoB, and KetoC levels derived HYB, HYC, and KetoB minimally activated GPR40 and GPR120. from LA were markedly decreased under HFD-fed condition for Based on these findings, we determined that HYA was not only 2 weeks and barely produced under GF conditions. Specifically, the initial PUFA-metabolite derived from LA but also the most long-term HFD feeding for 12 weeks induced substantial important gut microbial PUFA-metabolite that influenced host

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 9 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0

Fig. 6 HYA contributes to host metabolic condition via GPR40 and GPR120. Mobilization of [Ca2+]i induced by LA-derived gut microbial metabolites was monitored in Flp in a hGPR40 or b hGPR120 T-REx HEK293 cells. Data are presented as Ca2+ intensity. Cells were cultured for 24 h and then treated with or without 10 μg/mL doxycycline (n = 8 independent cultures with doxycycline from three biological replicates; n = 6 independent cultures without doxycycline from two biological replicates). Closed symbols represent values from cells treated with doxycycline, and open symbols denote untreated groups. c–f The inhibitory effects of c Gpr40 and Gpr120 siRNA, d MEK inhibitor (U0126), e PLC inhibitor (U73122), and f CaMKII inhibitor (KN-62) on GLP-1 secretion following LA, HYA, or HYB treatment (n = 4 independent cultures from two biological replicates). **P < 0.01 vs. None (Tukey–Kramer test). ##P < 0.01; #P < 0.05 vs. LA (Tukey–Kramer test). $$P < 0.01 vs. HYA (Tukey–Kramer test). (−) represents untreated cells with siRNA or antagonist. Results are presented as means ± SE. g GLP-1 concentration and h OGTT in wild-type (left, n = 10 animals per group), Gpr40-deficient (middle, n = 8 animals per group), and Gpr120-deficient (right, n = 9, 10, and 9 animals per group) mice were analyzed 2 h after FA administration. **P < 0.01 vs. Control (Tukey–Kramer test). #P < 0.05 vs. LA (Tukey–Kramer test). (−) represents the mice without FA administrations. Results are presented as means ± SE. Source data are provided as a Source Data file 6

a bcb 75 3 GF 400 GF GFGF HYA ((+)+) HYA ((–)–) # )

65 HYA (+) g HYA (+) ( # t 300 HYA (-) # HYA (–) 55 h 2 * ** g # i #

# e # ** 200 45 # w ## T

T ** A 1 # A W

35 i 100 Body weight (g) weight Body p WATW weight (g) epiWAT e 25 ** 0 0 0 Epi Peri Sub Blood glucose (mg/dL) GF HYA HYA 481122 1 166 (+) (–) Weeks of aagege

d efghe f Tnf 1616 25 L) # 4

112020 ) 400 **, ## d /

g 20 ) ** 1212 18S 3 300 m 80 15 * **, ## 200 8 2 10 40 4 1 100 (pM) GLP-1 5 Insulin (ng/mL) Relative mRNA Relative 0 0 0 0 expression (/ 0 GF HYA HYA (mg/dL)Triglycerides GF HYA HYA GF HYA HYA HYA HYA GF HYA HYA Total cholesterol (mg/dL) GF (+) (–) (+) (–) (+) (–) (+) (–) (+) (–)

ij k 400 # 150 12 300 ## HYA (+) 100 HYA (–) 8 * 200

**, # 50 100 in cecum 4 HYA (pmol/mg) HYA 0 Blood glucose (mg/dL) 0 0 Fecal triglycerides (mg/g)Fecal triglycerides GF HYA HYA 0 30 60 120 GFHYA HYA Conv. (+) (–) Time (min) after glucose p.o. (+) (–)

Fig. 7 HYA-producing Lactobacillus contributes to host metabolic improvement. Changes in a body weight (n = 10, 10, and 8 per group) and b tissue weight (n = 10 per group) at 16 weeks of age were measured in GF and gnotobiotic mice suffering from HFD-induced obesity. Scale bar; 1 cm. epi, epididymal; peri, perirenal; sub, subcutaneous. c Blood glucose (n = 8, 9, and 9 per group), d total plasma cholesterol (n = 8, 7, and 7 per group), e triglyceride (n = 9, 9, and 10 per group), f GLP-1 (n = 8 per group), and g insulin (n = 7 per group) levels were measured at the end of the experimental period. h mRNA expression of Tnfα in the WAT of HFD-induced obesity (n = 8 per group). i Fecal triglyceride levels were measured at 16 weeks of age (n = 10 per group). j After colonization of lactic acid bacteria for 1 week, OGTT was assessed (n = 7 per group). **P < 0.01; *P < 0.05 vs. GF mice (Tukey–Kramer test). ##P < 0.01; #P < 0.05 vs. HYA ( + ) (Tukey–Kramer test). k Cecal HYA was quantified in GF and gnotobiotic mice at 16 weeks of age (n = 9, 10, 10, and 7 per group). Results are presented as means ± SE. Source data are provided as a Source Data file 7 metabolism. Moreover, under physiological conditions, plasma local increase of HYA levels around HYA-producing bacteria can HYA levels were ~1/400 (~0.15 μM) of plasma LA levels, whereas activated those receptors in the gut. Therefore, gut microbial levels of other gut microbial PUFA metabolites were markedly PUFA metabolites may exhibit their beneficial metabolic effects lower. Even high-dose (1 g/kg) oral administration of HYA ele- via the intestinal environment rather than by exerting systemic vated plasma HYA level up to ~6 μM, suggesting that the con- effects via circulating plasma such as short-chain FAs, the major tribution of circulating HYA to the activation of GPR40 or gut microbial metabolites. GPR120 was low. In addition, although cecal HYA levels were In addition, we found that mice receiving LA supplementation also ~1/80 (~20 μM) of cecal LA levels, it might be possible that exhibited adipose inflammation due to the production of an

10 NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 ARTICLE

Dietary PUFAs ω3 fatty acid α-Linolenic acid DHA,EPA ω6 fatty acid Linoleic acid Linseed oil Perilla oil

Salad oil

Host homeostasis

HOOC Gut hormone Inflammation ↑ Linoleic acid (high fat diet-induced obesity)

Arachidonate cascade GPR40 GPR120 and PGE2 synthesis

Peristalsis

OH HOOC

O HYA O

HOOC HOOC O OH

HOOC HOOC Gut microbial PUFA metabolites

Gut microbiota confers host resistance to obesity by metabolizing dietary polyunsaturated fatty acids

Fig. 8 Schematic representation. The mechanism by which gut microbial metabolism of dietary PUFAs confers host resistance to obesity inflammatory lipid mediator via the AA cascade, whereas HYA- associated with host glucose homeostasis. Additionally, in vivo supplemented mice did not exhibit these effects. Therefore, our acute HYA administration exhibited stronger effects on GLP-1 result indicated that gut microbiota suppressed inflammatory secretion than in vitro HYA stimulation to STC-1 cells. These responses by converting excessive dietary LA to HYA. LA and results might suggest that further HYA-specific metabolites ori- HYA supplementation specifically increased the abundance of the ginating from gut microbiota promote strong GLP-1 secretion. Lactobacillaceae in gut microbiota. The genus Lactobacillus is Recently, in addition to HYA, we identified other gut microbial facultatively anaerobic and preferentially resides in the small PUFA metabolites with high affinities for GPR40 and GPR12023. intestine, particularly the ileum, but not the colon, as do most However, since the concentrations of these other gut microbial other gut microbes. This accounts for the fact that lipids are PUFA metabolites are lower than HYA, its status as a potential absorbed in the small intestine, and increased levels of HYA are activator of GPR40 and GPR120 might be the most important found in the ileum and cecum but not the colon. However, LA factor in the associated activity of gut microbial PUFA metabo- and HYA supplementation also changed the abundance of some lites under physiological conditions. families such as Lachnospiraceae. Therefore, gut microbial PUFA Acute HYA administration showed promotion of GLP-1 metabolites including HYA, might also exert important host secretion and improvement of glucose homeostasis. However, physiological functions via the colon. HYA supplementation and our results indicated similar glycemic effects in both OGTT and administration not only changed gut microbial composition but IPGTT, indicating that other physiological functions besides also promoted the production of HYA-related gut microbial GLP-1 release, such as pancreatic GPR40-mediated insulin PUFA metabolites. Moreover, FMT from HYA-supplemented secretion, may also be associated with HYA-mediated insulin HFD-fed mice improved glucose homeostasis as compared with responses. Moreover, the mechanism underlying the effect of FMT from HFD-fed control mice. These results indicated that long-term HYA administration involved metabolic improvement HYA influenced the host metabolic condition not only by HYA via some other factors. Probably, besides GLP-1-associated itself but also via secondary HYA-mediated changes in the appetite suppression and improvement of glucose homeostasis, intestinal environment. GLP-1-independent anti-inflammatory effects and intestinal Moreover, we found that HYA displayed a high affinity for peristalsis also influence metabolic improvements and improve- GPR40 and GPR120 as compared with that of LA, indicating that ment of glucose homeostasis as secondary effects. Further, other the gut microbiota locally induced GLP-1 secretion via GPR40 physiological functions via intestinal GPR40 and GPR120, and and GPR120 activation in the intestine and that it may be pancreatic GPR40 may also partially influence host metabolic

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 11 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 effects. Nevertheless, from the viewpoint of gut microbial meta- for target compounds using standards. Subsequently, gas chromatography-mass bolites, the influence of GLP-1 is one of the primary factors spectrometry (GC-MS) were employed to quantify specific metabolites; LA, 9c15c- contributing to host metabolic functions26. Additionally, inter- 18:2, 10t12c-18:2, CLA1, and CLA3 because of co-elution on the LC-MS/MS fi fi analysis. Extracted fatty acids were dissolved in (Trimethylsilyl) diazomethane (abt. estingly, we identi ed HYA as a low-af nity ligand that activated 10%)-hexane solution (Wako), and incubated at room temperature for 1 h to EP3 in the gut, thereby promoting intestinal peristalsis. In actu- undergo methylation. The samples were dried, and the residues were resuspended ality, low-affinity ligands cannot activate receptors in peripheral with chloroform:methanol (1:3, v/v) for GC-MS analysis. FA methyl esters were tissues and the intestine under normal conditions because of their analyzed using GC-MS QO2010 Ultra (Shimadzu) and separated on a VF-WAXms column (0.25 mm × 30 m, 1 μm; Agilent technologies). The initial oven low concentrations. However, under postprandial conditions, temperature was held at 100 °C; ramped to 240 °C at a rate of 70 °C/min; and held low-affinity ligands might activate local receptors in the gut based at 240 °C for 37 min. Helium was used as a carrier gas at a flow rate of 1 mL/min. on temporary increases in concentrations of these nutrient- The temperatures of the EI ion source and injector were 200 and 260 °C, derived metabolites within the gut. Most GPCRs activated by respectively. The electron energy was 70 eV. Full-scan mass spectra were recorded fi in the 35–400 m/z range. Quantification was done by integration of the extracted lipid ligands display low-af nity binding with their many ion chromatogram peaks for the specific ion species of individual FAs using a 30 ligands . Therefore, further study is warranted to clarify this calibration curve with standard FA. transient nutrient-stimulated mechanism associated with fi – nutrient-derived metabolites via low-af nity ligand GPCR Animals. C57BL/6 J, Gpr40-deficient, and Gpr120-deficient mice were housed interactions in the intestine. under a 12-h light–dark cycle and given NC (CE-2; CLEA, Tokyo, Japan). All Here, we demonstrated that gut microbiota exerted protective animal experiments were performed using mice from more than 4 litters per group. effects against HFD-induced obesity and improved glucose All experimental procedures involving mice were performed according to protocols approved by the Committee on the Ethics of Animal Experiments of the Tokyo homeostasis associated with several mechanisms involving gut University of Agriculture and Technology (permit No. 28–87). Gpr40- and Gpr120- microbial metabolites of dietary PUFAs: (1) gut microbiota deficient mice were generated on a C57BL/6 J background (Supplementary Figs. 6 converted LA to HYA, reducing the adipose inflammation and 7). otherwise induced by excessive dietary LA via the AA cascade; (2) For short-term treatment, 8-week-old C57BL/6 J mice were placed on an NC, a D12492 diet (60% kcal fat; Research Diets, New Brunswick, NJ, USA), or a HYA activated GPR40 and GPR120 and promoted GLP-1 modified D12492 diet for 2 weeks. For long-term treatment, 4-week-old C57BL/6 J secretion; and (3) HYA suppressed lipid absorption by promot- were placed on a D12492 diet or a modified D12492 diet for 12 weeks. To avoid ing intestinal peristalsis via EP3. These findings not only poten- coprophagy, mice were housed in wire mesh metal mouse cages, and placed on a tially represent a central mechanism underlying interplay between D12492 diet or a modified D12492 diet for 12 weeks. The compositions of the diets commensal bacteria and the host for energy homeostasis via are provided in Supplementary Table 2. Time-dependent profiling of PUFA metabolites in plasma, small intestine, and dietary lipids but also contribute to the development of functional colon was performed following the oral administration of individual FAs (1 g/kg) foods for the prevention of metabolic disorders, such as obesity dissolved in 0.5% carboxymethyl cellulose ammonium (CMC; Nacalai Tesque, and type 2 diabetes mellitus, through tailoring the use of HYA. In Kyoto, Japan). Time-course effects of FA administration on GLP-1 and insulin addition, the identification of metabolites exhibiting high levels of secretion were analyzed. GF ICR mice were housed in vinyl isolators under a 12-h light–dark cycle. For bioactivity in other low-concentration gut microbial PUFA short-term treatment, 8-week-old GF mice were placed on an NC (50 kGy metabolites might promote developments of potential therapeutic irradiated; CLEA) or D12492 diet (50 kGy irradiated; Research Diets) for 2 weeks. relevance for the treatment of several diseases. For generation of gnotobiotic mice, ICR mice were administered with the cocktail of lactic acid bacteria (as shown in Supplementary Fig. 9a) in drinking water at 3, 8, and 12 weeks of age (3 × 108 CFU/mL, respectively). Then, 4-week-old gnotobiotic, Methods and GF ICR mice were placed on a D12492 diet (50 kGy irradiated, Research Diets) α for 12 weeks. All experimental procedures involving GF mice were performed FA analysis. The structures of the gut microbial metabolites of LA and LA used according to protocols approved by the Institutional Animal Care and Use in this study (Supplementary Fig. 1) were synthesized according to previously Committee of Keio University School of Medicine [permission No. 09036-(12)]. ≥ 17 published methods (purity 98%) . In brief, the reaction mixtures were prepared Mice were killed by anesthesia with somnopentyl, and all efforts were made to in each vial that contained 0.1% (wt/vol) FA complexed with BSA [0.02% (wt/vol)] fi minimize suffering. in 20 mM KPB (pH 6.5) and puri ed enzymes (CLA-HY, CLA-DH, CLA-DC, and For FMT experiments, fecal content was collected from HFD-fed or HYA- CLA-ER) in various combinations. The mixtures were added with 5 mM NADH, + supplemented HFD-fed obese mice for 12 weeks. The fecal content was transferred 5 mM NAD , 0.1 mM FMN, or 0.1 mM FAD, and were gently shaken into GF ICR mice aged 8 weeks (3 mice/pellet) three times weekly by gavage. After (120 strokes per minute) at 37 °C for 12 h under microaerobic conditions. Liquid 1 week, OGTT was assessed. chromatography tandem mass spectrometry (LC-MS/MS)-based lipidomics was performed, as described previously17,31. Briefly, samples were subjected to solid- phase extraction using a Sep-Pak C18 cartridge (Waters, Tokyo, Japan) with a Gut microbiota composition. Cecal DNA was extracted from frozen samples deuterium-labeled internal standard (arachidonic acid-d8, leukotriene B4-d4, 15- using the FastDNA SPIN kit for feces (MP Biomedicals, Santa Ana, CA, USA) hydroxyeicosatetraenoic acid-d8, prostaglandin E2-d4). Lipidomic analyses were according to manufacturer instructions. Bacteria (L. salivarius JCM1044, L. john- performed using a high-performance LC system (Waters, UPLC) with a linear ion- sonii JCM2012, L. acidophilus JCM1028, and L. gasseri JCM1131) was obtained trap quadrupole mass spectrometer (QTRAP 5500; AB SCIEX, Framingham, MA, from the Japan Collection of Microorganisms of RIKEN BRC (Tokyo, Japan) and USA) equipped with an Acquity UPLC BEH C18 column (1.0 mm × 150 mm × used as a standard specifically for the DNA-based determination of intestinal lactic 1.7 μm; Waters). MS/MS analyses were conducted in negative-ion mode, and FA acid bacterial count. Bacterial DNA was isolated using the MonoFas bacterial metabolites were identified and quantified by multiple-reaction monitoring. genomic kit IV (GLC science, Tokyo, Japan) according to manufacturer instruc- Quantitation was performed using calibration curves constructed for each com- tions. Quantitative real-time PCR analysis was performed using SYBR Premix Ex pound, and recoveries were monitored using added deuterated internal standards. Taq II (TaKaRa, Shiga, Japan) and the StepOnePlus real-time PCR system (Applied To quantify individual FAs, samples (~50 mg cecal content or 100 μL plasma) Biosystems, Foster City, CA, USA). Standard curves for quantification comprised a with an internal control (C19:0) were homogenized in methanol (1 ml), and added series of 10-fold serial dilutions in the range of 108 to 100 copies of target 16 S chloroform (2 ml) and 0.5 M potassium chloride (0.75 mL) to extracts lipids. The rRNA genes. Bacterial primer sequences were as follows: Lactobacillus genus, 5′- collected lipid layers were dried, and the samples were resuspended with AGCAGTAGGGAATCTTCCA-3′ (forward) and 5′- CACCGCTACACATGGAG- chloroform:methanol (1:3, v/v) for LC-MS/MS analysis. FAs were analyzed using 3′ (reverse)32; L. salivarius,5′-CGAAACTTTCTTACACCGAATGC-3′ (forward) an Acquity UPLC system coupled to a Waters Xevo TQD mass spectrometry and 5′-GTCCATTGTGGAAGATTCCC-3′ (reverse); L. johnsonii,5′- CACTA- (Waters) and separated on an ACQUITY UPLC BEH C18 column (2.1 × 150 mm, GACGCATGTCTAGAG-3′ (forward) and 5′-AGTCTCTCAACTCGGCTATG-3′ 1.7 μm; Waters) using an acetonitrile–isopropanol (9:1; v/v) gradient in 0.1% acetic (reverse); L. acidophilus,5′-GTCTGATGGAGCAACGCCGC-3′ (forward) and 5′- acid aqueous solution (55% acetonitrile–isopropanol for 5 min, 55–100% ACCTTGCGGTCGTACTCCCC-3′ (reverse); and L. gasseri,5′-GCCACATTGG acetonitrile–isopropanol from 5–16 min, 100% acetonitrile–isopropanol to 18 min, GACTGAGACA-3′ (forward) and 5′-TTGCTCCATCAGACTTGCGT-3′ and then back to the initial 55% acetonitrile–isopropanol concentration at 18.1 min (reverse). Partial 16 S rRNA gene sequences were amplified targeting the hyper- for 1.9 min for column equilibration). The flow rate was 0.4 mL/min, and column variable regions v4 using primers 515 F (5′-TCGTCGGCAGCGTCAGATGTGTA temperature was maintained at 50 °C. MS detection was performed in negative TAAGAGACAGGTGYCAGCMGCCGCGGTAA-3′) and 806 R (5′-GTCTCGTG ionization mode, and the source capillary voltage was set to 3000 V. The GGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3′). desolvation and source temperatures were set at 500 °C and 150 °C, respectively. Amplicons generated from each sample were subsequently purified using AMPure Individually optimized multiple-reaction-monitoring parameters were determined XP (Beckman Coulter, Brea, CA, USA). The 16 S rRNA sequence data generated by

12 NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 ARTICLE the MiSeq sequencer (Illumina, San Diego, CA, USA) using the MiSeq Reagent kit Cell culture. STC-1 cells (murine enteroendocrine cells; ATCC, Manassas, VA, (version 3.0; 600 cycles) were processed by the quantitative insights into microbial USA) were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 5% ecology (QIIME 1.8.0; http://qiime.org/) pipeline. Data analysis was performed fetal bovine serum (FBS) and 15% horse serum and maintained at 37 °C and 5% using MiSeq Reporter software with the SILVA database (Illumina). Diversity CO2. For measurement of GLP-1 secretion, cells were plated in 24-well plates (1 × analyses were performed using the QIIME script core_diversity_analyses.py. The 105 cells/well) and cultured for 48 h before initiating GLP-1 secretion. Each well statistical significance of sample groupings was assessed using permutational was treated with FA for 0.5 h to 1 h, and the supernatant was collected in the multivariate analysis of variance (QIIME script compare_categories.py). presence of a DPP-IV inhibitor. For siRNA knockdown, STC-1 cells were trans- fected with 30 nM siRNA (Gpr40: CAAUGUGGCUAGUUUCAUA; and Gpr120: CGAAAUGACUUGUCUGUUA; Dharmacon, Lafayette, CO, USA) using Lipo- Histology. Adipose tissues were fixed in 10% neutral-buffered formalin, embedded fectamine 2000 transfection reagent (Invitrogen) according to manufacturer in paraffin, and sectioned (7 μm). Hematoxylin and eosin staining was performed instructions. For inhibitor treatment, STC-1 cells were pretreated with the MEK using standard techniques. To measure adipocyte area, the diameters of ≥100 cells inhibitor U0126 (10 μM; Wako), the PLC inhibitor U73122 (1 μM; Wako), or the from seven sections in each group were measured using ImageJ software (National CaMKII inhibitor KN-62 (10 μM, Wako) for 30 min prior to the addition of FAs. Institutes of Health, Bethesda, MD, USA). The results were expressed as the GLUTag cells used in this study were generated by Dr. Drucker from the average of >10 fields examined. Immunohistochemistry was performed using University of Toronto37, cultured in DMEM containing 10% FBS, and maintained antibodies against F4/80 (rat; 1:1000; Abcam, ab6640, Cambridge, UK), Caveolin-1 at 37 °C and 5% CO2. For measurement of GLP-1 secretion, cells were plated in 24- (mouse; 1:200; BD Biosciences, 610406, Franklin Lakes, NJ, USA), and DAPI well plates (1 × 105 cells/well) and cultured for 48 h before initiating GLP-1 (1:5000; Roche, 10236276001, Basel, Switzerland), as previously described33.In secretion. Each well was treated with FA for 0.5 h to 1 h, and supernatant was brief, sections were fixed with 4% paraformaldehyde, washed in PBS, and treated collected in the presence of a DPP-IV inhibitor. with 5% BSA in PBS. The sections were permeabilized with 0.1% Triton X-100 Flp-In T-REx HEK293 cells were obtained from Invitrogen, and for generation (Sigma) and immunostained with each primary antibody. This was followed by of HEK293 cells expressing human GPR40 or GPR120, the HEK293 cells were signal development using secondary antibodies conjugated with a fluorescent transfected with a mixture of pcDNA5/FRT/TO- FLAG-mGPR40 or mGPR120 marker. and pOG44, respectively, using the Lipofectamine reagent (Invitrogen)38,39, and the cells were cultured in DMEM containing 10 μg/mL blasticidin S (Funakoshi, Tokyo, Japan), 100 μg/mL hygromycin B (Gibco, Grand Island, NY, USA), and Biochemical analyses. Blood glucose concentrations were measured using a One 10% FBS. Next, the cells were incubated at 37 °C in an atmosphere of 5% CO2 and Touch Ultra (LifeScan, Milpitas, CA, USA). The concentrations of plasma and fecal further cultured under various conditions. For [Ca2+]i-response analysis, cells were triglycerides (LabAssay Triglyceride; Wako Pure Chemical Co. Ltd., Osaka, Japan), plated onto 96-well black plates (3 × 104 cells/well) and incubated for 24 h, and total cholesterol (LabAssay Cholesterol; Wako Pure Chemical Co. Ltd.), PYY each well was treated with or without doxycycline (10 μg/mL) for 24 h. After (Mouse/Rat PYY ELISA Kit, Wako), GLP-1 (active) ELISA kit (Merck Millipore, treatment, cells were further incubated in Hank’s balanced salt solution (HBSS; pH Billerica, MA, USA), and an insulin ELISA Kit (Shibayagi, Gunma, Japan) were 7.4) containing calcium assay kit component A (Molecular Devices, Sunnyvale, CA, measured according to manufacturer instructions. For GLP-1 measurement, USA) for 1 h at 37 °C. Each FA used in the Functional Drug Screening System plasma samples and culture media were treated with a dipeptidyl peptidase IV (FlexStation 3 Multi-Mode Microplate Reader; Molecular Devices) assay was (DPP-IV) inhibitor (Merck Millipore) to prevent degradation of active GLP-1. dissolved in HBSS and prepared in another set of 96-well plates, which were placed For GTT, 24-h-fasted obese mice were given 1.5 mg of glucose/gram of body in the Functional Drug Screening System to monitor the mobilization of [Ca2+]i. weight intraperitoneally (i.p.). For ITT, 3-h-fasted obese mice were administered Human EP3-expressing Chem-1 cells were measured for the [Ca2+]i response human insulin (0.75 mU/g by i.p.; Sigma-Aldrich, St. Louis, MO, USA). Plasma induced by each FA using a FLIPR TETRA system (Molecular Devices) with an glucose concentration was monitored before injection and at 15-, 30-, 60-, and 120- ICCD camera (Eurofins Scientific, Brussels, Belgium). min post-injection.

PGE2 measurement. To assay total-adipose and small-intestinal PGE2 con- Intestinal peristalsis. Wild-type mice were orally administered the EP3 agonist centration, frozen tissues were homogenized in TNE buffer containing 10 mM (0.1 mg/kg; Sigma-Aldrich) or each FA (1 g/kg) containing charcoal suspended in Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 50 mM NaF, 0.5% CMC. After 2 h, the mice were killed, and the gastrointestinal tracts were 2mMNa3VO4, 10 g/mL aprotinin, 1% phosphatase-inhibitor cocktail (Nacalai harvested. Intestinal peristalsis was expressed as the distance of the charcoal from Tesque), and 100 μM indomethacin (Wako Pure Chemical Co. Ltd.). The homo- the cecum to the start of the charcoal as measured with a ruler. genates were centrifuged at 3000 g and 4 °C for 20 min and stored at −80 °C until further analysis. Total protein levels in the supernatants were measured using a fi BCA protein assay kit (Thermo Fisher Scienti c, Waltham, MA, USA). PGE2 Murine intestinal motility. Intestinal motility in response to each FA and EP3 concentrations in the supernatants were determined by ELISA kit (Cayman Che- agonist was determined according to a previously described protocol40. In brief, mical, Ann Arbor, MI, USA), standardized to the amount of total protein in segments of the distal ileum were removed, cut along the mesenteric border, and supernatant, and presented as the amount of PGE2/mg of protein in supernatant. pinned flat to the bottom of a dish coated with silicone rubber and filled with cold Krebs–Ringer solution. The tissue was cut parallel to the longitudinal smooth muscle direction. The preparations were placed in organ baths filled with 5 mL RNA isolation and quantitative reverse transcriptase PCR. Total RNA was – Krebs Ringer gassed with 95%O2/5%CO2 at 37 °C and connected to isometric extracted using an RNeasy mini kit (Qiagen, Hilden, Germany) and RNAiso Plus force transducers (MLT0420; ADInstruments, BellaVista, Australia) by surgical reagent (TAKARA). cDNA was transcribed using RNA as templates and Moloney sutures. A four-channel bridge amplifier (FE224; ADInstruments) and a PowerLab murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, Cam USA). 4/26 (ADInstruments) were used to record the tension and amplitudes of spon- quantitative reverse transcriptase (qRT)-PCR analysis was performed using SYBR taneous contractions. During a 1-h equilibration, basal tensions of all preparations Premix Ex Taq II (TAKARA) and the StepOnePlus real-time PCR system (Applied μ μ 34,35 were adjusted by 1 mN to 2 mN, and tetrodotoxin (10 M) and piroxicam (0.1 M) Biosystems, Foster City, CA, USA), as described previously . In brief, the were added in order to remove neural activity and basal prostaglandin production, reaction was performed at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 58 ° respectively, 30 min before experiments. C for 30 s and 72 °C for 1 min. The dissociation stage was analyzed at 95 °C for 15 s, followed by 1 cycle of 60 °C for 1 min and 95 °C for 15 s. Primer sequences were as follows: Cla-hy,5′-TGGGGGCGTTATTTATGGT-3′ (forward) and 5′-GGCAA- CATACCCAGTCGTG-3′ (reverse); Cla-dh,5′-TTTGGGAATTGCCGACTCGT- Bacterial culture. Lactobacillus strains (Supplementary Table 1) were obtained 3′ (forward) and 5′-GAACAAAGCCAGGGCACATC-3′ (reverse); Cla-er,5′- from the Japan Collection of Microorganisms (Saitama, Japan). Each strain was TTTGTCGTCGTGGATACCCC-3′ (forward) and 5′-CGGAA- inoculated into 15 mL of MRS medium in screw-capped tubes at 37 °C and then CAATCAATCGTCGCA-3′ (reverse); 16S,5′-ACTCCTACGGGAGGCAGCAGT- shaken at 120 strokes per minutes for 1 to 2 days. After cultivation, cells were 3′ (forward) and 5′-ATTACCGCGGCTGCTGGC-3′ (reverse); Tnfa,5′- harvested by centrifugation (1,500 × g for 10 min) and washed twice with 0.85% GGCAGGTCTACTTTGGAGTC-3′ (forward) and 5′-TCGAGGCTCCAGT- NaCl. The reactions were performed in test tubes containing 1 mL of reaction GAATTCG-3′ (reverse); F4/80,5′-GATGTGGAGGATGGGAGATG-3′ (forward) mixture [washed cells, 100 mM potassium phosphate buffer (pH 6.5), and 1 mg/mL and 5′-ACAGCAGGAAGGTGGCTATG-3′ (reverse); Mcp1,5′-AATCTGAAGC- LA] under anaerobic conditions using an Aneropack “Kenki” (Mitsubishi Gas TAATGCATCC-3′ (forward) and 5′-GTGTTGAATCTGGATTCACA-3′ (reverse); Chemical Co., Ltd., Tokyo, Japan) in a sealed chamber and then shaken at and 18 S,5′-ACGCTGAGCCAGTCAGTGTA-3′ (forward) and 5′-CTTA- 120 strokes per minutes and 37 °C for 24 h. For detection of LA, HYA, and HYB in GAGGGACAAGTGGCG-3′ (reverse). the reaction mixture, lipids were extracted with 5 mL of chloroform/methanol/1.5% – KCl in H2O (2:2:1, by volume), according to the Bligh Dyer procedure and con- centrated by evaporation under reduced pressure. The resulting lipids were ana- OGTT. Following a 16-h fast, mice were administered LA or HYA (1 g/kg) dis- lyzed by gas chromatography using a Shimadzu (Kyoto, Japan) GC-1700 gas solved in 0.5% CMC by gavage, and after 2 h, mice were administered glucose (5 g/ chromatograph equipped with a flame ionization detector and a split injection kg) for OGTT36. Plasma glucose concentration was monitored before injection and system and fitted with a capillary column (SPB-1, 30 m × 0.25 mm i.d.; Supelco; at 15-, 30-, 60-, and 120-min post-injection. Sigma-Aldrich).

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 13 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0

Statistical analysis. All values are presented as the mean ± standard error of the 20. Takeuchi, M. et al. Characterization of the linoleic acid Δ9 hydratase mean. Differences between groups were examined for statistical significance using catalyzing the first step of polyunsaturated fatty acid saturation metabolism in Student’s t test or the Tukey–Kramer post hoc test (≥3 groups). A P < 0.05 was Lactobacillus plantarum AKU 1009a. J. Biosci. Bioeng. 119, 636–641 (2015). considered statistically significant. False discovery rates (q-value) of metabolomic 21. Miyamoto, J. et al. A gut microbial metabolite of linoleic acid, 10-hydroxy-cis- and 16 S rRNA gene sequencing data were estimated using the 12-octadecenoic acid, ameliorates intestinal epithelial barrier impairment Benjamini–Hochberg procedure. partially via GPR40-MEK-ERK pathway. J. Biol. Chem. 290, 2902–2918 (2015). Reporting summary. Further information on research design is available in the 22. Nanthirudjanar, T. et al. Gut microbial fatty acid metabolites reduce Nature Research Reporting Summary linked to this article. triacylglycerol levels in hepatocytes. Lipids 50, 1093–1102 (2015). 23. Ohue-Kitano, R. et al. α-Linolenic acid-derived metabolites from gut lactic acid bacteria induce differentiation of anti-inflammatory M2 Data availability macrophages through G protein-coupled receptor 40. FASEB J. 32, 304–318 A reporting summary for this article is available as a Supplementary Information file. The (2018). source data underlying Figs. 1–7, Supplementary Figs. 1–9, Supplementary Table 1, and 24. Kaikiri, H. et al. Supplemental feeding of a gut microbial metabolite of linoleic lipid metabolome, are provided as a Source Data file. 16S rRNA sequence data have been acid, 10-hydroxy-cis-12-octadecenoic acid, alleviates spontaneous atopic deposited into the DNA Data Bank of Japan (DDBJ) under the accession no. DRA008263 dermatitis and modulates intestinal microbiota in NC/nga mice. Int J. Food and no. DRA008264. All other data generated or analyzed during this study are included Sci. Nutr. 68, 941–951 (2017). in this published article and its Supplementary Information files or are available from the 25. Buckley, C. D., Gilroy, D. W. & Serhan, C. N. Proresolving lipid mediators and corresponding authors upon reasonable request. mechanisms in the resolution of acute inflammation. Immunity 40, 315–327 (2014). Received: 23 May 2019 Accepted: 15 August 2019 26. Greiner, T. U. & Bäckhed, F. Microbial regulation of GLP-1 and L-cell biology. Mol. Metab. 5, 753–758 (2016). 27. Hara, T. et al. Novel selective ligands for free fatty acid receptors GPR120 and GPR40. Naunyn Schmiede. Arch. Pharmacol. 380, 247–255 (2009). 28. Winzell, M. S. & Ahrén, B. G-protein-coupled receptors and islet function- implications for treatment of type 2 diabetes. Pharmacol. Ther. 116, 437–448 (2007). References 29. Tunaru, S., Althoff, T. F., Nüsing, R. M., Diener, M. & Offermanns, S. Castor 1. Kahn, S. E., Hull, R. L. & Utzschneider, K. M. Mechanisms linking obesity to oil induces laxation and uterus contraction via ricinoleic acid activating insulin resistance and type 2 diabetes. Nature 444, 840–846 (2006). prostaglandin EP3 receptors. Proc. Natl Acad. Sci. USA 109, 9179–9184 2. Turnbaugh, P. J. et al. Diet-induced obesity is linked to marked but reversible (2012). alterations in the mouse distal gut microbiome. Cell Host Microbe 3, 213–223 30. Im, D. S. Intercellular lipid mediators and GPCR drug discovery. Biomol. (2008). Ther. (Seoul.). 21, 411–422 (2013). 3. Ley, R. E. et al. Microbial ecology: human gut microbes associated with 31. Arita, M. Mediator lipidomics in acute inflammation and resolution. J. obesity. Nature 444, 1022–1023 (2006). Biochem. 152, 313–319 (2012). 4. Turnbaugh, P. J., Bäckhed, F., Fulton, L. & Gordon, J. I. A core gut 32. Vigsnaes, L. K. et al. Microbiotas from UC patients display altered metabolism microbiome in obese and lean twins. Nature 457, 480–484 (2009). and reduced ability of LAB to colonize mucus. Sci. Rep. 3, 1110 (2013). 5. Dalby, M. J., Ross, A. W., Walker, A. W. & Morgan, P. J. Dietary uncoupling 33. Kimura, I. et al. The gut microbiota suppresses insulin-mediated fat of gut microbiota and energy harvesting from obesity and glucose tolerance in accumulation via the short-chain fatty acid receptor GPR43. Nat. Commun. 4, mice. Cell Rep. 21, 1521–1533 (2017). 1829 (2013). 6. Turnbaugh, P. J. et al. An obesity-associated gut microbiome with increased 34. Nakajima, A. et al. The short chain fatty acid receptor GPR43 regulates capacity for energy harvest. Nature 444, 1027–1031 (2006). inflammatory signals in adipose tissue M2-type macrophages. PLoS ONE 12, 7. German, J. B. Saturated fats: what dietary intake? Am. J. Clin. Nutr. 80, e0179696 (2017). 550–559 (2004). 35. Kimura, I. et al. Short-chain fatty acids and ketones directly regulate 8. Galgani, J. E., Uauy, R. D., Aguirre, C. A. & Díaz, E. O. Effect of the dietary fat sympathetic nervous system via G protein-coupled receptor 41 (GPR41). Proc. quality on insulin sensitivity. Br. J. Nutr. 100, 471–479 (2008). Natl Acad. Sci. USA 108, 8030–8035 (2011). 9. Simopoulos, A. P. An increase in the omega-6/omega-3 fatty acid ratio 36. Miki, T. et al. Distinct effects of glucose-dependent insulinotropic polypeptide increases the risk for obesity. Nutrients 8, 128 (2016). and glucagon-like peptide-1 on insulin secretion and gut motility. Diabetes 54, 10. Ichimura, A., Hasegawa, S., Kasubuchi, M. & Kimura, I. Free fatty acid 1056–1063 (2005). receptors as therapeutic targets for the treatment of diabetes. Front. 37. Lee, Y. C. et al. Glucagon gene 5’-flanking sequences direct expression Pharmacol. 5, 236 (2014). of simian virus 40 large T antigen to the intestine, producing carcinoma 11. Milligan, G., Alvarez-Curto, E., Watterson, K. R., Ulven, T. & Hudson, B. D. of the large bowel in transgenic mice. J. Biol. Chem. 267, 10705–10708 Characterizing pharmacological ligands to study the long-chain fatty acid (1992). receptors GPR40/FFA1 and GPR120/FFA4. Br. J. Pharmacol. 172, 3254–3265 38. Hara, T. et al. Flow cytometry-based binding assay for GPR40 (FFAR1; free (2015). fatty acid receptor 1). Mol. Pharmacol. 75,85–91 (2009). 12. Itoh, Y. et al. Free fatty acids regulate insulin secretion from pancreatic beta 39. Hirasawa, A. et al. Free fatty acids regulate gut incretin glucagon-like peptide- cells through GPR40. Nature 422, 173–176 (2003). 1 secretion through GPR120. Nat. Med. 11,90–94 (2005). 13. Ichimura, A. et al. Dysfunction of lipid sensor GPR120 leads to obesity in both 40. Iizuka, Y., Kuwahara, A. & Karaki, S. Role of PGE2 in the colonic motility: mouse and human. Nature 483, 350–354 (2012). PGE2 generates and enhances spontaneous contractions of longitudinal 14. Oh, D. Y. et al. GPR120 is an omega-3 fatty acid receptor mediating smooth muscle in the rat colon. J. Physiol. Sci. 64,85–96 (2014). potent anti-inflammatory and insulin-sensitizing effects. Cell 142, 687–698 (2010). 15. Iakoubov, R., Izzo, A., Yeung, A., Whiteside, C. I. & Brubaker, P. L. Protein Acknowledgements kinase Czeta is required for oleic acid-induced secretion of glucagon-like This work was supported by research grants from the JSPS and MEXT KAKENHI (grant – peptide-1 by intestinal endocrine L cells. Endocrinology 148, 1089 1098 nos. (JP15H05344 and JP16H01355, respectively) to I.K., AMED (no. JP18gm1010007) (2007). to I.K., CIHR Foundation (grant 154321) to D.J.D., the Institute for Fermentation Osaka 16. Polan, C. E., Mcneill, J. J. & Tove, S. B. Biohydrogenation of unsaturated fatty to IK, and the Smoking Research Foundation to IK. We thank NITTO PHARMA- – acids by rumen bacteria. J. Bacteriol. 88, 1056 1064 (1964). CEUTICAL INDUSTRIES, LTD. for supplying purified HYA, Kanako Igarashi, Miwa 17. Kishino, S. et al. Polyunsaturated fatty acid saturation by gut lactic acid Yoshimoto, and Mie Honda for their help with metabolome analysis, Kumiko Tachi- bacteria affecting host lipid composition. Proc. Natl Acad. Sci. USA 110, kawa, Mai Arita, and Shizuka Kasuga for their help with fatty acid analysis and in vitro – 17808 17813 (2013). assays, Yukie Katayama for 16S rRNA gene sequence analysis, Kohey Kitao and Keiko 18. Kishino, S., Ogawa, J., Yokozeki, K. & Shimizu, S. Metabolic diversity in Hisa for their valuable discussions, and Dr. Tadahiro Kitamura for the GLUTag cells. biohydrogenation of polyunsaturated fatty acids by lactic acid bacteria involving conjugated fatty acid production. Appl Microbiol Biotechnol. 84, 87–97 (2009). Author contributions 19. Kishino, S. et al. Novel multi-component enzyme machinery in lactic J.M. performed the experiments and wrote the paper; M.I. performed the experiments, acid bacteria catalyzing C=C double bond migration useful for interpreted data, and wrote the paper; K.W. performed the experiments and interpreted conjugated fatty acid synthesis. Biochem Biophys. Res. Commun. 416, 188–193 data; Shin.K. performed the experiments and interpreted data; H.M. performed the (2011). experiments; Shig.K. performed the experiments and interpreted the data; X.L. performed

14 NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-11978-0 ARTICLE

the experiments; A.I. interpreted data; J.I. interpreted the data; Y.S. interpreted the data; Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in Te.M. performed the experiments; T.S. interpreted the data; J.O. interpreted the data; published maps and institutional affiliations. Ta.M. interpreted the data; D.J.D. interpreted the data; M.A. performed the experiments and interpreted the data; H.I. interpreted the data; I.K. supervised the project, interpreted fi the data, and wrote the paper; I.K. had primary responsibility for the nal content. All Open Access This article is licensed under a Creative Commons fi authors read and approved the nal manuscript. Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give Additional information appropriate credit to the original author(s) and the source, provide a link to the Creative Supplementary Information accompanies this paper at https://doi.org/10.1038/s41467- Commons license, and indicate if changes were made. The images or other third party 019-11978-0. material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the Competing interests: The authors declare no competing interests. article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from Reprints and permission information is available online at http://npg.nature.com/ the copyright holder. To view a copy of this license, visit http://creativecommons.org/ reprintsandpermissions/ licenses/by/4.0/.

Peer review information: Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available. © The Author(s) 2019

NATURE COMMUNICATIONS | (2019) 10:4007 | https://doi.org/10.1038/s41467-019-11978-0 | www.nature.com/naturecommunications 15 SUPPLEMENTARY INFORMATION

Gut microbiota confers host resistance to obesity by metabolizing dietary polyunsaturated fatty acids

Miyamoto et al.

*Corresponding author; Ikuo Kimura Email: [email protected]

This PDF file includes: Supplementary Figures 1–9 Supplementary Table 1, 2 Supplementary Figure 1

a O OH CLA-DH CLA-HY HOOC HOOC HOOC

LA; Linoleic acid HYA; 10-hydroxy-cis-12-octadecenoic acid KetoA; 10-oxo-cis-12-octadecenoic acid

HOOC CLA-ER

trans-10, cis-12-CLA

CLA-HY OH CLA-DH O HOOC

HOOC HOOC cis-9, trans-11-CLA HYC; 10-hydroxy-trans-11-octadecenoic acid KetoC; 10-oxo-trans-11-octadecenoic acid

HOOC CLA-ER

trans-9, trans-11-CLA

CLA-HY OH CLA-DH O HOOC

HOOC HOOC Oleic acid HYB; 10-hydroxyoctadecanoic acid KetoB; 10-Oxooctadecanoic acid

HOOC

trans-10-octadecenoic acid b

OH CLA-DH O CLA-HY HOOC HOOC HOOC

α-Linolenic acid αHYA; 10-hydroxy-cis-12, cis-15-18:2 αKetoA; 10-oxo-cis-12, cis-15-18:2

CLA-ER HOOC trans-10, cis-12, cis-15-18:3

CLA-HY OH CLA-DH O HOOC

HOOC HOOC cis-9, trans-11, cis-15, 18:3 αHYC; 10-hydroxy-trans-11, cis-15-18:2 αKetoC; 10-oxo-trans-11, cis-15-18:2

HOOC CLA-ER

trans-9, trans-11, cis-15-18:3

CLA-HY OH CLA-DH O HOOC

HOOC HOOC cis-9,cis-15-18:2 αHYB; 10-hydroxy-cis-15-18:1 αKetoB; 10-Oxo-cis-15-18:1

HOOC trans-10, cis-15-18:2

c

100 15 0.6 A

Y 80 □ NC H _ 10 0.4 ■ HFD

C 60

N

o t

e 40 v

i 5 0.2

t a

l 20

e R 0 0 0

Supplementary Figure 1. Dietary PUFA-metabolic pathway mediated by gut microbiota. Gut microbial metabolites of (a) LA, and (b) αLA. (c) The relative abundance of gut microbial PUFA metabolites in cecal content (n = 8 per group). Results are presented as means ± SE. Open squares represent NC-fed mice and closed squares represent HFD-fed mice over 2 weeks. Source data are provided as a Source Data file. Supplementary Figure 2 a b c

NS 45

80 ○ Control Control HYA

) )

g □

g HYA (

m 35 1.6

60 t

/ l

h *

o

g i

) 1.2

e m

40 g

p

( w

( 25 T y **

T 0.8

A

d A

20 A

o

Y

W

i

W

p B

H 0.4 e 0 15 NC HFD 0.5% 1% 0 0 4 8 12 16 epi peri sub HYA Weeks of age

d e

s k

w 4

15000 )

)

y

7

2

a

t

m d Control HYA a 3

/ ** μ

* )

( 10000

g

e

(

e s

t 2

u

e

y

k

o

c

a

o t

5000 m p

n 1

/

i

i

d

g

d

( A o 0 0 o ControlHYA F ControlHYA

f g h

)

)

)

L

L L

d 260

d /

d 250 500 /

/ **

g g

g ** m

m 400

m 200

( (

( 220

e

e e

300 s s

s 150

o

o

o

c c c ○ 180

u 200 Control

u 100

u

l

l

l

g g

100 □ HYA g d d 50 **

** d o

o 140

o

o

o

l l 0 o

0 l B B 0 0 15 30 60 120 0 15 30 60 120 B ControlHYA Time (min) after insulin i.p. Time (min) after glucose i.p.

i j k l m

)

)

g

) /

L 4 L

9 g **

d 60 / * ) 60

200 d

/

m

g L

** ** * (

)

g

m

m s

( 3

/

M

m

e l

150 ( g p 6

40 d

o 40

(

i

n

r

s

r

(

e

e

1 e

t 2

- d

100 n

c

s

i

i

l

P

r

y

e

l

l

u L

e 20 3 20

g

o

i s

c 1

r h

50 G

y

t

n

l

c

I

l

l

g

a

i

a

r t

0 0 0 0 c 0

T

o e

T ControlHYA Control HYA ControlHYA ControlHYA Control HYA F Supplementary Figure 2. Gut microbial PUFA metabolites improve host metabolic condition. (a) Quantification of HYA in cecal content (n = 8 per group). Changes in (b) body weight, representative macroscopic appearance, and (c) tissue weights were measured (n = 10 and 11 per group). Scale bar; 1 cm. epi, epididymal; peri, perirenal; sub, subcutaneous. (d) Hematoxylin-eosin (H&E)-stained WAT and mean area of adipocytes (n = 8 per group). Scale bar; 400 μm. (e) Daily food intake measured at 7 weeks of age (n = 6 per group). (f) ITT (n = 8 per group) and (g) GTT (n = 8 per group) were analyzed at 14 to 15 weeks of age. (h) Blood glucose, (i) total plasma cholesterol, (j) triglyceride, (k) GLP-1, and (l) insulin levels were measured at the end of the experimental period (n = 10 and 11 per group). (m) Fecal triglyceride levels were measured at 16 weeks of age (n = 10 and 11 per group). **P < 0.01; *P < 0.05 vs. control (Student’s t test). Results are presented as means ± SE. Source data are provided as a Source Data file. Supplementary Figure 3 a

) HYA HYB HYC KetoA KetoB KetoC

g 40 400 1.8 0.12 10000 6

s

m

t

/

l n

o 8000 e

t 30 300 m

n 1.2 0.08 4

p o

( 6000

c s

l 20 200

d a

i 4000 c

c 0.6 0.04 2 e a 10 100

c 2000

y

t

n

t i

a 0 0 0 0 0 0 F NC HFD NC HFD NC HFD NC HFD NC HFD NC HFD

b

n o

i Cla-hy Cla-dh Cla-er s

s 1.6 8 2.5

e ** r

p 2

x 1.2 6

) e

S 1.5

A ** 6

N 0.8 4

1 /

R 1 (

m 0.4 2

e 0.5

v

i t

a 0 0 0 l

e NC HFD NC HFD NC HFD

R

A

Y

A L

c H d

A

s

s

L

v

v

l

l

s

o

o

v

r

r

t

t

A

n

n

o

o Y

C C Control HYA LA H Bifidobacteriaceae Microbacteriaceae Coriobacteriaceae Bacteroidaceae Bacteroidales S24-7 group Porphyromonadaceae 2 Prevotellaceae

Rikenellaceae ) %

Deferribacteraceae 7 . 0 ● Control Bacillaceae 6

1 ■ HYA z-score Bacillales_Family XI (

2 ▲ 2 Staphylococcaceae LA Aerococcaceae C -2 1 P Carnobacteriaceae 0 Enterococcaceae -1 Lactobacillaceae -4 -2 Streptococcaceae -2 0 -2 -4 q-value Christensenellaceae PC1 (26.4%) Clostridiaceae 1 0.06 Clostridiales vadinBB60 group 0.04 Clostridiales__Family XIII 0.02 Lachnospiraceae 0 Peptococcaceae Peptostreptococcaceae Ruminococcaceae Erysipelotrichaceae Acidaminococcaceae Veillonellaceae Phyllobacteriaceae Alcaligenaceae Burkholderiaceae Desulfovibrionaceae Helicobacteraceae Enterobacteriaceae Verrucomicrobiaceae Supplementary Figure 3. Analysis of gut microbial metabolites and gut microbiota. (a, b) Analysis of gut microbial metabolites of (a) LA and (b) the relative mRNA expression of metabolite-synthesizing enzymes (Cla-hy, Cla-dh, and Cla-er) (n = 7 and 8 per group). Open squares represent NC-fed mice, and closed squares represent HFD-fed mice over 12 weeks. (c, d) Gut microbial composition determined according to the abundance of bacterial domains at (c) the family level and (d) diversity (n = 4 samples per group). Source data are provided as a Source Data file. Supplementary Figure 4

a b

10, 17-diHDoHE 10, 13-hy-18:0 HYA αHYA

αHYC 400 )

L ○ Control

9-oxo-ODE d /

g △ 300 LA TXB3 m * ( □ HYA

z-score 15-hy-5c, 8c, 11c-20:3 e s

o 200

2 13-HODE c ** **

u l 1 9-HODE g *

d 100 KetoC o

0 o l -1 t10-18:1 B 0 -2 KetoA -120 0 30 60 120 9-HOTrE (n-3) Time (min) after glucose i.p. 12-HEPE 13-HOTrE (n-3) HYC 17-HDoHE 5,6-DHT 10-HDoHE 14-HDoHE c

600 ** ** ** ** ** ** ** ** ** ** ** ** * ** * *

) 400

M

p

(

1

-

P L

G 200

0 LA HYA HYB HYC KetoA KetoB KetoC CLA1 CLA2 CLA3

Supplementary Figure 4. Gut microbial metabolites regulate glucose homeostasis. (a) Heat map of gut microbial PUFA metabolites in the ileum after oral administration of HYA (n = 3 tissues). (b) Individual FAs (HYA and LA; 1 g/kg) were administered by gavage, and IPGTT was analyzed (n = 8 animals). **P < 0.01; *P < 0.05 vs. control (Tukey–Kramer test). Results are presented as means ± SE. (c) GLUTag cells were treated with LA-derived gut microbial metabolites [in a dose-dependent manner (20, 100, and 200 μM)], and GLP-1 concentration was measured in culture medium (n = 6 independent cultures from two biological replicates). **P < 0.01; *P < 0.05 vs. None (Tukey–Kramer test). Results are presented as means ± SE. Source data are provided as a Source Data file. Supplementary Figure 5

Gpr40 Gpr120 Gcg

1.5 1.5 1.5

n

o

i

s s

e 1 1 1

r

p x

e ** **

e

v i

t 0.5 0.5 0.5

a

l

e R 0 0 0 None NT Gpr40 Gpr120 None NT Gpr40 Gpr120 None NT Gpr40 Gpr120 siRNA siRNA siRNA Supplementary Figure 5. The efficiency of siRNA knockdown STC-1 cells. (a) mRNA expression of Gpr40 (left), Gpr120 (center), and Gcg (right) in individual siRNA-transfected STC-1 cells (n = 7 independent cultures for Gpr40 and Gpr120 from two biological replicates, n = 8 independent cultures for Gcg from two biological replicates). **P < 0.01 vs. None (Tukey–Kramer test). Results are presented as means ± SE. NT, non-targeting siRNA. Source data are provided as a Source Data file. Supplementary Figure 6

a 1 kb

GPR40

AAGGTGTGCACCACCACTCCGGGCTTTCTCTCTTAAAACCAAAAACAACTGTATATGTGTG AAAGAGGAACAATTCAGAAG CAGCCACCTCTGGGGGCAAGGGGCACTGCGTGGAATTG Forward primer TGCAGTTATGGTGACTGTGAGTGACTGATGTGGGTGCCAGGATCCGAACTCAGGTCTCCTG GATGACTCTGACTCTGCCAGGCTCCCAAGAGGGCAGATCCACCACAACTCAGGAGGCCTGG PAM GPR40-gRNA2 GAAGAGCAGCAAGCTCTCTCTAACTGCCGAGTCATCCCTCAAGGCAGCCCCTGATTTCTCT CCCAAAGCCATCGCAGAAACCACTCATGGGAAGGGTTCCACCTGGAGAGGACAGCGTCCTT

GGTGAGGGTTCTTTCCTTTTGAAGGGGTACAGAAACTCTGGTCACAGAGTAAGGGACAAGC GTACGAAGAAAGTGGAGGGCAAGTGCTGGACAACAAGAGACAGTACGTCTGCCTTACACAC

AGTGAACTCGGGGTCTCTGTCGCCCCATACAGCCTGGTTCTGACTTCCCTCTGCTCCTTAT CTCAGCCTGCTCCCAACTGCTTCTGGCCTGTATTGTCCTAACTGCCTGCCGTAGGCGGTGC WT TCCCCAGAGTCTCTGGGATCAGACATCGTTGCCTTGGTTCTGGAACCTTCTTTCTCTTCCT GCAGTCCTCTCCTGGGGGTGACGGGAAGCTCAGTTCTGATCTGGAGGAATACCACCATCAT GTTACACCCAGTCGTTATCTTCATCCTAAGAGCGGTACTGTGGAGGAGCAGCTGGGGACTG GACCCAGTTTTGGAGTGTTTCCCTGAGATAAGAACATTTTCATGTCTGAAGAAAAGAGGCA

AAAGCTTGGAATCCTTGATGCTGACCCGAGTTCGGTTGCTCTCCGGCGGCCATTTCCTTCT GCATCATGGCCCTGCCATACCACGCTGAATCCACTAGGGGACAGCACTGAACGTTCAGCTT

GTGGGCCTTGGCATCCTCAGTGACTCTAGGACTGGCTTCTGGTGCTCTGGGCAGGAGGAAC CAGCGAACCGGGGATAGGGGGTGGGGTGGAGGTGGGAGGAGGGGGCGGGGGTGGTAGGAGG GPR40-gRNA1 PAM GCCAGTTGTGACATTCTTTTCTCTGCAGATGAGCTGAGTACAGTGAACAGGAGGAACAGTG AACTGGCTTGAAACAGGGAAAGAAAGGGCTTTGCCGGCCTGAGCTCCATCAGAGGCAACTG

GCGACCAGCACCCACTCGGCCTC GACCTGCCCCCACAGCTCTCCTTCGCTCTCTATGT CGGAGAGGAGTAGGTAGTTGCCGGTACCACTCAGAGTCTCATCCTTCAGGGTGTCTCATTT

ATCTGCCTTTGCGCTGGGCTTTCCA CATCGTCAAACAACCCTTCTGTGTAGCACCCCTCCCTCTTCGTGCGTGTGTGTGTGTGTGT Reverse primer

AAGGTGTGCACCACCACTCCGGGCTTTCTCTCTTAAAACCAAAAACAACTGTATATGTGTGTGCAGTTATGGTGACTGTGAGTGACTGATGTGGGTGCCAGGATCCGAACTCAGGTCTCCTGGAAGAGC Forward primer AGCAAGCTCTCTCTAACTGCCGAGTCATCCCTCAAGGCAGCCCCTGATTTCTCTGGTGAGGGTTCTTTCCTTTTGAAGGGGTACAGAAACTCTGGTCACAGAGTAAGGGACAAGCAGTGAACTCGGGGT

CTCTGTCGCCCCATACAGCCTGGTTCTGACTTCCCTCTGCTCCTTATTCCCCAGAGTCTCTGGGATCAGACATCGTTGCCTTGGTTCTGGAACCTTCTTTCTCTTCCTGTTACACCCAGTCGTTATCTT

CATCCTAAGAGCGGTACTGTGGAGGAGCAGCTGGGGACTGAAAGCTTGGAATCCTTGATGCTGACCCGAGTTCGGTTGCTCTCCGGCGGCCATTTCCTTCTGTGGGCCTTGGCATCCTCAGTGACTCTA GPR40-gRNA1 GPR40-gRNA2 Mut GGACTGGCTTCTGGTGCTCTGGGCAGGAGGAACGCCAGTTGTGACATTCTTTTCTCTGCAGATGAGCTGAGTACAGTGGCCATCGCAGAAACCACTCATGGGAAGGGTTCCACCTGGAGAGGACAGCGT CCTTGTACGAAGAAAGTGGAGGGCAAGTGCTGGACAACAAGAGACAGTACGTCTGCCTTACACACCTCAGCCTGCTCCCAACTGCTTCTGGCCTGTATTGTCCTAACTGCCTGCCGTAGGCGGTGCGCA

GTCCTCTCCTGGGGGTGACGGGAAGCTCAGTTCTGATCTGGAGGAATACCACCATCATGACCCAGTTTTGGAGTGTTTCCCTGAGATAAGAACATTTTCATGTCTGAAGAAAAGAGGCAGCATCATGGC

CCTGCCATACCACGCTGAATCCACTAGGGGACAGCACTGAACGTTCAGCTTCAGCGAACCGGGGATAGGGGGTGGGGTGGAGGTGGGAGGAGGGGGCGGGGGTGGTAGGAGGAACTGGCTTGAAACAGG

GAAAGAAAGGGCTTTGCCGGCCTGAGCTCCATCAGAGGCAACTGCGGAGAGGAGTAGGTAGTTGCCGGTACCACTCAGAGTCTCATCCTTCAGGGTGTCTCATTTCATCGTCAAACAACCCTTCTGTGT

AGCACCCCTCCCTCTTCGTGCGTGTGTGTGTGTGTGT Reverse primer

GPR40-gRNA1 PAM Wild-type CTGCAGATGAGCTGAGTACAGTGAACAGGAGGAACAGTGGCGACCAGCACCCACTCGGCCTC GACCTGCCCCCACAGCT Mutation CTGCAGATGAGCTGAGTACAGT------PAM GPR40-gRNA2 Wild type GAAG CAGCCACCTCTGGGGGCAAGGGGCACTGCGTGGAATTGGATGACTCTGACTCTGCCAGGCTCCCAAGAGGGCAGATCCACCACAACTCAGGAGGCCTGGCCCAAAGCCATCGCAGAAACCACTCAT Mutation ------GCCATCGCAGAAACCACTCAT

b +/+ +/- -/- c ×10-5 Gpr40

n 6

)

o

i

S

s 8

← Wild Type allele: s

1 e

r 4

2230bp /

( p

← Targeted allele: x

m

e u

1300bp A

e 2

l

i

N

n

R i

m 0 Primer Forward: ACTCCGGGCTTTCTCTCTTAAA Reverse: CTACACAGAAGGGTTGTTTGACGAT Supplementary Figure 6. Gpr40 gene modification. (a) Schematic representation of the genomic structures of Gpr40 genes. Gpr40-deficient mice were generated using the CRISPR/Cas9 system in wild-type C57BL/6 zygotes. The coding exon region is shown in a black box. gRNA and PAM sequence are indicated in the green, and purple boxes, respectively. gRNA, guide RNA; PAM, protospacer-adjacent motif. (b) Mouse genotypes were determined by PCR using the indicated primers to detect wild-type and mutant Gpr40 alleles. (c) mRNA expression of Gpr40 in the ileum (n = 8 per group). Results are presented as means ± SE. Source data are provided as a Source Data file. Supplementary Figure 7 a

1 kb

GPR120

ACTCTTCGATCAGGGTTAGCTTAAGTAGGATTTCAGTAATCAGTGTCCATGAAAGATGAAG CCAGCGCCATCCCTCTAGTGCTCGTCGTGCGCTGGACTGAGGCCTGGCTGTTGGGGCCCGT

AAGGCGGCCTCGGGGGCGGGGGGGGGGGGGGGGGCGGGGCAGGGACAGGGAGGCGGAGATT CGTCTGCCACCTGCTCTTCTACGTGATGACAATGAGCGGCAGCGTCACGATCCTCACACTG

CTTTAATTTTCTGGCTTAAGAGCACTTAGACTGCCCAAGGGTCTGAGGTCTCTGCCTTGGT GCCGCGGTCAGCCTGGAGCGCATGGTGTGCATCGTGCGCCTCCGGCGCGGCTTGAGCGGCC Forward primer GGCCACCTTCCCACCCACGGTGTTCAGGCCAGTGTTGCCAGGCACTTCCTCGTTCCGGTGC CGGGGCGGCGGACTCAGGCGGCACTGCTGGCTTTCATATGGGGTTACTCGGCGCTCGCCGC PAM GPR120-gRNA2 GCCCTGGACGCAGCTCCTACGCCCAGAGCCTGGGCAACTCGGGCGGGAGGGTGACAGAGGG GCTGCCCCTCTGCATCTTGTTCCGCGTGGTCCCGCAGCGCCTTCCCGGCGGGGACCAGGTG

GAGGTGTCGCAACCTCCTCCCTCCCTCTTTCCCCGCCTTGGCATTCAGTTACCCGCAGATG AGCGCTGGCTGCGTGCAACGCAACAAGTATCCAGGCGGGCTGCTGGTGGGAGGCAAGGATC WT GPR120-gRNA1 PAM AGCGCTCTCTCAGACAGCGGCGGGCGGCCGGGCGCCCGGC TCCCCTGAGTGTGCACAG TGACCAAAGCCGTGGGCCGGGGGTGGGGGTGGGGGATAGTGACTAGTAACAATAATAGGTC

ACGACGGGCCCTGGCCCCTCGCACACCCTGGACCAAGTCAATCGCACCCACTTCCCTTTCT GTGGGTGGAATTGTATCCTTTTTGGCAGACCCAGTGCCCAATACTCTGGAGTTTAATTTCG

TCTCGGATGTCAAGGGCGACCACCGGTTGGTGTTGAGCGTCGTGGAGACCACCGTTCTGGG TCAGTTTACCCACAGTGCCAAGTGGGTAAGTAAATCCTCACAAGTGTTAAGGGGGCCTTCC Reverse primer GCTCATCTTTGTCGTCTCACTGCTGGGCAACGTGTGTGCTCTAGTGCTGGTGGCGCGCCGT CGGACTTTTTGCAAACTGCAGAGACTATTATGAGGCTAATTAAGCAATGGGAGCTTACAGC

CGGCGCCGTGGGGCGACAGCCAGCCTGGTGCTCAACCTCTTCTGCGCGGATTTGCTCTTCA CAGGTGGGACACAGGGTGCGAGGTGGCTTCTCACAGAGTTTCTGCTTTCTCTCCAAATGTC

ACTCTTCGATCAGGGTTAGCTTAAGTAGGATTTCAGTAATCAGTGTCCATGAAAGATGAAGAAGGCGGCCTCGGGGGCGGGGGGGGGGGGGGGGGCGGGGCAGGGACAGGGAGGCGGAGATTCTTTAA

TTTTCTGGCTTAAGAGCACTTAGACTGCCCAAGGGTCTGAGGTCTCTGCCTTGGTGGCCACCTTCCCACCCACGGTGTTCAGGCCAGTGTTGCCAGGCACTTCCTCGTTCCGGTGCGCCCTGGACGCA Forward primer GCTCCTACGCCCAGAGCCTGGGCAACTCGGGCGGGAGGGTGACAGAGGGGAGGTGTCGCAACCTCCTCCCTCCCTCTTTCCCCGCCTTGGCATTCAGTTACCCGCAGATGAGCGCTCTCTCAGACAGC GPR120-gRNA1 GPR120-gRNA2 GGCGGGCGGCCCTCTGCATCTTGTTCCGCGTGGTCCCGCAGCGCCTTCCCGGCGGGGACCAGGTGAGCGCTGGCTGCGTGCAACGCAACAAGTATCCAGGCGGGCTGCTGGTGGGAGGCAAGGATCTG

ACCAAAGCCGTGGGCCGGGGGTGGGGGTGGGGGATAGTGACTAGTAACAATAATAGGTCGTGGGTGGAATTGTATCCTTTTTGGCAGACCCAGTGCCCAATACTCTGGAGTTTAATTTCGTCAGTTTA Mut CCCACAGTGCCAAGTGGGTAAGTAAATCCTCACAAGTGTTAAGGGGGCCTTCCCGGACTTTTTGCAAACTGCAGAGACTATTATGAGGCTAATTAAGCAATGGGAGCTTACAGCCAGGTGGGACACAG Reverse primer GGTGCGAGGTGGCTTCTCACAGAGTTTCTGCTTTCTCTCCAAATGTC

GPR120-gRNA1 PAM Wild type AGCGCTCTCTCAGACAGCGGCGGGCGGCCGGGCGCCCGGC TCCCCTGAGTGTGCACAG Mutation AGCGCTCTCTCAGACAGCGGCGGGCG------

PAM GPR120-gRNA2 Wild type CGGGGCGGCGGACTCAGGCGGCACTGCTGGCTTTCATATGGGGTTACTCGGCGCTCGCCGCGCTGCCCCTCTGCATCTTGTTCCGCGTGGTCCCGCAGCGCCTTCCCGGCGGGGACCAGGTG Mutation ------TCTTGTTCCGCGTGGTCCCGCAGCGCCTTCCCGGCGGGGACCAGGTG

b c +/+ +/- -/- ×10-6 Gpr120

3

n

)

o

i

S

s

8

s 1

← Wild Type allele: e 2

r

/ (

1100bp p

x

m

e u

A 1

e

l i

← Targeted allele: N

n R 600bp i m 0

Primer Forward: CTTTAATTTTCTGGCTTAAGAGCAC Reverse: CCCTTAACACTTGTGAGGATTTACT Supplementary Figure 7. Gpr120 gene modification. (a) Schematic representation of the genomic structure of Gpr120 genes. Gpr120-deficient mice were generated using the CRISPR/Cas9 system in wild-type C57BL/6 zygotes. Coding and untranslated exon regions are shown as black and grey boxes and words, respectively. gRNA and PAM sequence are indicated in blue and purple boxes, respectively. gRNA, guide RNA; PAM, protospacer-adjacent motif. (b) Mouse genotypes were determined by PCR using the indicated primers to detect wild-type and mutant Gpr120 alleles. (c) mRNA expression of Gpr120 in the ileum (n = 8 per group). Results are presented as means ± SE. Source data are provided as a Source Data file.

Supplementary Figure 8

a

m

u c

e 8 **

c

m o

r -0.5 cm

f 4

) m

c Control

( 0 s

i EP3 agonist

s l

a (0.1mg/kg) 5.4 cm t

s -4

i r

e Control EP3 p agonist

b c m

60 u

y

c t

i **

■ HYA e 8 s -2.7 cm c

n ▲ LA m

e 40 **, #

t

o

r n f 4

i Control )

+ 6.4 cm 2

20 m

c a

HYA (

C 0

2.1 cm s

i s 0 l LA a -10 -8 -6 -4 t s -4

10 10 10 10 i r

Ligand conc. (M) e ControlHYA LA p d

1 mN

30 min

None

1.5 P = 0.0124 TTX Pirox 10-8 10-7 10-6 10-5 10-4 10-3 CCh ■ HYA

] 0.6

▲ LA N

m ]

1 ◆ EP3 agonist [ N

e 0.4

m

d [

HYA u

t

e

i l

d 0.5

u p

t 0.2

i P = 0.0584

l

m p

TTX Pirox 10-8 10-7 10-6 10-5 10-4 10-3 CCh a

m Δ A 0 0 10-9 10-8 10-7 10-6 10-5 10-4 10-3 - + - + EP3 antagonist -0.5 HYA LA Ligand conc. (M)

TTX Pirox 10-8 10-7 10-6 10-5 10-4 10-3 CCh

EP3 agonist

TTX Pirox 10-8 10-7 10-6 10-5 10-4 10-3 CCh Supplementary Figure 8. HYA facilitates intestinal peristalsis via EP3 signaling. (a) Intestinal peristalsis was assessed 2 h after administration of the EP3 agonist (sulprostone; 0.1 mg/kg) with charcoal by measuring the distance travelled by the charcoal (i.e., the base of the cecum or the start of the colon) (n = 5 and 7 animals per group). (b) Mobilization of [Ca2+]i induced by LA and HYA in EP3-experssiong Chem-1 cells. Data are presented as Ca2+ intensity (n = 3 independent experiments). (c) Intestinal peristalsis evaluated 2 h after FA administration (1 g/kg) with charcoal by measuring the distance travelled by the charcoal (i.e., the base of the cecum or the start of the colon) (n = 8 animals per group). (d) Representative traces of the isolated intestine in response to the cumulative addition of an HYA, LA, or EP3 agonist in the presence or absence of an EP3 antagonist (n = 10, 7, 5, and 5 samples per group). **P < 0.01; *P < 0.05 vs. None (Tukey–Kramer test). Results are presented as means ± SE. Source data are provided as a Source Data file. Supplementary Figure 9

a

HYA-producing lactic acid bacteria. HYA (+) bacteria I.S. LA (mg) HYA (mg) HYB (mg) L. salivarius JCM1044 1 1.17±0.041 3.71±0.518 0.05±0.004 L. salivarius JCM1042 1 1.17±0.088 3.58±0.206 0.04±0.003 L. salivarius JCM1231 1 2.45±0.504 2.61±0.299 0.01±0.001

HYA (-) bacteria I.S. LA (mg) HYA (mg) HYB (mg) L. johnsonii JCM1022 1 5.7±0.089 0.01±0.02 ND L. johnsonii JCM8791 1 4.95±0.254 0.25±0.019 ND

L. acidophilus JCM1229 1 4.91±0.735 ND ND A

b c Y H

f 8

e

o g

Colonization of Lactobacillus a

e f

Lactobacillus genus c 6

o n

6 a

(î 10 copies / ng DNA) s

d k

n 4

e

u e

GF ND b w a 2

HYA (+) 5.9±0.827 9

e

t

v i ± a

HYA (-) 3.31 0.176 t 0

a l

e GFHYAHYA Conv. R (+) (-)

d e

400 45

) ○ Control

L

d )

/ 〇 HYA

g g

300 ( 35

t

m

(

h

g

e

i

s e

o 200 w

c * 25

u y

l * d

g * * ** o

d 100 ** ○ HFD (FMT) B o **

o 15 l □ HFD＋HYA (FMT) B 0 0 0 30 60 120 4 8 12 16 Time (min) after glucose p.o. Weeks of age Supplementary Figure 9. HYA-producing lactic acid bacteria. (a) Selection of HYA-producing Lactobacillus strains (n = 3 bacteria). (b) Lactobacillus colonization was detected by qPCR (n = 4 samples per group). (c) The relative abundance of HYA in feces was measured at 9 weeks of age (n = 8 samples per group). *P < 0.05 vs. GF mice (Tukey–Kramer test). (d) OGTT in FMT mice. Colonization was undertaken using fecal contents (suspended in sterile PBS) in conventional HFD-induced obese mice (n = 8 and 10 animals per group; 3 mice/pellet, 3 times/week). *P < 0.05 vs. HFD-fed gnotobiotic mice (Student’s t test). (e) Changes in body weight under non-coprophagy conditions were measured (n = 9 animals per group). **P < 0.01; *P < 0.05 vs. control (Student’s t test). Results are presented as means ± SE. Source data are provided as a Source Data file. Supplementary Table 1

Screening of HYA-producing Lactobacillus I.S. HYA (mg) HYB (mg) L. acidophilus JCM1028 1 0.005 ND L. acidophilus JCM 1034 1 0.004±0.002 ND L. acidophilus JCM 1132 1 0.023±0.004 ND L. acidophilus JCM1229 1 0.004±0.002 ND L. amylovorus JCM2125 1 0.041±0.002 ND L. amylovorus JCM5811 1 0.018±0.001 0.002±0.002 L. antri JCM15950 1 0.055±0.004 ND L. crispatus JCM8778 1 0.002±0.002 ND L. gasseri JCM1025 1 0.023±0.005 0.002±0.002 L. gasseri JCM1130 1 0.035±0.003 ND L. gasseri JCM1131 1 0.034±0.003 0.004±0.004 L. johnsonii JCM1022 1 0.005 ND L. johnsonii JCM8791 1 0.011±0.001 ND L. johnsonii JCM8794 1 0.014±0.001 ND L. paracasei subsp. paracasei JCM1109 1 0.061±0.01 ND L. paracasei subsp. paracasei JCM1133 1 0.055±0.005 ND L. reuteri JCM1112 1 0.02±0.009 ND L. salivarius JCM1040 1 0.048±0.013 0.002±0.002 L. salivarius JCM1042 1 0.389±0.157 0.005±0.005 L. salivarius JCM1044 1 0.088±0.027 0.006±0.006 L. salivarius JCM1045 1 0.146±0.022 ND L. salivarius JCM1231 1 0.322±0.075 0.016±0.008

Supplementary Table 1. Selection of HYA-producing Lactobacillus strains. After bacterial cultivation, HYA and HYB were quantified in culture medium (n = 3 culture supernatants per bacteria). Source data are provided as a Source Data file. Supplementary Table 2

Composition of diets. HFD 0.5% HYA 1% HYA LA Normal chow Product gm% gm% gm% gm% gm% protein 26 25.87 25.74 25.74 25.48 Carbohydrate 26 25.87 25.74 25.74 48.92 Fat 35 34.83 34.65 34.65 4.61 (Soybean oil and/or Lard) LA 0 0 0 1 0 HYA 0 0.5 1 0 0

Fatty acid ratio in total fat gm% gm% gm% gm% gm% Saturated 32 31.52 31.04 31.04 22.02 Monounsaturated 35.97 36.93 37.88 34.9 25.07 Polyunsaturated 32.04 31.55 31.08 34.06 52.91

Ingredient of soybean oil and/or Lard gm% gm% gm% gm% gm% C10, Capric acid 0.01 0.01 0.01 0.01 0 C12, Lauric acid 0.03 0.03 0.03 0.03 0 C14, Myristic acid 0.39 0.38 0.37 0.37 0.04 C15, pentadecylic acid 0.03 0.03 0.03 0.03 0 C16, Palmitic acid 6.87 6.73 6.59 6.59 0.75 C16:1, Palmitoleic acid 0.47 0.46 0.45 0.45 0.06 C17, Margaric acid 0.12 0.12 0.12 0.12 0.02 C18, Stearic acid 3.7 3.63 3.55 3.55 0.1 C18:1, Oleic acid 11.91 11.68 11.44 11.44 0.97 C18:2, Linoleic acid 10.06 9.86 9.66 9.66 2.05 C18:3, Linolenic acid 0.72 0.7 0.69 0.69 0.15 C20, Arachidic acid 0.06 0.05 0.05 0.05 0.02 C20:1 0.21 0.2 0.2 0.2 0.03 C20:2 0.28 0.27 0.26 0.26 0 C20:3 0.04 0.04 0.04 0.04 0 C20:4, Arachidonic acid 0.1 0.09 0.09 0.09 0 C22:5, Docosapentaenoic acid 0.03 0.03 0.03 0.03 0 C22:6, Docosahexaenoic acid 0 0 0 0 0.06 C24:0, Lignoceric acid 0 0 0 0 0.01 C24:1, Tetracosenoic acid 0 0 0 0 0.01 C18:2, Linoleic acid (free fatty acid) 0 0 0 1 0 C18:1 (OH), HYA (free fatty acid) 0 0.5 1 0 0 Supplementary Table 2. Diet compositions