Overexpression of HOXB7 Protein Reduces Sensitivity of Oral Cancer Cells to Chemo-Radiotherapy

ORIGINAL ARTICLE Overexpression of HOXB7 protein reduces sensitivity of oral cancer cells to chemo-radiotherapy

Z Yuan1, D Chen2, X Chen1, H Yang1 and Y Wei1

The upregulation of homeobox-B7 (HOXB7) in cancers has been reported. However, its role in oral cancer progression remains to be investigated. In current study, our data revealed that reconstitution of HOXB7 expression by transient transfection resulted in increased cell growth, migration and invasion in vitro. In addition, apoptosis and clonogenic assay data showed that overexpression of HOXB7 decreased the sensitivity of oral cancer cells to vincristine-induced apoptosis of HSC-4 and KB/VCR cells. Furthermore, overexpression of HOXB7 promoted oral cancer cells' migration and invasion through activation of TGFβ2/SMAD3 signaling pathway. Moreover, forced expression of HOXB7 increased Bcl-2 to Bax ratio, which would promote cell survival and induce drug and radiotherapy resistance. Altogether, our ﬁndings support the role of HOXB7 in the progression of oral cancer. Therefore, HOXB7 potentially can be a therapeutic target for oral cancer.

Cancer Gene Therapy (2016) 23, 419–424; doi:10.1038/cgt.2016.55; published online 11 November 2016

INTRODUCTION survival analysis showed that patients whose tumors had high Oral squamous cell carcinoma (OSCC) is the sixth most commonly number of HOXB7-positive cells had a shortened overall 11,16,17 diagnosed cancer worldwide, especially in developing countries. survival. Altogether, those studies suggested that HOXB7 Annually, about 300 000 cases encounter this disease, accounting had an important role in the tumorigenesis of oral cancer. for 5.1% of the total new cancer cases. It represents 95% of all Although aberrant expression of HOXB7 has been associated head and neck cancers and with an increasing incidence over the with human oral cancer, studies examining the impact of HOXB7 last decade.1 Although the clinical diagnosis and management of on human oral cancer cell biology and its sensitivity to early-stage oral squamous carcinoma has improved significantly, conventional therapeutics are limited. In current study, we oral squamous carcinoma prognosis is still extremely poor.2 The investigated the effect of overexpression of HOXB7 on oral cancer 5-year survival rate has remained below 50% for patients cell behavior. Our data revealed that HOXB7 increases cell diagnosed with advanced stages.1,3 Therefore, novel insights are migration and invasion, and reduces sensitivity to chemo- required to better understand the mechanisms that contribute to radiotherapy. disease progression, in order to design improved therapies for patients with locally advanced oral cancer. HOXB7, a trihelical 60-amino-acid homeodomain encoded by a MATERIALS AND METHODS 180-bp DNA, is a newly identified member of the HOX gene family. Reagents and antibodies Within the HOX family, there are 39 HOX genes and is organized in Dulbecco’s modified Eagle’s medium and fetal bovine serum were four clusters (HOXA–HOXD) in human.4,5 HOX gene is highly obtained from Gibco (Carlsbad, CA, USA). Mouse anti-GPADH polyclonal expressed in embryonic tissues, and aberrant expression of the antibody (Lot#ab37168), rabbit anti-HOXB7 monoclonal antibody HOX genes is involved in carcinogenesis of colorectal, breast, (Lot#ab168466), mouse anti-Bcl-2 monoclonal antibody (Lot#ab694), – β prostate, pancreatic and oral cancers.6 9 Overexpression of HOXB7 mouse anti-Bax monoclonal antibody (Lot#ab75566), mouse anti-TGF 2 in these cancer patients is associated with a poor prognosis.10,11 In monoclonal antibody (Lot#ab36495), mouse anti-p-SMAD monoclonal antibody (Lot#ab118825) and rabbit anti-total SMAD monoclonal antibody addition, enforced HOXB7 expression promotes cell proliferation 12,13 (Lot#ab40854) were obtained from Abcam (Cambridge, UK). Goat anti- and angiogenesis. Furthermore, it has been reported that rabbit IgG IR Dye 800cw (Lot#C30626-03) and goat anti-mouse IgG IR Dye HOXB7 promotes several cancer cells' migration and invasion 800cw (Lot#C40528-02) were from Odyssey (LI-COR, Lincoln, NE, USA). through the activation of the classical TGFβ2/SMAD3 signaling Click-iT Edu imaging kit for microscopy was from Invitrogen (Carlsbad, CA, pathway.10,14,15 USA). Annexin V-FITC Apoptosis Detection was from Becton Dickinson Previous study found that HOXB7 was highly expressed in oral (Franklin Lakes, NJ, USA). cancer tissues (13/19 tissues) at III/IV clinical stages compared with the corresponding normal tissues. Overexpression of the HOXB7 Cell cultures and transfection gene in oral cancer induces proliferation and is associated with 11 Four human oral cancer cell lines KOSC-2, HSC-4, Ca9-22 and KB/VCR were poor prognosis. Oral cancers with high percent of HOXB7- obtained from Nanjing KeyGen Biotech Co, Ltd (Nanjing, China). These cells positive cells tended to be in advanced clinical stage (higher T were cultured in Dulbecco’s modified Eagle’s medium (Gibco) containing stage, positive lymph node metastasis and late disease stage), and 10% fetal bovine serum in a humidified atmosphere of 5% CO2 at 37 °C.

1Department of Blood Transfusion, Guangzhou First People's Hospital, Guangzhou Medical University, Guangzhou, China and 2Department of Radiology, Guangzhou First People's Hospital, Guangzhou Medical University, Guangzhou, China. Correspondence: Dr Y Wei, Department of Blood Transfusion, Guangzhou First People's Hospital, Guangzhou Medical University, Guangzhou 510180, China. E-mail: [email protected] Received 24 May 2016; revised 12 September 2016; accepted 19 September 2016; published online 11 November 2016 HOXB7; a therapeutic target for oral cancer Z Yuan et al 420 To generate HOXB7-overexpressing stable cell lines, 293T cells were co- infect different human oral cancer cell lines for 2 days, and then cells were transfected with retroviral constructs of pMSCV-HOXB7 along with the collected for RT-PCR and western blot analysis.9,18 To generate HOXB7- package system plasmids for 2 days. The supernatant was collected to overexpressing HSC-4 and KB/VCR cells, plasmid pBI-HOXB7-eGFP and the

Figure 1. Correlation between the HOXB7 level and the proliferation of oral cancer cells. (a) Quantiﬁcation of HOXB7 by western blot in human normal oral squamous epithelium cell (NOSEC) and four OSCC cell lines including KOSC-2, HSC-4, Ca9-22 and KB/VCR. (b) Semi-quantitative RT-PCR analysis and Western blot were used to assess the mRNA and protein levels of HOXB7 in HSC-4 and KB/VCR cells with or without forced expression of HOXB7 as described in Materials and methods section. (c) Total cell number assays. Cells were cultured, and cell number was counted every 12 h. Results represent mean ± s.e.m. n=3, **Po 0.01.

Figure 2. Forced expression of HOXB7 increases oral cancer cell migration and invasion. Statistical signiﬁcance was assessed by using an unpaired two-tailed Student’s t-test. Columns are the mean of triplicate experiments; bars, ± s.d. **Po0.001.

Figure 3. HOXB7 decreased sensitivity of oral cancer cells to vincristine-induced apoptosis of HSC-4 and KB/VCR cells. (a) Total cell number assays of oral cancer cells treated with and without vicristine (25 mol l − 1) for 24 h. (b) Quantification of apoptotic cell by flow cytometry. Statistical significance was assessed by using an unpaired two-tailed Student’s t-test. Columns are the mean of triplicate experiments; bars ± s.d. *Po0.05, **Po0.01.

empty vector were transfected into HSC-4 and KB/VCR cells. The Total cell number GFP-positive cells were sorted and used in the experiments. HSC-4 or KB/VCR cells (1 × 105) were seeded into 35 mm2 Falcon tissue culture dish in monolayers in 10% serum media in triplicate. On indicated days, cells were trypsinized, and cell number was determined using a RT-PCR and semi-quantitative RT-PCR hemocytometer. Total RNA was isolated using Trizol plus RNA Purification system as 19 previously described. DNase I treatment, total RNA to complementary Transwell assays DNA, PCR and quantitative PCR assays were performed as previously Invasion assays were carried out in Matrigel-based Transwell plates described. Gene expression analysis was performed as previously 21 20 essentially as described previously by Pelletier et al. with modifications. described. 4 Total RNA was isolated using Trizol Plus RNA Purification Kit (Invitrogen, Cells (5 × 10 ) were plated into the Matrigel-coated upper chambers of the Carlsbad, CA) as previously described.19 Semi-quantitative RT-PCR was 24-well Transwell plates (Corning Costar, Cambridge, MA, USA) with a pore μ fi performed using a Super Script One Step RT-PCR kit (Invitrogen, Carlsbad, size of 8 m. The lower compartments were lled with medium CA). Sequences of the nucleotide primers for RT-PCR were: GAPDH, forward supplemented with 20% fetal bovine serum. After 24 h of incubation, nucleotide primers for RT-PCR were 5′- GGCACAGTCAAGGCTGAGAATG-3′, the non-migrated cells on the upper surface of the membranes reverse nucleotide primers were 5′- ATGGTGGTGAAGACGCCAGTA′; were gently scraped with cotton swabs, and the migrated cells that had HOXB7, forward 5′-TACCCCTGGATGCGAAGCTC-3′ and reverse 5′-AATCTT invaded to the lower surface were stained with crystal violet and counted. GATCTGTCTTTCCGTGA-3′ (23 cycles). Amplified RT-PCR products were Cell migration assays were carried out in a similar way but without visualized on a 1.5% agarose gel. Matrigel.

Apoptosis assays by flow cytometry Western blot Phosphate-buffered saline–rinsed cells (106 per ml) were suspended in Oral cancer cells' lysates were separated by SDS–PAGE, blotted onto 500 μl binding buffer. After additing Annexin V-FITC (5 μl) and PI (5 μl), the nitrocellulose membranes and probed with specific primary antibodies samples were gently mixed and incubated for 10 min in the dark at room followed by incubating with goat anti-rabbit or mouse IgG IR Dye 800cw temperature. The flow cytometry analysis was carried out within 3 h. Data (1:15 000). Images were obtained with an Odyssey Imager (LI-COR). were analyzed using the Cell Quest software (Becton Dickinson, Mountain

Figure 4. HOXB7 reduces the sensitivity of oral cancer cells to radiation. (a) Clonogenic assays were conducted after radiation. Cells (500 per well) grown for 10–12 days were irradiated with indicated doses. (b) Clonogenic survival curves of HSC-4 and KB/VCR cells. Surviving fraction (SF) was determined as SF = PE (irradiated)/PE (control). (c) Cell viability assays. Cells were seeded in 96-well plates (n=6) and exposed to radiation with a metal wedge placed over the top of the chamber to achieve a gradient across the plate. Viability was assessed on day 7 using AlamarBlue. Results represent mean ± s.e.m. **Po0.01.

View, CA, USA). The same assay was used to measure spontaneous RESULTS apoptosis in freshly isolated cells. Correlation of HOXB7 expression with the proliferation of HSC-4 and KB/VCR cells Clonogenic assay Previous study reported that HOXB7 was overexpressed in most Clonogenic assay was performed as previously described.22 Cells were oral carcinoma tissues in comparison with normal oral mucosa plated in six-well plates at the indicated cell density in triplicate, and tissues.11,16,17 In current study, human normal oral squamous – cultured in 10% serum media for 10 14 days. Colonies were stained with epithelium cell (NOSEC) and four OSCC cell lines KOSC-2, HSC-4, 4 crystal violet, and colonies with 50 cells were counted and expressed as Ca9-22 and KB/VCR were tested for HOXB7 protein expression. plating efficiency (PE) % = (number of colonies/number of cells plated) × 100. For radiation studies, cells were plated at 500 cells per well and then Western blot data revealed that HOXB7 was detected in all the cell irradiated at the doses indicated. Surviving fraction (SF) was determined as lines (Figure 1a). SF = PE (irradiated)/PE (control). To further determine whether HOXB7 can promote proliferation in human oral cancer cells, HOXB7-expressing plasmids were Statistics transiently transfected into HSC-4 and KB/VCR cells. Semi- quantitative RT-PCR and Western blot were performed to examine All graphs were generated using Prism 4 (GraphPad Software, Inc., CA, USA). Statistical significance was assessed by using an unpaired two-tailed the expression of HOXB7 (Figure 1b). In addition, overexpression Student’s t-test (Po0.05 was considered as significant) using SPSS 18.0. of HOXB7 promoted proliferation of HSC-4 and KB/VCR cells, and (SPSS, Inc., Chicago, IL, USA) Columns are the mean of triplicate the number of HSC-4 and KB/VCR cells increased by 1.48- and experiments; bars ± s.d. *Po0.05, **Po0.01. 1.37-fold, respectively, after 48 h (Figure 1c).

Cancer Gene Therapy (2016), 419 – 424 © 2016 Nature America, Inc., part of Springer Nature. HOXB7; a therapeutic target for oral cancer Z Yuan et al 423 forced expression of HOXB7 resulted in a small increase in the regrowth of cells following radiation particularly in the HSC-4 cell line (HSC-4-vector vs HSC-4-HOXB7 1–7Gy; KB/VCR-vector vs KB/ VCR-HOXB7 1–7Gy, all Po0.01; Figure 4c).

Overexpression of HOXB7 promoted oral cancer cell migration and invasion via TGFβ2/SMAD3 -Signaling pathway and increased the ratio of Bcl-2 to Bax Previous study found that TGFβ2 induction is critical for HOXB7- mediated cancer cell migration and invasion. HOXB7 directly binds to TGFβ2 promoter and upregulates its transcriptional activity.10,23,24 By western blot, data revealed that overexpression of HOXB7 was accompanied by activation of TGFβ2 and SMAD3 signaling pathway (Figure 5). Similar results were obtained in KB/VCR cells (Figure 5). In addition, overexpression of HOXB7 led to increased Bcl-2, whereas pro-apoptotic Bax levels were not altered. A rise in the Bcl-2-to-Bax ratio with forced expression of HOXB7 provides evidence that overexpression of HOXB7 inhibited Figure 5. Western blot analyze the efficiency of HOXB7 overexpression in HOXB7-overexpressing oral cancer cell lines. The oral apoptosis and enhanced their oncogenic characteristics. cancer cells were harvested and lysed and equal amounts of extracted protein were analyzed for Bax, Bcl-2, HOXB7, TGFβ2, p-SMAD3 and SMAD3 expression by western blot. DISCUSSION This study contributes to our understanding of the molecular mechanism by which overexpression of HOXB7 in oral cancers promotes tumor progression and is associated with poor Forced expression of HOXB7 increased the migration and invasion prognosis. The presented data showed that forced expression of of oral cancer cells HOXB7 promoted cell proliferation and reduced apoptotic oral Transwell assays showed that forced expression of HOXB7 in cancer cells. We also observed that overexpression of HOXB7 o HSC-4 and KB/VCR cells resulted in a 2.2- (P 0.01) and 1.9-fold reduced the sensitivity of oral cancer cells to chemo as well as o (P 0.01) increase of cell migration, respectively, compared with radiotherapy and increased the expression of anti-apoptotic that of the control cells (Figure 2). Moreover, we found that forced protein BCL2. As predicted, overexpression of HOXB7 was expression of HOXB7 increased the ability to penetrate and accompanied by increased TGFβ2 and phosphorylatedSMAD3. migrate in two-dimensional Matrigel compared with that of the Together, the results suggest that HOXB7 promotes oral cancer vector cells (1.9- and 1.7-fold increase, respectively, all Po0.01. cell migration and invasion by activation of TGFβ2/SMAD3 Figure 2). signaling pathway. Deregulation of HOXB7 has been observed in esophageal Overexpression of HOXB7 decreased the sensitivity of oral cancer squamous cell carcinoma, oral cancer, ovarian carcinoma and cells to vincristine and inhibits HSC-4 and KB/VCR cell apoptosis breast cancer.24,25 In addition, it has been reported that increased Following vincristine (VCR, 25 mol l − 1) treatment for 24 h, the expression of HOXB7 was closely associated with tumor cell 12,13,25 number of the HSC-4-HOXB7 cells was significantly higher than proliferation, invasion and metastasis. In OSCCs, the number of HOXB7-positive cells was significantly higher than that of that of vector-transfected HSC-4 cells. Similar results were 11 obtained in KB/VCR cells shown in Figure 3a. By apoptosis assays, controls. The presenast study extends these observations we further found that overexpression of HOXB7 inhibited the showing that HOXB7 can be detected in four OSCC cell lines. apoptosis of oral cancer cells. Compared with HSC-4-vector and Cell proliferation assays by BrdU incorporation and Ki67 expression show that HOXB7 overexpression promotes a proliferative KB/VCR-vector cells, respectively, the percentage of apoptosis cells 11,17 in HOXB7-overexpressed HSC-4 and KB/VCR cells was significantly phenotype of OSCC cells. In this study, our results show that reduced (19.77% for HSC-4-HOXB7 cells vs 35.17% for HSC-4- overexpression of HOXB7 promoted growth and proliferation in vector cells, Po0.01; 13.48% for HSC-4-HOXB7 cells vs 26.92% for both oral cancer cell lines (HSC-4 and KB/VCR cells), which was HSC-4-vector cells, Po0.01; Figure 3b). Taken together, over- consistent with earlier report. expression of HOXB7 decreased the sensitivity of oral cancer cells HOXB7, a transcriptional factor, has been shown to promote cell migration and invasion, and induce EMT and angiogenesis in to VCR and inhibits HSC-4-HOXB7 and KB/VCR-HOXB7 cells' 26,27 apoptosis. various cell lines. HOXB7 may directly or indirectly regulate the transcription of target genes. TGFβ2 is one of the important HOXB7 target genes critical for HOXB7 to mediate its migration Overexpression of HOXB7 in HSC-4 and KB/VCR cell lines reduced and invasion property. HOXB7 may directly bind to the TGFβ2 sensitivity to ionizing radiation promoter and upregulate its transcription activity.23,24 Forced Clonogenic assay data showed that ionizing radiation significantly expression of HOXB7 increased migration and invasion in both decreased the number of colonies formed by HSC-4 cells. OSCC cell lines. Overexpression of HOXB7 was accompanied with However, overexpression of HOXB7 increased the colon number increasing expression of TGFβ2 protein and phosphorylation level compared with that in the control cells (22.8% for HSC-4-vector of SMAD3, which indicated that HOXB7 may promote cell cells vs 33.2% for HSC-4-HOXB7; Po0.01; Figure 4a). Similar migration and invasion via the TGFβ2/SMAD3 signaling pathway results were obtained for KB/VCR cells (15.5% for KB/VCR-vector in the studied OSCC cell lines. cells vs 27.8% for KB/VCR-HOXB7; all Po0.01; Figure 4a). In Another interesting finding is that overexpression of HOXB7 in addition, overexpression of HOXB7 increased the surviving HSC-4 and KB/VCR cell lines reduces sensitivity to chemo- fraction of oral cancer cells following radiation (HSC-4-vector vs radiotherapy-induced apoptosis. Overexpression of HOXB7 was HSC-4-HOXB7 1–5Gy; KB/VCR-vector vs KB/VCR-HOXB7 1–5Gy, all accompanied by reduced BCL2 and increased BAX. The ratio of Po0.01; Figure 4b). Moreover, cell viability assays showed that anti- and pro-apoptotic members within the Bcl-2 family has an

© 2016 Nature America, Inc., part of Springer Nature. Cancer Gene Therapy (2016), 419 – 424 HOXB7; a therapeutic target for oral cancer Z Yuan et al 424 28,29 important role to determine the cell fate. Increased Bax, which 13 Jin K, Sukumar S. A pivotal role for HOXB7 protein in endocrine resistant triggers caspase-mediated apoptosis, increases the sensitivity of breast cancer. Oncoscience 2015; 2:917–919. malignant cancer cells to chemicals.30,31 However, increased BCL2 14 Chen H, Lee JS, Liang X, Zhang H, Zhu T, Zhang Z et al. Hoxb7 inhibits transgenic or reduced BAX promotes cell survival and causes chemo and HER-2/neu-induced mouse mammary tumor onset but promotes progression and – radiotherapy resistance.32–34 Therefore, it is highly likely that these lung metastasis. Cancer Res 2008; 68: 3637 3644. 15 Siegel PM, Shu W, Cardiff RD, Muller WJ, Massague J. Transforming growth factor proteins are involved in chemo-radiotherapy resistance of beta signaling impairs Neu-induced mammary tumorigenesis while promoting OSCC cells. pulmonary metastasis. Proc Natl Acad Sci USA 2003; 100:8430–8435. In summary, this study for the first time reveals that the 16 Marcinkiewicz KM, Gudas LJ. Altered histone mark deposition and dna overexpression of HOXB7 in HSC-4 and KB/VCR cells reduces the methylation at homeobox genes in human oral squamous cell carcinoma cells. sensitivity of the cells to chemo-radiotherapy-induced apoptosis J Cell Physiol 2014; 229: 1405–1416. and promotes oral cancer cell migration and invasion via 17 Marcinkiewicz KM, Gudas LJ. Altered epigenetic regulation of homeobox genes in – upregulation of TGFβ2. Our results would be helpful for further human oral squamous cell carcinoma cells. Exp Cell Res 2014; 320: 128 143. studies to elucidate the molecular functions of HOXB7 in 18 Heinonen H, Lepikhova T, Sahu B, Pehkonen H, Pihlajamaa P, Louhimo R et al. Identification of several potential chromatin binding sites of HOXB7 and its anticancer drug based concurrent radiotherapy resistance and to downstream target genes in breast cancer. Int J Cancer 2015; 137: 2374–2383. predict their therapeutic potentials. 19 Pandey V, Wu ZS, Zhang M, Li R, Zhang J, Zhu T et al. Trefoil factor 3 promotes metastatic seeding and predicts poor survival outcome of patients with mammary carcinoma. Breast Cancer Res 2014; 16: 429–449. CONFLICT OF INTEREST 20 Pandey V, Qian PX, Kang J, Perry JK, Mitchell MD, Yin Z et al. Artemin stimulates The authors declare no conflict of interest. oncogenicity and invasiveness of human endometrial carcinoma cells. Endocri- nology 2010; 151: 909–920. 21 Pelletier AJ, Kunicki T, Quaranta V. Activation of the integrin alpha v beta 3 ACKNOWLEDGEMENTS involves a discrete cation-binding site that regulates conformation. J Biol Chem 1996; 271:1364–1370. This study was supported by research funds from the Guangzhou Science and 22 Perera O, Evans A, Pertziger M, MacDonald C, Chen H, Liu DX et al. Trefoil factor 3 Technology Project of Pharmaceutical Health (20141A011010 and 20161A011010). (TFF3) enhances the oncogenic characteristics of prostate carcinoma cells and We thank Prof. Yu-Jui Yvonne Wan for critically reading the manuscript and for their reduces sensitivity to ionising radiation. Cancer Lett 2015; 361: 104–111. insightful suggestions. 23 Yu Q, Stamenkovic I. Transforming growth factor-beta facilitates breast carcinoma metastasis by promoting tumor cell survival. Clin Exp Metastasis 2004; 21: 235–242. REFERENCES 24 Wakefield LM, Piek E, Bottinger EP. TGF-beta signaling in mammary gland 1 Parkin D, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin development and tumorigenesis. J Mammary Gland Biol Neoplasia 2001; 2005; 55:74–108. 6:67–82. 2 Wang Q, Gao P, Wang X, Duan Y. Investigation and identification of potential 25 Care A, Silvani A, Meccia E, Mattia G, Stoppacciaro A, Parmiani G et al. HOXB7 biomarkers in human saliva for the early diagnosis of oral squamous cell constitutively activates basic fibroblast growth factor in melanomas. Mol Cell Biol. carcinoma. Clin Chim Acta 2014; 427:79–85. 1996; 16: 4842–4851. 3 Dissanayaka WL, Pitiyage G, Kumarasiri PV, Liyanage RL, Dias KD, Tilakaratne WM. 26 Care A, Silvani A, Meccia E, Mattia G, Peschle C, Colombo MP. Transduction of the Clinical and histopathologic parameters in survival of oral squamous cell SkBr3 breast carcinoma cell line with the HOXB7 gene induces bFGF expression, carcinoma. Oral Surg Oral Med Oral Pathol Oral Radiol 2012; 113:518–525. increases cell proliferation and reduces growth factor dependence. Oncogene 4 Nguyen Kovochich A, Arensman M, Lay AR, Rao NP, Donahue T, Li X et al. HOXB7 1998; 16: 3285–3289. promotes invasion and predicts survival in pancreatic adenocarcinoma. Cancer 27 Care A, Felicetti F, Meccia E, Bottero L, Parenza M, Stoppacciaro A et al. HOXB7: a 2013; 119: 529–539. key factor for tumor-associated angiogenic switch. Cancer Res 2001; 61: 5 Cantile M, Pettinato G, Procino A, Feliciello I, Cindolo L, Cillo C. In vivo expression 6532–6539. of the whole HOX gene network in human breast cancer. Eur J Cancer 2003; 39: 28 Yuan Z, Wang H, Hu Z, Huang Y, Yao F, Sun S et al. Quercetin inhibits proliferation 257–264. and drug resistance in KB/VCR oral cancer cells and enhances its sensitivity to 6 Chen KN, Gu ZD, Ke Y, Li JY, Shi XT, Xu GW. Expression of 11 HOX genes is vincristine. Nutr Cancer 2015; 67: 126–136. deregulated in esophageal squamous cell carcinoma. Clin Cancer Res 2005; 11: 29 Daniel PT. Dissecting the pathways to death. Leukemia 2000; 14: 2035–2044. 1044–1049. 30 Bargou RC, Wagener C, Bommert K, Mapara MY, Daniel PT et al. Overexpression of 7 De Souza Setubal Destro MF, Bitu CC, Zecchin KG, Graner E, Lopes MA, Kowalski LP the death-promoting gene bax-alpha which is downregulated in breast cancer et al. Overexpression of HOXB7 homeobox gene in oral cancer induces cellular restores sensitivity to different apoptotic stimuli and reduces tumor growth in proliferation and is associated with poor prognosis. Int J Oncol 2010; 36:141–149. SCID mice. J Clin Invest 1996; 97: 2651–2659. 8 Naora H, Yang YQ, Montz FJ, Seidman JD, Kurman RJ, Roden RB. A serologically 31 Radetzki S, Köhne CH, von Haefen C, Gillissen B, Sturm I, Dörken B et al. identified tumor antigen encoded by a homeobox gene promotes growth of Theapoptosis promoting Bcl-2 homologues Bak and Nbk/Bik overcome drug ovarian epithelial cells. Proc Natl Acad Sci USA 2001; 98: 4060–4065. resistance in Mdr1-negative and Mdr-1-overexpressing breast cancer cell lines. 9 Wu X, Chen H, Parker B, Rubin E, Zhu T, Lee JS et al. HOXB7, a homeodomain Oncogene 2002; 21:227–238. protein, is overexpressed in breast cancer and confers epithelial-mesenchymal 32 Miyashita T, Reed JC. Bcl-2 oncoprotein blocks chemotherapy-induced apoptosis transition. Cancer Res 2006; 66: 9527–9534. in a human leukemia cell line. Blood 1993; 81:151–157. 10 Liu S, Jin K, Hui Y, Fu J, Jie C, Feng S et al. HOXB7 promotes malignant progression 33 Aneja R, Zhou J, Zhou B, Chandra R, Joshi HC. Treatment of hormone-refractory by activating the TGFβ signaling pathway. Cancer Res 2015; 75: 709–719. breast cancer: Apoptosis and regression of human tumors implanted in mice. 11 Destro MF, Setubal De Souza, Bitu CC, Zecchin KG, Graner E, Lopes MA et al. Mol Cancer Ther 2006; 5: 2366–2377. Overexpression of HOXB7 homeobox gene in oral cancer induces cellular 34 Lotem J, Sachs L. Regulation by bcl-2, c-myc, and p53 of susceptibility to induc- proliferation and is associated with poor prognosis. Int J Oncol 2010; 36:141–149. tion of apoptosis by heat shock and cancer chemotherapy compounds in 12 Ma R, Zhang D, Hu P, Li Q, Lin C. HOXB7-S3 inhibits the proliferation and invasion differentiation-competent and -defective myeloid leukemic cells. Cell Growth of MCF-7 human breast cancer cells. Mol Med Rep 2015; 12: 4901–4908. Differ 1993; 4:41–47.