Changes in Brain Gene Expression Shared by Scrapie and Alzheimer

Proc. Nati. Acad. Sci. USA Vol. 86, pp. 7260-7264, September 1989 Neurobiology Changes in brain gene expression shared by scrapie and Alzheimer disease (Pick disease/sulfated glycoprotein 2/transferrin/glial fibrillary acidic protein/metaflothionein) JOHN R. DUGUID*tt, CRAIG W. BOHMONT*, NINGAI LIU*t, AND WALLACE W. TOURTELLOTTE§¶ *Geriatric Research, Education and Clinical Center, Edith N. Rogers Memorial Veterans Hospital, Bedford, MA, 01730; Departments of tBiochemistry and SNeurology, Boston University School of Medicine, Boston, MA 02118; Neurology Service, Wadsworth Veterans Administration Medical Center, Los Angeles, CA 90073; and IDepartment of Neurology, University of California, Los Angeles, CA 90024 Communicated by Walle J. H. Nauta, June 19, 1989 (receivedfor review January 5, 1989)

ABSTRACT We have isolated two recombinant cDNAs study the single-stranded scrapie library DNA (25 Lg ) was whose corresponding RNAs have an increased abundance in hybridized successively with 50, 25, and 25 ,ug of sonicated, scrapie-infected hamster brain. DNA sequence analysis has biotinylated control library DNA (2.5 ,ug/Al) for 20 hr at 680C shown that these two recombinants represent the genes for in 0.75 M NaCl/25 mM Hepes/5 mM EDTA/0.1% sodium sulfated glycoprotein 2 and transferrin. The abundance of dodecyl sulfate, pH 7.5, containing poly(A) and poly(C) sulfated glycoprotein 2 RNA is increased in hippocampus from (Pharmacia) at 10 ,ug/ml. After each cycle the DNA was patients with Alzheimer disease and Pick disease, whereas subjected to the stringency incubation, subtracted with avi- transferrin RNA is not strongly modulated in these conditions. din-biocytin-Sephacryl 1000 resin (4 ,ul ofpacked resin per ,ug Expression of two previously identified scrapie-modulated of biotinylated DNA), and denatured as described (8). The genes, encoding glial fibrillary acidic protein and metallothio- product of the third cycle was converted to the double- nein, is also increased in both of these neurodegenerative stranded form by using Escherichia coli DNA polymerase I. diseases. The subtracted single-stranded DNA was ethanol-precip- itated, dissolved in 100 ,ll of 50 mM Tris HCl, pH 7.5/5 mM Scrapie is a transmissable neurodegenerative disease of MgCl2, 10 mM 2-mercaptoethanol containing hybridization sheep and goats and is characterized by a long latent period, primer [d(CCTTACTTCTGTGGTGTGAC), the gift of John followed by progressive ataxia, tremor, wasting, and death Smith (Massachusetts General Hospital, Boston)] at 1 ,ug/ml, (1). Scrapie has been adapted to the laboratory hamster (2) and incubated for 10 min at 42°C. The mixture was cooled to and has become the experimental prototype of the spongi- 15°C and incubated for 1 hr with E. coli DNA polymerase I form encephalopathies, manifest in humans as kuru and (New England Biolabs; 50 units/ml) and dNTPs (50 ,M Creutzfeld-Jakob disease (1, 3, 4). The nature of the scrapie each). The reaction product was used to transform E. coli agent is controversial because ofits resistance to many virus- strain FG2 cells (8), which generated a subtracted library and nucleic acid-inactivating agents (1, 3, 4). One possibility composed of 9000 independent recombinants. The library is that the agent lacks a nucleic acid genome, as suggested by was screened by successive hybridization with probe derived Prusiner in the prion hypothesis (5). Implicit in this hypoth- from the scrapie and control libraries. The control library was esis is the possibility that modulated host gene expression subtracted through two cycles as described above with may participate in the pathogenesis of the disease. biotinylated control library DNA, in order to remove highly Identifying the changes in brain gene expression that occur abundant sequences from the library. Insert DNA from each in scrapie might contribute to the understanding of the subtracted library was liberated by Xho I digestion and pathogenesis of this condition. Wietgrefe et al. (6) isolated a purified from vector by potassium acetate gradient centrifu- recombinant cDNA corresponding to a mRNA whose abun- gation and agarose gel electrophoresis (9). Probe was gener- dance was increased in the brains of scrapie-infected mice ated from the polydisperse insert DNA (100-2000 base pairs) and patients with Alzheimer disease (AD). This RNA was cut from the gel (8, 10). Probe (2 x 108 cpm) from each library shown to code for glial fibrillary acidic protein (GFAP) (7). A was subtracted with 50 Ag of biotinylated wH3M plasmid previous study (8) used a library subtraction strategy to DNA as described above to remove trace contaminating isolate genes whose transcription products are increased in vector sequences before hybridization with the library colony scrapie infected hamster brain and identified them as GFAP, replicas. To avoid the selection of previously identified metallothionein, and crystallin mRNAs. Here, we report the recombinants, probes for metallothionein, crystallin, GFAP, isolation and identification of two additional genes whose and rRNA (106 cpm each) were included with the control RNAs are increased in scrapie-infected hamster brain.ll probe. Selected recombinants were screened with scrapie Exploring the expression of scrapie-modulated genes in hu- and control brain cDNA as described (8). man neurodegenerative diseases might give clues about the RNA preparation (11), RNA blot analysis (12), and DNA similarities and differences between these conditions that sequencing (13) were performed as described (8). Human might not be apparent from clinical or pathological exami- cognates of the hamster recombinants were isolated from a nations. For this reason we have also studied the expression human liver cDNA library obtained from Brian Seed (Mas- of these genes in human neurodegenerative diseases. sachusetts General Hospital) [sulfated glycoprotein 2 (SGP- 2) and transferrin] or from a cDNA library constructed from METHODS AD hippocampal mRNA (GFAP and metallothionein), using the hamster inserts as probe. Human specimens, frozen in The scrapie tissue, the starting cDNA libraries, and the liquid nitrogen (14) after postmortem times of 2-6 hr, were method of their subtraction have been described (8). In this Abbreviations: AD, Alzheimer disease; PD, Pick disease; GFAP, The publication costs of this article were defrayed in part by page charge glial fibrillary acidic protein; SGP-2, sulfated glycoprotein 2. payment. This article must therefore be hereby marked "advertisement" IIThe sequences reported in this paper have been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession nos. M26637-M26642). 7260 Downloaded by guest on September 29, 2021 Neurobiology: Duguid et al. Proc. Natl. Acad. Sci. USA 86 (1989) 7261 obtained from the National Neurologic Research Bank (Vet- sequences were 80% identical; the derived amino acid se- erans Administration Wadsworth Medical Center, Los An- quences were 72% identical, with 20% of the differences geles) and the Dementia Study Unit (Edith N. Rogers Me- representing conservative amino acid substitutions. This morial Veterans Administration Hospital, Bedford, MA). relatively high evolutionary divergence of the transferrin Pathological diagnoses on tissue from the Dementia Study gene was observed previously (16). Unit were provided by Thomas Kemper. The degree of increased expression of each of these genes was investigated by RNA blot analysis. The SGP-2 probe RESULTS recognized a 2.0-kilobase mRNA that was some 10-fold increased in scrapie-infected brain compared to controls (Fig. In order to identify additional genes whose transcription 2 Upper). The transferrin probe identified a 2.5-kilobase products are increased in scrapie-infected hamster brain (8), mRNA that was about 6-fold increased in scrapie-infected more starting DNA was used and the subtraction was more brain (Fig. 2 Lower). exhaustive. Probes used to screen the library were generated The human cognates of each of these two genes were from subtracted libraries. These probes had a reduced se- isolated from an adult human liver cDNA library, and the quence complexity after removal of abundant sequences and partial sequences of each are presented in Fig. 1. The human would therefore be more sensitive in the detection of low- SGP-2 recombinant was 93% identical with the rat sequence; abundance sequences compared to standard cDNA probes the derived amino acid sequences were 97% identical. The (9). Nevertheless, the abundance ofthe two mRNAs we have human transferrin recombinant was 76% identical with the rat identified here are similar to those of metallothionein and sequence and differed by a single change in 350 residues from crystallin described previously (8) (see Fig. 2). the published human sequence (17). The derived amino acid Two differentially expressed recombinants were isolated sequence of the human transferrin recombinant was 72% from the subtracted scrapie cDNA library. The 650-base-pair identical with the rat sequence; 25% of the changes were insert ofthe first recombinant was sequenced and found to be conservative substitutions. The sequence of human recom- highly homologous with rat testicular SGP-2 (15) as shown in binants representing GFAP and metallothionein, isolated Fig. 1. The two nucleic acid sequences were 90%o identical; from an AD hippocampal cDNA library, are presented in Fig. the derived amino acid sequences were 88% identical, with 3. The nucleic acid sequence of the GFAP recombinant was 25% of the differences representing conservative amino acid 90% identical with the known murine sequence (18), whereas substitutions. The sequence ofthe 850-base-pair insert ofthe the derived protein sequences were 98% identical. The second recombinant was found to be homologous with rat nucleic acid sequence of the metallothionein recombinant transferrin (16), as shown in Fig. 1. The two nucleic acid was 97% identical with a previously reported human metal- SGP-2 A) hanter x rat ham GGGCCCCTGAGCTTCCACGACATGTTCCAGCCTTTCCTCGAGATGATACACQAGGCGCAACAGGCCATGGATGTCCAGTTCCACAGCCCAGCCTTCCAGT 1000 rat GGGCCTCTGAGCTTCCACAACATGTTCQGCCTTTCTTTGATATGATACACCAGGCTCAACAGGCCATGGACGTCCAGCTCCATAGCCCAGCTTTACAGT ham TCCCGGACATGGATTTGTTAAGAGAAGGTGAAGATGACCGTGCAGTGTGCAAGGAGATCCGCCACAACTCCACAGGATGCCTGAAGATGkAAGGGCCAGTG 1111111 1111111 11ii 11111l111!1111111 11111111 1111iIIIII11 11111111111111111111111111111111111 1100 rat TCCCGGATGTGGATTTCTTAAAAGAAGGTGAAGATGACCCGACAGTGTGCAAGGAGATCCGCCATAACTCCACACGATGCCTGAAGATGAAGGGCCAGTG ham TGAGAAATGCCAGGAGATCTTGTCTGTGGACTGTTCAGCCAACAACCCAGCACAGGCTCACCTGCGCCAGGAGCTGAACGACTCCCTCCAGGTGGCCGAG 111111 11111 11111111111111111111111 1111111 11 11 111111 1111111111111111 11111111 11111111111 111 1200 rat TGAGAAGTGCCAAGAGATCTTGTCTGTGGACTGTTCGACCAACAATCCTGCCCAGGCTAACCTGCGCCAGGAGCTAAACGACTCGCTCCAGGTGGCTGAG B) human x rat hum AATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGG 1111111111111111111111111111111111 1 1111111111111111111111111111111 11 11 601 rat AACGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAGCACACCTGCATGAAGTTCTACGCACGCGTCTGCAGGAGCGGCTCGGGGCTGG hUm TTGGGCGCCAGCTTGAGGAGTTTCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCA 701 rat TTGGTCGCCAGCTAGAGGAGTTTCTGAACCAGAGCTCACCCTTCTACTTCTGGATGAACGGGGACCGCATCGACTCCCTGCTGGAGAGTGACCGGCAGCA TRANSFERRIN ham TACCTGGCCCMAGCTCCAAACCACGTTGTGGTCTCACGGAAAGAGMAGGCAGCCCGGGTTAGCACAGTGCTGCTTMACCAGCAGACTTCATTTGGAAGGG 111111111111111111111111111111111111 1111111111111111111 111111 11111 11111111 I1 229 rat CACCTGGCCCAAGCTCCMACCATGTTGTGGTCTCACGAAAAGAGAAGGCAGCCCGGGTTAGCACTGTGCTGACTGCCCAGMGGATTTATTTTGGAAAG hUm ......

ham GTGTATCTGACTGCACTACGAACTTCTGTATGTTCAAATCTGACACCAGCGACCTTCTGTTCAGAGATGACACCAAATGCTTGTTTAAACTTCCTGATGG 111 111111111 11 11111 11111 III 11111111111111111 11111 11111111 329 rat GTGACAAGGACTGCACTGGCAATTTCTGTTTGTTCCGGTCTTCCACCAAGGACCTTCTGTTCAGAGATGACAACAGTGTTTGACTAAACTTCCAGAAGG III T 1 1 1 1 1 1 1 1 1 1 1 1 H hUm...... GGCMACTTTTGTTTGTTCCGGTCGGAAACCAAGGACCTTCTGTTCAGAGATGACACAGTATGTTTGGCCAAACTTCATGACAG

ham TATC...... 11 1 429 rat TACCACATATGAAGAGTACTTAGGAGGAGAGTACTTGCAAGCTGTTGGAAACATACGGAAGTGTTCAACCTCACGACTCCTAGACGGCTGCACTTTcACA IIIIIIIII I I I II I I I I I I IIIH I I1- 11 hUm AAACACATATGAAAAATACTTAGGAGAAGAATATGTCMAGGCTGTTGGTMACCTGAGAAAATGCTCCACCTCATCACTCCTGGAAGCCTGCACTTTCCGT FIG. 1. Nucleic acid sequence analysis of isolated recombinants. The partial sequences of hamster and human SGP-2 and transferrin recombinants are presented, aligned with the published rat sequences (15, 16), which are numbered for orientation. The open reading frames of the two sequences begin at residues 1000 and 229, for SGP-2 and transferrin, respectively. Downloaded by guest on September 29, 2021 7262 Neurobiology: Duguid et A Proc. Natl. Acad. Sci. USA 86 (1989)

12 3 4 5 6 7 generative diseases (Fig. 4). Three cases of AD, which prominently affects the hippocampus (20), and one case of Pick disease (PD) with prominent hippocampal involvement showed an increased abundance ofSGP-2 message compared to a case of Huntington disease, in which there is no primary pathological change in the hippocampus. Transferrin expression was not strongly modulated in the AD cases or the single case of PD. Though transferrin expression appeared slightly moo 40 gm decreased in the AD hippocampi, quantitative analysis was f, 01 04 14 complicated by message degradation, a consequence of the postmortem interval. Both GFAP and metallothionein RNAs had an increased expression in both AD and PD, though the pattern of expression was somewhat different. Compared to the AD samples, PD sample showed less modulation of metallothionein relative to GFAP mRNA. As a control for RNA loading and integrity, probe derived from the phosphoglucokinase gene, which encodes a "housekeeping enzyme" (21), showed similar expression in all samples. The expression of the a1-antichymotrypsin gene, known to be increased in AD (22), showed a pattern of expression similar to that of SGP-2, GFAP, and metallothionein. One of the cases of AD had two a1-antichymotrypsin transcripts hybridizing with _mm probe. This might have been the result of alternative pro- t cessing ofthe initial transcript or the result oftranscription of an allelic or rearranged gene.

DISCUSSION We have described the isolation of two recombinants, representing SGP-2 and transferrin, and have shown that their FIG. 2. Modulation of SGP-2 and transferrin mRNA levels in respective mRNAs have an increased abundance in scrapie- scrapie-infected hamster brain. Samples (10 jg) of total brain RNA infected hamster brain compared to controls. SGP-2 is the from four hamsters with advanced scrapie (lanes 1-4) and three major secretion product of Sertoli cells and has been pro- age-matched control hamsters (lanes 5-7) were electrophoresed, posed to be a lipid-transport molecule (15). Transferrin is transferred, and hybridized with probe derived from the hamster both the iron-transport molecule and a neurotrophic factor SGP-2 (Upper) or transferrin (Lower) recombinants, as described, and autoradiographed for 16 hr. For comparisons of band intensity (23). These two proteins are known to be expressed in both 4-hr autoradiograms were scanned and integrated with an LKB the brain and testes (15, 16, 24). While transferrin is known Ultroscan densitometer. Size standards were obtained from BRL and to be synthesized by oligodendrocytes (24), the site of visualized by ethidium bromide staining (9). increased transcription of either of these genes in scrapie- infected brain is not known. The reason that these genes have lothionein sequence (19); the derived protein sequences were an increased expression in scrapie-infected brain is unclear, identical. though the increased expression of important transport pro- We used these human cognates to investigate the expres- teins might support the proliferative astrogliosis that is seen sion of these genes in hippocampus from human neurode- in this condition (1).

Human x Murine GFAP

...... CCTGCTCAATGTCAAGCTGGCCCTGGACATCGAGATCGCCACCTACAGGAAGCTGCTAGAGGGCGAGGAGAACCGGATCACCATTCCC 11 11111 11 11111 11111111111111111111111111111111 1li 11111111 11 Hill 11111111111 951 - -. - -.. -.-- -._-__ _ --._- ._- -... -aP oax n~ .,aona.... GTGCAGACCTTCTCCAACCTGCAGATTCGAGAAACCAGCCTGGACACCAAGTCTGTGTCAGAAGGCCACCTCAAGAGGAACATCGTGGTGAAGACCGTGG 11 11111 11111111111 11111 1111111111111111111111111 11111111111111111111111111111111111 11111 li1 1051 GUACAGACUUUCUCCAACCUCCAGAUCCGAGAAACCAGCCUGGACACCAAAUCCGUGUCAGAAGGCCACCUCAAGAGGAACAUCGUGGUAAAGACUGUGG AGATGCGGGATGGAGAGGTCATTAAGGAGTCC...... 1111111111111 111111111111II 11 1151 AGAUGCGGGAUGGUGAGGUCAUUAAGGACUCGAAGCAGGAGCACAAGGAC

Human x Human Metallothionein

11 111111111111111111111111111111111111111111111111 11111 1111111111111111111111111111L 4. 111111111 51 GCACGCCAUGGAUCCCAACUGCUCCUGCGCCGCCGGUGACUCCUGCACCUGCGCCGGUWCCUGCAAAUGCAAAGAGUGCAAAUGCACUWCGUGCAAGAAA__~~~~~ AGCTGCTGCTCCTGCTGCCCTGTCGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGG 11111111111111111111111 111111111111111111111111111111111111111111111111 151 AGCUGCUGCUCCUGCUGCCCUGUGGGCUGUGCCAAGUGUGCCCAAGGCUGCAUCUGCAAAGGGGCGUCGGACAAGUGCAGCUGCUGCGCCUGAUGCUCGGG FIG. 3. Nucleic acid sequences of the human cognates for GFAP and metallothionein. The sequences of the isolated recombinants are presented, aligned with known sequences for murine GFAP (18) and human metallothionein (19), which are numbered for reference. Downloaded by guest on September 29, 2021 Neurobiology: Duguid et al. Proc. Natl. Acad. Sci. USA 86 (1989) 7263 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 SJ P-2 GFAP PCK

TRANS MET a. -AC'lTP

. .zI,'ilI..z., ."z. 40"Ot.t I .. -M X ..~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ I I ..

FIG. 4. Expression of scrapie-modulated genes in human neurodegenerative disease. Blots of 10 pg of total hippocampal RNA from three patients with AD (lanes 1-3), one patient with PD (lanes 4), and one patient with Huntington disease (lanes 5) were hybridized with probe generated from human genes for SGP-2 and transferrin (Left), GFAP and metallothionein (Center), and phosphoglucokinase and al- antichymotrypsin (Right). For reference, the lengths of the transcripts identified by the phosphoglucokinase probe are 2.0 and 4.1 kilobases. We explored the expression of the human cognates of imens, and Mary Dinauer and Brian Seed for helpful comments. We scrapie-modulated genes in human neurodegenerative dis- thank Stuart Orkin (Children's Hospital, Boston) for providing the eases. The finding that SGP-2, GFAP, and metallothionein phosphoglucokinase recombinant and C. Abraham and H. Potter mRNAs have an increased abundance in scrapie, a spongi- (Harvard Medical School, Boston), for providing the a1-antichymo- form encephalopathy, and in AD has precedent in the patho- trypsin recombinant. This work was supported by grants from the logical similarities that have occasionally be-en noted in these Veterans Administration and the American Parkinson Disease As- two classes of disease. Certain strains of mice develop senile sociation. N.L. received support from Public Health Service Grant plaques after infection with some scrapie isolates (25), though RO1 AG05894-16 to Dr. Richard Fine. the amyloids isolated from these two conditions are biochem- 1. Gajdusek, D. C. (1977) Science 197, 943-960. ically distinct (26, 27). Furthermore, senile plaques are seen 2. Kimberlin, R. H. & Walker, C. A. (1977) J. Gen. Virol. 34, in occasional cases of Creutzfeld-Jakob disease (28). The 295-304. finding that SGP-2, GFAP, and metallothionein mRNAs have 3. Carp, R. I., Merz, P. A., Kascsak, R. J., Merz, G. S. & an increased abundance in both AD and PD has precedent in Wisniewski, H. M. (1985) J. Gen. Virol. 66, 1357-1368. the reports that neurofibrillary tangle antigens are present in 4. Prusiner, S. B. (1987) Annu. Rev. Med. 38, 381-398. both of these conditions (29, 30). The finding that transferrin 5. Prusiner, S. B. (1982) Science 216, 136-144. mRNA is moderately increased in the brains of scrapie- 6. Wietgrefe, S., Zupancic, M., Hasse, A., Chesboro, B., Race, infected hamsters but not in the hippocampus ofpatients with R., Frey, W., Rustan, T. & Friedman, R. L. (1985) Science 230, AD or PD may reflect the pathological differences that are 1177-1179. usually greater than the similarities between these diseases 7. Diedrich, J., Wietgrefe, S., Zupancic, M., Staskus, K., Retzel, and the spongiform encephalopathies (28). E., Hasse, A. & Race, R. (1987) Microbiol. Pathol. 2, 435-442. We have assembled a panel of genes whose expression is 8. Duguid, J. R., Rohwer, R. G. & Seed, B. (1988) Proc. Natl. modulated in different neurodegenerative diseases. Although Acad. Sci. USA 85, 5738-5742. the reason for the increased expression of these genes is not 9. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular known, a comparison ofthe changes in brain gene expression Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY). that occur in different neurodegenerative diseases can iden- 10. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, tify similarities and differences between these diseases that 6-13. has not been possible using other approaches. As more 11. Cathala, G., Savouret, J. F., Mendez, B., West, B. L., Karin, modulated genes are identified and the reasons for their M., Martial, J. A. & Baxter, J. D. (1983) DNA 2, 329-335. altered expression are understood, they may yield insight into 12. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. USA 77, 5201- the molecular basis ofthe disease processes and may form the 5205. basis for the development of diagnostic tools (31, 32). 13. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. We thank T. Kemper and D. Lathi for neuropathological consul- 14. Toutellotte, W., Itabashi, H. H., Rosario, I. & Berman, K. tation, the National Neurologic Research Bank for supplying spec- (1984) Ann. N. Y. Acad. Sci. 436, 513-516. Downloaded by guest on September 29, 2021 7264 Neurobiology: Duguid et al. Proc. Nail. Acad. Sci. USA 86 (1989) 15. Collard, M. W. & Griswold, M. D. (1987) Biochemistry 26, 24. Bloch, B., Popovici, T., Levin, M. J., Tuil, D. & Kahn, A. 3297-3303. (1985) Proc. NatI. Acad. Sci. USA 82, 6706-6710. 16. Huggenvick, J. I., Idzerda, R. L., Haywood, L., Lee, D. C., 25. Wisniewski, H., Bruce, M. E. & Frasier, H. (1975) Science 190, McKnight, G. S. & Griswold, M. D. (1987) Endocrinology 120, 1108-1110. 332-340. 26. Masters, C. L., Sims, 0., Weinman, N. A., Multhaup, G., 17. Uzan, G., Frain, M., Park, I., Besmond, C., Maessen, G., McDonald, B. L. & Beyreuther, K. (1985) Proc. Natl. Acad. Trepat, J. S., Zakin, M. M. & Kahn, A. (1984) Biochem. Sci. USA 82, 4245-4249. Biophys. Res. Commun. 119, 273-281. 27. C. V. & 18. Lewis, S. A., Balcarek, J. M., Krek, V., Shelanski, M. & Wong, W., Quaranta, Glenner, G. G. (1985) Proc. Cowan, N. J. (1984) Proc. Natl. Acad. Sci. USA 81,2743-2746. Natl. Acad. Sci. USA 82, 8729-8732. 19. Karin, M. & Richards, R. J. (1982) Nucleic Acids Res. 10, 28. Masters, C. L., Gajdusek, D. C. & Gibbs, C. J. (1981) Brain 3165-3173. 104, 559-588. 20. Jamada, M. & Mehraein, P. (1968) Arch. Psychiatr. 211, 29. Love, S., Quijada, S., Saitoh, T., Davies, P. & Terry, R. D. 308-324. (1987) Soc. Neurosci. Abstr. 13, Part 2, 1151. 21. Michelson, A. M., Markham, A. F. & Orkin, S. H. (1983) 30. Rasool, C. G. & Selkoe, D. J. (1985) N. Engl. J. Med. 312, Proc. Natl. Acad. Sci. USA 80, 472-476. 700-708. 22. Abraham, C. R., Selkoe, D. J. & Potter, H. (1988) Cell 52, 31. Albrechtsen, M., Srensen, P. S., Gjerris, F. & Bock, E. (1985) 487-501. J. Neurol. Sci. 70, 267-274. 23. Stamatos, C., Squicciarini, J. & Fine, R. E. (1983) FEBS Lett. 32. Crols, R., Saerens, J., Noppe, M. & Lowenthal, A. (1986) J. 153, 387-390. Neurol. 233, 157-160. Downloaded by guest on September 29, 2021