DOCSLIB.ORG

United States Patent (19) 11 Patent Number: 5,723,292 Kawasaki Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
United States Patent (19) 11 Patent Number: 5,723,292 Kawasaki Et Al I US005723292A United States Patent (19) 11 Patent Number: 5,723,292 Kawasaki et al. 45) Date of Patent: *Mar. 3, 1998 54 STABLE DNA CONSTRUCTS Carbon and Ratzkin, "The Expression of Eukaryotic DNA Segments in Escherichia coli'', J. Supramolec. Struct. 75 Inventors: Glenn H. Kawasaki, Seattle, Wash.; Suppl. 1, 46, 1977. Leslie Bell, Princeton, N.J.; Meher Struhl et al. "Functional genetic expression of eukaryotic Irani, Seattle, Wash. DNA in Escherichia coli,” PNAS 73:1471-1475, 1976. Beach et al., "Functionally homologous cell cycle control 73 Assignee: ZymoGenetics, Inc., Seattle, Wash. genes in budding and fission yeast,” Nature 300:706-709, *) Notice: The term of this patent shall not extend 1982, beyond the expiration date of Pat. No. Jasin and Schimmel, "Delection of an Essential Gene in 5.527,668. Escherichia coli by Site-Specific Recombination with Lin ear DNA Fragments." J. Bact. 159:783-786, 1984. Maniatis, T. et al., Molecular Cloning. A laboratory (21) Appl. No.: 488,179 manual, Cold Springs Harbor Laboratory, 1982, p. 57. 22 Filed: Jun. 7, 1995 Hopwood, D.A. et al., Genetic manipulation of Streptomy ces: A Laboratory Manual. The John Innes Foundation. Related U.S. Application Data Norwich, 1985, pp. 112-113. Rodriguez, R.L. and R.C. Tait. Recombinant DNA Tech 63 Continuation of Ser. No. 293,568, Aug. 22, 1994, which is a continuation of Ser. No. 136,472, Oct. 12, 1993, aban niques: An Introduction, Addison-Wesley Publishing Com doned, which is a continuation of Ser. No. 587,613, Sep. 20, pany, Canada, 1983, pp. 27-29. 1990, abandoned, which is a continuation-in-part of Ser. No. Kuo and Campbell. "Cloning of Saccharomyces cerevisiae 734,119, May 15, 1985, abandoned, which is a continuation DNA Replication Genes Isolation of the CDC8Cene and in-part of Ser. No. 614,734, May 25, 1984, abandoned. Two Genes That Compensate for the cdc8-1 Mutation.” (51) Int. Cl. ..................................... C12P21/02 Mol, Cell. Biol. 3:1730-1737, 1983. (52) U.S. Cl. ............................ 435/6: 435/69.1; 435/71.1; Carter et al., “Genetic Control of Cell Proliferation' Yeast 435/171; 435/172.3; 435/254.2: 435/254.21; Genetics, Spencer et al. (Editors) Springer-Verlag, NY pp. 435/255.21 1-28, 1983. 58) Field of Search ............................ 435/171, 6, 171.1. Alber and Kawasaki, "Nucleotide Sequence of the Triose 435/69.1, 254.2, 254.21, 320.1. 172.3, 71.1, Phosphate Isomerase Gene of Saccharomyces cerevisiae,” J. 255.21; 536/232, 23.74 Mol. Appl. Gen. 1:419-434, 1982. Nasmyth and Reed, "Isolation of genes by complementation 56 References Cited in yeast: Molecular cloning of a cell-cycle gene." Proc. Natl. Acad. Sci. USA 77(4)21 19-2123, 1980. U.S. PATENT DOCUMENTS Arendes et al., "Yeast 2-um plasmid DNA replication in 4,237,244 I.2/1980 Cohen et al. .. ... 525/17 vitro: Purification of the CDC8 gen product by complemen 4,371,615 2/1983 Miwa et al. .... ... 435/1723 tation assay." Proc. Natl. Acad. Sci. USA 80:673–677, 1983. 4.506,013 3/1985 Hershberger et al. .................... 435/34 4.599,311 7/1986 Kawasaki ........... ... 435/69.2 Walsh et al., "Cloning of Genes That Complement Yeast 4.931,373 6/1990 Kawasaki et al. .. ... 435/69.2 Hexokinase and Glucokinase Mutants." J. Bact, 5,527,668 6/1996 Kawasaki et al. .......................... 435/6 154:1002-1004, 1983. Nurse and Bissett, "Gene required in G for commitment to FOREIGN PATENT DOCUMENTS cell cycle and in G for control omitosis in fission yeast." 0 100 561 A1 2/1984 European Pat. Off. ........ C12N 15/00 Nature 292:558-560, 1981. 0 184438A2 6/1986 European Pat. Off. ........ C12N 1500 (List continued on next page.) WO 86/03774 7/1986 WIPO ............................ C12N 1500 OTHER PUBLICATIONS Primary Examiner-James Ketter Nagley, P. et al. 1983 in. Manipulation and Expression of Assistant Examiner-Iran Yucel Genes in Furkayotes. Academic Press. New York. pp. Attorney, Agent, or Firm-Gary E. Parker 293-302. N. Pagratis pp. 5-9 and Pavlakis et al. pp. 29-38 in Current (57) ABSTRACT Communications in Mol. Biology. Miker et al (eds). 1987. Carrell et al., "Structure and Variation of Human o-Antit Methods are provided for producing protein products in host rypsin.” Nature 298:239-334, 1982. cells and for selecting transformed cells comprising the step Owen et al., “Mutation of Antitrypsin to Antithrombin." of transforming the host cell with a DNA molecule com New Eng. J. Med. 309:694-698, 1983. prising a gene which complements a deficiency in the host Cohen et al., “Functional expression in yeast of the Escheri cell. The host cell is s strain having a deficiency in a function chia coli plasmid gene coding for chloramphenicol acetyl necessary for normal cell growth. The gene in the DNA transferase,” PNAS 77: 1078-1082, 1980. molecule, such as a plasmid, which complements the defi Dickson. "Expression of a foreign eukaryotic gene in Sac ciency serves as a selection marker whereby the growth charomyces cerevisiae: 3-galactosidase from Kluyveromy conditions for selection may comprise a conventional com ces lactis,' Gene 10:347-356, 1980. plex medium. Carbon et al., “The Expression of Yeast DNAin Escherichia coli,” Ninth Miami Winter Symposia 13/14:59–72, 1977. 20 Claims, 21 Drawing Sheets 5,723,292 Page 2 OTHER PUBLICATIONS Ilgen et al., "Transformation of Yeast." Genetic Engineer ing: Principles and Methods 1:117-132, 1979. Suggs et al., "Use of synthetic oligonucleotides as hybrid Hsiao and Carbon. "High-frequency transformation of yeast ization probes: Isolation of cloned cDNA sequences for by plasmids containing the cloned yeat ARG4 gene." PNAS human B-microglobulin." PNAS USA 78(11):6613-6617, USA 76(8):3829-3833. 1979. 1981. Carbon et al. "The Isolation and Charcterization of Specific Bollen et al., "Cloning and Expression in Escherichia coli of Gene Sysstems from the Yeast, Saccharomyces cerevisiae,” Full-Length Complementary DNA Coding for Human Biochem. and Gene. of Yeasts 425-443, 1978. o-Antitrypsin." DNA 2:255-264, 1983. Banks, "Transformation of Ustilago maydis by a Plasmid Das and Hollenberg, "A High-Frequency Transformation Containing Yeast 2-Micron DNA." Current Genetics System for the Yeast Kluyveromyces lactis,” Current Genet 7:73-77, 1983. ics 6:123-128, 1982. Berse et al. "Cloning and characterization of the ornithine Williamson et al. "Isolation of the structural gene for carbamoyltransferase gene from Aspergillus nidulans,” alcohol dehydrogenase by genetic complementation in Gene 25:109-117, 1983. yeast." Nature 283:214-216, 1980. Russell, "Evolutionary divergence of the mRNA transcrip Henikoff et al., "Isolation of a gene from Drosophila by tion initiation mechanism in yeast." Nature 301:167-169, complementation in yeast." Nature 289:33-37, 1981. 1983. Bennetzen, "An Analysis of Gene Structure and Expression Russel, "Transcription of the triose-phosphate-isomerase in the Yeast Saccharomyces cerevisiae,' Doctoral disserta gene of Schizosaccharomyces pombe initiates from a start tion, p. 118, University of Washington, 1980. point different from that in Saccharomyces cerevisiae,” Hartwell et al., "Genetic Control of the Cell Division Cycle Gene 40:125-130, 1985. in Yeast: V. Genetic Analysis of cdc Mutants." Genetics Rothstein, "One-Step Gene Disruption in Yeast," Meth, in 74:267-286, 1973. Enz. 101:202-211, 1983. Gleeson et al., "Transformation of the Methylotrophic Yeast Clarke and Carbon. "Functional Expression of Cloned Yeast Hansenula polymorpha,” J. of Gen. Micro. 132:3459-3465, DNA in Escherichia coli: Specific Complementation of 1986. Argininosuccinate Lyase (argh) Mutations." J. Mol. Biol. Stinchcomb et al., "Centromerie DNA from Saccharomyces 120:517-532, 1978. cerevisiae,' J. Mol. Biol. 158:157-179, 1982. U.S. Patent Mar. 3, 1998 Sheet 1 of 21 5,723,292 Cla. I Hinc II Hinc II End III Hind III CDC4 LICATE TO Hind III - CUT pBR322 LINKER ADDITION ! LICATE TO Bam-I - CUT YRp 7 RE-CIRCULARIZE dil, LARCE FRACHENT Eco RI Bum H + End III Hind IIIag\Bam HI LICATE TO UC4 Bom HI, Hind III - CUT pBR322 Bam H. Hind III E CDC4 9ig. 1. U.S. Patent Mar. 3, 1998 Sheet 2 of 21 5,723,292 EcoRI - PARTIAL Kerol) U.S. Patent Mar. 3, 1998 Sheet 3 of 21 5,723,292 Hinc II . Cla. lSindSYCla. I I Bon II Bam H. Bom BI Cla. I Bam H. Hine II Hird III Bin H CDC4 Cla. I LICATE TO Bam II - CUT pUC13 SR LNER ADDITION is a --cotRNSFORANTS ADD LEU2 b c d e f g h FROM YEp13 o o o o Bgl. II Byl II Bam II U.S. Patent Mar. 3, 1998 Sheet 4 of 21 5,723,292 SEQUENCE COMPARISON OF S. POMBE AND S. CEREVISIAE GENES FOR TRIOSE PHOSPHATE SOMERASE (POT1 AND TPI)) -50 -140 - 30 - 20 - 10 - OO S. Pombe GGATCCATGCCAACGGTTGCTATCGACGGGGTAAATTGCCGAAGCTCGGTAATTCCCCT S. cerevisiae AATTTAGGAGTTTAGTGAACTTGCAACATTTACTATTTTCCCTTCTTACGTAAAIATTT -90 -80 -70 a-60 -50 -40 S. Pombe AACTGTGTGACGTCCGCTACCTATATATAATGACCCGACGGGCCAACTCTCCTCTC S. cerevisiae TTCTTTTTAATTCTAAATCAATCTTTTTCAATTTTTTGTTTGTATTCTTTTCTTCCTTA -30 -2O - O - 10 S. Pombe TCCCCAACTACATTCAATAGTAGAACTAGGATCAAA ATG GCA CGT AAA TTC S. cerevisiae AATCTATAACTACAAAAAACACATACATAAACTAAAA ATG CCT AGA ACT TTC S. pombe ME ALA ARG LYS PHE S. cerevisiae (Met) Thr 20 30 40 SO 6O S. pombe TTT GTC GGT GGT AAC TTT AAG ATC AAT CCC TCT TTG GAG TCC ATG S. cerevisiae TTT GTC GGT CGT AAC TTT AAA TIA AAC GGT TCC AAA CAA TCC ATT S. pombe PHE WAL GLY GLY ASN PHE LYS MET ASN GLY SER LEU CLU SER MET S. cerevisiae Leu Lys Clin le 70 80 90 OO S. pombe AAG ACT ATT ATT GAG GCT TG AAC ACC ACC AAG CT AAC GTT GGT S. cerevisiae AAG GAA ATT GTT GAA AGA TTG AAC ACT GCT TCT ATC CCA GAA AAT S.
Load more

Recommended publications
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • TPI1 Gene Triosephosphate Isomerase 1
    TPI1 gene triosephosphate isomerase 1 Normal Function The TPI1 gene provides instructions for making an enzyme called triosephosphate isomerase 1. This enzyme is involved in a critical energy-producing process known as glycolysis. During glycolysis, the simple sugar glucose is broken down to produce energy for cells. The triosephosphate isomerase 1 enzyme carries out a specific reaction during glycolysis: the conversion of a molecule called dihydroxyacetone phosphate (DHAP) to glyceraldehyde 3-phosphate. This conversion can go both ways, meaning that the triosephosphate isomerase 1 enzyme can also convert glyceraldehyde 3-phosphate back into DHAP. Additional steps convert glyceraldehyde 3-phosphate into other molecules that ultimately produce energy in the form of a molecule called ATP. For the triosephosphate isomerase 1 enzyme to be turned on (active), it has to attach ( bind) to another triosephosphate isomerase 1 enzyme, forming a two-enzyme complex called a dimer. Health Conditions Related to Genetic Changes Triosephosphate isomerase deficiency At least 12 mutations in the TPI1 gene have been found to cause triosephosphate isomerase deficiency. This condition is characterized by a shortage of red blood cells ( anemia), movement problems, increased susceptibility to infection, and muscle weakness that can affect breathing and heart function. TPI1 gene mutations can lead to the production of an enzyme with decreased activity. As a result, glycolysis is impaired and cells have a decreased supply of energy. One TPI1 gene mutation accounts for approximately 80 percent of triosephosphate isomerase deficiency cases. This change replaces the protein building block (amino acid) glutamic acid with the amino acid aspartic acid at position 104 in the triosephosphate isomerase 1 enzyme (written as Glu104Asp or E104D).
    [Show full text]
  • Candida Albicans and Candida Glabrata Triosephosphate Isomerase
    Satala et al. BMC Microbiology (2021) 21:199 https://doi.org/10.1186/s12866-021-02235-w RESEARCH Open Access Candida albicans and Candida glabrata triosephosphate isomerase – a moonlighting protein that can be exposed on the candidal cell surface and bind to human extracellular matrix proteins Dorota Satala1, Grzegorz Satala2, Marcin Zawrotniak3 and Andrzej Kozik1,4* Abstract Background: Triosephosphate isomerase (Tpi1) is a glycolytic enzyme that has recently been reported also to be an atypical proteinaceous component of the Candida yeast cell wall. Similar to other known candidal “moonlighting proteins”, surface-exposed Tpi1 is likely to contribute to fungal adhesion during the colonization and infection of a human host. The aim of our present study was to directly prove the presence of Tpi1 on C. albicans and C. glabrata cells under various growth conditions and characterize the interactions of native Tpi1, isolated and purified from the candidal cell wall, with human extracellular matrix proteins. Results: Surface plasmon resonance measurements were used to determine the dissociation constants for the complexes of Tpi1 with host proteins and these values were found to fall within a relatively narrow range of 10− 8- 10− 7 M. Using a chemical cross-linking method, two motifs of the Tpi1 molecule (aa 4–17 and aa 224–247) were identified to be directly involved in the interaction with vitronectin. A proposed structural model for Tpi1 confirmed that these interaction sites were at a considerable distance from the catalytic active site. Synthetic peptides with these sequences significantly inhibited Tpi1 binding to several extracellular matrix proteins suggesting that a common region on the surface of Tpi1 molecule is involved in the interactions with the host proteins.
    [Show full text]
  • Degradation of Functional Triose Phosphate Isomerase Protein Underlies Sugarkill Pathology
    Copyright Ó 2008 by the Genetics Society of America DOI: 10.1534/genetics.108.087551 Degradation of Functional Triose Phosphate Isomerase Protein Underlies sugarkill Pathology Jacquelyn L. Seigle,1 Alicia M. Celotto1 and Michael J. Palladino2 Department of Pharmacology and Chemical Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261 and Pittsburgh Institute for Neurodegenerative Diseases, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15260 Manuscript received January 26, 2008 Accepted for publication April 12, 2008 ABSTRACT Triose phosphate isomerase (TPI) deficiency glycolytic enzymopathy is a progressive neurodegenerative condition that remains poorly understood. The disease is caused exclusively by specific missense mutations affecting the TPI protein and clinically features hemolytic anemia, adult-onset neurological impairment, degeneration, and reduced longevity. TPI has a well-characterized role in glycolysis, catalyzing the isom- erization of dihydroxyacetone phosphate (DHAP) to glyceraldehyde-3-phosphate (G3P); however, little is known mechanistically about the pathogenesis associated with specific recessive mutations that cause progressive neurodegeneration. Here, we describe key aspects of TPI pathogenesis identified using the TPIsugarkill mutation, a Drosophila model of human TPI deficiency. Specifically, we demonstrate that the mutant protein is expressed, capable of forming a homodimer, and is functional. However, the mutant protein is degraded by the 20S proteasome core leading to loss-of-function pathogenesis. LYCOLYTIC enzymopathies are devastating hu- instability of the protein homodimer, aberrant protein G man diseases that result from heritable mutations complexes, and/or a decrease in isomerase activity con- in genes encoding certain glycolytic enzymes. The un- tribute to pathogenesis of the disease (Olah et al. 2002; derlying pathogenesis of these diseases remains poorly Orosz et al.
    [Show full text]
  • Datasheet: VPA00146 Product Details
    Datasheet: VPA00146 Description: GOAT ANTI TPI1 Specificity: TPI1 Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse, Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Goat polyclonal antibody purified by affinity chromatography. Buffer Solution TRIS buffered saline Preservative 0.02% Sodium Azide (NaN ) 0.5 % BSA Stabilisers 3 Immunogen Peptide with the sequence C-LKPEFVDIINAKQ, from the C Terminus of the protein sequence. External Database Links UniProt: P60174 Related reagents Entrez Gene: 7167 TPI1 Related reagents Synonyms TPI Page 1 of 2 Specificity Goat anti Human TPI1 antibody recognizes triosephosphate isomerase, also known as TIM or triose-phosphate isomerase. Encoded by the TPI1 gene, this enzyme consists of two identical proteins and catalyzes the isomerization of glyceraldehydes 3-phosphate (G3P) and dihydroxy-acetone phosphate (DHAP) in glycolysis and gluconeogenesis.
    [Show full text]
  • A Bioinformatics Model of Human Diseases on the Basis Of
    SUPPLEMENTARY MATERIALS A Bioinformatics Model of Human Diseases on the basis of Differentially Expressed Genes (of Domestic versus Wild Animals) That Are Orthologs of Human Genes Associated with Reproductive-Potential Changes Vasiliev1,2 G, Chadaeva2 I, Rasskazov2 D, Ponomarenko2 P, Sharypova2 E, Drachkova2 I, Bogomolov2 A, Savinkova2 L, Ponomarenko2,* M, Kolchanov2 N, Osadchuk2 A, Oshchepkov2 D, Osadchuk2 L 1 Novosibirsk State University, Novosibirsk 630090, Russia; 2 Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk 630090, Russia; * Correspondence: [email protected]. Tel.: +7 (383) 363-4963 ext. 1311 (M.P.) Supplementary data on effects of the human gene underexpression or overexpression under this study on the reproductive potential Table S1. Effects of underexpression or overexpression of the human genes under this study on the reproductive potential according to our estimates [1-5]. ↓ ↑ Human Deficit ( ) Excess ( ) # Gene NSNP Effect on reproductive potential [Reference] ♂♀ NSNP Effect on reproductive potential [Reference] ♂♀ 1 increased risks of preeclampsia as one of the most challenging 1 ACKR1 ← increased risk of atherosclerosis and other coronary artery disease [9] ← [3] problems of modern obstetrics [8] 1 within a model of human diseases using Adcyap1-knockout mice, 3 in a model of human health using transgenic mice overexpressing 2 ADCYAP1 ← → [4] decreased fertility [10] [4] Adcyap1 within only pancreatic β-cells, ameliorated diabetes [11] 2 within a model of human diseases
    [Show full text]
  • A Methodological Approach for the Construction of a Radiation Hybrid Map of Bovine Chromosome 5
    Genetics and Molecular Biology, 27, 1, 22-32 (2004) Copyright by the Brazilian Society of Genetics. Printed in Brazil www.sbg.org.br Research Article A methodological approach for the construction of a radiation hybrid map of bovine chromosome 5 M. De Donato1,2*, R.A. Brenneman1,3*, D.M. Stelly5, J.E. Womack5 and J.F. Taylor1,6 1Texas A&M University, Department of Animal Science, College Station, USA. 2Present address: Departamento de Biomedicina, IIBCA, Universidad de Oriente, Venezuela. 3Present address: Omaha’s Henry Doorly Zoo, Omaha, USA. 4Laboratory of Plant Molecular Cytogenetics, Department of Soil and Crop Sciences, Texas A&M University, College Station, USA. 5Laboratory of Genetics, Department of Veterinary Pathobiology, Texas A&M University, College Station, USA. 6Present address: University of Missouri, Campus Drive, Columbia, USA. Abstract A bovine 5,000 rad WG-RH panel was used to construct an RH map of bovine chromosome 5 (BTA5). Twenty-one microsatellites and thirteen genes were scored in the panel using PAGE and radioactive labeling. Marker retention ranged from 8.9%-25.8% and averaged 17.8%. Pairwise locus analysis placed all markers in a single syntenic group with a LOD support of 4.0. At a LOD support of 8.0, a centromeric group of 23 syntenic markers was formed. Telomeric groups of 11 and 9 markers were assembled with a LOD support of 6.0 and 8.0, respectively. All markers were ordered by maximum likelihood methods using the program RHMAP. Only 13 markers were ordered with a LOD support of at least 3.0, while 25 and 29 markers were ordered with a support of at least 2.0 and 1.0, respectively.
    [Show full text]
  • Ncomms8838.Pdf
    ARTICLE Received 2 Feb 2015 | Accepted 17 Jun 2015 | Published 21 Jul 2015 DOI: 10.1038/ncomms8838 OPEN Functional genomics identifies negative regulatory nodes controlling phagocyte oxidative burst Daniel B. Graham1,2, Christine E. Becker3, Aivi Doan1, Gautam Goel3, Eduardo J. Villablanca1,2,3, Dan Knights4, Amanda Mok1, Aylwin C.Y. Ng1,5, John G. Doench1, David E. Root1, Clary B. Clish1 & Ramnik J. Xavier1,2,3,5,6 The phagocyte oxidative burst, mediated by Nox2 NADPH oxidase-derived reactive oxygen species, confers host defense against a broad spectrum of bacterial and fungal pathogens. Loss-of-function mutations that impair function of the Nox2 complex result in a life-threatening immunodeficiency, and genetic variants of Nox2 subunits have been implicated in pathogenesis of inflammatory bowel disease (IBD). Thus, alterations in the oxidative burst can profoundly impact host defense, yet little is known about regulatory mechanisms that fine-tune this response. Here we report the discovery of regulatory nodes controlling oxidative burst by functional screening of genes within loci linked to human inflammatory disease. Implementing a multi-omics approach, we define transcriptional, metabolic and ubiquitin-cycling nodes controlled by Rbpj, Pfkl and Rnf145, respectively. Furthermore, we implicate Rnf145 in proteostasis of the Nox2 complex by endoplasmic reticulum-associated degradation. Consequently, ablation of Rnf145 in murine macrophages enhances bacterial clearance, and rescues the oxidative burst defects associated with Ncf4 haploinsufficiency. 1 Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02142, USA. 2 Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02114, USA. 3 Center for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02114, USA.
    [Show full text]
  • A Curated Biochemical Pathways Database for the Laboratory Mouse Alexei V Evsikov, Mary E Dolan, Michael P Genrich, Emily Patek and Carol J Bult
    Open Access Software2009EvsikovetVolume al. 10, Issue 8, Article R84 MouseCyc: a curated biochemical pathways database for the laboratory mouse Alexei V Evsikov, Mary E Dolan, Michael P Genrich, Emily Patek and Carol J Bult Address: The Jackson Laboratory, Main Street, Bar Harbor, ME 04609, USA. Correspondence: Carol J Bult. Email: [email protected] Published: 14 August 2009 Received: 22 May 2009 Revised: 17 July 2009 Genome Biology 2009, 10:R84 (doi:10.1186/gb-2009-10-8-r84) Accepted: 14 August 2009 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2009/10/8/R84 © 2009 Evsikov et al,; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MouseCyc<p>MouseCyc database is a database of curated metabolic pathways for the laboratory mouse.</p> Abstract Linking biochemical genetic data to the reference genome for the laboratory mouse is important for comparative physiology and for developing mouse models of human biology and disease. We describe here a new database of curated metabolic pathways for the laboratory mouse called MouseCyc http://mousecyc.jax.org. MouseCyc has been integrated with genetic and genomic data for the laboratory mouse available from the Mouse Genome Informatics database and with pathway data from other organisms, including human. Rationale Biochemical interactions and transformations among organic The availability of the nearly complete genome sequence for molecules are arguably the foundation and core distinguish- the laboratory mouse provides a powerful platform for pre- ing feature of all organic life.
    [Show full text]
  • 9Kosinski Proof2
    Tested Studies for Laboratory Teaching Proceedings of the Association for Biology Laboratory Education Vol. 37, Article 9, 2016 An Introduction to Bioinformatics Robert J. Kosinski Department of Biological Sciences, 132 Long Hall, Clemson University, Clemson SC 29634- 0314 USA ([email protected]) This exercise is used in introductory biology for majors at Clemson University. Students download DNA and protein sequences from a Web site and apply common bioinformatics tools to identifying and researching them. The students identify a piece of a gene using BLAST, explore their gene’s genomic “neighborhood,” determine the percent of DNA that is transcribed in this neighborhood, identify a protein using BLAST, research this protein using UniProt, search for literature on the role of the protein in disease, and finally, determine if DNA isolates from a mass disease outbreak show evidence of bioterrorism. Keywords: bioinformatics, gene, protein, BLAST, GenBank, UniProt, PubMed, bioterrorism Introduction Each student is given a code letter (A-Q). Another code (Z) is not given to students because it is used as an Overview of the Laboratory example in the exercise. Each of these letters represents a This is a “dry lab” introduction to some common group of files. Using the Web site techniques in bioinformatics using DNA and protein files http://www.ableweb.org/volumes/vol−37/kosinski/bioinfo downloaded from a Clemson Web site. An older version rmatics.htm each student will download: of this laboratory has been used at Clemson for about 10 a) a fragment of human genomic DNA years, and was presented at ABLE in 2006. Aside from corrupted by sequencing ambiguities (Ns).
    [Show full text]
  • Skeletal Muscle Transcriptome in Healthy Aging
    ARTICLE https://doi.org/10.1038/s41467-021-22168-2 OPEN Skeletal muscle transcriptome in healthy aging Robert A. Tumasian III 1, Abhinav Harish1, Gautam Kundu1, Jen-Hao Yang1, Ceereena Ubaida-Mohien1, Marta Gonzalez-Freire1, Mary Kaileh1, Linda M. Zukley1, Chee W. Chia1, Alexey Lyashkov1, William H. Wood III1, ✉ Yulan Piao1, Christopher Coletta1, Jun Ding1, Myriam Gorospe1, Ranjan Sen1, Supriyo De1 & Luigi Ferrucci 1 Age-associated changes in gene expression in skeletal muscle of healthy individuals reflect accumulation of damage and compensatory adaptations to preserve tissue integrity. To characterize these changes, RNA was extracted and sequenced from muscle biopsies col- 1234567890():,; lected from 53 healthy individuals (22–83 years old) of the GESTALT study of the National Institute on Aging–NIH. Expression levels of 57,205 protein-coding and non-coding RNAs were studied as a function of aging by linear and negative binomial regression models. From both models, 1134 RNAs changed significantly with age. The most differentially abundant mRNAs encoded proteins implicated in several age-related processes, including cellular senescence, insulin signaling, and myogenesis. Specific mRNA isoforms that changed sig- nificantly with age in skeletal muscle were enriched for proteins involved in oxidative phosphorylation and adipogenesis. Our study establishes a detailed framework of the global transcriptome and mRNA isoforms that govern muscle damage and homeostasis with age. ✉ 1 National Institute on Aging–Intramural Research Program, National
    [Show full text]
  • Datasheet: MCA4180Z Product Details
    Datasheet: MCA4180Z Description: MOUSE ANTI HUMAN TPI1:Preservative Free Specificity: TPI1 Format: Preservative Free Product Type: Monoclonal Antibody Clone: 1D10-2E2 Isotype: IgG1 Quantity: 0.1 mg Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 0.1 - 10 ug/ml Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Suggested working dilutions are given as a guide only. It is recommended that the user titrates the product for use in their own system using appropriate negative/positive controls. Target Species Human Product Form Purified IgG - liquid Preparation Purified IgG prepared by affinity chromatography on Protein A Buffer Solution Phosphate buffered saline Preservative None present Stabilisers Approx. Protein Ig concentration 0.5 mg/ml Concentrations Immunogen Recombinant protein corresponding to aa 1-250 of human TPI1 External Database Links UniProt: P60174 Related reagents Entrez Gene: 7167 TPI1 Related reagents Synonyms TPI Page 1 of 3 Fusion Partners Spleen cells from BALB/c mice were fused with cells from the Sp2/0 myeloma cell line. Specificity Mouse anti Human TPI1 antibody, clone 1D10-2D2 recognizes human Triosephosphate isomerase, also known as TPI1 or TIM. TPI1 is a 286 amino acid enzyme with a predicted molecular mass of ~31 kDa involved in carbohydrate biosynthesis and degradation.
    [Show full text]