DOCSLIB.ORG

Changes in Brain Gene Expression Shared by Scrapie and Alzheimer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Changes in Brain Gene Expression Shared by Scrapie and Alzheimer Proc. Nati. Acad. Sci. USA Vol. 86, pp. 7260-7264, September 1989 Neurobiology Changes in brain gene expression shared by scrapie and Alzheimer disease (Pick disease/sulfated glycoprotein 2/transferrin/glial fibrillary acidic protein/metaflothionein) JOHN R. DUGUID*tt, CRAIG W. BOHMONT*, NINGAI LIU*t, AND WALLACE W. TOURTELLOTTE§¶ *Geriatric Research, Education and Clinical Center, Edith N. Rogers Memorial Veterans Hospital, Bedford, MA, 01730; Departments of tBiochemistry and SNeurology, Boston University School of Medicine, Boston, MA 02118; Neurology Service, Wadsworth Veterans Administration Medical Center, Los Angeles, CA 90073; and IDepartment of Neurology, University of California, Los Angeles, CA 90024 Communicated by Walle J. H. Nauta, June 19, 1989 (receivedfor review January 5, 1989) ABSTRACT We have isolated two recombinant cDNAs study the single-stranded scrapie library DNA (25 Lg ) was whose corresponding RNAs have an increased abundance in hybridized successively with 50, 25, and 25 ,ug of sonicated, scrapie-infected hamster brain. DNA sequence analysis has biotinylated control library DNA (2.5 ,ug/Al) for 20 hr at 680C shown that these two recombinants represent the genes for in 0.75 M NaCl/25 mM Hepes/5 mM EDTA/0.1% sodium sulfated glycoprotein 2 and transferrin. The abundance of dodecyl sulfate, pH 7.5, containing poly(A) and poly(C) sulfated glycoprotein 2 RNA is increased in hippocampus from (Pharmacia) at 10 ,ug/ml. After each cycle the DNA was patients with Alzheimer disease and Pick disease, whereas subjected to the stringency incubation, subtracted with avi- transferrin RNA is not strongly modulated in these conditions. din-biocytin-Sephacryl 1000 resin (4 ,ul ofpacked resin per ,ug Expression of two previously identified scrapie-modulated of biotinylated DNA), and denatured as described (8). The genes, encoding glial fibrillary acidic protein and metallothio- product of the third cycle was converted to the double- nein, is also increased in both of these neurodegenerative stranded form by using Escherichia coli DNA polymerase I. diseases. The subtracted single-stranded DNA was ethanol-precip- itated, dissolved in 100 ,ll of 50 mM Tris HCl, pH 7.5/5 mM Scrapie is a transmissable neurodegenerative disease of MgCl2, 10 mM 2-mercaptoethanol containing hybridization sheep and goats and is characterized by a long latent period, primer [d(CCTTACTTCTGTGGTGTGAC), the gift of John followed by progressive ataxia, tremor, wasting, and death Smith (Massachusetts General Hospital, Boston)] at 1 ,ug/ml, (1). Scrapie has been adapted to the laboratory hamster (2) and incubated for 10 min at 42°C. The mixture was cooled to and has become the experimental prototype of the spongi- 15°C and incubated for 1 hr with E. coli DNA polymerase I form encephalopathies, manifest in humans as kuru and (New England Biolabs; 50 units/ml) and dNTPs (50 ,M Creutzfeld-Jakob disease (1, 3, 4). The nature of the scrapie each). The reaction product was used to transform E. coli agent is controversial because ofits resistance to many virus- strain FG2 cells (8), which generated a subtracted library and nucleic acid-inactivating agents (1, 3, 4). One possibility composed of 9000 independent recombinants. The library is that the agent lacks a nucleic acid genome, as suggested by was screened by successive hybridization with probe derived Prusiner in the prion hypothesis (5). Implicit in this hypoth- from the scrapie and control libraries. The control library was esis is the possibility that modulated host gene expression subtracted through two cycles as described above with may participate in the pathogenesis of the disease. biotinylated control library DNA, in order to remove highly Identifying the changes in brain gene expression that occur abundant sequences from the library. Insert DNA from each in scrapie might contribute to the understanding of the subtracted library was liberated by Xho I digestion and pathogenesis of this condition. Wietgrefe et al. (6) isolated a purified from vector by potassium acetate gradient centrifu- recombinant cDNA corresponding to a mRNA whose abun- gation and agarose gel electrophoresis (9). Probe was gener- dance was increased in the brains of scrapie-infected mice ated from the polydisperse insert DNA (100-2000 base pairs) and patients with Alzheimer disease (AD). This RNA was cut from the gel (8, 10). Probe (2 x 108 cpm) from each library shown to code for glial fibrillary acidic protein (GFAP) (7). A was subtracted with 50 Ag of biotinylated wH3M plasmid previous study (8) used a library subtraction strategy to DNA as described above to remove trace contaminating isolate genes whose transcription products are increased in vector sequences before hybridization with the library colony scrapie infected hamster brain and identified them as GFAP, replicas. To avoid the selection of previously identified metallothionein, and crystallin mRNAs. Here, we report the recombinants, probes for metallothionein, crystallin, GFAP, isolation and identification of two additional genes whose and rRNA (106 cpm each) were included with the control RNAs are increased in scrapie-infected hamster brain.ll probe. Selected recombinants were screened with scrapie Exploring the expression of scrapie-modulated genes in hu- and control brain cDNA as described (8). man neurodegenerative diseases might give clues about the RNA preparation (11), RNA blot analysis (12), and DNA similarities and differences between these conditions that sequencing (13) were performed as described (8). Human might not be apparent from clinical or pathological exami- cognates of the hamster recombinants were isolated from a nations. For this reason we have also studied the expression human liver cDNA library obtained from Brian Seed (Mas- of these genes in human neurodegenerative diseases. sachusetts General Hospital) [sulfated glycoprotein 2 (SGP- 2) and transferrin] or from a cDNA library constructed from METHODS AD hippocampal mRNA (GFAP and metallothionein), using the hamster inserts as probe. Human specimens, frozen in The scrapie tissue, the starting cDNA libraries, and the liquid nitrogen (14) after postmortem times of 2-6 hr, were method of their subtraction have been described (8). In this Abbreviations: AD, Alzheimer disease; PD, Pick disease; GFAP, The publication costs of this article were defrayed in part by page charge glial fibrillary acidic protein; SGP-2, sulfated glycoprotein 2. payment. This article must therefore be hereby marked "advertisement" IIThe sequences reported in this paper have been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession nos. M26637-M26642). 7260 Downloaded by guest on September 29, 2021 Neurobiology: Duguid et al. Proc. Natl. Acad. Sci. USA 86 (1989) 7261 obtained from the National Neurologic Research Bank (Vet- sequences were 80% identical; the derived amino acid se- erans Administration Wadsworth Medical Center, Los An- quences were 72% identical, with 20% of the differences geles) and the Dementia Study Unit (Edith N. Rogers Me- representing conservative amino acid substitutions. This morial Veterans Administration Hospital, Bedford, MA). relatively high evolutionary divergence of the transferrin Pathological diagnoses on tissue from the Dementia Study gene was observed previously (16). Unit were provided by Thomas Kemper. The degree of increased expression of each of these genes was investigated by RNA blot analysis. The SGP-2 probe RESULTS recognized a 2.0-kilobase mRNA that was some 10-fold increased in scrapie-infected brain compared to controls (Fig. In order to identify additional genes whose transcription 2 Upper). The transferrin probe identified a 2.5-kilobase products are increased in scrapie-infected hamster brain (8), mRNA that was about 6-fold increased in scrapie-infected more starting DNA was used and the subtraction was more brain (Fig. 2 Lower). exhaustive. Probes used to screen the library were generated The human cognates of each of these two genes were from subtracted libraries. These probes had a reduced se- isolated from an adult human liver cDNA library, and the quence complexity after removal of abundant sequences and partial sequences of each are presented in Fig. 1. The human would therefore be more sensitive in the detection of low- SGP-2 recombinant was 93% identical with the rat sequence; abundance sequences compared to standard cDNA probes the derived amino acid sequences were 97% identical. The (9). Nevertheless, the abundance ofthe two mRNAs we have human transferrin recombinant was 76% identical with the rat identified here are similar to those of metallothionein and sequence and differed by a single change in 350 residues from crystallin described previously (8) (see Fig. 2). the published human sequence (17). The derived amino acid Two differentially expressed recombinants were isolated sequence of the human transferrin recombinant was 72% from the subtracted scrapie cDNA library. The 650-base-pair identical with the rat sequence; 25% of the changes were insert ofthe first recombinant was sequenced and found to be conservative substitutions. The sequence of human recom- highly homologous with rat testicular SGP-2 (15) as shown in binants representing GFAP and metallothionein, isolated Fig. 1. The two nucleic acid sequences were 90%o identical; from an AD hippocampal cDNA library, are presented in Fig. the derived amino acid sequences were 88% identical, with 3. The nucleic acid sequence of the GFAP recombinant
Load more

Recommended publications
  • Evolutionary Genetic Studies of Mating Type and Silencing in Saccharomyces
    Evolutionary Genetic Studies of Mating Type and Silencing in Saccharomyces by Oliver Anthony Zill A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Jasper Rine, Chair Professor Barbara Meyer Professor Michael Levine Professor Kathleen Ryan Spring 2010 Evolutionary genetic studies of mating type and silencing in Saccharomyces © 2010 by Oliver Anthony Zill Abstract Evolutionary Genetic Studies of Mating Type and Silencing in Saccharomyces by Oliver Anthony Zill Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor Jasper Rine, Chair This thesis describes studies exploring the evolution of the genetic circuits regulating yeast mating-type and silencing by Sir (Silent Information Regulator) proteins in the budding yeast Saccharomyces bayanus, a close relative of the laboratory workhorse S. cerevisiae (a.k.a., budding yeast, or brewer’s yeast). The two central subjects of these studies, mating type and silencing, are textbook examples of “well understood” mechanisms of eukaryotic gene regulation: the former serves as a model for understanding the genetic control of cell-type differentiation, the latter serves as a model for understanding physically condensed, transcriptionally repressed portions of the genome, often referred to as “heterochromatin”. The two subjects are intimately connected in the biology of the budding yeast life cycle, as explained below, and I argue that a deeper appreciation of this connection is necessary for further progress in the study of either subject. My thesis brings a critical evolutionary perspective to certain assumptions underlying current knowledge of mating-type regulation and silencing—in short, an appreciation of organismal biology that has been marginalized in the pursuit of understanding molecular mechanisms.
    [Show full text]
  • An Initiator Element Mediates Autologous Down- Regulation of the Human Type a ␥-Aminobutyric Acid Receptor ␤1 Subunit Gene
    An initiator element mediates autologous down- regulation of the human type A ␥-aminobutyric acid receptor ␤1 subunit gene Shelley J. Russek, Sabita Bandyopadhyay, and David H. Farb* Laboratory of Molecular Neurobiology, Department of Pharmacology, Boston University School of Medicine, 80 East Concord Street, Boston, MA 02118 Edited by Erminio Costa, University of Illinois, Chicago, IL, and approved May 15, 2000 (received for review November 19, 1999) The regulated expression of type A ␥-aminobutyric acid receptor The ␤1 subunit gene is located in the ␤1-␣4-␣2-␥1 gene cluster (GABAAR) subunit genes is postulated to play a role in neuronal on chromosome 4 (12) and is most highly expressed in the adult maturation, synaptogenesis, and predisposition to neurological rat hippocampus. Seizure activity decreases hippocampal ␤1 disease. Increases in GABA levels and changes in GABAAR subunit mRNA levels by about 50% while increasing ␤3 levels (11). gene expression, including decreased ␤1 mRNA levels, have been Because the subtype of ␤ subunit influences the sensitivity of the observed in animal models of epilepsy. Persistent exposure to GABAAR to GABA and to allosteric modulators such as GABA down-regulates GABAAR number in primary cultures of etomidate, loreclezole, barbiturates, and mefenamic acid (13– neocortical neurons, but the regulatory mechanisms remain un- 17), a change in ␤ subunit composition may alter receptor known. Here, we report the identification of a TATA-less minimal function and pharmacology in vivo. Modulation of receptor ␤ promoter of 296 bp for the human GABAAR ␤1 subunit gene that function by phosphorylation is also influenced by subunit is neuron specific and autologously down-regulated by GABA.
    [Show full text]
  • The Hexokinase System of the Erythrocyte
    THE HEXOKINASE SYSTEM OF THE ERYTHROCYTE by Charles Prévost A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfilment of the requirements for the degree of Master of Science. Department of Biochemistry, Mc Gill University, Montreal. September 1961 i ABSTRACT The writer has developed an as say for estimation of optimal hexokinase activity in stroma-free hemolyzate, and shawn that hexokinase remains stable and active for at least 30 days in human erythrocytes preserved in CD or ACD at 4 ° C. Addition of ADP or DPN to the assay medium could increase the enzyme 1s activity; nicotinamide or alloxan depressed it. It is suggested that failure of glycolytic activity during preservation is not therefore due to the formerly supposed lability of hexokinase, but to inhibition of hexokinase attributable to falling pH and ATP, and conditions favouring glucose-6-P accumulation such as decrease of phosphofructokinase, DPN and ADP. Pyruvate produced in cells during the first 15 days of storage tended to be expelled into the external medium. Cyclic adenylate was utilised by the human red cell, as evidenced by conversion of its ribose moiety into lactic acid with concomitant esterification of inorganic phosphate into the stable phosphate fraction. ii AC KNOWLEDGE MEN TS I am most grateful to Dr. O. F. Denstedt for his sympathetic guidance and understanding throughout the course of this investigation. The kindness and spirit of my colleagues are greatly appreciated and I wish to express my thanks to Mrs. Marina van Ermengen, Miss Anne Hemphill and Miss Arlene Maximchuk for assistance in some of the experimenta, and to Miss Maximchuk for proofreading the manuscript.
    [Show full text]
  • Bio-Based Route to the Carbon-5 Chemical Glutaric Acid and Bio-Polyamide PA6.5 Using Metabolically Engineered Corynebacterium Glutamicum
    Electronic Supplementary Material (ESI) for Green Chemistry. This journal is © The Royal Society of Chemistry 2018 Online Supplementary Information to: Bio-based route to the carbon-5 chemical glutaric acid and bio-polyamide PA6.5 using metabolically engineered Corynebacterium glutamicum Submitted for publication to Green Chemistry Christina Maria Rohlesa, Lars Gläsera, Michael Kohlstedta, Gideon Gießelmanna, Samuel Pearsonb, Aránzazu del Campob, Judith Beckera, and Christoph Wittmanna* a. Institute of Systems Biotechnology, Saarland University, Saarbrücken, Germany b. Leibniz Institut für Neue Materialien, Saarbrücken, Germany * Phone: +49-(0) 681 302 71970, E-mail: [email protected] Annotations and abbreviations of genes in central carbon metabolism and lysine biosynthesis (addendum to Figure 1). aceA: isocitrate lyase; aceB: malic synthase; aceEF: subunits of pyruvate dehydrogenase; acn: aconitase; ald: aldolase; asd: aspartate semialdehyde dehydrogenase; aspB: aspartate aminotransferase; dapA: dihydrodipicolinate synthase; dapB: dihydrodipicolinate reductase; dapC: succinyl-amino-ketopimelate transaminase; dapD: tetrahydrodipicolinate succinylase; dapE: succinyl- diaminopimelate desuccinylase; dapF: diaminopimelate epimerase; ddh: diaminopimelate dehydrogenase; eno: enolase; fbp: fructose 1,6-bisphosphatase; fum: fumarase; gapA: glyceraldehyde 3-phosphate dehydrogenase; gltA: citrate synthase; homV59A: homoserine dehydrogenase with amino acid exchange valine to alanine at position 59; icdA1G: isocitrate dehydrogenase
    [Show full text]
  • The Biological Role of the RBP7910 Z-Binding Protein in the Mitochondrial Mrna Processing of Trypanosoma Brucei
    The biological role of the RBP7910 Z-binding protein in the mitochondrial mRNA processing of Trypanosoma brucei Nisha Ramamurthy Department of Parasitology McGill University Montréal, Canada August 2020 A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Master of Science ©Nisha Ramamurthy, 2020 1 Table of contents 1. List of Figures and Tables .................................................................................................... 4 2. List of Abbreviations ............................................................................................................ 6 3. Abstract .................................................................................................................................. 7 4. Acknowledgments ................................................................................................................. 9 5. Introduction and Literature review .................................................................................. 10 5.1 Kinetoplastids: Occurrence, Prevalence and Importance ............................................... 10 5.2 Life cycle of T.brucei: .................................................................................................... 11 5.3 Energy regulation in T. brucei: ...................................................................................... 12 5.4 Differentiation between procyclic forms (PFs) and bloodstream forms (BFs): ............. 14 5.5 RNA editing regulated in a life-stage specific manner .................................................
    [Show full text]
  • Glycogen Metabolism Glycogen Breakdown Glycogen Synthesis
    Glycogen Metabolism Glycogen Breakdown Glycogen Synthesis Control of Glycogen Metabolism Glycogen Storage Diseases Glycogen Glycogen - animal storage glucan 100- to 400-Å-diameter cytosolic granules up to 120,000 glucose units α(1 → 6) branches every 8 to 12 residues muscle has 1-2% (max) by weight liver has 10% (max) by weight ~12 hour supply Although metabolism of fat provides more energy: 1. Muscle mobilize glycogen faster than fat 2. Fatty acids of fat cannot be metabolized anaerobically 3. Animals cannot convert fatty acid to glucose (glycerol can be converted to glucose) Glycogen Breakdown Three enzymes: glycogen phosphorylase glycogen debranching enzyme phosphoglucomutase Glycogen phosphorylase (phosphorylase) - phosphorolysis of glucose residues at least 5 units from branch point Glycogen + Pi glycogen + glucose-1-phosphate (n residues) (n-1 residues) homodimer of 842-residues (92-kD) subunits allosteric regulation - inhibitors (ATP, glucose-6- phosphate, glucose) and activator (AMP), T ⇔ R covalent modification (phosphorylation) - modification/demodification 2- phosphorylase a (active, SerOPO3 ) phosphorylase b (less active, Ser) narrow 30-Å crevice binds glycogen, accommodates 4 to 5 residues Pyridoxal-5-phosphate (vit B6 derivative) cofactor - located near active site, general acid-base catalyst Rapid equilibrium Random Bi Bi kinetics Glycogen Breakdown Glycogen debranching enzyme - possesses two activities α(1 → 4) transglycosylase (glycosyl transferase) 90% glycogen → glucose-1-phosphate transfers trisaccharide unit from
    [Show full text]
  • 12) United States Patent (10
    US007635572B2 (12) UnitedO States Patent (10) Patent No.: US 7,635,572 B2 Zhou et al. (45) Date of Patent: Dec. 22, 2009 (54) METHODS FOR CONDUCTING ASSAYS FOR 5,506,121 A 4/1996 Skerra et al. ENZYME ACTIVITY ON PROTEIN 5,510,270 A 4/1996 Fodor et al. MICROARRAYS 5,512,492 A 4/1996 Herron et al. 5,516,635 A 5/1996 Ekins et al. (75) Inventors: Fang X. Zhou, New Haven, CT (US); 5,532,128 A 7/1996 Eggers Barry Schweitzer, Cheshire, CT (US) 5,538,897 A 7/1996 Yates, III et al. s s 5,541,070 A 7/1996 Kauvar (73) Assignee: Life Technologies Corporation, .. S.E. al Carlsbad, CA (US) 5,585,069 A 12/1996 Zanzucchi et al. 5,585,639 A 12/1996 Dorsel et al. (*) Notice: Subject to any disclaimer, the term of this 5,593,838 A 1/1997 Zanzucchi et al. patent is extended or adjusted under 35 5,605,662 A 2f1997 Heller et al. U.S.C. 154(b) by 0 days. 5,620,850 A 4/1997 Bamdad et al. 5,624,711 A 4/1997 Sundberg et al. (21) Appl. No.: 10/865,431 5,627,369 A 5/1997 Vestal et al. 5,629,213 A 5/1997 Kornguth et al. (22) Filed: Jun. 9, 2004 (Continued) (65) Prior Publication Data FOREIGN PATENT DOCUMENTS US 2005/O118665 A1 Jun. 2, 2005 EP 596421 10, 1993 EP 0619321 12/1994 (51) Int. Cl. EP O664452 7, 1995 CI2O 1/50 (2006.01) EP O818467 1, 1998 (52) U.S.
    [Show full text]
  • GC/MS-Based Differential Metabolic Profiling of Human Peptic Ulcer Disease to Study Helicobacter Pylori-Induced Metabolic Pertur
    BIOCELL Tech Science Press 2021 GC/MS-based differential metabolic profiling of human peptic ulcer disease to study Helicobacter pylori-induced metabolic perturbations GAGANJOT GUPTA1;DEEPAK BANSAL2;ANSHULA SHARMA1;TAWSEEF AHMAD1;ATUL SACHDEV2;AJAZ AHMAD3; HAMED A. EL-SEREHY4;BALJINDER KAUR1,* 1 Department of Biotechnology, Punjabi University, Patiala, 147002, India 2 Department of Gastroenterology, Government Medical College and Hospital, Chandigarh, 160047, India 3 Department of Clinical Pharmacy, College of Pharmacy, King Saud University, Riyadh, 11451, Saudi Arabia 4 Department of Zoology, College of Science, King Saud University, Riyadh, 11451, Saudi Arabia Key words: Peptic ulcer disease, Gastric cancer, Helicobacter pylori, Metabolic profiling, Perturbations, Stomach ulcers Abstract: Helicobacter pylori infection has been significantly linked to Peptic Ulcer Disease and Gastric Cancer. Metabolomic fingerprinting may offer a principal way of early diagnosis and to understand the molecular mechanism of H. pylori-induced pathogenicity. The rationale of the study is to explore the underlying distinct metabolic mechanisms of H. pylori-induced PUD and to identify potential biomarkers for disease diagnosis and associated risks using Gas chromatography/mass spectrometry. GC/MS-based analytical method was used to compare metabolic profiles of healthy controls (N = 20) and peptic ulcer patients (N = 45). Acquired metabolomic data were analyzed by constructing a diagnostic model using principal component analysis and a non-parametric two-tailed paired Wilcoxon analysis to identify disease-specific metabolic biomarkers. A total of 75 low-molecular-weight endogenous metabolites were detected during comparative metabolomic analysis of PUD vs. healthy gut tissues, among which 16 metabolites are being proposed to be diagnostic markers of Human PUD.
    [Show full text]
  • Modeling and Simulation of the Redox Regulation of the Metabolism in Escherichia Coli at Diferent Oxygen Concentrations Yu Matsuoka1 and Hiroyuki Kurata1,2*
    Matsuoka and Kurata Biotechnol Biofuels (2017) 10:183 DOI 10.1186/s13068-017-0867-0 Biotechnology for Biofuels RESEARCH Open Access Modeling and simulation of the redox regulation of the metabolism in Escherichia coli at diferent oxygen concentrations Yu Matsuoka1 and Hiroyuki Kurata1,2* Abstract Background: Microbial production of biofuels and biochemicals from renewable feedstocks has received consider- able recent attention from environmental protection and energy production perspectives. Many biofuels and bio- chemicals are produced by fermentation under oxygen-limited conditions following initiation of aerobic cultivation to enhance the cell growth rate. Thus, it is of signifcant interest to investigate the efect of dissolved oxygen concen- tration on redox regulation in Escherichia coli, a particularly popular cellular factory due to its high growth rate and well-characterized physiology. For this, the systems biology approach such as modeling is powerful for the analysis of the metabolism and for the design of microbial cellular factories. Results: Here, we developed a kinetic model that describes the dynamics of fermentation by taking into account transcription factors such as ArcA/B and Fnr, respiratory chain reactions and fermentative pathways, and catabolite regulation. The hallmark of the kinetic model is its ability to predict the dynamics of metabolism at diferent dissolved oxygen levels and facilitate the rational design of cultivation methods. The kinetic model was verifed based on the experimental data for a wild-type E. coli strain. The model reasonably predicted the metabolic characteristics and molecular mechanisms of fnr and arcA gene-knockout mutants. Moreover, an aerobic–microaerobic dual-phase culti- vation method for lactate production in a pf-knockout mutant exhibited promising yield and productivity.
    [Show full text]
  • Protrudin and PDZD8 Contribute to Neuronal Integrity by Promoting Lipid
    ARTICLE https://doi.org/10.1038/s41467-020-18413-9 OPEN Protrudin and PDZD8 contribute to neuronal integrity by promoting lipid extraction required for endosome maturation ✉ Michiko Shirane1 , Mariko Wada1, Keiko Morita1, Nahoki Hayashi1, Reina Kunimatsu1, Yuki Matsumoto1, ✉ Fumiko Matsuzaki2, Hirokazu Nakatsumi1, Keisuke Ohta 3, Yasushi Tamura4 & Keiichi I. Nakayama 2 1234567890():,; Endosome maturation depends on membrane contact sites (MCSs) formed between endo- plasmic reticulum (ER) and endolysosomes (LyLEs). The mechanism underlying lipid supply for this process and its pathophysiological relevance remains unclear, however. Here, we identify PDZD8—the mammalian ortholog of a yeast ERMES subunit—as a protein that interacts with protrudin, which is located at ER-LyLE MCSs. Protrudin and PDZD8 promote the formation of ER-LyLE MCSs, and PDZD8 shows the ability to extract various lipids from the ER. Overexpression of both protrudin and PDZD8 in HeLa cells, as well as their depletion in mouse primary neurons, impairs endosomal homeostasis by inducing the formation of abnormal large vacuoles reminiscent of those apparent in spastin- or REEP1-deficient neu- rons. The protrudin-PDZD8 system is also essential for the establishment of neuronal polarity. Our results suggest that protrudin and PDZD8 cooperatively promote endosome maturation by mediating ER-LyLE tethering and lipid extraction at MCSs, thereby maintaining neuronal polarity and integrity. 1 Department of Molecular Biology, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Aichi, Japan. 2 Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Fukuoka, Japan. 3 Department of Anatomy, Kurume University School of Medicine, Kurume, Fukuoka, Japan. 4 Department of Material and Biological Chemistry, Faculty of Science, Yamagata University, Yamagata, Yamagata, ✉ Japan.
    [Show full text]
  • Barr Virus Latent Membrane Protein 1- Mediated NF-Κb Activation
    Investigation of the mechanism of Epstein- Barr Virus Latent Membrane Protein 1- mediated NF-κB activation. Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) eingereicht im Fachbereich Biologie, Chemie, Pharmazie der Freien Universität Berlin vorgelegt von Daniela Böhm aus Mittweida Februar 2010 Die Arbeit wurde von März 2006 bis September 2009 im Labor von Prof. Elliott Kieff und Prof. Ellen Cahir- McFarland im Department of Microbiology and Molecular Genetics, Harvard Medical School and Department of Medicine, Division of Infectious Disease, Brigham and Woman’s Hospital in Boston, MA, USA unter der Leitung von Prof. Ellen Cahir-McFarland angefertigt. 1. Gutachter: Prof. Ellen Cahir-McFarland 2. Gutachter: Prof. Volker Haucke Disputation am: 27.April 2010 2 Acknowledgments ACKNOWLEDGMENTS I would like to thank Prof. Ellen D. Cahir McFarland and Prof. Elliott Kieff for giving me the opportunity to complete my thesis in their laboratory. Furthermore, I sincerely thank Ellen D. Cahir McFarland for her great guidance and support throughout my work. In addition, I thank all the members of the Kieff/ Muenger/ Kaye and Wang laboratories at the 8 th floor of the Channing lab, especially Mike Calderwood, Ben Gewurz, Aline Habison, Chantal Beauchemin, Kevin Hall, Amy Holthaus, Olga Saturne, Vishal Soni, Thomas Sommermann, Nick Shinners, and Jae Song. 5 Table of contents 1. INTRODUCTION ................................................................................................................
    [Show full text]
  • Genome-Scale Methods Converge on Key Mitochondrial Genes For
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UCL Discovery 1 Title: “Genome-scale methods converge on key mitochondrial genes 2 for the survival of human cardiomyocytes in hypoxia.” 3 Authors: Lindsay M Edwardsa, Martin I Sigurdssonb,c, Peter A Robbinsd, Michael E 4 Wealee, Gianpiero L. Cavallerif, Hugh E Montgomeryg and Ines Thieleh 5 6 Affiliations: 7 a School of Biomedical Science, King’s College London, SE1 1UL, UK 8 bDepartment of Anaesthesia, Perioperative and Pain Medicine, Brigham and Women's 9 Hospital / Harvard Medical School, Boston, USA 10 d Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford, 11 OX1 3PT, UK 12 e Department of Medical and Molecular Genetics, King's College London School of 13 Medicine, London, SE1 9RT, UK 14 f Molecular and Cellular Therapeutics, Royal College of Surgeons in Ireland, 123 St. 15 Stephen's Green, Dublin 2, Ireland 16 g Institute for Human Health and Performance, University College London, N19 5LW, 17 UK 18 h Luxembourg Centre for Systems Biomedicine, University of Luxembourg, Belval, 7, 19 avenue des Hauts-Fourneaux, L-4362 Esch-sur-Alzette, Luxembourg 20 21 Address for Correspondence: 22 Dr Lindsay Edwards 23 Centre of Human & Aerospace Physiological Sciences, King’s College London 24 SH4.15 Guy’s Campus 25 London SE1 1UL. 26 Tel: +44 (0)20 7848 6978 27 E-mail: [email protected] 28 29 Running head: Constraint-based modelling, hypoxia and human genetics 30 31 1 32 Abstract 33 Background: Any reduction in myocardial oxygen delivery relative to its demands can 34 impair cardiac contractile performance.
    [Show full text]