DOCSLIB.ORG

Mouse Cpeb1 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Cpeb1 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Cpeb1 Knockout Project (CRISPR/Cas9) Objective: To create a Cpeb1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cpeb1 gene (NCBI Reference Sequence: NM_001252525 ; Ensembl: ENSMUSG00000025586 ) is located on Mouse chromosome 7. 12 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 12 (Transcript: ENSMUST00000178892). Exon 2 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a null allele are viable and overtly normal but display a developmental arrest of both female and male germ cells at the pachytene stage, defective synaptonemal complex formation, and impaired neuronal synaptic plasticity. Exon 2 starts from about 0.95% of the coding region. Exon 2 covers 10.38% of the coding region. The size of effective KO region: ~175 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 12 Legends Exon of mouse Cpeb1 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 2 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(28.15% 563) | C(17.15% 343) | T(35.55% 711) | G(19.15% 383) Note: The 2000 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(30.5% 610) | C(18.05% 361) | T(30.25% 605) | G(21.2% 424) Note: The 2000 bp section downstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr7 - 81436378 81438377 2000 browser details YourSeq 43 1619 1668 2000 94.0% chr12 - 4767122 4767181 60 browser details YourSeq 38 1382 1636 2000 93.2% chr14 - 26660119 26660619 501 browser details YourSeq 35 385 495 2000 94.8% chr4 - 6430021 6430132 112 browser details YourSeq 29 1371 1401 2000 96.8% chr9 - 14114209 14114239 31 browser details YourSeq 28 1345 1372 2000 100.0% chr4 - 136731017 136731044 28 browser details YourSeq 28 1 30 2000 96.7% chr4 + 123757362 123757391 30 browser details YourSeq 28 1371 1399 2000 100.0% chr11 + 82653527 82653558 32 browser details YourSeq 26 1345 1372 2000 96.5% chr2 + 168858006 168858033 28 browser details YourSeq 26 1344 1369 2000 100.0% chr11 + 62161610 62161635 26 browser details YourSeq 25 1388 1414 2000 96.3% chrX - 86595121 86595147 27 browser details YourSeq 25 1343 1372 2000 85.2% chr2 + 166123621 166123648 28 browser details YourSeq 25 1378 1402 2000 100.0% chr17 + 32259781 32259805 25 browser details YourSeq 24 1623 1647 2000 100.0% chr1 - 16149892 16149926 35 browser details YourSeq 24 1170 1195 2000 96.2% chr5 + 88702961 88702986 26 browser details YourSeq 24 1347 1370 2000 100.0% chr19 + 29619680 29619703 24 browser details YourSeq 22 44 66 2000 100.0% chr7 - 137562776 137562800 25 browser details YourSeq 22 1618 1639 2000 100.0% chr6 - 47587051 47587072 22 browser details YourSeq 22 1349 1370 2000 100.0% chr4 - 116134816 116134837 22 browser details YourSeq 22 43 65 2000 100.0% chr3 - 30220306 30220329 24 Note: The 2000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr7 - 81434203 81436202 2000 browser details YourSeq 57 1760 1938 2000 91.2% chr10 + 18078050 18078263 214 browser details YourSeq 54 510 602 2000 84.7% chr8 - 107144297 107144390 94 browser details YourSeq 51 507 569 2000 90.5% chr9 - 115974678 115974740 63 browser details YourSeq 51 516 705 2000 90.7% chr7 - 97859777 97859966 190 browser details YourSeq 49 509 569 2000 90.2% chr6 - 88089456 88089516 61 browser details YourSeq 48 508 575 2000 85.3% chr6 - 34671001 34671068 68 browser details YourSeq 47 508 602 2000 81.4% chr12 - 8383365 8383642 278 browser details YourSeq 46 573 706 2000 85.2% chr3 - 130948000 130948130 131 browser details YourSeq 45 1617 1818 2000 88.3% chr16 + 91577744 91577943 200 browser details YourSeq 44 510 602 2000 74.5% chr11 + 61893837 61893899 63 browser details YourSeq 43 1617 1680 2000 86.8% chr11 - 20664451 20664513 63 browser details YourSeq 43 1617 1821 2000 70.4% chr1 + 60819170 60819342 173 browser details YourSeq 42 509 569 2000 85.3% chr9 - 106549801 106549862 62 browser details YourSeq 42 509 624 2000 90.4% chr2 - 153534191 153534306 116 browser details YourSeq 42 507 563 2000 92.0% chr4 + 148631941 148632177 237 browser details YourSeq 42 510 569 2000 85.0% chr11 + 98292659 98292718 60 browser details YourSeq 41 508 602 2000 90.7% chr9 - 9698099 9698191 93 browser details YourSeq 41 509 557 2000 91.9% chr11 + 59652541 59652589 49 browser details YourSeq 40 501 602 2000 95.5% chr3 - 57747927 57748037 111 Note: The 2000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Cpeb1 cytoplasmic polyadenylation element binding protein 1 [ Mus musculus (house mouse) ] Gene ID: 12877, updated on 3-Sep-2019 Gene summary Official Symbol Cpeb1 provided by MGI Official Full Name cytoplasmic polyadenylation element binding protein 1 provided by MGI Primary source MGI:MGI:108442 See related Ensembl:ENSMUSG00000025586 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Cpeb; mCPEB; Cpe-bp1; mCpeb-1; AU024112 Expression Broad expression in cortex adult (RPKM 9.8), frontal lobe adult (RPKM 9.6) and 15 other tissues See more Orthologs human all Genomic context Location: 7; 7 D3 See Cpeb1 in Genome Data Viewer Exon count: 16 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 7 NC_000073.6 (81347026..81458001, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 7 NC_000073.5 (88492329..88599562, complement) Chromosome 7 - NC_000073.6 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 9 transcripts Gene: Cpeb1 ENSMUSG00000025586 Description cytoplasmic polyadenylation element binding protein 1 [Source:MGI Symbol;Acc:MGI:108442] Location Chromosome 7: 81,347,026-81,455,465 reverse strand. GRCm38:CM001000.2 About this gene This gene has 9 transcripts (splice variants), 216 orthologues, 3 paralogues, is a member of 1 Ensembl protein family and is associated with 13 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Cpeb1-201 ENSMUST00000098331.9 3111 561aa ENSMUSP00000095936.3 Protein coding CCDS40007 P70166 TSL:1 GENCODE basic APPRIS P3 Cpeb1-209 ENSMUST00000178892.2 1777 562aa ENSMUSP00000137079.1 Protein coding CCDS57557 Q059Z2 TSL:1 GENCODE basic APPRIS ALT1 Cpeb1-203 ENSMUST00000130310.7 2969 551aa ENSMUSP00000120139.1 Protein coding - F6X7Z3 CDS 5' incomplete TSL:5 Cpeb1-207 ENSMUST00000152319.1 718 No protein - Retained intron - - TSL:3 Cpeb1-204 ENSMUST00000135177.7 821 No protein - lncRNA - - TSL:3 Cpeb1-208 ENSMUST00000153419.2 654 No protein - lncRNA - - TSL:3 Cpeb1-205 ENSMUST00000136689.1 639 No protein - lncRNA - - TSL:3 Cpeb1-202 ENSMUST00000124937.1 335 No protein - lncRNA - - TSL:3 Cpeb1-206 ENSMUST00000151661.1 326 No protein - lncRNA - - TSL:3 Page 7 of 9 https://www.alphaknockout.com 128.44 kb Forward strand 81.34Mb 81.36Mb 81.38Mb 81.40Mb 81.42Mb 81.44Mb 81.46Mb Genes Rpl7a-ps9-201 >processed pseudogene (Comprehensive set... Cpeb1os1-201 >TEC Contigs AC162897.4 > AC161215.6 > < AC169082.2 < AC167120.2 Genes (Comprehensive set... < Rps17-202lncRNA < Cpeb1-204lncRNA < Rps17-201protein coding< Cpeb1-208lncRNA < Cpeb1-202lncRNA < Rps17-206lncRNA < Cpeb1-206lncRNA < Ap3b2-204retained intron < Rps17-203retained intron < Ap3b2-201protein coding < Rps17-205retained intron < Ap3b2-209protein coding < Rps17-204lncRNA < Ap3b2-207protein coding < Cpeb1-201protein coding < Cpeb1-203protein coding < Cpeb1-209protein coding < Cpeb1-207retained intron < Cpeb1-205lncRNA Regulatory Build 81.34Mb 81.36Mb 81.38Mb 81.40Mb 81.42Mb 81.44Mb 81.46Mb Reverse strand 128.44 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding RNA gene pseudogene processed transcript Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000178892 < Cpeb1-209protein coding Reverse strand 106.40 kb ENSMUSP00000137..
Load more

Recommended publications
  • FMRP Links Optimal Codons to Mrna Stability in Neurons
    FMRP links optimal codons to mRNA stability in neurons Huan Shua,1, Elisa Donnardb, Botao Liua, Suna Junga, Ruijia Wanga, and Joel D. Richtera aProgram in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA 01605; and bBioinformatics and Integrative Biology, University of Massachusetts Medical School, Worcester, MA 01605 Edited by Lynne E. Maquat, University of Rochester School of Medicine and Dentistry, Rochester, NY, and approved October 12, 2020 (received for review May 8, 2020) Fragile X syndrome (FXS) is caused by inactivation of the FMR1 Here, we have used ribosome profiling and RNA sequencing gene and loss of encoded FMRP, an RNA binding protein that re- (RNA-seq) to investigate translational dysregulation in the presses translation of some of its target transcripts. Here we use FMRP KO cortex and found that FMRP coordinates the link ribosome profiling and RNA sequencing to investigate the dysre- between RNA destruction and codon usage bias (codon opti- gulation of translation in the mouse brain cortex. We find that mality). We find that the apparent dysregulation of translational most changes in ribosome occupancy on hundreds of mRNAs are activity (i.e., ribosome occupancy) in FMRP KO cortex can be largely driven by dysregulation in transcript abundance. Many accounted for by commensurate changes in steady-state RNA down-regulated mRNAs, which are mostly responsible for neuro- levels. Down-regulated mRNAs in FMRP KO cortex are nal and synaptic functions, are highly enriched for FMRP binding enriched for those that encode factors involved in neuronal and targets. RNA metabolic labeling demonstrates that, in FMRP- synaptic functions and are highly enriched for FMRP binding deficient cortical neurons, mRNA down-regulation is caused by targets.
    [Show full text]
  • CPEB1 (NM 001079533) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG213281 CPEB1 (NM_001079533) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CPEB1 (NM_001079533) Human Tagged ORF Clone Tag: TurboGFP Symbol: CPEB1 Synonyms: CPE-BP1; CPEB; CPEB-1; h-CPEB; hCPEB-1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 CPEB1 (NM_001079533) Human Tagged ORF Clone – RG213281 ORF Nucleotide >RG213281 representing NM_001079533 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTTTTCCCAACCTCTGCGCAAGAATCTTCCCGTGGCCTCCCAGATGCAAATGACTTGTGCCTTGGCC TGCAGTCCCTCAGTCTGACAGGCTGGGACCGACCCTGGAGCACCCAGGACTCAGATTCCTCAGCCCAGAG CAGCACACACTCGGTACTGAGCATGCTCCATAACCCACTGGGAAATGTCCTAGGAAAACCCCCCTTGAGC TTCCTGCCTCTGGATCCCCTTGGGTCTGACTTGGTGGACAAGTTTCCAGCACCCTCAGTTAGAGGATCAC GCCTGGACACCCGGCCCATCCTGGACTCTCGATCTAGCAGCCCCTCTGACTCAGACACCAGTGGCTTCAG CTCTGGATCAGATCATCTCTCAGATTTGATTTCAAGCCTTCGCATTTCTCCACCTCTGCCCTTCCTGTCT CTGTCAGGGGGTGGTCCCAGAGACCCTTTAAAGATGGGGGTAGGGTCTCGGATGGACCAAGAGCAAGCTG CTCTTGCTGCAGTCACTCCCTCCCCAACCAGTGCTTCAAAGAGATGGCCAGGAGCTTCTGTGTGGCCATC CTGGGACCTCCTCGAAGCTCCCAAAGACCCCTTCAGCATAGAGAGAGAGGCCAGGCTGCACCGACAAGCT
    [Show full text]
  • Nuclear Export of Ubiquitinated Proteins Via the UBIN-POST System
    Nuclear export of ubiquitinated proteins via the PNAS PLUS UBIN-POST system Shoshiro Hirayamaa,1,2, Munechika Sugiharab,1, Daisuke Moritoc,d, Shun-ichiro Iemurae, Tohru Natsumee, Shigeo Murataa, and Kazuhiro Nagatab,c,d,2 aLaboratory of Protein Metabolism, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo, 113-0033, Japan; bFaculty of Life Sciences, Kyoto Sangyo University, Kyoto, 603-8555, Japan; cInstitute for Protein Dynamics, Kyoto Sangyo University, Kyoto, 603-8555, Japan; dCore Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency, Saitama, 332-0012, Japan; and eBiomedicinal Information Research Center, National Institute of Advanced Industrial Science and Technology, Tokyo, 135-0064, Japan Edited by Brenda A. Schulman, Max Planck Institute of Biochemistry, Martinsried, Germany, and approved March 19, 2018 (received for review June 19, 2017) Although mechanisms for protein homeostasis in the cytosol have folding enzymes with a broad range of activities, two strong and been studied extensively, those in the nucleus remain largely flexible proteolytic machineries (namely, the UPS and autophagy), unknown. Here, we identified that a protein complex mediates and regulated protein deposition systems, such as the aggresome, export of polyubiquitinated proteins from the nucleus to the aggresome-like induced structure (ALIS), insoluble protein de- cytosol. UBIN, a ubiquitin-associated (UBA) domain-containing pro- posit (IPOD), and juxta nuclear quality control compartment tein, shuttled between the nucleus and the cytosol in a CRM1- (JUNQ), which sequester damaged proteins (9–11). Thus, the dependent manner, despite the lack of intrinsic nuclear export signal cytosol constitutes a robust system for maintaining protein ho- (NES). Instead, the UBIN binding protein polyubiquitinated substrate meostasis that extends to distinct organelles within the cytosol.
    [Show full text]
  • MOCHI Enables Discovery of Heterogeneous Interactome Modules in 3D Nucleome
    Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press MOCHI enables discovery of heterogeneous interactome modules in 3D nucleome Dechao Tian1,# , Ruochi Zhang1,# , Yang Zhang1, Xiaopeng Zhu1, and Jian Ma1,* 1Computational Biology Department, School of Computer Science, Carnegie Mellon University, Pittsburgh, PA 15213, USA #These two authors contributed equally *Correspondence: [email protected] Contact To whom correspondence should be addressed: Jian Ma School of Computer Science Carnegie Mellon University 7705 Gates-Hillman Complex 5000 Forbes Avenue Pittsburgh, PA 15213 Phone: +1 (412) 268-2776 Email: [email protected] 1 Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The composition of the cell nucleus is highly heterogeneous, with different constituents forming complex interactomes. However, the global patterns of these interwoven heterogeneous interactomes remain poorly understood. Here we focus on two different interactomes, chromatin interaction network and gene regulatory network, as a proof-of-principle, to identify heterogeneous interactome modules (HIMs), each of which represents a cluster of gene loci that are in spatial contact more frequently than expected and that are regulated by the same group of transcription factors. HIM integrates transcription factor binding and 3D genome structure to reflect “transcriptional niche” in the nucleus. We develop a new algorithm MOCHI to facilitate the discovery of HIMs based on network motif clustering in heterogeneous interactomes. By applying MOCHI to five different cell types, we found that HIMs have strong spatial preference within the nucleus and exhibit distinct functional properties. Through integrative analysis, this work demonstrates the utility of MOCHI to identify HIMs, which may provide new perspectives on the interplay between transcriptional regulation and 3D genome organization.
    [Show full text]
  • Cpg Island Hypermethylation in Human Astrocytomas
    Published OnlineFirst March 16, 2010; DOI: 10.1158/0008-5472.CAN-09-3631 Molecular and Cellular Pathobiology Cancer Research CpG Island Hypermethylation in Human Astrocytomas Xiwei Wu2, Tibor A. Rauch3, Xueyan Zhong1, William P. Bennett1, Farida Latif4, Dietmar Krex5, and Gerd P. Pfeifer1 Abstract Astrocytomas are common and lethal human brain tumors. We have analyzed the methylation status of over 28,000 CpG islands and 18,000 promoters in normal human brain and in astrocytomas of various grades using the methylated CpG island recovery assay. We identified 6,000 to 7,000 methylated CpG islands in normal human brain. Approximately 5% of the promoter-associated CpG islands in the normal brain are methylated. Promoter CpG island methylation is inversely correlated whereas intragenic methylation is directly correlated with gene expression levels in brain tissue. In astrocytomas, several hundred CpG islands undergo specific hy- permethylation relative to normal brain with 428 methylation peaks common to more than 25% of the tumors. Genes involved in brain development and neuronal differentiation, such as BMP4, POU4F3, GDNF, OTX2, NEFM, CNTN4, OTP, SIM1, FYN, EN1, CHAT, GSX2, NKX6-1, PAX6, RAX, and DLX2, were strongly enriched among genes frequently methylated in tumors. There was an overrepresentation of homeobox genes and 31% of the most commonly methylated genes represent targets of the Polycomb complex. We identified several chromosomal loci in which many (sometimes more than 20) consecutive CpG islands were hypermethylated in tumors. Seven such loci were near homeobox genes, including the HOXC and HOXD clusters, and the BARHL2, DLX1,and PITX2 genes. Two other clusters of hypermethylated islands were at sequences of recent gene duplication events.
    [Show full text]
  • ATAP00896-Recombinant Human CPEB1 Protein
    ATAGENIX LABORATORIES Catalog Number:ATAP00896 Recombinant Human CPEB1 protein Product Details Summary English name Recombinant Human CPEB1 protein Purity >90% as determined by SDS-PAGE Endotoxin level Please contact with the lab for this information. Construction A DNA sequence encoding the human CPEB1 (Cys311-Lys561) was fused with His tag Accession # Q9BZB8 Host E.coli Species Homo sapiens (Human) Predicted Molecular Mass 29.21 kDa Formulation Supplied as solution form in PBS pH 7.5 or lyophilized from PBS pH 7.5. Shipping In general, proteins are provided as lyophilized powder/frozen liquid. They are shipped out with dry ice/blue ice unless customers require otherwise. Stability &Storage Use a manual defrost freezer and avoid repeated freeze thaw cycles. Store at 2 to 8 °C for one week . Store at -20 to -80 °C for twelve months from the date of receipt. Reconstitution Reconstitute in sterile water for a stock solution.A copy of datasheet will be provided with the products, please refer to it for details. Background Background Sequence-specific RNA-binding protein that regulates mRNA cytoplasmic polyadenylation and translation initiation during oocyte maturation, early development and at postsynapse sites of neurons. Binds to the cytoplasmic polyadenylation element (CPE), an uridine-rich sequence element (consensus sequence 5'-UUUUUAU-3') within the mRNA 3'-UTR. RNA binding results in a clear conformational change analogous to the Venus fly trap mechanism. In absence of phosphorylation and in association with TACC3 is also involved as a repressor of translation of CPE-containing mRNA; a repression that is relieved by phosphorylation or degradation.
    [Show full text]
  • CPEB1 Restrains Proliferation of Glioblastoma Cells Through The
    CPEB1 restrains proliferation of Glioblastoma cells through the regulation of p27Kip1 mRNA translation Silvia Galardi, Massimo Petretich, Guillaume Pinna, Silvia D’amico, Fabrizio Loreni, Alessandro Michienzi, Irina Groisman, Silvia Anna Ciafrè To cite this version: Silvia Galardi, Massimo Petretich, Guillaume Pinna, Silvia D’amico, Fabrizio Loreni, et al.. CPEB1 restrains proliferation of Glioblastoma cells through the regulation of p27Kip1 mRNA translation. Scientific Reports, Nature Publishing Group, 2016, 6, 10.1038/srep25219. hal-01412513 HAL Id: hal-01412513 https://hal.archives-ouvertes.fr/hal-01412513 Submitted on 8 Dec 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. www.nature.com/scientificreports OPEN CPEB1 restrains proliferation of Glioblastoma cells through the regulation of p27Kip1 mRNA Received: 25 November 2015 Accepted: 08 April 2016 translation Published: 04 May 2016 Silvia Galardi1, Massimo Petretich2,†, Guillaume Pinna2, Silvia D’Amico3, Fabrizio Loreni3, Alessandro Michienzi1, Irina Groisman2,* & Silvia Anna Ciafrè1,* The cytoplasmic element binding protein 1 (CPEB1) regulates many important biological processes ranging from cell cycle control to learning and memory formation, by controlling mRNA translation efficiency via′ 3 untranslated regions (3′UTR). In the present study, we show that CPEB1 is significantly downregulated in human Glioblastoma Multiforme (GBM) tissues and that the restoration of its expression impairs glioma cell lines growth.
    [Show full text]
  • Application of Genomic Technologies to Study Infertility Nicholas Rui Yuan Ho Washington University in St
    Washington University in St. Louis Washington University Open Scholarship Arts & Sciences Electronic Theses and Dissertations Arts & Sciences Spring 5-15-2016 Application of Genomic Technologies to Study Infertility Nicholas Rui Yuan Ho Washington University in St. Louis Follow this and additional works at: https://openscholarship.wustl.edu/art_sci_etds Part of the Bioinformatics Commons, Genetics Commons, and the Molecular Biology Commons Recommended Citation Yuan Ho, Nicholas Rui, "Application of Genomic Technologies to Study Infertility" (2016). Arts & Sciences Electronic Theses and Dissertations. 786. https://openscholarship.wustl.edu/art_sci_etds/786 This Dissertation is brought to you for free and open access by the Arts & Sciences at Washington University Open Scholarship. It has been accepted for inclusion in Arts & Sciences Electronic Theses and Dissertations by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected]. WASHINGTON UNIVERSITY IN ST. LOUIS Division of Biology and Biomedical Sciences Computational and Systems Biology Dissertation Examination Committee: Donald Conrad, Chair Barak Cohen Joseph Dougherty John Edwards Liang Ma Application of Genomic Technologies to Study Infertility by Nicholas Rui Yuan Ho A dissertation presented to the Graduate School of Arts & Sciences of Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy May 2016 St. Louis, Missouri © 2016, Nicholas Rui Yuan Ho Table of
    [Show full text]
  • Cytomegalovirus Infection Relies on Human RNA-Binding Protein 24 October 2016
    Cytomegalovirus infection relies on human RNA-binding protein 24 October 2016 compromised immune systems, or babies infected with the virus before birth. There are currently no treatments or vaccines for CMV. In human cells, RNA is the genetic material that carries instructions from the DNA in a cell's nucleus out to the cytoplasm, where molecular machinery uses those instructions to build proteins. CPEB1 is a human protein that normally binds RNAs that are destined to be translated into proteins. Yeo's team discovered that CPEB1 levels increase dramatically in human cells infected by CMV. Using genomics technologies, the researchers also found that increased CPEB1 levels in CMV-infected cells Human CPEB1 protein is shown here in green, while leads to abnormal processing of RNAs encoding cytomegalovirus is orange. Credit: UC San Diego Health thousands of human genes. In addition, they were surprised to find that CPEB1 was necessary for proper processing of viral RNAs. Without the host CPEB1 protein, viral RNA did not mature properly Viruses hijack the molecular machinery in human and the virus was weakened. cells to survive and replicate, often damaging those host cells in the process. Researchers at the CMV-infected human cells undergo abnormal University of California San Diego School of changes and produce more virus, which ultimately Medicine discovered that, for cytomegalovirus infects other cells. In collaboration with Deborah (CMV), this process relies on a human protein Spector, PhD, Distinguished Professor at UC San called CPEB1. The study, published October 24 in Diego School of Medicine and Skaggs School of Nature Structural and Molecular Biology, provides Pharmacy and Pharmaceutical Sciences, the team a potential new target for the development of CMV went on to show that suppressing CPEB1 levels therapies.
    [Show full text]
  • Anti-CPEB1 (RABBIT) Antibody - 600-401-AM7
    Anti-CPEB1 (RABBIT) Antibody - 600-401-AM7 Code: 600-401-AM7 Size: 100 µg Product Description: Anti-CPEB1 (RABBIT) Antibody - 600-401-AM7 Concentration: 1 mg/mL by UV absorbance at 280 nm PhysicalState: Liquid (sterile filtered) Label Unconjugated Host Rabbit Gene Name CPEB1 Species Reactivity Human, mouse, rat Buffer 0.01 M Sodium Phosphate, 0.25 M Sodium Chloride, pH 7.2 Stabilizer None Preservative 0.02% (w/v) Sodium Azide Storage Condition Store vial at -20° C prior to opening. Aliquot contents and freeze at -20° C or below for extended storage. Avoid cycles of freezing and thawing. Centrifuge product if not completely clear after standing at room temperature. This product is stable for several weeks at 4° C as an undiluted liquid. Dilute only prior to immediate use. Synonyms CPEB1 Antibody, CEBP, CPEB, CPEB-1, CPE-BP1, hCPEB-1, Cytoplasmic polyadenylation element-binding protein 1 Application Note Anti-CPEB1 Antibody has been tested for use in ELISA and Western Blotting. Specific conditions for reactivity should be optimized by the end user. Expect a band at approximately 63 kDa in Western Blots of specific cell lysates and tissues. Background CPEB1 is an RNA binding protein that contains an RNA-recognition motif and a zinc finger-containing region found in a wide range of vertebrates and invertebrates. CPEB1 forms the nucleus of a complex of factors that regulate poly(A) elongation and promotes polyadenylation-induced translation. CPEB1 mediates many diverse biological processes such as germ cell development, cell division and senescence, and synaptic plasticity. Recently, it was discovered that CPEB1 is involved in beta-catenin mRNA translation and cell migration in astrocytes as well as regulating hypoxia-inducible factor (HIF)-1 expression, demonstrating the wide range of processes in which CPEB1 plays a role.
    [Show full text]
  • Mouse Cpeb1 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Cpeb1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Cpeb1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cpeb1 gene (NCBI Reference Sequence: NM_001252525 ; Ensembl: ENSMUSG00000025586 ) is located on Mouse chromosome 7. 12 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 12 (Transcript: ENSMUST00000178892). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Cpeb1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-335C7 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a null allele are viable and overtly normal but display a developmental arrest of both female and male germ cells at the pachytene stage, defective synaptonemal complex formation, and impaired neuronal synaptic plasticity. Exon 2 starts from about 0.95% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 18256 bp, and the size of intron 2 for 3'-loxP site insertion: 63999 bp. The size of effective cKO region: ~675 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 12 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Cpeb1 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Utrs Define the Temporal Pattern of Ccnb1 Synthesis During Mouse Oocyte Meiotic Maturation
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION Maternal mRNAs with distinct including the metaphase-promoting factor (MPF) (see be- ′ low), and are in a poised state ready to quickly re-enter 3 UTRs define the temporal meiosis (Eppig 1996). They will re-enter the cell cycle upon withdrawal of the inhibitory signal originating pattern of Ccnb1 synthesis from somatic cells (Norris et al. 2009; Vaccari et al. 2009; Zhang et al. 2010b). In other species, a variable during mouse oocyte meiotic time interval is necessary from the hormonal trigger to maturation meiotic re-entry and involves the synthesis of critical 1,2,3,4 2,3,4 components necessary for meiotic progression, including Ye Yang, Cai-Rong Yang, Cyclins, the regulatory subunits of CDK1 kinase (Ferrell Seung Jin Han,2,3,4,5 Enrico Maria Daldello,2,3,4 1999). The complex of Cyclin B and CDK1 constitutes Ara Cho,2,3,4 Joao P. Sousa Martins,2,3,4 the MPF, the master regulator of both meiosis and mitosis Guoliang Xia,1 and Marco Conti2,3,4 (Morgan 2007). An inactive pre-MPF is assembled prior to meiotic re-entry through translational regulations. 1State Key Laboratory of Agrobiotechnology, College of It has long been known that synthesis of Cyclins is crit- Biological Sciences, China Agricultural University (CAU), Beijing ical at different stages of meiotic progression, with syn- 100193, People’s Republic of China; 2Center for Reproductive thesis required before germinal vesicle (GV) breakdown Sciences, University of California at San Francisco, San Francisco (GVBD) in those species where insufficient pre-MPFs California 94143, USA; 3Eli and Edythe Broad Center of have been assembled.
    [Show full text]