DOCSLIB.ORG

Overexpression of HOXB7 Protein Reduces Sensitivity of Oral Cancer Cells to Chemo-Radiotherapy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Overexpression of HOXB7 Protein Reduces Sensitivity of Oral Cancer Cells to Chemo-Radiotherapy Cancer Gene Therapy (2016) 23, 419–424 © 2016 Nature America, Inc., part of Springer Nature. All rights reserved 0929-1903/16 www.nature.com/cgt ORIGINAL ARTICLE Overexpression of HOXB7 protein reduces sensitivity of oral cancer cells to chemo-radiotherapy Z Yuan1, D Chen2, X Chen1, H Yang1 and Y Wei1 The upregulation of homeobox-B7 (HOXB7) in cancers has been reported. However, its role in oral cancer progression remains to be investigated. In current study, our data revealed that reconstitution of HOXB7 expression by transient transfection resulted in increased cell growth, migration and invasion in vitro. In addition, apoptosis and clonogenic assay data showed that overexpression of HOXB7 decreased the sensitivity of oral cancer cells to vincristine-induced apoptosis of HSC-4 and KB/VCR cells. Furthermore, overexpression of HOXB7 promoted oral cancer cells' migration and invasion through activation of TGFβ2/SMAD3 signaling pathway. Moreover, forced expression of HOXB7 increased Bcl-2 to Bax ratio, which would promote cell survival and induce drug and radiotherapy resistance. Altogether, our findings support the role of HOXB7 in the progression of oral cancer. Therefore, HOXB7 potentially can be a therapeutic target for oral cancer. Cancer Gene Therapy (2016) 23, 419–424; doi:10.1038/cgt.2016.55; published online 11 November 2016 INTRODUCTION survival analysis showed that patients whose tumors had high Oral squamous cell carcinoma (OSCC) is the sixth most commonly number of HOXB7-positive cells had a shortened overall 11,16,17 diagnosed cancer worldwide, especially in developing countries. survival. Altogether, those studies suggested that HOXB7 Annually, about 300 000 cases encounter this disease, accounting had an important role in the tumorigenesis of oral cancer. for 5.1% of the total new cancer cases. It represents 95% of all Although aberrant expression of HOXB7 has been associated head and neck cancers and with an increasing incidence over the with human oral cancer, studies examining the impact of HOXB7 last decade.1 Although the clinical diagnosis and management of on human oral cancer cell biology and its sensitivity to early-stage oral squamous carcinoma has improved significantly, conventional therapeutics are limited. In current study, we oral squamous carcinoma prognosis is still extremely poor.2 The investigated the effect of overexpression of HOXB7 on oral cancer 5-year survival rate has remained below 50% for patients cell behavior. Our data revealed that HOXB7 increases cell diagnosed with advanced stages.1,3 Therefore, novel insights are migration and invasion, and reduces sensitivity to chemo- required to better understand the mechanisms that contribute to radiotherapy. disease progression, in order to design improved therapies for patients with locally advanced oral cancer. HOXB7, a trihelical 60-amino-acid homeodomain encoded by a MATERIALS AND METHODS 180-bp DNA, is a newly identified member of the HOX gene family. Reagents and antibodies Within the HOX family, there are 39 HOX genes and is organized in Dulbecco’s modified Eagle’s medium and fetal bovine serum were four clusters (HOXA–HOXD) in human.4,5 HOX gene is highly obtained from Gibco (Carlsbad, CA, USA). Mouse anti-GPADH polyclonal expressed in embryonic tissues, and aberrant expression of the antibody (Lot#ab37168), rabbit anti-HOXB7 monoclonal antibody HOX genes is involved in carcinogenesis of colorectal, breast, (Lot#ab168466), mouse anti-Bcl-2 monoclonal antibody (Lot#ab694), – β prostate, pancreatic and oral cancers.6 9 Overexpression of HOXB7 mouse anti-Bax monoclonal antibody (Lot#ab75566), mouse anti-TGF 2 in these cancer patients is associated with a poor prognosis.10,11 In monoclonal antibody (Lot#ab36495), mouse anti-p-SMAD monoclonal antibody (Lot#ab118825) and rabbit anti-total SMAD monoclonal antibody addition, enforced HOXB7 expression promotes cell proliferation 12,13 (Lot#ab40854) were obtained from Abcam (Cambridge, UK). Goat anti- and angiogenesis. Furthermore, it has been reported that rabbit IgG IR Dye 800cw (Lot#C30626-03) and goat anti-mouse IgG IR Dye HOXB7 promotes several cancer cells' migration and invasion 800cw (Lot#C40528-02) were from Odyssey (LI-COR, Lincoln, NE, USA). through the activation of the classical TGFβ2/SMAD3 signaling Click-iT Edu imaging kit for microscopy was from Invitrogen (Carlsbad, CA, pathway.10,14,15 USA). Annexin V-FITC Apoptosis Detection was from Becton Dickinson Previous study found that HOXB7 was highly expressed in oral (Franklin Lakes, NJ, USA). cancer tissues (13/19 tissues) at III/IV clinical stages compared with the corresponding normal tissues. Overexpression of the HOXB7 Cell cultures and transfection gene in oral cancer induces proliferation and is associated with 11 Four human oral cancer cell lines KOSC-2, HSC-4, Ca9-22 and KB/VCR were poor prognosis. Oral cancers with high percent of HOXB7- obtained from Nanjing KeyGen Biotech Co, Ltd (Nanjing, China). These cells positive cells tended to be in advanced clinical stage (higher T were cultured in Dulbecco’s modified Eagle’s medium (Gibco) containing stage, positive lymph node metastasis and late disease stage), and 10% fetal bovine serum in a humidified atmosphere of 5% CO2 at 37 °C. 1Department of Blood Transfusion, Guangzhou First People's Hospital, Guangzhou Medical University, Guangzhou, China and 2Department of Radiology, Guangzhou First People's Hospital, Guangzhou Medical University, Guangzhou, China. Correspondence: Dr Y Wei, Department of Blood Transfusion, Guangzhou First People's Hospital, Guangzhou Medical University, Guangzhou 510180, China. E-mail: [email protected] Received 24 May 2016; revised 12 September 2016; accepted 19 September 2016; published online 11 November 2016 HOXB7; a therapeutic target for oral cancer Z Yuan et al 420 To generate HOXB7-overexpressing stable cell lines, 293T cells were co- infect different human oral cancer cell lines for 2 days, and then cells were transfected with retroviral constructs of pMSCV-HOXB7 along with the collected for RT-PCR and western blot analysis.9,18 To generate HOXB7- package system plasmids for 2 days. The supernatant was collected to overexpressing HSC-4 and KB/VCR cells, plasmid pBI-HOXB7-eGFP and the Figure 1. Correlation between the HOXB7 level and the proliferation of oral cancer cells. (a) Quantification of HOXB7 by western blot in human normal oral squamous epithelium cell (NOSEC) and four OSCC cell lines including KOSC-2, HSC-4, Ca9-22 and KB/VCR. (b) Semi-quantitative RT-PCR analysis and Western blot were used to assess the mRNA and protein levels of HOXB7 in HSC-4 and KB/VCR cells with or without forced expression of HOXB7 as described in Materials and methods section. (c) Total cell number assays. Cells were cultured, and cell number was counted every 12 h. Results represent mean ± s.e.m. n=3, **Po 0.01. Figure 2. Forced expression of HOXB7 increases oral cancer cell migration and invasion. Statistical significance was assessed by using an unpaired two-tailed Student’s t-test. Columns are the mean of triplicate experiments; bars, ± s.d. **Po0.001. Cancer Gene Therapy (2016), 419 – 424 © 2016 Nature America, Inc., part of Springer Nature. HOXB7; a therapeutic target for oral cancer Z Yuan et al 421 Figure 3. HOXB7 decreased sensitivity of oral cancer cells to vincristine-induced apoptosis of HSC-4 and KB/VCR cells. (a) Total cell number assays of oral cancer cells treated with and without vicristine (25 mol l − 1) for 24 h. (b) Quantification of apoptotic cell by flow cytometry. Statistical significance was assessed by using an unpaired two-tailed Student’s t-test. Columns are the mean of triplicate experiments; bars ± s.d. *Po0.05, **Po0.01. empty vector were transfected into HSC-4 and KB/VCR cells. The Total cell number GFP-positive cells were sorted and used in the experiments. HSC-4 or KB/VCR cells (1 × 105) were seeded into 35 mm2 Falcon tissue culture dish in monolayers in 10% serum media in triplicate. On indicated days, cells were trypsinized, and cell number was determined using a RT-PCR and semi-quantitative RT-PCR hemocytometer. Total RNA was isolated using Trizol plus RNA Purification system as 19 previously described. DNase I treatment, total RNA to complementary Transwell assays DNA, PCR and quantitative PCR assays were performed as previously Invasion assays were carried out in Matrigel-based Transwell plates described. Gene expression analysis was performed as previously 21 20 essentially as described previously by Pelletier et al. with modifications. described. 4 Total RNA was isolated using Trizol Plus RNA Purification Kit (Invitrogen, Cells (5 × 10 ) were plated into the Matrigel-coated upper chambers of the Carlsbad, CA) as previously described.19 Semi-quantitative RT-PCR was 24-well Transwell plates (Corning Costar, Cambridge, MA, USA) with a pore μ fi performed using a Super Script One Step RT-PCR kit (Invitrogen, Carlsbad, size of 8 m. The lower compartments were lled with medium CA). Sequences of the nucleotide primers for RT-PCR were: GAPDH, forward supplemented with 20% fetal bovine serum. After 24 h of incubation, nucleotide primers for RT-PCR were 5′- GGCACAGTCAAGGCTGAGAATG-3′, the non-migrated cells on the upper surface of the membranes reverse nucleotide primers were 5′- ATGGTGGTGAAGACGCCAGTA′; were gently scraped with cotton swabs, and the migrated cells that had HOXB7, forward 5′-TACCCCTGGATGCGAAGCTC-3′ and reverse 5′-AATCTT invaded to the lower surface were stained with crystal violet and counted. GATCTGTCTTTCCGTGA-3′ (23 cycles). Amplified RT-PCR products were Cell migration assays were carried out in a similar way but without visualized on a 1.5% agarose gel. Matrigel. Apoptosis assays by flow cytometry Western blot Phosphate-buffered saline–rinsed cells (106 per ml) were suspended in Oral cancer cells' lysates were separated by SDS–PAGE, blotted onto 500 μl binding buffer. After additing Annexin V-FITC (5 μl) and PI (5 μl), the nitrocellulose membranes and probed with specific primary antibodies samples were gently mixed and incubated for 10 min in the dark at room followed by incubating with goat anti-rabbit or mouse IgG IR Dye 800cw temperature.
Load more

Recommended publications
  • Overlap of Vitamin a and Vitamin D Target Genes with CAKUT- Related Processes [Version 1; Peer Review: 1 Approved with Reservations]
    F1000Research 2021, 10:395 Last updated: 21 JUL 2021 BRIEF REPORT Overlap of vitamin A and vitamin D target genes with CAKUT- related processes [version 1; peer review: 1 approved with reservations] Ozan Ozisik1, Friederike Ehrhart 2,3, Chris T Evelo 2, Alberto Mantovani4, Anaı̈s Baudot 1,5 1Aix Marseille University, Inserm, MMG, Marseille, 13385, France 2Department of Bioinformatics - BiGCaT, Maastricht University, Maastricht, 6200 MD, The Netherlands 3Department of Bioinformatics, NUTRIM/MHeNs, Maastricht University, Maastricht, 6200 MD, The Netherlands 4Istituto Superiore di Sanità, Rome, 00161, Italy 5Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain v1 First published: 18 May 2021, 10:395 Open Peer Review https://doi.org/10.12688/f1000research.51018.1 Latest published: 18 May 2021, 10:395 https://doi.org/10.12688/f1000research.51018.1 Reviewer Status Invited Reviewers Abstract Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) are a 1 group of abnormalities affecting the kidneys and their outflow tracts, which include the ureters, the bladder, and the urethra. CAKUT version 1 patients display a large clinical variability as well as a complex 18 May 2021 report aetiology, as only 5% to 20% of the cases have a monogenic origin. It is thereby suspected that interactions of both genetic and 1. Elena Menegola, Università degli Studi di environmental factors contribute to the disease. Vitamins are among the environmental factors that are considered for CAKUT aetiology. In Milano, Milan, Italy this study, we collected vitamin A and vitamin D target genes and Any reports and responses or comments on the computed their overlap with CAKUT-related gene sets.
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Spatiotemporal DNA Methylome Dynamics of the Developing Mouse Fetus
    Article Spatiotemporal DNA methylome dynamics of the developing mouse fetus https://doi.org/10.1038/s41586-020-2119-x Yupeng He1,2, Manoj Hariharan1, David U. Gorkin3, Diane E. Dickel4, Chongyuan Luo1, Rosa G. Castanon1, Joseph R. Nery1, Ah Young Lee3, Yuan Zhao2,3, Hui Huang3,5, Received: 9 August 2017 Brian A. Williams6, Diane Trout6, Henry Amrhein6, Rongxin Fang2,3, Huaming Chen1, Bin Li3, Accepted: 11 June 2019 Axel Visel4,7,8, Len A. Pennacchio4,7,9, Bing Ren3,10 & Joseph R. Ecker1,11 ✉ Published online: 29 July 2020 Open access Cytosine DNA methylation is essential for mammalian development but Check for updates understanding of its spatiotemporal distribution in the developing embryo remains limited1,2. Here, as part of the mouse Encyclopedia of DNA Elements (ENCODE) project, we profled 168 methylomes from 12 mouse tissues or organs at 9 developmental stages from embryogenesis to adulthood. We identifed 1,808,810 genomic regions that showed variations in CG methylation by comparing the methylomes of diferent tissues or organs from diferent developmental stages. These DNA elements predominantly lose CG methylation during fetal development, whereas the trend is reversed after birth. During late stages of fetal development, non- CG methylation accumulated within the bodies of key developmental transcription factor genes, coinciding with their transcriptional repression. Integration of genome- wide DNA methylation, histone modifcation and chromatin accessibility data enabled us to predict 461,141 putative developmental tissue-specifc enhancers, the human orthologues of which were enriched for disease-associated genetic variants. These spatiotemporal epigenome maps provide a resource for studies of gene regulation during tissue or organ progression, and a starting point for investigating regulatory elements that are involved in human developmental disorders.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal
    NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through ␤-catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania).
    [Show full text]
  • 1 HOXB7 Is an Erα Cofactor in the Activation Of
    HOXB7 is an ERα cofactor in the activation of HER2 and multiple ER target genes leading to endocrine resistance Kideok Jin, Sunju Park, Wei Wen Teo, Preethi Korangath, Sean Soonweng Cho, Takahiro Yoshida, Balázs Győrffy, Chirayu Pankaj Goswami, Harikrishna Nakshatri, Leigh-Ann Cruz, Weiqiang Zhou, Hongkai Ji, Ying Su, Muhammad Ekram, Zhengsheng Wu, Tao Zhu, Kornelia Polyak, and Saraswati Sukumar Supplemental Methods Plasmids Full-length promoter region including ER and one of two different HOXB7 binding sites of CA12 was cloned into the pGL3 promoter luciferase construct. Full length miR196a cDNA was cloned into the pcDNA3.1 vector. Full-length promoter region including MYC binding region of miR-196a gene was cloned into pGL3 promoter luciferase plasmid. 3’UTR region of HOXB7 was cloned into pGL2 promoter luciferase plasmid. The full-length human HER2 plasmid was a generous gift from Daniel Leahy (Johns Hopkins University, Baltimore, MD) and the HER2 cDNA was cloned to pLPCX vector. EGFR WT, pRetrosuper Myc shRNA, Lenti-sh1368 knockdown c-myc were purchased at Addgene (1-3). siRNAs against HOXB7 were purchased at Invitrogen and shRNAs against HOXB7 was purchased at Thermo scientific. Immunohistochemistry Immunohistochemical analysis of HOXB7 and HER2 protein expression was performed using monoclonal antibodies against HOXB7 (Santa Cruz Biotechnology) and HER2 (Cell signaling). After blocking with 5% goat serum in PBST for 1 hour at room temperature, the sections were treated with the HOXB7 or HER2 antibodies overnight at 4°C, then the peroxidase conjugated streptavidin 1 complex method was performed, followed by the 3, 3' diaminobenzidine (DAB) procedure according to manufacturer’s protocols (VECTASTAIN Elite ABC Kit, Vector Lab).
    [Show full text]
  • Beta Protein 1 Homeoprotein Induces Cell Growth and Estrogen-Independent Tumorigenesis by Binding to the Estrogen Receptor in Breast Cancer
    Himmelfarb Health Sciences Library, The George Washington University Health Sciences Research Commons Medicine Faculty Publications Medicine 7-16-2016 Beta protein 1 homeoprotein induces cell growth and estrogen-independent tumorigenesis by binding to the estrogen receptor in breast cancer. Sidney W Fu George Washington University Saurabh P Kirolikar Erika Ginsburg Xiaohui Tan Arnold Schwartz See next page for additional authors Follow this and additional works at: http://hsrc.himmelfarb.gwu.edu/smhs_medicine_facpubs Part of the Medicine and Health Sciences Commons APA Citation Fu, S., Kirolikar, S., Ginsburg, E., Tan, X., Schwartz, A., Simmens, S., Man, Y., & Pinzone, J. (2016). Beta protein 1 homeoprotein induces cell growth and estrogen-independent tumorigenesis by binding to the estrogen receptor in breast cancer.. Oncotarget, (). http://dx.doi.org/10.18632/oncotarget.10633 This Journal Article is brought to you for free and open access by the Medicine at Health Sciences Research Commons. It has been accepted for inclusion in Medicine Faculty Publications by an authorized administrator of Health Sciences Research Commons. For more information, please contact [email protected]. Authors Sidney W Fu, Saurabh P Kirolikar, Erika Ginsburg, Xiaohui Tan, Arnold Schwartz, Samuel J Simmens, Yan- Gao Man, and Joseph J Pinzone This journal article is available at Health Sciences Research Commons: http://hsrc.himmelfarb.gwu.edu/smhs_medicine_facpubs/ 793 www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2016 Beta protein 1 homeoprotein induces cell growth and estrogen- independent tumorigenesis by binding to the estrogen receptor in breast cancer Sidney W. Fu1,*, Saurabh P. Kirolikar2,*, Erika Ginsburg3, Xiaohui Tan1, Arnold Schwartz4, Samuel J. Simmens5, Yan-gao Man6, Joseph J.
    [Show full text]
  • HOXB7 Is an Erα Cofactor in the Activation of HER2 and Multiple ER Target Genes Leading
    Author Manuscript Published OnlineFirst on July 15, 2015; DOI: 10.1158/2159-8290.CD-15-0090 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. HOXB7 is an ERα cofactor in the activation of HER2 and multiple ER target genes leading to endocrine resistance Kideok Jin1, Sunju Park1, Wei Wen Teo1, Preethi Korangath1, Sean Soonweng Cho1, Takahiro Yoshida1*, Balázs Győrffy2, Chirayu Pankaj Goswami3#, Harikrishna Nakshatri3, Leigh-Ann Cruz1, Weiqiang Zhou4, Hongkai Ji4, Ying Su5, Muhammad Ekram5, Zhengsheng Wu6, Tao Zhu6, Kornelia Polyak5, and Saraswati Sukumar1≠ 1Breast Cancer Program, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD, 22nd Department of Pediatrics, MTA TTK Lendület Cancer Biomarker Research Group, Semmelweis University, Budapest, Hungary, 3Center for Computational Biology and Bioinformatics, Indiana University, IN, 4Department of Biostatistics, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD and 5Dana- Farber Cancer Institute, Boston, MA. 6Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, People's Republic of China. Current address: *Department of Surgery, Tokushima University, 3-18-15 Kuramoto-cho, Tokushima 770-8503, Japan #Thomas Jefferson University Hospital, Philadelphia, PA 19107, USA ≠ To whom correspondence may be addressed: Saraswati Sukumar, PhD Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, 1650 Orleans Street, CRB 1, Room 143, Baltimore, MD 21231-1000. Phone: 410-614-2479 1 Downloaded from cancerdiscovery.aacrjournals.org on September 28, 2021. © 2015 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 15, 2015; DOI: 10.1158/2159-8290.CD-15-0090 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.
    [Show full text]
  • HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2007-02-28 HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes Mohammad Q. Hassan University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons Repository Citation Hassan MQ, Tare RS, Lee SH, Mandeville M, Weiner B, Montecino MA, Van Wijnen AJ, Stein JL, Stein GS, Lian JB. (2007). HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes. Open Access Articles. https://doi.org/10.1128/MCB.01544-06. Retrieved from https://escholarship.umassmed.edu/oapubs/1334 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. MOLECULAR AND CELLULAR BIOLOGY, May 2007, p. 3337–3352 Vol. 27, No. 9 0270-7306/07/$08.00ϩ0 doi:10.1128/MCB.01544-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved. HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genesᰔ Mohammad Q. Hassan,1 Rahul Tare,1† Suk Hee Lee,1 Matthew Mandeville,1 Brian Weiner,1 Martin Montecino,2 Andre J. van Wijnen,1 Janet L. Stein,1 Gary S. Stein,1 and Jane B. Lian1* Department of Cell Biology and Cancer Center, University of Massachusetts Medical School, Worcester, Massachusetts 01655,1 and Departamento de Bioquimica y Biologia Molecular, Facultad de Ciencias Biologicas, Universidad de Concepcion, Concepcion, Chile2 Received 18 August 2006/Returned for modification 4 October 2006/Accepted 9 February 2007 HOXA10 is necessary for embryonic patterning of skeletal elements, but its function in bone formation beyond this early developmental stage is unknown.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Independent Regulation of Vertebral Number and Vertebral Identity by Microrna-196 Paralogs
    Independent regulation of vertebral number and vertebral identity by microRNA-196 paralogs Siew Fen Lisa Wonga,1, Vikram Agarwalb,c,d,e,1, Jennifer H. Mansfieldf,g, Nicolas Denansh, Matthew G. Schwartzf, Haydn M. Prosseri, Olivier Pourquiéf,j, David P. Bartelb,c,d, Clifford J. Tabinf,2, and Edwina McGlinna,f,2 aEMBL Australia, Australian Regenerative Medicine Institute, Monash University, Clayton, VIC 3800, Australia; bHoward Hughes Medical Institute, Cambridge, MA 02142; cWhitehead Institute for Biomedical Research, Cambridge, MA 02142; dDepartment of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; eComputational and Systems Biology Program, Massachusetts Institute of Technology, Cambridge, MA 02139; fDepartment of Genetics, Harvard Medical School, Boston, MA 02115; gDepartment of Biological Sciences, Barnard College, New York, NY 10027; hDepartment of Developmental Biology and Genetics, Stanford School of Medicine, Stanford, CA 94305; iThe Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, United Kingdom; and jDepartment of Pathology, Brigham and Women’s Hospital, Boston, MA 02115 Contributed by Clifford J. Tabin, July 16, 2015 (sent for review March 24, 2015; reviewed by Jacqueline Deschamps and Joshua T. Mendell) The Hox genes play a central role in patterning the embryonic anterior- of which is a critical factor in establishing species-specific vertebral to-posterior axis. An important function of Hox activity in verte- number (8). brates is the specification of different vertebral morphologies, with Within vertebral precursors, specific combinations of Hox an additional role in axis elongation emerging. The miR-196 family transcription factors impart positional information that governs of microRNAs (miRNAs) are predicted to extensively target Hox 3′ vertebral identity (9).
    [Show full text]