(12) Patent Application Publication (10) Pub. No.: US 2015/0376261 A1 Steyaert Et Al
US 20150376261A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0376261 A1 Steyaert et al. (43) Pub. Date: Dec. 31, 2015
(54) NOVEL CHMERIC POLYPEPTIDES FOR Publication Classification SCREENING AND DRUG DSCOVERY PURPOSES (51) Int. Cl. C07K I4/72 (2006.01) (71) Applicants: VIB VZW, Gent (BE); VRIJE C07K 6/28 (2006.01) UNIVERSITEIT BRUSSEL, Brussel GOIN33/566 (2006.01) (BE) (52) U.S. Cl. CPC ...... C07K 14/723 (2013.01); G0IN33/566 (72) Inventors: Jan Steyaert, Beersel (BE); Toon (2013.01); C07K 16/2869 (2013.01); G0IN Laeremans, Dworp (BE); Els Pardon, 2333/726 (2013.01); C07K 231 7/569 (2013.01); Lubbeek (BE) C07K 23.17/32 (2013.01); C07K 2317/75 (2013.01); C07K 2319/74 (2013.01) (21) Appl. No.: 14/764,548 (22) PCT Fled: Jan. 30, 2014 (57) ABSTRACT PCT NO.: PCT/EP2014/051845 Described are polypeptides and their use for screening and (86) drug discovery. More specifically, the disclosure provides S371 (c)(1), chimeric polypeptides comprising a membrane protein, in (2) Date: Jul. 29, 2015 particular a GPCR, fused to a binding domain, wherein the binding domain is directed against and/or specifically binds Related U.S. Application Data to the membrane protein. In particular, the chimeric polypep (60) Provisional application No. 61/758,518, filed on Jan. tides are single proteins wherein, in an intramolecular reac 30, 2013. tion, the binding domain stabilizes the membrane protein in a conformation of interest. Also provided are nucleic acid (30) Foreign Application Priority Data sequences encoding Such chimeric polypeptides, cells capable of expressing such chimeric polypeptides as well as Feb. 8, 2013 (EP) ...... 13154552.7 cellular compositions derived thereof. Also screening meth Oct. 3, 2013 (EP) ...... 13187265.7 ods for compounds using the chimeric polypeptides.
Patent Application Publication Dec. 31, 2015 Sheet 3 of 21 US 2015/0376261 A1
FIG. 4A
100
a. IC50high- 151 E-9 M C F 50 IC50= 3,13E-6M SS
O -12 10 -8 6 -4 log epinephrine), M
OO
C IC50high= 3.16E-9 M d F 50 IC50= 2,12E-6 M SS
-12 -10 -8 -6 -4 log isoprotenerol), M Patent Application Publication Dec. 31, 2015 Sheet 4 of 21 US 2015/0376261 A1
FIG. 4C
100
e
50 IC50= 6,91E-9 M SS IC50= 1,65E-9 M
logalprenolol), M
FIG. 4D
100
IC50high- 990E-9 M
i 50
12 ... O -8 -6 -4 log salbutamol, M Patent Application Publication Dec. 31, 2015 Sheet 5 of 21 US 2015/0376261 A1
FIG. 4E
100
c 3. SS 50 IC50= 3,59E-7M IC50= 8,27E-9 M
log IC 118,551, M
FIG. 4F
100
IC50= 3,96E-9 M
IC50= 1,59E-9 M
- 12 10 -8 -6 -4 log carvedilol), M Patent Application Publication Dec. 31, 2015 Sheet 6 of 21 US 2015/0376261 A1
FIG. 5A
100
50 IC50= 1,98E-6 M
log epinephrine, M
FIG. 5B
100
50 IC50= 3,96E-9 M i IC50= 8,62E-10 M
12 10 -8 -6 4. log carvedilol, M Patent Application Publication Dec. 31, 2015 Sheet 7 of 21 US 2015/0376261 A1
FIG. 6A
100
IC50high- 154E-9 M t
IC50= 3,13E-6 M 50 SS
2 ... O -8 -6 r4 log epinephrine, M
100
g IC50high=m 2.75E-9 M E 50 SS IC50= 2.2OF-7 M
log isoprotenerol, M Patent Application Publication Dec. 31, 2015 Sheet 8 of 21 US 2015/0376261 A1
FIG. 6C
100
c
50 IC50= 4,39E-9 M SS IC50=2,90E-9
O 12 10 -8 -6 -4 logalprenolol, M
100
g
E IC50= 5,13E-6 M
SS 50
log salbutamol), M Patent Application Publication Dec. 31, 2015 Sheet 9 of 21 US 2015/0376261 A1
F.G. 6E
100
IC50= 8,03E-7M F IC50= 7.75E-9 M SS
log IIC 118,551), M
F.G. 6F
1 OO
i IC50= 2,70E-9 M
log carvedilol), M Patent Application Publication Dec. 31, 2015 Sheet 10 of 21 US 2015/0376261 A1
FIG. 7
100
g F 50 SS
O 2O 40 SO temperature (C)
OO
a. d
s 50 SS
- 10 -8 -6 -4 log epinephrine, M
Patent Application Publication Dec. 31, 2015 Sheet 12 of 21 US 2015/0376261 A1
FIG 10A
IC50high- 7, 17E-6 M R s V 2. F 50 IC50= A4,82E-4M 82E-4 SS N
O -8 -6 -4 2 log carbachol, M
FIG 10B s 100
IC50high- 3,11E-7 M
50 C5OH. 9,84E-5 M t
log oxotremorine M, M
Patent Application Publication Dec. 31, 2015 Sheet 14 of 21 US 2015/0376261 A1
F.G. 12A
100
i IC50= 3,76E-7 M
log epinephrine, M
FIG. 12B
100
IC50= 105E-5 M 50 IC50= 8,05E-7E.7 M ;
-12 - 10 -8 6 -4 log ICI118,551), M Patent Application Publication Dec. 31, 2015 Sheet 15 of 21 US 2015/0376261 A1
FIG. 12C
OO
C 5 IC50= 144E-8M f 50 IC50= 1,46E-8M
12 -10 -8 -6 -4 log alprenolol, M
F.G. 13A
1OO KNS N O 3. t IC50 high= 153E-9 M f IC50= 1.31 E-6 M IC50= 2,84E-M 50 SS S
S O
O Y E. - 2 - 11 1 0 -9 -8 . 6 5 -4 -3 2 . log epinephrine), M Patent Application Publication Dec. 31, 2015 Sheet 16 of 21 US 2015/0376261 A1
FIG. 13B
100
s IC50high= 5,41E-9 M
A f IC50= 8,36E-7M IC50= 6.92E-5 M S
- 12 - 11 1 0 -9 -8 -7 -6 -5 4 3 2 1 log isoprotenerol), M
FIG. 13C
100
c IC50= 2,28E-8 50 t IC50= 6,04E-7 M SS IC50= 1,14E-8M
12 - 11 - 10 9 -8 -7 -6 -5 -4 3 2 - 1 log IC 118,551), M
Patent Application Publication Dec. 31, 2015 Sheet 19 of 21 US 2015/0376261 A1
FIG. 16A -o- MO1-NO33 100 H. Mor1-Nb10
75
50
25
O -12 - 11 -10 -9 -8 -7 -6 -5 -4 log (Dmt1-Dalda), M FIG. 16B
100
75
O 50
25
O -12 - 11 - 10 -9 -8 -7 -6 -5 -4 log (KGOPO1), M FIG. 16C
100
75
50
25
O -12 - 11 - 10 -9 -8 -7 -6 -5 -4 log naloxone), M Patent Application Publication Dec. 31, 2015 Sheet 20 of 21 US 2015/0376261 A1
go. r . s
FIG. 18A
AC23506 CCS823
O O
. 6 5 r -3 . w 5 -4 3. log fragment, M log fragment, M Patent Application Publication Dec. 31, 2015 Sheet 21 of 21 US 2015/0376261 A1
FIG. 18B CC43746 00 CC4494
8 8. e 5 60 25 60 #w 40 F 40 O S. S o 20 2
O . s s ra -3 f s 5 wa 3 log fragment, M. log fragment, M FIG. 18C
KVO8985 AWOO89
80 80 i s 6 25 60 40 F. O S S. 2 O
7 s s 4. -3 . s 5 4. 3. log fragment, M log fragment, M
100 ... CC5623 o IC50=126E-3M a C50= 5,60E-5 M
e F ... compound 9 . w 50 A C50= 2,55E-4M V. SS a C50= 3,59E-6 M W. V. W. -- compound 10 &. g IC50=248E- M N.
IC50= 2,64E-6 M St.
log ligand, M US 2015/0376261 A1 Dec. 31, 2015
NOVEL CHMERIC POLYPEPTIDES FOR phatases. And for many of these targets, the most stable SCREENING AND DRUG DSCOVERY conformation, corresponding to the prominent structural spe PURPOSES cies in the absence of ligands or accessory proteins (the basal conformation), does not correspond to the druggable confor CROSS-REFERENCE TO RELATED mation to which a drug must bind to be most effective for the APPLICATIONS therapeutic indication. 0001. This application is a national phase entry under 35 0005 Today, the most commonly targeted protein class for U.S.C. S371 of International Patent Application PCT/ medicinal intervention are G protein-coupled receptors EP2014/051845, filed Jan. 30, 2014, designating the United (GPCRs), also called seven-transmembrane receptors States of America and published in English as International (7TMRs). They play essential roles in physiological Patent Publication WO 2014/118297 A1 on Aug. 7, 2014, responses to a diverse set of ligands such as biogenic amines, which claims the benefit under Article 8 of the Patent Coop amino acids, peptides, proteins, prostanoids, phospholipids, eration Treaty and under 35 U.S.C. S 119(e) to U.S. Provi fatty acids, nucleosides, nucleotides, Ca" ions, odorants, sional Patent Application Ser. No. 61/758,518, filed Jan. 30, bitter and Sweet tastants, pheromones and protons (Heilker et 2013, and under Article 8 of the PCT to European Application al., 2009). Orthosteric ligands that act on a GPCR can induce Serial Nos. 13154552.7, filed Feb. 8, 2013, and 13/187265.7, a spectrum of effects on down-stream signaling pathways. In filed Oct. 3, 2013. general, GPCRs require agonist binding for activation. Full agonists maximally activate the receptor. Partial agonists STATEMENT ACCORDING TO 37 C.F.R. elicit a Submaximal stimulation even at Saturating concentra S1.821 (c) or (e) tions. In some cases, a GPCR may exhibit basal activity towards a specific signaling pathway even in the absence of an Sequence Listing Submitted as a TXT and PDF Files agonist (constitutive activity). Inverse agonists can inhibit this basal activity. Notably, whereas neutral antagonists can 0002 Pursuant to 37 C.F.R.S1.821(c) or (e), files contain inhibit binding of agonists, partial agonists, and inverse ago ing a TXT version and a PDF version of the Sequence Listing nists at the orthosteric binding site of GPCRs, they do not alter have been submitted concomitant with this application, the the basal receptor activity. In recent years, advances have contents of which are hereby incorporated by reference. been made in the discovery of novel ligands for GPCRs that TECHNICAL FIELD act at allosteric sites to regulate receptor function, including positive and negative allosteric modulators (PAMs and 0003. The disclosure relates to novel polypeptides and NAMs, respectively) and neutral ligands, which offer novel their use for Screening and drug discovery. More specifically, modes of action over orthosteric ligands (Christopoulos the disclosure provides chimeric polypeptides comprising a 2002). membrane protein, in particular a GPCR, fused to a binding 0006. It is now well established that GPCRs can signal domain, wherein the binding domain is directed against and/ through several distinct mechanisms including those medi or specifically binds to the membrane protein. In particular, ated by G proteins or the multifunctional adaptor proteins the chimeric polypeptides of the disclosure are single proteins B-arrestins (Rajagopal et al., 2010). With the structures of wherein, in an intramolecular reaction, the binding domain several GPCRs solved in complex with various ligands stabilizes the membrane protein in a conformation of interest. including inverse agonists, antagonists and agonists (Cher Also provided are nucleic acid sequences encoding Such chi eZov et al., 2007, Rasmussen et al., 2011b, Rosenbaum et al., meric polypeptides, cells capable of expressing Suchchimeric 2011, Shimamura et al., 2011, Xu 2011, Granier et al., 2012, polypeptides as well as cellular compositions derived thereof. Haga et al., 2012, Hanson et al., 2012, Kruse et al., 2012, Also envisaged are screening methods for compounds using Manglik et al., 2012, Wu et al., 2012, Zhang et al., 2012) and the chimeric polypeptides of the disclosure. the G-protein (Rasmussen et al., 2011a), we now know that GPCRs are conformationally complex molecules with spe BACKGROUND cific conformations causing G protein activation. Of special 0004 Drug discovery efforts generally focus on the iden significance in the context of this disclosure is the observation tification of compounds that modulate, inhibit or enhance the that in comparison to the basal conformation, only relatively activity of the target of interest. Conventional lead identifica Small changes in the structure of the agonist binding pocket tion efforts proceed viabiochemical or cell based screening or led to Substantial movement (up to 141) and rearrangements in silico compound design. These methods have identified in three of the transmembrane segments (Lebon et al., 2012). and validated a multitude of viable therapeutics in use today. 0007 Mass-spectrometry-based strategies (Kahsai et al., However, as reflected by the high failure rate of new drug 2011), biophysical analysis (Yao et al., 2006, Mary et al., compounds (only an estimated 8% of phase I clinical thera 2012) and NMR spectroscopy (Liu et al., 2012; Bokochet al., peutics eventually gain Food and Drug Administration 2010) provide direct evidence for the presence of other dis approval, at a conservative cost of S800 million per drug), tinct ligand-specific conformations that lead to arrestin medi many efforts are unsuccessful and often targets are aban ated signaling. It follows that different ligands can have dif doned once they are deemed undruggable (Lee et al., 2009). A ferential effects on the conformation and the diverse signaling considerable part of these failures are due to the fact that most and regulatory repertoire of a single receptor. The importance biochemical or cell based assays are performed on targets in of these multiple conformational states is their pharmacologi their prominent conformation, also referred to as the basal cal relevance. As illustrated in FIG. 1, each of these receptor conformation. However, we now know that conformational conformations can be considered as a separate therapeutic flexibility is key to the function and the pharmacology of the drug target because each of these conformations promotes majority of the current and future drug targets including distinct relative efficacies toward the different effector sys GPCRs, ion channels, (nuclear) receptors, kinases and phos tems including G proteins and arrestins. US 2015/0376261 A1 Dec. 31, 2015
0008 Drug discovery approaches can take considerable agonists generally do not sufficiently stabilize the receptor for advantage from capturing the target in a therapeutically rel the formation of diffraction-quality crystals. In an attempt to evant "druggable' conformation. Stabilizing a receptor in a Solve this problem, agonists have been covalently bound to particular functional conformation would inherently freeze GPCRs for crystallization purposes. However, for example, the receptor in a single, disease relevant druggable conforma the crystal structure of a covalent agonist-bound BAR tion revealing new structural features that are suitable for reveals a conformation closely resembling an inactive state targeting with Small molecules or biologicals and may enable rather than the active state with only little rearrangements in the identification of compounds that are selective for that the transmembrane segments (Rosenbaum et al., 2011) (Le druggable conformation. The stabilization of a unique drug bon et al., 2012). gable conformation, including inactive states corresponding 0012 Another approach towards determining agonist to effector systems below basal activity or particular func bound conformations of a GPCR is thermostabilization of the tional states that activate individual effector systems could receptor via systematic mutagenesis followed by measuring not only lead to compounds with better therapeutic efficacies increased thermostability in the presence of bound agonist but could also benefit the identification of compounds with (e.g., WO2008114020, WO200907 1914, WO2010149964, less undesirable side effects that result from triggering undes WO20120984.13). For example, thermostabilizing mutations ired pathways (Galandrin et al., 2007). have been discovered for the agonist-bound AAR (Lebonet 0009 Further to that, conformational flexibility is an issue al., 2011), the agonist bound B1-adrenergic receptor (Warne in high-throughput screening (HTS) and fragment-based et al., 2011) and the agonist bound neurotensin receptor drug discovery (FBDD) (Lawson 2012). In HTS, issues of (White et al., 2012). However, the structures of these agonist different conformations of a target can in some cases be bound stabilized receptors are likely not in the fully active overcome by using whole-system assays with a functional conformation, judged on the Small displacement of trans readout rather than reductionist recombinant systems assays membrane helix 6. More important and in contrast to the (Kenakin, 2009; Rajagopal et al., 2010). In FBDD, however, active state that is stabilized by a G-protein or a G-protein whole-system assays cannot be used because of the low effi mimic, these thermostabilized receptors show no significant cacy/potency of the initial hits, often requiring mM concen increase in the affinities for their respective agonists (Ser trations of the fragments for biological activity and causing rano-Vega et al., 2008, Shibata et al., 2009, Lebon et al., toxicity. It follows that high-throughput primary screens 2011). would benefit considerably from target receptors that are 0013. Only recently, it became possible to obtain struc stabilized in the desired functional conformation in the tures of an agonist-bound active state of a GPCR, making use absence of ligands or accessory proteins. Access to Such of conformationally selective Nanobodies (XAPERONETM) that conformationally stabilized receptors would allow the iden mimic G protein function and increase the affinity for ago tification of the subset of ligands that are specific for that nists at the orthosteric site (Rasmussen et al., 2011b). Xaper conformation with its particular structural features (FIG. 1). ones are useful tools to lock the structure of GPCRs in a In this way, a first selection of the potentially biologically therapeutically relevant conformation (Steyaert & Kobilka, active compounds can be made using simple assessment of 2011) and facilitate the discovery of drug candidates by binding before establishing their efficacy profiles in a variety increasing the sensitivity and selectivity of existing screening of (whole-system) signaling assays. methods (WO2012007593). However, this technological 0010 Conformational flexibility also obstructs structure approach also has its limitations. Because the binding of the based drug discovery starting from fragments. First, many of agonist at the orthosteric site increases the affinity for the the potential hits of fragment-based screening (FBS) are not G-protein mimicking XAPERONETM at the allosteric intracellu potent enough to quantitatively displace the conformational lar side of the receptor and vice versa (Rasmussen et al., equilibrium into a single conformation of the protein-ligand 2011b), the GPCR-XAPERONETM complex is much more stable complex that can be crystallized in a diffracting crystal. If a in the presence of an agonist. It follows that a GPCR, a complex cannot be crystallized, soaking existing crystals of stabilizing XAPERONETM and agonist have to be co-crystallized ligand-free protein with (small) ligands is often the method of to obtain crystals of the GPCR in its active conformation and choice to obtain crystals of the complex. However, if these that the disclosure described in WO2012007593 is not very ligands displace the conformational equilibrium of a confor well Suited for structure based drug discovery approaches mationally complex protein, these induced conformational involving, for example, soaking of ligands in existing crystals changes will in many cases destroy the crystals (Danley because the agonist that has been used to grow the crystals 2006). will compete with the ligand that is soaked in Subsequently. 0011. With the structures of the first GPCRs solved in 0014 Thus, the development of new methods that consti 2007 (Rasmussen et al., 2007, Rosenbaum et al., 2007), we tutively stabilize GPCRs in a particular druggable conforma entered the new era of GPCR structural biology raising the tion, even in the absence of agonists, would be an important possibility of applying structure-based approaches to GPCR asset to improve drug discovery via compound screening drug discovery efforts (Shoichet and Kobilka 2012). For a and/or structure based drug design. large number of GPCR drug targets relating to several thera peutic indications, the agonist-bound active-state is often the BRIEF SUMMARY druggable conformation. Resolving the structure at high reso 00.15 Provided is a drug target that is stabilized in a thera lution of a GPCR in this therapeutically relevant "druggable' peutically relevant conformation. This approach captures the conformation remains a challenge. Efforts to obtain an ago target in a conformation of interest to reveal novel structural nist-bound active-state GPCR structure have proven difficult features suitable for targeting with small molecules or bio due to the inherent instability of this state in the absence of a logicals for therapeutic intervention. The constitutive stabili G protein. Structures of GPCRs in complex with full agonists Zation of a unique conformation of the drug target is obtained have been solved but not without difficulties. First, natural by fusing the drug target of interest with a conformation US 2015/0376261 A1 Dec. 31, 2015
selective binding domain, optionally separated by a linker, conformation by exogenous addition of a conformation-se and is the result of an intramolecular reaction of both moieties lective binding domain (WO2012007593), neither in a cellu within a single protein. The resulting fusion polypeptides, lar system whereby a GPCR is co-expressed with a confor herein also referred to as chimeric polypeptides, are particu mation-selective binding domain. A particular advantage larly interesting since they may have structural properties that related to the defined 1:1 stoichiometry is that the binding differ significantly from the drug target in the non-chimeric domain moiety can constrain a particular receptor conforma form and as Such may serve as novel innovative tools for the tion at a high, effective intramolecular concentration, even in development of new, more potent or more selective drugs. It the absence of any conformation-selective ligand (see will be appreciated that while the disclosure has been exem Example 8). plified with GPCRs, it is equally applicable to any membrane 0018 HTS based on classical receptor binding techniques protein. Such as radioligand competition (inhibition or displacement) 0016 One key advantage of the chimeric polypeptides of assays to selectively screen for a Subset of ligands that are the disclosure is that a defined 1:1 stoichiometry of GPCR to specific for a particular druggable conformation of a given binding domain is ensured in a single protein, forcing the GPCR may benefit considerably from the chimeric polypep physical proximity of the fusion partners, while maintaining tides of the disclosure as compared to non-covalent com the properties of the binding domain to stabilize the receptor plexes of the GPCR with a Single-domain antibody that sta in a particular druggable conformation. To illustrate this, and bilizes the druggable conformation (WO2012007593) without the purpose of being limitative, several genetic (Rasmussen et al., 2011b). This is due to the fact that radio fusions of the gene segments encoding a GPCR and a con ligand competition assays (or competition assays of ligands formation-selective Single-domain antibody have been con labeled by another means) critically rely on the physical structed (see examples 1, 9, 13, 17, 20) and the pharmaco separation of free ligand and receptor-bound ligand. This is logical properties of the expressed GPCR-Single-domain commonly done by filtration on a filter, by centrifugation, by antibody fusion polypeptides have been analyzed (see size exclusion chromatography or by other biophysical meth examples 6, 8, 12, 16, 19, 22, 24-25). We show that the ods. Separating free ligand (labeled by any means) from properties of particular panels of Nanobodies, such as those labeled ligand bound to the GPCR-binding domainfusion can that stabilize active conformations of GPCRs or those that be easily achieved using the same conventional methods stabilize inactive conformations of GPCRs, are maintained in because the chimer is covalently linked in a defined 1:1 sto Such 1:1 genetic fusions. For example, the B2 adrenergic ichiometry of GPCR to binding domain. In case the binding receptor (B2AR) fused to Nb80, a Single-domain antibody domain is not covalently linked to the GPCR that mimics G protein function and Stabilizes the active con (WO2012007593), radioligand competition assays and the formation coupled to G protein signaling (WO2012007593), Subsequent analysis of the data are much more difficult to shows a 2072 fold increased affinity for the natural agonist perform because the 1:1 stoichiometry of GPCR to binding epinephrine and exhibits a 43 fold decreased affinity for the domain does not hold, implying much more molecular spe inverse agonist ICI118,551, compared to the receptor fused to cies to be separated and analyzed: free ligand, free binding a mock Single-domain antibody that is not directed against domain, ligand-receptor complex, receptor-binding domain and does not specifically bind to B2AR (see Example 6). The complex, ligand-receptor-binding domain complex versus finding that the B2AR-Nb80 fusion binds the natural agonist free ligand, free chimer and ligand-chimer complex in the epinephrine 2000-fold tighter than B2AR fused to a mock case of a GPCR-binding domain fusion (see Example 8). Single-domain antibody indicates that these conformation 0019. Further, the innovative features of the GPCR-bind ally constrained fusion proteins show increase in ligand ing domain fusion proteins of the disclosure also allows par affinities relating to a particular effector System like G-pro ticular functional conformations of GPCRs to be screened for tein mediated signaling. The observation that the B2AR the binding of lead compounds or fragments using emerging Nb80 fusion also shows an increased affinity for synthetic biophysical methods including Surface plasmon resonance agonists such as isoproterenol or salbutamol indicates that (Rich et al., 2011) and target immobilized NMR screening Such conformationally constrained fusion proteins may pro (Fruh et al., 2010), because the GPCR can be immobilized as vide a better starting point to screen for synthetic compounds a single protein fusion in the desired functional conformation or biologicals that trigger/inhibit particular signaling path on the solid phase in a defined 1:1 stoichiometry of GPCR to ways. Accordingly, Small molecules or fragments that selec binding domain. tively recognize structural features of orthosteric or allosteric 0020. Furthermore, it is particularly surprising that the sites that are unique to the active conformation of B2AR GPCR-binding domain fusion proteins of the disclosure (leading to G protein coupled signaling) may bind up to 3 allow to Screen for and discriminate between agonists, orders of magnitude tighter to the B2AR-Nb80 1:1 fusion antagonists and inverse agonists in one single comparative compared to the receptor not constrained in its active state. radioligand competition assay. The ability to discriminate and For HTS purposes, this means that the sensitivity to pick up predict the mode of action of tested compounds at nM-uM test compounds that induce G protein coupled signaling may concentrations without the need for a cellular receptor signal be increased with 3 orders of magnitude if Such screening is ing assay is an additional advantage for compound screening performed on a GPCR-Nb fusion such as the B2AR-Nb80 (see examples 24-26). fusion, compared to HTS efforts on B2AR not constrained in 0021. Another advantage of these GPCR-binding domain its active state. fusion proteins in a defined 1:1 stoichiometry relates to X-ray 0017. The well-defined 1:1 stoichiometry of the intramo crystallography of GPCRs and its applications in structure lecular interaction between the GPCR and the binding based drug design. More particularly, one advantage of the domain of the chimeric polypeptides of the disclosure cannot GPCR-binding domainfusion is that the fusion protein can be be maintained/guaranteed as efficiently in intermolecular purified and crystallized in a defined 1:1 stoichiometry in the interactions, nor with a GPCR that is stabilized in a specific presence or absence of any ligand. Multiple ligand-receptor US 2015/0376261 A1 Dec. 31, 2015 co-complex structures can thus be determined, just by Soak the immunoglobulin single variable domain comprises a ing compounds into the ligand free GPCR-binding domain VHH sequence or a Single-domain antibody sequence. fusion, with the additional advantage that this crystal system 0026. In another aspect, the disclosure envisages a com is trapped in a predefined receptor conformation Such as, for plex comprising a chimeric polypeptide, as described above, example, an active conformation leading to G protein and/or and a receptor ligand. Such a complex may be in Solution or B-arrestin coupled signaling, or an inactive conformation crystalline. unable to promote G protein and/or arrestin-coupled signal 0027. Further, nucleic acid molecules comprising a ing. This possibility to Soak/co-crystallize ligand free recep nucleic acid sequence encoding the chimeric polypeptide, as tor with (low affinity) lead compounds is a prerequisite for described above, as well as host cells comprising Such nucleic lead generation involving virtual screening and during the acids are also encompassed. Host cells can be of prokaryotic lead optimization part of drug discovery, for example, to or eukaryotic origin, Such as a bacterial cell, a yeast cell, a address selectivity and solubility issues. mammaliancell, an insect cell. Also envisaged are membrane 0022. Thus, according to a first aspect, the disclosure compositions comprising the chimeric polypeptide or the relates to a chimeric polypeptide comprising a GPCR moiety complex, as described herein. and a binding domain moiety. More particularly, the chimeric 0028. One other aspect of the disclosure relates to a polypeptide of the disclosure comprises a GPCR fused to a method to produce a chimeric polypeptide comprising a binding domain, wherein the binding domain is directed GPCR fused to a binding domain, the method comprising the against and/or capable of specifically binding to the GPCR in steps of culturing a host cell comprising the chimeric an intramolecular interaction. According to a particular polypeptide, as described hereinbefore, under suitable con embodiment, the binding domain is fused to the GPCR either ditions and optionally isolating the chimeric polypeptide. directly or through a linker. In a particular embodiment, the 0029. Further, the disclosure also provides for a method to binding domain is not a naturally-occurring binding partner, display a GPCR in an active or inactive conformation at the Such as a G protein or an arrestin. cellular surface or in a particular cellular membrane fraction 0023 Preferably, the binding domain as comprised in the of a host cell, the method comprising the steps of providing a chimeric polypeptide is a conformation-selective binding host cell comprising a chimeric polypeptide, as described domain. According to one particular embodiment, the disclo above, and culturing the cell under Suitable conditions to sure relates to a chimeric polypeptide comprising a GPCR express the chimeric polypeptide. fused to a binding domain that is selective for the active 0030. A further aspect of the disclosure is a method of conformation, so that the GPCR is stabilized in an active identifying conformation-selective compounds, the method conformation upon binding of the binding domain. Accord comprising the steps of ing to specific embodiments, the active conformation is an 0031 (i) Providing a chimeric polypeptide, as described agonist-bound active conformation, such as a full agonist above, and bound active conformation or a partial agonist-bound active 0032 (ii) Providing a test compound, and conformation. Alternatively, the disclosure also relates to a 0033 (iii) Evaluating the selective binding of the test com chimeric polypeptide comprising a GPCR fused to a binding pound to the GPCR comprised in the chimeric polypeptide. domain that is selective for an inactive conformation, so that the GPCR is stabilized in an inactive conformation upon 0034. The conformation-selective compound (a small binding of the binding domain. According to one embodi molecule, an antibody, an antibody derivative, a peptide or any other protein scaffold that may interact with a GPCR) that ment, the inactive conformation is an inverse agonist-bound is identified by the above method may be an unbiased agonist, inactive conformation. Preferably, the chimeric polypeptide an unbiased inverse agonist, or biased ligands that trigger or of the disclosure comprising a GPCR fused to a conforma inhibit G-protein coupled or arrestin coupled signaling, tion-selective binding domain has an increased affinity for a respectively. According to a particular embodiment, the conformation-selective ligand as compared to the corre method as described above, further comprises the step of sponding GPCR alone. classifying the test compounds according to biological activ 0024. According to more specific embodiments, the dis ity (agonist activity, inverse agonist, antagonist activity). Or closure provides for chimeric polypeptides, as described in other words, the above-described method allows discrimi above, wherein the binding domain specifically binds to an nating between agonists, inverse agonists and antagonist intracellular conformational epitope of the GPCR, more par activity. ticularly wherein the intracellular epitope is comprised in a binding site for a downstream signaling protein (e.g., a G 0035 Also encompassed is the use of a chimeric polypep protein binding site). Alternatively, the disclosure provides tide, as described above, or a complex, as described above, to for chimeric polypeptides, as described above, wherein the crystallize and/or to solve the structure of the GPCR; to binding domain binds to an extracellular conformational capture a GPCR in a functional conformational state. epitope of the GPCR. 0036 Further aspects and preferred embodiments of the disclosure are defined in the description below and in the 0025. According to other specific embodiments, the bind appended claims. ing domain that form part of the chimeric polypeptide, as described above, comprises an amino acid sequence that BRIEF DESCRIPTION OF THE DRAWINGS comprises 4 framework regions (FR1 to FR4) and 3 comple mentary determining regions (CDR1 to CDR3), or any suit 0037 FIG. 1: Conformational complexity of GPCR sig able fragment thereof. More specifically, the binding domain naling. Schematic representation of ligand-biased efficacy, may be an immunoglobulin single variable domain, prefer where three different ligands can induce and/or stabilize dif ably an immunoglobulin single variable domain that is ferent receptor conformations that will each promote distinct derived from a heavy chain only antibody. Most preferably, relative efficacies toward different effector systems. Abbre US 2015/0376261 A1 Dec. 31, 2015 viations: R, receptor; A, B and C, proteins or group of proteins for binding to B2AR365N-Nb80 (open squares), and using implicated in a specific signaling pathway. (Adapted from the non-fused B2AR365N receptor (closed squares) as an Galandrin et al., 2007). internal reference for the non-constrained B2 adrenergic 0038 FIGS. 2A-2E: The B2AR-Single-domain antibody receptor as described in Example 6. Competition assays were fusions described in Example 1 contain two different proteins performed on both receptors using the natural agonist epi connected with a peptide linker: the GPCR B2AR365N, the nephrine (FIG. 5A), and the antagonist carvedilol (FIG. 5B) linker GGGGSGGGS (underlined and highlighted in bold), a as the competing ligand, respectively. Curves have been fitted Single-domain antibody. Underlined is the HA signal peptide by non-linear regression to a model for competitive binding and the His peptide tag. The FLAG-tag is represented in using the standard settings of Graphpad Prism 6.0. IC50 bold, the TEV cleavage site is indicated in grey shade. FIG. labeled values have been fitted to a one binding site competi 2A. Cartoon representation of the B2AR-Single-domain anti tive model. IC50's" labeled values have been fitted to a two body fusion constructs. FIG.2B. The amino acid sequence of binding site competitive binding model and correspond to the the open reading frame encoded by pFastEac B2AR365N IC50 of the highest affinity site. Nb80. FIG.2C. The amino acid sequence of the open reading 0042 FIGS. 6A-6F: Ligand binding properties of frame encoded by pFastBac B2AR365N-Nb71. FIG. 2D. The |B2AR365N-Nb71 fusion compared to B2AR365N-Nb69 amino acid sequence of the open reading frame encoded by fusion. Radioligand displacement assays of different ligands pFastBac B2AR365N-Nb69. FIG. 2E. The amino acid competing with 3H]-dihydroalprenolol (3H-DHA) for sequence of the open reading frame encoded by pFastBac binding to B2AR365N-Nb71 (open triangles), and using the B2AR365N-Nb60. B2AR365N-Nb69 chimer (closed triangles) as an internal 0039 FIG. 3: Expression of recombinant B2AR-Single reference for the non-constrained B2 adrenergic receptor as domain antibody fusion proteins in Sf9 cells analyzed by described in Example 6. Competition assays were performed Western Blot. The presence of fusion protein was detected by on both receptors using the natural agonist epinephrine (FIG. anti-FLAG detection as explained in Example 4. Membranes 6A), the full agonist isoproterenol (FIG. 6B), the neutral of non-infected Sf9 cells (lane 1). Membranes of Sf9 cells antagonist alprenolol (FIG. 6C), the partial agonist salbuta expressing recombinant B2AR365N that was not fused to any mol (FIG. 6D), the inverse agonist ICI-118,551 (FIG. 6E) and Nb (lane 2: cells were infected with a 1:250 dilution of P2 and the antagonist carvedilol (FIG. 6F) as the competing ligand, cultured for 48 hours; lane 3: cells were infected with a 1:250 respectively. Curves have been fitted by non-linear regression dilution of P2 and cultured for 55 hours; lane 5: cells were to a model for competitive binding using the standard settings infected with a 1:100 dilution of P2 and cultured for 48 hours; of Graphpad Prism 6.0. IC50 labeled values have been fitted lane 6: cells were infected with a 1:100 dilution of P2 and to a one binding site competitive model. IC50'8' labeled cultured for 55 hours). Protein marker (PAGERULERTM values have been fitted to a two binding site competitive Prestained Protein Ladder, Fermentas cat. Nr SMO671) (lane binding model and correspond to the IC50 of the highest 4). Membranes of Sf9 cells expressing recombinant affinity site. |B2AR365N-Nb80 (lane 7: cells were infected with a 1:100 dilution of P2 and cultured for 55 hours). Membranes of Sf9 0043 FIG. 7: Thermostability of the B2AR365N-Nb80 cells expressing recombinant B2AR365N-Nb71 (lane 8: cells fusion compared to 32AR365N-Nb69 fusion. Thermostabili were infected with a 1:100 dilution of P2 and cultured for 55 ties of the ligand free DDM solubilized fusion proteins hours). Membranes of Sf9 cells expressing recombinant |B2AR365-Nb80 (open diamonds) and B2AR365N-Nb69 |B2AR365N-Nb69 (lane 9: cells were infected with a 1:100 (closed diamonds). Thermostability assays were performed dilution of P2 and cultured for 55 hours). in the absence of any ligand on solubilized receptors in 0.08% 0040 FIGS. 4A-4F: Ligand binding properties of DDM, as described in Example 7. Curves have been fitted by |B2AR365N-Nb80 fusion compared to B2AR365N-Nb69 non-linear regression with the log(agonist) versus response mock fusion. Radioligand displacement assays of different variable slope (four parameters) equation using Prism using ligands competing with H-dihydroalprenolol (H-DHA) Graphpad Prism 6.0 (GraphPad Software, San Diego, Calif.). for binding to B2AR365N-Nb80 (open circles), and using the 0044 FIG. 8: Ligand binding properties of B2AR365N B2AR365N-Nb69 chimer (closed circles) as an internal ref Nb80 fusion compared to the non-fused B2AR365N in com erence for the non-constrained B2 adrenergic receptor as plex with exogenously added Nb80. Radioligand displace described in Example 6. Competition assays were performed ment assays of epinephrine competing with H on both receptors using the natural agonist epinephrine (FIG. dihydroalprenolol (H-DHA) for binding to non-fused 4A), the agonist (-)-isoproterenol (FIG. 4B), the neutral B2AR365N receptor in the presence of different concentra antagonist alprenolol (FIG. 4C), the partial agonist Salbuta tions of Nb80 (500 nM Nb80: closed triangles, 50 nM Nb80: mol (FIG. 4D), the inverse agonist ICI-118,551 (FIG. 4E), closed diamonds, 5 nM Nb80: closed inverted triangles and and the antagonist carvedilol (FIG. 4F) as the competing 50 pMNb80: closed squares; dashed lines) or in the presence ligand, respectively. Curves have been fitted by non-linear of different concentrations of Nb69 (500 nM Nb69: open regression to a model for competitive binding using the stan triangle, 50 pM Nb69 open squares; dotted lines). The dard settings of Graphpad Prism 6.0. IC50 labeled values =2AR365N-Nb80 fusion (closed circles, full line) and the have been fitted to a one binding site competitive model. B2AR365N-Nb69 fusion (open circles, full line) were used as IC50' labeled values have been fitted to a two binding site internal reference in the assay, as described in Example 8. competitive binding model and correspond to the IC50 of the Curves have been fitted by non-linear regression to a model highest affinity site. for competitive binding using the standard settings of Graph 004.1 FIGS. 5A & 5B: Ligand binding properties of pad Prism 6.0. IC50 labeled values have been fitted to a one B2AR365N-Nb80 fusion compared to non-fused binding site competitive model. IC50" labeled values have B2AR365N. Radioligand displacement assays of different been fitted to a two binding site competitive binding model ligands competing with H-dihydroalprenolol (H-DHA) and correspond to the IC50 of the highest affinity site. US 2015/0376261 A1 Dec. 31, 2015
004.5 FIGS. 9A-9C. The M2R-Single-domain antibody values have been fitted to a two binding site competitive fusion, described in Example 9 contains two different pro binding model and correspond to the IC50 of the highest teins connected with a peptide linker: the GPCRM2Ai3R, the affinity site. linker GGGSGGGGSGGGGSGGGGSGGGS (underlined 0049 FIGS. 13 A-13C: Ligand binding properties of and highlighted in bold) (SEQ ID NO:49) and a Single |B2AR365N-Nb60 fusion compared to B2AR365N-Nb69 domain antibody. Underlined is the HA signal peptide and the mock fusion. Radioligand displacement assays of different His peptide tag. The FLAG-tag is represented in bold, the ligands competing with H-dihydroalprenolol (H-DHA) TEV cleavage site is indicated in grey shade. FIG.9A. Car for binding to B2AR365N-Nb80 (open circles), B2AR365N toon representation of the M2R-Single-domain antibody Nb60 (crossed open circles), using the B2AR365N-Nb69 fusion construct. FIG. 9B. The amino acid sequence of the chimer (closed circles) as an internal reference for the non open reading frame encoded by pFastEac1 M2Ai3R. FIG.9C. constrained B2 adrenergic receptor, as described in Example The amino acid sequence of the open reading frame encoded 19. Competition assays were performed on the B2-receptors by pFastBac1 M2Ai3R-Nb9-1. fusions using the natural agonist epinephrine (FIG. 13A), the agonist (-)-isoproterenol (FIG. 13B) and the inverse agonist 0046 FIGS. 10A & 10B: Ligand binding properties of ICI-118,551 (FIG. 13C) as the competing ligand, respec M2Ai3R-Nb9-1 compared to the free non-fused M2Ai3R. tively. Curves have been fitted by non-linear regression to a Radioligand displacement assays of different ligands com model for competitive binding using the standard settings of peting with HI-N methyl scopolamine (HI-NMS) for Graphpad Prism 6.0. IC50 labeled values have been fitted to binding to M2Ai3R-Nb9-1 (closed circles), and using the a one binding site competitive model. IC50' labeled values M2Ai3R (crossed circles) as an internal reference for the have been fitted to a two binding site competitive binding non-constrained muscarinic receptor M2, as described in model and correspond to the IC50 of the highest affinity site. Example 12. Competition assays were performed on both 0050 FIG. 14. AA sequence alignment of full length wild receptors using the agonist carbachol (FIG. 10A) or the ago type human Mor1 (Uniprot code P35372: SEQ ID NO:46) nist oxotremorineM (FIG. 10B) as the competing ligand, and mouse Mor1 (Uniprot code P42866: SEQID NO:45). For respectively. Curves have been fitted by non-linear regression the purification of mouse Mor1 expressing in Sf9 cells, an to a model for competitive binding using the standard settings N-terminal TEV (N-terminus; insect cell expression of of Graphpad Prism 6.0. IC50 labeled values have been fitted mouse Morl) protease cleavage site has been introduced to a one binding site competitive model. IC50" labeled between the two underlined Glycines. A C-terminal 3C pro values have been fitted to a two binding site competitive tease cleavage site has also been introduced between the binding model and correspond to the IC50 of the highest underlined isoleucine and the underlined glutamic acid in affinity site. mouse and human Mor1 expressed in Sf9. The theoretical 0047 FIGS. 11A-11C: The B1AR-Single-domain anti intracellular loops (ICL) and the intracellular C-terminus body fusions, described in Example 13 contains two different according to the Uniprot database are depicted in grey shade. proteins connected with a peptide linker: the GPCR human AA residues that have been deleted in the Mor-Single-domain B1AR, the linker antibody fusion constructs are striked-through. 0051 FIGS. 15A-15E: The Mor1-Single-domain anti body fusions, described in Example 20 contain two different (SEQ ID NO: 6O) proteins connected with a peptide linker: the GPCRMor1, the GGGGSGGGGSGGGGSGGGGSGGGS 34 GS linker (underlined and highlighted in bold) and a Single-domain antibody. Underlined is the HA signal peptide (underlined and highlighted in bold) and a Single-domain and the His peptide tag. The FLAG-tag is represented in antibody. Underlined is the HA signal peptide and the His bold. The 3C cleavage site is indicated in grey shade. FIG. peptide tag. The FLAG-tag is represented in bold, the TEV 15A. Cartoon representation of the Mor1-Single-domain cleavage site is indicated in grey shade. FIG. 11 A. Cartoon antibody fusion constructs. FIG. 15B-FIG. 15E. The amino representation of the B1AR-Single-domain antibody fusion acid sequence of the four Mor-Nb open reading frames (SEQ constructs. FIG. 11B. The amino acid sequence of the open ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID reading frame encoded by pFastBach? 1AR-Nb80. FIG. 11C. NO:12, respectively). The amino acid sequence of the open reading frame encoded 0052 FIGS. 16A-FIG.16C: Ligand binding properties of by pFastBach B1AR-Nb69. hMor1-Nb33 fusion compared to hMor1-Nb10 mock fusion. 0048 FIGS. 12A-12C: Ligand binding properties of Radioligand displacement assays of different ligands com hß1AR-Nb80 fusion compared to h31AR-Nb69 fusion. peting with radioligand for binding to hMor1-Nb33 (circles) Radioligand displacement assays of different ligands com using the hMor1-Nb10 chimer (squares) as an internal refer peting with H-dihydroalprenolol (H-DHA) for binding ence for the non-constrained receptor. Competition assays to h31AR-Nb80 (open circles), and using the h? 1AR-Nb69 were performed on both receptors using agonists Dmt1 chimer (closed circles) as an internal reference for the non Dalda (FIG. 16A), KGOP01 (FIG. 16B), and antagonist constrained B1 adrenergic receptor, as described in Example naloxone (FIG.16C) as the competing ligand. 16. Competition assays were performed on both B1-receptors 0053 FIG. 17. Comparative fragment binding with differ fusions using the natural agonist epinephrine (FIG. 12A), the ent activity profiles to B2AR-fusions. inverse agonist ICI-118,551 (FIG. 12B) and the neutral 0054 Representative example of binding of 6 fragments to antagonist alprenolol (FIG. 12C) as the competing ligand, the active-state stabilized B2AR365N-Nb80 fusion (open respectively. Curves have been fitted by non-linear regression bars) versus the prominent, non-constrained conformation to a model for competitive binding using the standard settings B2AR365N-Nb69 fusion (black bars), measured by radioli of Graphpad Prism 6.0. IC50 labeled values have been fitted gand displacement assays using H-dihydroalprenolol to a one binding site competitive model. IC50" labeled (H-DHA) as the radioligand. 2 fragments (AC23506, US 2015/0376261 A1 Dec. 31, 2015
CC56213) show an agonist profile, 2 fragments (CC46746, Sure shall have the meanings that are commonly understood CC44914) have an antagonistic profile and 2 fragments by those of ordinary skill in the art. Generally, nomenclatures KMO8985) show an inverse agonist profile. used in connection with, and techniques of molecular and 0055 FIGS. 18A-18C. Dose response curves of 6 frag cellular biology, structural biology, biophysics, pharmacol ments to B2AR-Nb80 fusion compared to B2AR-Nb69 ogy, genetics and protein and nucleic acid chemistry fusion. described herein are those well-known and commonly used in 0056 Radioligand displacement assays of 6 different frag the art. The methods and techniques of the disclosure are ments competing with H-dihydroalprenolol (H-DHA) generally performed according to conventional methods well for binding to B2AR365N-Nb80 (open circles) and using the known in the art and as described in various general and more B2AR365N-Nb69 chimer (closed circles) as an internal ref erence for the non-constrained B2 adrenergic receptor, as specific references that are cited and discussed throughout the described in Example 24. Competition assays were per present specification unless otherwise indicated. See, for formed on the B2-receptors fusions using 2 fragments with example, Sambrook et al. Molecular Cloning: A Laboratory agonist profile (A), 2 fragments with antagonist profile (B) Manual, 3th ed., Cold Spring Harbor Laboratory Press, Cold and 2 fragments with the inverse agonist profile (C) as the Spring Harbor, N.Y. (2001); Ausubel et al., Current Protocols competing ligand, respectively. Curves have been fitted by in Molecular Biology, Greene Publishing Associates (1992, non-linear regression with the log(agonist) versus response and Supplements to 2002); Rup, Biomolecular crystallogra variable slope (four parameters) equation using Prism using phy: principles, Practice and Applications to Structural Biol Graphpad Prism 6.0. (GraphPad Software, San Diego, Calif.). ogy, 1 edition, Garland Science, Taylor & Francis Group, 0057 FIG. 19: Binding properties of elaborated fragments LLC, an informa Business, N.Y. (2009); Limbird, Cell Sur to the B2AR-Nb80 fusion compared to the B2AR-Nb69 mock face Receptors, 3d ed., Springer (2004). fusion. Radioligand displacement assays of different elabo 0060. The terms “chimeric polypeptide.” “chimeric pro rated and original parent fragments competing with H tein.” “fusion polypeptide.” “fusion protein’ are used inter dihydroalprenolol (H-DHA) for binding to B2AR365N changeably herein and refer to a protein that comprises at Nb80 (closed symbols), using the B2AR365N-Nb69 chimer least two separate and distinct polypeptide components that (open symbols) as an internal reference for the non-con may or may not originate from the same protein. The polypep strained 32 adrenergic receptor. Competition assays were tide components, while typically unjoined in their native performed on the B2-receptors fusions using (A) the state, are joined by their respective amino and carboxyl ter CC40246 (full line), the elaborated fragments: compound 2 mini through a peptide linkage to form a single continuous (dashed line) and compound 3 (dotted line) as the competing polypeptide. For example, a protein of interest fused to an ligand, respectively, and (B) the CC56213 (full line), the antibody is an example of a chimeric protein. A convenient elaborated fragments: compound 9 (dashed line) and com means for linking or fusing two polypeptides is by expressing pound 10 (dotted line) as the competing ligand, respectively. them as a fusion protein from a recombinant nucleic acid Curves have been fitted by non-linear regression to a model molecule, which comprises a first polynucleotide encoding a for competitive binding using the standard settings of Graph first polypeptide operably linked to a second polynucleotide pad Prism 6.0. IC50 labeled values have been fitted to a one encoding the second polypeptide. Otherwise, the polypep binding site competitive model. tides comprised in a fusion protein can be linked through peptide bonds that result from intein-mediated protein splic DETAILED DESCRIPTION ing (Muralidharan and Muir 2006) or sortagging (Popp et al., 2007) or may be chemically linked by any other means. Definitions Typically, a chimeric polypeptide will not exist as a contigu 0058. The disclosure will be described with respect to ous polypeptide in a protein encoded by a gene in a non particular embodiments and with reference to certain draw recombinant genome. The term "chimeric polypeptide' and ings but the disclosure is not limited thereto but only by the grammatical equivalents refer to a non-naturally occurring claims. Any reference signs in the claims shall not be con molecule which means that it is man-made. The term “fused Strued as limiting the scope. The drawings described are only to.” and other grammatical equivalents, when referring to a schematic and are non-limiting. In the drawings, the size of chimeric polypeptide, as defined herein, refers to any chemi Some of the elements may be exaggerated and not drawn on cal or recombinant mechanism for linking two or more scale for illustrative purposes. Where the term “comprising polypeptide components. The fusion of the two or more is used in the present description and claims, it does not polypeptide components may be a direct fusion of the exclude other elements or steps. Where an indefinite or defi sequences or it may be an indirect fusion, e.g., with interven nite article is used when referring to a singular noun, e.g., “a” ing amino acid sequences or linker sequences. Examples will or “an.” “the this includes a plural of that noun unless be provided further herein. Something else is specifically stated. Furthermore, the terms 0061 The term “membrane protein, as used herein, refers first, second, third and the like in the description and in the to a protein that is attached to or associated with a membrane claims, are used for distinguishing between similar elements of a cell or an organelle. They are often subdivided into and not necessarily for describing a sequential or chronologi several categories including integral membrane proteins, cal order. It is to be understood that the terms so used are peripheral membrane proteins and lipid-anchored proteins. interchangeable under appropriate circumstances and that the Preferably, the membrane protein is an integral membrane embodiments of the disclosure described herein are capable protein that is permanently bound to the lipid bilayer and of operation in other sequences than described or illustrated which requires a detergent or another apolar solvent to be herein. removed. Integral membrane proteins include transmem 0059. Unless otherwise defined herein, scientific and tech brane proteins that are permanently attached to the lipid nical terms and phrases used in connection with the disclo membrane and span across the membrane one or several US 2015/0376261 A1 Dec. 31, 2015 times. Examples of Suitable membrane proteins include computer programs that are available in the art. Examples of receptors such as GPCRs, amongst others. useful algorithms are PILEUP (Higgins & Sharp, CABIOS 0062. As used herein, the terms “polypeptide.” “protein.” 5:151 (1989), BLAST and BLAST 2.0 (Altschuletal. J. Mol. "peptide' are used interchangeably herein, and refer to a Biol. 215: 403 (1990). Software for performing BLAST polymeric form of amino acids of any length, which can analyses is publicly available through the National Center for include coded and non-coded amino acids, chemically or Biotechnology Information (on the World WideWeb at ncbi. biochemically modified or derivatized amino acids, and nlm.nih.gov/). polypeptides having modified peptide backbones. Through 0.066 “Similarity” refers to the percentage number of out the application, the standard one letter notation of amino amino acids that are identical or constitute conservative Sub acids will be used. Typically, the term “amino acid' will refer stitutions. Similarity may be determined using sequence to “proteinogenic amino acid, i.e., those amino acids that are comparison programs such as GAP (Deveraux et al., 1984). In naturally present in proteins. Most particularly, the amino this way, sequences of a similar or Substantially different acids are in the L isomeric form, but Damino acids are also length to those cited herein might be compared by insertion of envisaged. gaps into the alignment, such gaps being determined, for 0063. As used herein, the terms “nucleic acid molecule.” example, by the comparison algorithm used by GAP. As used "polynucleotide.” “polynucleic acid, “nucleic acid are used herein, "conservative substitution' is the substitution of interchangeably and refer to a polymeric form of nucleotides amino acids with other amino acids whose side chains have of any length, either deoxyribonucleotides or ribonucle similar biochemical properties (e.g., are aliphatic, are aro otides, or analogs thereof. Polynucleotides may have any matic, are positively charged. . . . ) and is well known to the three-dimensional structure, and may perform any function, skilled person. Non-conservative substitution is then the sub known or unknown. Non-limiting examples of polynucle stitution of amino acids with other amino acids whose side otides include a gene, a gene fragment, exons, introns, mes chains do not have similar biochemical properties (e.g., senger RNA (mRNA), transfer RNA, ribosomal RNA, replacement of a hydrophobic with a polar residue). Conser ribozymes, cDNA, recombinant polynucleotides, branched vative substitutions will typically yield sequences which are polynucleotides, plasmids, vectors, isolated DNA of any not identical anymore, but still highly similar. By conserva sequence, control regions, isolated RNA of any sequence, tive Substitutions is intended combinations such as gly, ala; nucleic acid probes, and primers. The nucleic acid molecule Val, ile, leu, met; asp, glu; asn, gin, ser, thr; lys, arg: cys, met: may be linear or circular. and phe, tyr, trp. 0064. Any of the peptides, polypeptides, nucleic acids, 0067. A "deletion' is defined here as a change in either etc., disclosed herein may be “isolated' or “purified.” “Iso amino acid or nucleotide sequence in which one or more lated' is used hereinto indicate that the material referred to is amino acid or nucleotide residues, respectively, are absent as (i) separated from one or more Substances with which it exists compared to an amino acid sequence or nucleotide sequence in nature (e.g., is separated from at least some cellular mate of a parental polypeptide or nucleic acid. Within the context rial, separated from other polypeptides, separated from its of a protein, a deletion can involve deletion of about 2, about natural sequence context), and/or (ii) is produced by a process 5, about 10, up to about 20, up to about 30 or up to about 50 that involves the hand of man such as recombinant DNA or more amino acids. A protein or a fragment thereof may technology, chemical synthesis, etc.; and/or (iii) has a contain more than one deletion. Within the context of a sequence, structure, or chemical composition not found in GPCR, a deletion may also be a loop deletion, oran N- and/or nature. "Purified, as used herein, denote that the indicated C-terminal deletion, or a combination thereof. As will be nucleic acid or polypeptide is present in the Substantial clear to the skilled person, an N- and/or C-terminal deletion of absence of other biological macromolecules, e.g., polynucle a GPCR is also referred to as a truncation of the amino acid otides, proteins, and the like. In one embodiment, the poly sequence of the GPCR or a truncated GPCR. nucleotide or polypeptide is purified Such that it constitutes at 0068 An “insertion' or “addition' is that change in an least 90% by weight, e.g., at least 95% by weight, e.g., at least amino acid or nucleotide sequences which has resulted in the 99% by weight, of the polynucleotide(s) or polypeptide(s) addition of one or more amino acid or nucleotide residues, present (but water, buffers, ions, and other Small molecules, respectively, as compared to an amino acid sequence or nucle especially molecules having a molecular weight of less than otide sequence of a parental protein. “Insertion' generally 1000 Dalton, can be present). refers to addition to one or more amino acid residues within 0065. The term “sequence identity, as used herein, refers an amino acid sequence of a polypeptide, while “addition” to the extent that sequences are identical on a nucleotide-by can be an insertion or refer to amino acid residues added at an nucleotide basis or an amino acid-by-amino acid basis over a N- or C-terminus, or both termini. Within the context of a window of comparison. Thus, a “percentage of sequence protein or a fragment thereof, an insertion or addition is identity” is calculated by comparing two optimally aligned usually of about 1, about 3, about 5, about 10, up to about 20, sequences over the window of comparison, determining the up to about 30 or up to about 50 or more amino acids. A number of positions at which the identical nucleic acid base protein or fragment thereofmay contain more than one inser (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., tion. Ala, Pro, Ser. Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, 0069. A “substitution,” as used herein, results from the His, Asp, Glu, Asn., Gln, Cys and Met) occurs in both replacement of one or more amino acids or nucleotides by sequences to yield the number of matched positions, dividing different amino acids or nucleotides, respectively, as com the number of matched positions by the total number of pared to an amino acid sequence or nucleotide sequence of a positions in the window of comparison (i.e., the window parental protein or a fragment thereof. It is understood that a size), and multiplying the result by 100 to yield the percent protein or a fragment thereof may have conservative amino age of sequence identity. Determining the percentage of acid substitutions which have substantially no effect on the sequence identity can be done manually, or by making use of protein's activity. By conservative substitutions is intended US 2015/0376261 A1 Dec. 31, 2015
combinations such as gly, ala; Val, ile, leu, met; asp, glu; asn, over, certain preferred vectors are capable of directing the gln, ser, thr; lys, arg: cys, met; and phe, tyr, trp. expression of certain genes of interest. Such vectors are 0070. The term “recombinant when used in reference to a referred to herein as “recombinant expression vectors' (or cell, nucleic acid, protein or vector, indicates that the cell, simply, “expression vectors'). Suitable vectors have regula nucleic acid, protein or vector, has been modified by the tory sequences, such as promoters, enhancers, terminator introduction of a heterologous nucleic acid or protein or the sequences, and the like as desired and according to a particu alteration of a native nucleic acid or protein, or that the cell is lar host organism (e.g., bacterial cell, yeast cell). Typically, a derived from a cell so modified. Thus, for example, recombi recombinant vector, according to the disclosure, comprises at nant cells express nucleic acids or polypeptides that are not least one "chimeric gene' or “expression cassette.” Expres found within the native (non-recombinant) form of the cell or sion cassettes are generally DNA constructs preferably express native genes that are otherwise abnormally including (5' to 3' in the direction of transcription): a promoter expressed, under expressed, over expressed or not expressed region, a polynucleotide sequence, homologue, variant or at all. fragment thereof of the disclosure operably linked with the 0071. As used herein, the term “expression” refers to the transcription initiation region, and a termination sequence process by which a polypeptide is produced based on the including a stop signal for RNA polymerase and a polyade nucleic acid sequence of a gene. The process includes both nylation signal. It is understood that all of these regions transcription and translation. should be capable of operating in biological cells, such as 0072 The term “operably linked as used herein, refers to prokaryotic or eukaryotic cells, to be transformed. The pro a linkage in which the regulatory sequence is contiguous with moter region comprising the transcription initiation region, the gene of interest to control the gene of interest, as well as which preferably includes the RNA polymerase binding site, regulatory sequences that act in trans or at a distance to and the polyadenylation signal may be native to the biological control the gene of interest. For example, a DNA sequence is cell to be transformed or may be derived from an alternative operably linked to a promoter when it is ligated to the pro Source, where the region is functional in the biological cell. moter downstream with respect to the transcription initiation 0075. The term “host cell as used herein, is intended to site of the promoter and allows transcription elongation to refer to a cell into which a recombinant vector has been proceed through the DNA sequence. A DNA for a signal introduced. It should be understood that such terms are sequence is operably linked to DNA coding for a polypeptide intended to refer not only to the particular subject cell but also if it is expressed as a pre-protein that participates in the to the progeny of Such a cell. Because certain modifications transport of the polypeptide. Linkage of DNA sequences to may occur in succeeding generations due to either mutation regulatory sequences is typically accomplished by ligation at or environmental influences. Such progeny may not, in fact, suitable restriction sites or adapters or linkers inserted in lieu be identical to the parent cell, but are still included within the thereofusing restriction endonucleases known to one of skill scope of the term “host cell as used herein. A host cell may in the art. bean isolated cell or cell line grown in culture or may be a cell 0073. The term “regulatory sequence.” as used herein, and which resides in a living tissue or organism. In particular, host also referred to as “control sequence.” refers to polynucle cells are of bacterial or fungal origin, but may also be of plant otide sequences which are necessary to affect the expression or mammalian origin. The wordings “host cell. “recombi of coding sequences to which they are operably linked. Regu nant host cell.” “expression host cell.” “expression host sys latory sequences are sequences which control the transcrip tem.” “expression system.” are intended to have the same tion, post-transcriptional events and translation of nucleic meaning and are used interchangeably herein. acid sequences. Regulatory sequences include appropriate 0076 An "epitope,” as used herein, refers to an antigenic transcription initiation, termination, promoter and enhancer determinant of a polypeptide. An epitope could comprise 3 sequences; efficient RNA processing signals such as splicing amino acids in a spatial conformation, which is unique to the and polyadenylation signals; sequences that stabilize cyto epitope. Generally, an epitope consists of at least 4, 5, 6, 7 plasmic mRMA; Sequences that enhance translation effi Such amino acids, and more usually, consists of at least 8, 9. ciency (e.g., ribosome binding sites); sequences that enhance 10 such amino acids. Methods of determining the spatial protein stability; and when desired, sequences that enhance conformation of amino acids are known in the art, and protein secretion. The nature of Such control sequences dif include, for example, X-ray crystallography and multi-dimen fers depending upon the host organism. The term “regulatory sional nuclear magnetic resonance. sequence' is intended to include, at a minimum, all compo 0077. A “conformational epitope, as used herein, refers nents whose presence is essential for expression, and can also to an epitope comprising amino acids in a spacial conforma include additional components whose presence is advanta tion that is unique to a folded three-dimensional conforma geous, for example, leader sequences and fusion partner tion of a polypeptide. Generally, a conformational epitope Sequences. consists of amino acids that are discontinuous in the linear 0.074 The term “vector,” as used herein, is intended to sequence but that come together in the folded structure of the refer to a nucleic acid molecule capable of transporting protein. However, a conformational epitope may also consist another nucleic acid molecule to which it has been linked. The of a linear sequence of amino acids that adopts a conforma vector may be of any Suitable type including, but not limited tion that is unique to a folded three-dimensional conforma to, a phage, virus, plasmid, phagemid, cosmid, bacmid or tion of the polypeptide (and not present in a denatured state). even an artificial chromosome. Certain vectors are capable of In protein complexes, conformational epitopes consist of autonomous replication in a host cell into which they are amino acids that are discontinuous in the linear sequences of introduced (e.g., vectors having an origin of replication which one or more polypeptides that come together upon folding of functions in the host cell). Other vectors can be integrated into the different folded polypeptides and their association in a the genome of a host cell upon introduction into the host cell, unique quaternary structure. Similarly, conformational and are thereby replicated along with the host genome. More epitopes may here also consist of a linear sequence of amino US 2015/0376261 A1 Dec. 31, 2015 acids of one or more polypeptides that come together and particular conformation of a GPCR refers to a binding adopt a conformation that is unique to the quaternary struc domain that binds with a higher affinity to the GPCR in a ture. subset of conformations than to other conformations that the 0078. The term “conformation' or “conformational state' GPCR may assume. One of skill in the art will recognize that of a protein refers generally to the range of structures that a binding domains that specifically or selectively bind to a protein may adopt at any instant in time. One of skill in the art particular conformation of a GPCR will stabilize this particu will recognize that determinants of conformation or confor lar conformation, and its related activity. More details are mational state include a protein's primary structure as provided further herein. reflected in a protein's amino acid sequence (including modi I0081. The term “affinity, as used herein, generally refers fied amino acids) and the environment Surrounding the pro to the degree to which a ligand (as defined further herein) tein. The conformation or conformational State of a protein binds to a target protein so as to shift the equilibrium of target also relates to structural features Such as protein secondary protein and ligand toward the presence of a complex formed structures (e.g., C.-helix, B-sheet, among others), tertiary by their binding. Thus, for example, where a chimeric structure (e.g., the three-dimensional folding of a polypeptide polypeptide and a ligand are combined in relatively equal chain), and quaternary structure (e.g., interactions of a concentration, a ligand of high affinity will bind to the chi polypeptide chain with other protein subunits). Post-transla meric polypeptide so as to shift the equilibrium toward high tional and other modifications to a polypeptide chain such as concentration of the resulting complex. The dissociation con ligand binding, phosphorylation, Sulfation, glycosylation, or stant Kd is commonly used to describe the affinity between a attachments of hydrophobic groups, among others, can influ ligand and a target protein. Typically, the dissociation con ence the conformation of a protein. Furthermore, environ stant has a value that is lower than 10 M. Preferably, the mental factors, such as pH, salt concentration, ionic strength, dissociation constant is lower than 10 M, more preferably, and osmolality of the Surrounding solution, and interaction lower than 107M. Most preferably, the dissociation constant with other proteins and co-factors, among others, can affect is lower than 10 M. Other ways of describing the affinity protein conformation. The conformational state of a protein between a ligand and its target protein are the association may be determined by either functional assay for activity or constant (Ka), the inhibition constant (Ki), or indirectly by binding to another molecule or by means of physical methods evaluating the potency of ligands by measuring the half maxi Such as X-ray crystallography, NMR, or spin labeling, among mal inhibitory concentration (IC50) or half maximal effective other methods. For a general discussion of protein conforma concentration (EC50). It will be appreciated that within the tion and conformational states, one is referred to Cantor and scope of the disclosure, the term “affinity” is used in the Schimmel, Biophysical Chemistry, Part I: The Conformation context of a binding domain that binds a conformational of Biological Macromolecules, W.H. Freeman and Company, epitope of a target GPCR as well as in the context of a test 1980, and Creighton, Proteins: Structures and Molecular compound (as defined further herein) that binds to the chi Properties, W.H. Freeman and Company, 1993. meric polypeptide of the disclosure, more particularly to an 0079 A “functional conformation” or a “functional con orthosteric or allosteric site of a target GPCR comprised in the formational state' refers to the fact that proteins, in particular chimeric polypeptide. GPCRs, possess different conformational states having a 0082 It should be noted that, in intramolecular interac dynamic range of activity, in particular ranging from no activ tions, such as the specific interaction of the binding domain ity to maximal activity. It should be clear that “a functional moiety to the GPCR moiety of the chimeric polypeptide of the conformational state as used herein, is meant to cover any disclosure, the two interacting groups are contained within a conformational state of a protein, in particular a GPCR, hav single molecule. The dissociation constant between the bind ing any activity, including no activity, and is not meant to ing domain and the target, might be known when they are cover the denatured States of proteins. Non-limiting examples individual molecules, but for an intramolecular interaction, of functional conformations of GPCRs include active confor their concentration within the solution is irrelevant. Instead, it mations, inactive conformations or basal conformations. A is the “effective concentration' of the two groups within the particular class of functional conformations is defined as macromolecule that is important for the intramolecular inter 'druggable conformation' and generally refers to a unique action. The term “effective intramolecular concentration' or therapeutically relevant conformational state of a target pro “effective molarity” (M), as used herein, refers to the effec tein. As an illustration, the agonist-bound active conforma tive concentration and can be calculated as K'/K", tion of the B2 adrenergic receptor corresponds to the drug wherein the dissociation constant K", which is dimen gable conformation of this receptor relating to Smooth muscle sionless, is the dissociation constant that is used to describe an relaxation, dilation of bronchial passages (asthma), Vasodila intramolecular reaction, which is a fusion of a target GPCR tion in muscle and liver, relaxation of uterine muscle, and and a binding domain, and wherein K', which has units of release of insulin. It will thus be understood that druggability concentration (e.g., molarity), is the dissociation constant for is confined to particular conformations depending on the an analogous intermolecular interaction, which is a non-co therapeutic indication. More details are provided further valent complex of a binding domain and a target GPCR. The herein. effective molarity will depend upon the structure of the mac 0080. The term “stabilizing” or “stabilized,” with respect romolecule, in particular the extent to which it brings the two to a functional conformational state of a GPCR, as used reactants together or keeps them apart, plus the environment herein, refers to the retaining or holding of a GPCR in a subset in which the two groups are kept. The effective molarity for of the possible conformations that it could otherwise assume, the intramolecular reaction will be essentially Zero if the due to the effects of the intramolecular interaction of the macromolecular structure keeps the two groups apart, which GPCR moiety with the binding domain moiety of the chi is the case when a binding domain is not directed against meric polypeptide of the disclosure. Within this context, a and/or is not capable of specifically binding (as defined fur binding domain that specifically or selectively binds to a ther herein) to a target GPCR. At the other extreme, when the US 2015/0376261 A1 Dec. 31, 2015
macromolecular structure keeps the two groups in the correct from about 40 to about 500 amino acids, such as antibodies, proximity and orientation for reaction, their effective molar antibody fragments or antibody conjugates. Test compounds ity can be extremely high, up to 10' M, concentrations that can also be protein scaffolds or synthetic scaffolds. For high are not feasible with two independent molecules. According throughput purposes, test compound libraries may be used, to the disclosure, this is the case when a binding domain is such as combinatorial or randomized libraries that provide a capable of specifically binding (as defined further herein) to a Sufficient range of diversity. Examples include, but are not target GPCR. Such values are predicted by theoretical con limited to, natural compound libraries, allosteric compound siderations and are also observed experimentally, from the libraries, peptide libraries, antibody fragment libraries, Syn ratio of the rate or equilibrium constants for the same reaction thetic compound libraries, fragment-based libraries, phage when the groups are on the same molecule and on separate display libraries, and the like. A more detailed description can molecules. be found further in the specification. 0083. The term “specificity, as used herein, refers to the I0086. As used herein, the term “ligand’ means a molecule ability of a binding domain, in particular an immunoglobulin that binds to a polypeptide, in particular a GPCR. A ligand or an immunoglobulin fragment, Such as a VHH or Single may be, without the purpose of being limitative, a protein, a domain antibody, to bind preferentially to one antigen, Versus (poly)peptide, a lipid, a Small molecule, a protein scaffold, a a different antigen, and does not necessarily imply high affin nucleic acid, an ion, a carbohydrate, an antibody or an anti ity. body fragment. A ligand may be synthetic or naturally occur 0084. The terms “specifically bind' and “specific bind ring. A ligand also includes a “native ligand, which is a ing.” as used herein, generally refers to the ability of a binding ligand that is an endogenous, natural ligand for a native pro domain, in particular an immunoglobulin, such as an anti tein. Within the context of the disclosure, a ligand means a body, or an immunoglobulin fragment, Such as a VHH or molecule that binds to a GPCR, either at the intracellular site Single-domain antibody, to preferentially bind to a particular or extracellular site and/or at the transmembrane domains. antigen that is present in a homogeneous mixture of different Usually, but not necessarily, a GPCR will adopt a particular antigens. In certain embodiments, a specific binding interac conformation upon binding of a ligand. Thus, a ligand may tion will discriminate between desirable and undesirable anti also be a “conformation-selective ligand’ or “conformation gens in a sample, in Some embodiments more than about 10 to specific ligand. The team includes agonists, full agonists, 100-fold or more (e.g., more than about 1000- or 10,000 partial agonists, and inverse agonists, binding at either the fold). Within the context of the spectrum of conformational orthosteric site or at an allosteric site. For the sake of clarity, states of GPCRs, the terms particularly refer to the ability of the term “conformation-selective ligand’ or "conformation a binding domain (as defined herein) to preferentially recog specific ligand does not include a neutral antagonist, since a nize and/or bind to a particular conformational state of a neutral antagonist does not selectively bind a particular con GPCR as compared to another conformational state. Accord formation of a GPCR. ingly, as used herein, the term “conformation-selective bind ing domain in the context of the disclosure refers to a binding I0087 An “orthosteric ligand, as used herein, refers to a domain that binds to a target GPCR in a conformation-selec ligand (both natural and synthetic), that binds to the active site tive manner. A binding domain that selectively binds to a of a receptor, such as a GPCR, and are further classified particular conformation of a GPCR refers to a binding according to their efficacy or in other words to the effect they domain that binds with a higher affinity to a GPCR in a subset have on signaling through a specific pathway. As used herein, of conformations than to other conformations that the GPCR an "agonist” refers to a ligand that, by binding a receptor may assume. One of skill in the art will recognize that binding protein, increases the receptor's signaling activity. Full ago domains that selectively bind to a particular conformation of nists are capable of maximal protein stimulation; partial ago a GPCR will stabilize or retain the GPCR it this particular nists are unable to elicit full activity even at Saturating con conformation. For example, an active state conformation centrations. Partial agonists can also function as "blockers' selective binding domain will preferentially bind to a GPCR by preventing the binding of more robust agonists. An in an active conformational state and will not or to a lesser 'antagonist, also referred to as a “neutral antagonist, refers degree bind to a GPCR in an inactive conformational state, to a ligand that binds a receptor without stimulating any and will thus have a higher affinity for the active conforma activity. An “antagonist' is also known as a “blocker because tional state, or vice versa. The terms “specifically bind.” of its ability to prevent binding of other ligands and, therefore, “selectively bind.” “preferentially bind,” and grammatical block agonist-induced activity. Further, an “inverse agonist' equivalents thereof, are used interchangeably herein. The refers to an antagonist that, in addition to blocking agonist terms “conformational specific' or “conformational selec effects, reduces a receptor's basal or constitutive activity tive' are also used interchangeably herein. below that of the unliganded protein. 0085. The term “compound or “test compound' or “can I0088 Ligands, as used herein, may also be “biased didate compound” or "drug candidate compound, as used ligands' with the ability to selectively stimulate a subset of a herein, are intended to have the same meaning and describe receptor's signaling activities, for example, in the case of any molecule, either naturally occurring or synthetic that is GPCRs the selective activation of G-protein or B-arrestin tested in an assay, Such as a screening assay for drug discov function. Such ligands are known as “biased ligands.” “biased ery purposes. As such, these compounds comprise organic or agonists' or “functionally selective agonists. More particu inorganic compounds. The compounds include Small mol larly, ligand bias can be an imperfect bias characterized by a ecules, polynucleotides, lipids or hormone analogs that are ligand stimulation of multiple receptor activities with differ characterized by low molecular weights. Other biopolymeric ent relative efficacies for different signals or can be a perfect organic test compounds include Small peptides or peptide bias characterized by a ligand stimulation of one receptor like molecules (peptidomimetics) comprising from about 2 to protein activity without any stimulation of another known about 40 amino acids and larger polypeptides comprising receptor protein activity. US 2015/0376261 A1 Dec. 31, 2015
0089 Another kind of ligands is known as allosteric regu defined herein) of any GPCR. A binding domain that specifi lators. 'Allosteric regulators' or otherwise “allosteric modu cally binds to a “conformational epitope’ specifically binds to lators.” “allosteric ligands” or “effector molecules, as used a tertiary (i.e., three-dimensional) structure of a folded pro herein, refer to ligands that bind at an allosteric site (that is, a tein, and binds at much reduced (i.e., by a factor of at least 2, regulatory site physically distinct from the protein's active 5, 10, 50 or 100) affinity to the linear (i.e., unfolded, dena site) of a receptor protein such as a GPCR. In contrast to tured) form of the protein. In particular, the conformational orthosteric ligands, allosteric modulators are non-competi epitope can be part of an intracellular or extracellular region, tive because they bind receptor proteins at a different site and oran intramembraneous region, or a domain or loop structure modify their function even if the endogenous ligand also is of any desired GPCR. Thus, according to particular embodi binding. Allosteric regulators that enhance the protein's ments, the binding domain moiety may be directed againstan activity are referred to herein as “allosteric activators' or extracellular region, domain, loop or other extracellular con “positive allosteric modulators’ (PAMs), whereas those that formational epitope of any desired GPCR, but is preferably decrease the protein’s activity are referred to herein as “allos directed against the extracellular parts of the transmembrane teric inhibitors' or otherwise “negative allosteric modula domains or more preferably against the extracellular loops tors” (NAMs). that link the transmembrane domains. Alternatively, the bind 0090. As used herein, the terms “determining.” “measur ing domain moiety may be directed against an intracellular ing.” “assessing.” “monitoring and “assaying are used region, domain, loop or other intracellular conformational interchangeably and include both quantitative and qualitative epitope of any desired GPCR, but is preferably directed determinations. against one of the intracellular parts of the transmembrane 0091. As used herein, the terms “complementarity deter domains or more preferably against the intracellular loops mining region' or “CDR' within the context of antibodies that link the transmembrane domains. In other specific refer to variable regions of either H (heavy) or L (light) chains embodiments, the binding domain moiety may be directed (also abbreviated as VH and VL, respectively) and contains against a conformational epitope that forms part of the bind the amino acid sequences capable of specifically binding to ing site of a natural ligand including, but not limited to, an antigenic targets. These CDR regions account for the basic endogenous orthosteric agonist. In still other embodiments, specificity of the antibody for a particular antigenic determi the binding domain moiety may be directed against a confor nant structure. Such regions are also referred to as “hyper mational epitope, in particular an intracellular epitope, that is variable regions.” The CDRs represent non-contiguous comprised in a binding site for a downstream signaling pro stretches of amino acids within the variable regions but, tein including, but not limited to, a G protein binding site, a regardless of species, the positional locations of these critical B-arrestin binding site. amino acid sequences within the variable heavy and light 0.095 According to a preferred embodiment, the chimeric chain regions have been found to have similar locations polypeptide of the disclosure comprises a GPCR fused to a within the amino acid sequences of the variable chains. The binding domain wherein, upon binding of the binding domain variable heavy and light chains of all canonical antibodies to the GPCR in an intramolecular reaction, the GPCR is each have 3 CDR regions, each non-contiguous with the stabilized in a particular conformation without the need for an others (termed L1, L2, L3, H1, H2, H3) for the respective additional ligand. Preferably, the chimeric polypeptide of the light (L) and heavy (H) chains. Immunoglobulin single vari disclosure comprises a GPCR that is stabilized by the binding able domains, in particular VHHs or Nanobodies, generally domain in a functional conformation, as defined herein. With comprise a single amino acid chain that can be considered to the term "stabilized as defined hereinbefore, is meant an comprise 4 “framework sequences or regions” or FRs and 3 increased stability of a GPCR with respect to the structure “complementarity determining regions' or CDRs. The Nano (e.g., conformational state) and/or particular biological activ bodies have 3 CDR regions, each non-contiguous with the ity (e.g., intracellular signaling activity, ligand binding affin others (termed CDR1, CDR2, CDR3). The delineation of the ity, . . . ). In relation to increased Stability with respect to FR and CDR sequences can, for example, be based on the structure and/or biological activity, this may be readily deter IMGT unique numbering system for V-domains and V-like mined either by means of physical methods such as X-ray domains (Lefranc et al., 2003). crystallography, NMR, or spin labeling, among other meth 0092 Chimeric Polypeptides ods or by a functional assay for activity (e.g., Ca" release, 0093. A first aspect of the disclosure relates to a chimeric cAMP generation or transcriptional activity, B-arrestin polypeptide comprising a G protein-coupled receptor recruitment, . . . ) or ligand binding, among other methods. (GPCR) fused to a binding domain, wherein the binding The term “stabilize also includes increased thermostability domain is directed against and/or specifically binds to the of the GPCR under non-physiological conditions induced by GPCR. The disclosure, thus, provides a chimeric polypep denaturants or denaturing conditions. The term “thermosta tide, which is a fusion protein of at least two moieties, in bilize.” “thermostabilizing, “increasing the thermostability particular at least a GPCR moiety and a binding domain of as used herein, refers to the functional rather than to the moiety, wherein the binding domain is directed againstand/or thermodynamic properties of a GPCR and to the protein's specifically binds to the GPCR. resistance to irreversible denaturation induced by thermal 0094. In general, the choice of the GPCR moiety forming and/or chemical approaches including, but not limited to, part of the chimeric polypeptide is not critical to the disclo heating, cooling, freezing, chemical denaturants, pH, deter Sure, and will typically be selected according to the intended gents, salts, additives, proteases or temperature. Irreversible use and application. A prerequisite of the binding domain denaturation leads to the irreversible unfolding of the func moiety is its capability to specifically bind (as defined herein) tional conformations of the protein, loss of biological activity to the GPCR of choice. Thus, the binding domain moiety may and aggregation of the denaturated protein. In relation to an generally be directed against any desired GPCR, and may in increased stability to heat, this can be readily determined by particular be directed against any conformational epitope (as measuring ligand binding or by using spectroscopic methods US 2015/0376261 A1 Dec. 31, 2015
Such as fluorescence, CD or light scattering that are sensitive 0097. It will, thus, be understood that the chimeric to unfolding at increasing temperatures. It is preferred that the polypeptides of the disclosure are conformationally con binding domain moiety is capable of increasing the stability strained proteins since the GPCR moiety of the fusion is as measured by an increase in the thermal stability of a GPCR stabilized in a particular functional conformation, due to the in a functional conformational state with at least 2°C., at least high local concentration of the tethered binding domain. To 5°C., at least 8°C., and more preferably at least 10°C. or 15° illustrate this further, without the purpose of being limitative, C. or 20°C. In relation to an increased stability to a detergent a chimeric polypeptide of the disclosure comprising a GPCR or to a chaotrope, typically the GPCR is incubated for a that is stabilized in an active conformation will have an defined time in the presence of a test detergent or a test increased or enhanced affinity for an agonist, more particu chaotropic agent and the stability is determined using, for larly for a full agonist, a partial agonist or a biased agonist, as example, ligand binding or a spectroscoptic method, option compared to the to the corresponding non-fused GPCR or as ally at increasing temperatures as discussed above. Other compared to a chimeric polypeptide of the corresponding wise, the binding domain moiety is capable of increasing the GPCR fused to a mock binding moiety (also referred to as stability to extreme pH of a functional conformational state of control binding moiety or irrelevant binding moiety, and that a GPCR. In relation to an extreme of pH, a typical test pH is not directed to and/or does not specifically bind to the would be chosen, for example, in the range 6 to 8, the range GPCR). Also, a chimeric polypeptide of the disclosure com 5.5 to 8.5, the range 5 to 9, the range 4.5 to 9.5, more specifi prising a GPCR that is stabilized in an active conformation cally in the range 4.5 to 5.5 (low pH) or in the range 8.5 to 9.5 will have a decreased affinity for an inverse agonist, as com (high pH). The term “(thermo)stabilize.” “(thermo)stabiliz pared to the corresponding non-fused GPCR or to a chimeric ing.” “increasing the (thermo)stability of as used herein, polypeptide of the corresponding GPCR fused to a mock applies to GPCRs embedded in lipid particles or lipid layers binding moiety. In contrast, a chimeric polypeptide of the (for example, lipid monolayers, lipid bilayers, and the like) disclosure comprising a GPCR that is stabilized in an inactive and to GPCRs that have been solubilized in detergent. conformation will have an enhanced affinity for an inverse 0096. It is, thus, particularly envisaged that the chimeric agonist and/or will have a decreased affinity for an agonist as polypeptides of the disclosure comprises a GPCR moiety that compared to the corresponding non-fused GPCR or to a chi is stabilized in a functional conformation upon binding of the meric polypeptide of the corresponding GPCR fused to a binding domain moiety. According to a preferred embodi mock binding moiety. An increase or decrease in affinity for ment of the disclosure, the GPCR moiety is stabilized in an a ligand may be directly measured by and/or calculated from active conformation upon binding of a binding domain that is a decrease or increase, respectively in ECso ICso, K, K, or selective for an active conformation. The term “active con any other measure of affinity or potency known to one of skill formation, as used herein, refers to a spectrum of receptor in the art. Preferably, the affinity of a chimeric polypeptide of conformations that upon binding of a ligand allows signal the disclosure for a ligand is increased or decreased at least 2 transduction towards an intracellular effector system, includ fold, at least 5 fold, at least 10 fold, at least 50 fold, and more ing G protein dependent signaling and G protein-independent preferably at least 100 fold, at least 200 fold, at least 300 fold, signaling (e.g., B-arrestin signaling). An “active conforma at least 400 fold, at least 500 fold, even more preferably at tion, thus, encompasses a range of ligand-specific confor least 1000 fold or 2000 fold or more, upon binding to the mations, including an agonist-bound active conformation, a constrained GPCR. It will be appreciated that affinity mea partial agonist-bound active conformation or a biased agonist Surements for conformation-selective ligands that trigger/in conformation that induces the cooperative binding of an intra hibit particular signaling pathways may be carried with any cellular effector protein. In another preferred embodiment, type of ligand, including natural ligands, Small molecules, as the GPCR moiety is stabilized in an inactive conformation well as biologicals; with orthosteric ligands as well as allos upon binding of a binding domain that is conformation-se teric modulators; with single compounds as well as com lective for an inactive conformation. The term “inactive con pound libraries; with lead compounds or fragments; etc. formation, as used herein, refers to a spectrum of receptor (0098. Further, the way the different moieties that form part conformations that does not allow or blocks signal transduc of the chimeric polypeptides as described are fused to each tion towards an intracellular effector system. An “inactive other will typically depend on both the type of GPCR and the conformation, thus, encompasses a range of ligand-specific characteristics of the binding domain (e.g., conformational conformations, including an inverse agonist-bound inactive epitope to which it binds). As is known by the person skilled conformation that prevents the cooperative binding of an in the art, GPCRs are characterized by an extracellular N-ter intracellular effector protein. It will be understood that the minus, followed by seven transmembrane C-helices con site of binding of the ligand is not critical for obtaining an nected by three intracellular and three extracellular loops, and active or inactive conformation. Hence, orthosteric ligands as finally an intracellular C-terminus (see also further herein). well as allosteric modulators may equally be capable of sta Depending on the site of binding (extracellular or intracellu bilizing a GPCR in an active or inactive conformation. Thus, lar or transmembrane), the binding domain moiety will pref according to a particular embodiment of the disclosure, the erably be fused to the N-terminal end of the GPCR or to the binding domain moiety that is capable of stabilizing the C-terminal end. Preferably, a binding domain that binds the GPCR moiety may bind at the orthosteric site or at an allos GPCR at an intracellular site will be fused to the C-terminus teric site. In other specific embodiments, the binding domain of the GPCR. Likewise, a binding domain that binds the moiety that is capable of stabilizing the GPCR moiety may be GPCR at an extracellular site will be fused to the N-terminus a binding domain that is selective for an agonist-bound active of the GPCR. The binding domain moiety will be fused with conformation, or that is selective for a partial agonist-bound its C-terminal end to N-terminal end of the GPCR or the active conformation or that is selective for a biased agonist binding domain can be fused with its N-terminal end to the bound functional conformation binding domain, or that is C-terminal end of the GPCR. Further, the fusion may be a selective for an inverse agonist-bound inactive conformation. direct fusion of the sequences or it may be an indirect fusion, US 2015/0376261 A1 Dec. 31, 2015 e.g., with intervening amino acid sequences or linker tein Linked Receptor Factsbook, published by Academic sequences, as described further herein. A person skilled in the Press (1st edition: 1994). GPCRs can be grouped on the basis art will know how to design a fusion construct. If available, of sequence homology and functional similarity into several one will make use of the atomic structure of the GPCR sepa families, each of which can be used in the creation and use of rately and/or the atomic structure of the binding domain sepa the chimeric polypeptides of the disclosure. Most of the rately and/or the atomic structure of the GPCR in complex human GPCRs can be found in five main families, termed with the binding domain. Alternatively, the GPCR could be Glutamate, Rhodopsin, Adhesion, Frizzled/Taste2 and Secre linked to the binding domain using intein-mediated protein tin (Fredriksson et al., 2003). Members of the Rhodopsin splicing (Muralidharan and Muir 2006) or sortagging (Popp family corresponding to class A (Kolakowski, 1994) or Class et al., 2007) or other chemoenzymatic methods for site-spe 1 (Foord et al., 2005) in older classification systems only have cific labeling or engineering of proteins with Small molecules Small extracellular loops and the interaction of the ligands or other proteins, for example, as described in Chen and Ting occurs with residues within the transmembrane cleft. This is (2005) and Rabuka (2010) and incorporated herein by refer by far the largest group (>90% of the GPCRs) and contains CCC. receptors for odorants, Small molecules such as catechola 0099 Particular embodiments of the different moieties mines and amines, (neuro)peptides and glycoprotein hor that form part of the chimeric polypeptides of the disclosure mones. Rhodopsin, a representative of this family, is the first will be further detailed here below. GPCR for which the structure has been solved (Palczewski et 0100 GPCR Moiety al., 2000). B2AR, the first receptor interacting with a diffus 0101 The chimeric polypeptide of the disclosure com ible ligand for which the structure has been solved (Rosen prises at least two polypeptide components, one of which is a baum et al., 2007) also belongs to this family. Based on GPCR. As a GPCR, any GPCR of interest can be used. The phylogenetic analysis, class B GPCRs or Class 2 (Foordet al., skilled person can choose a suitable GPCR depending on the 2005) receptors have recently been subdivided into two fami intended application, as described further herein. In the same lies: adhesion and secretin (Fredriksson et al., 2003). Adhe line, and depending on the intended use, a GPCR from any sion and secretin receptors are characterized by a relatively organism may be selected, such as fungus (including yeast), long amino terminal extracellular domain involved in ligand nematode, virus, insect, plant, bird (e.g., chicken, turkey), binding. Little is known about the orientation of the trans reptile, or mammal (e.g., a mouse, rat, rabbit, hamster, gerbil, membrane domains, but it is probably quite different from dog, cat, goat, pig, cow, horse, whale, monkey, camelid, or that of rhodopsin. Ligands for these GPCRs are hormones, human). Such as glucagon, secretin, gonadotropin-releasing hormone 0102) “G-protein coupled receptors,” or “GPCRs,” as used and parathyroid hormone. The Glutamate family receptors herein, are well-known by the skilled person and refer to (Class C or Class 3 receptors) also have a large extracellular polypeptides that share a common structural motif, having domain, which functions like a “Venus fly trap' since it can seven regions of between 22 to 24 hydrophobic amino acids open and close with the agonist bound inside. Family mem that form seven alpha helices, each of which spans the mem bers are the metabotropic glutamate, the Ca"-sensing and the brane. Each span is identified by number, i.e., transmem Y-aminobutyric acid (GABA)-B receptors. brane-1 (TM1), transmembrane-2 (TM2), etc. The trans 0104 Thus, according to particular embodiments of the membrane helices are joined by regions of amino acids disclosure, the chimeric polypeptide of the disclosure com between transmembrane-2 and transmembrane-3, transmem prises a GPCR that is chosen from the group comprising a brane-4 and transmembrane-5, and transmembrane-6 and GPCR of the Glutamate family of GPCRs, a GPCR of the transmembrane-7 on the exterior, or “extracellular side, of Rhodopsin family of GPCRs, a GPCR of the Adhesion family the cell membrane, referred to as “extracellular regions 1, 2 of GPCRs, a GPCR of the Frizzled/Taste2 family of GPCRs, and 3 (EC1, EC2 and EC3), respectively. The transmembrane and a GPCR of the Secretin family of GPCRs. Preferably, the helices are also joined by regions of amino acids between GPCR comprised in the chimeric polypeptide is a mamma transmembrane-1 and transmembrane-2, transmembrane-3 lian protein, or a plant protein, or a microbial protein, or a and transmembrane-4, and transmembrane-5 and transmem viral protein, or an insect protein. Even more preferably, the brane-6 on the interior, or “intracellular side, of the cell GPCR is a human protein. membrane, referred to as “intracellular regions 1, 2 and 3 0105 More specifically, GPCRs include, without limita (IC1, IC2 and IC3), respectively. The “carboxy” (“C”) termi tion, 5-hydroxytryptamine receptors, acetylcholine receptors nus of the receptor lies in the intracellular space within the (muscarinic), adenosine receptors, adrenoceptors, anaphyla cell, and the “amino” (“N) terminus of the receptor lies in the toxin receptors, angiotensin receptors, apelin receptors, bile extracellular space outside of the cell. Any of these regions acid receptors, bombesin receptors, bradykinin receptors, are readily identifiable by analysis of the primary amino acid cannabinoid receptors, chemokine receptors, cholecystoki sequence of a GPCR. nin receptors, dopamine receptors, endothelin receptors, 0103 GPCR structure and classification is generally well estrogen (G protein coupled) receptors, formylpeptide recep known in the art and further discussion of GPCRs may be tors, free fatty acid receptors, galanin receptors, ghrelin found in Probst et al., 1992; Marchese et al., 1994: Lager receptors, glycoprotein hormone receptors, gonadotrophin strom & Schióth, 2008; Rosenbaum et al., 2009; and the releasing hormone receptors, histamine receptors, KiSS1 following books: Jurgen Wess (Ed) Structure-Function derived peptide receptor, leukotriene receptors, lysophospho Analysis of G Protein-Coupled Receptors published by lipid receptors, melanin-concentrating hormone receptors, Wiley-Liss (1 edition; Oct. 15, 1999); Kevin R. Lynch (Ed) melanocortin receptors, melatonin receptors, motilin recep Identification and Expression of G Protein-Coupled Recep tors, neuromedin U receptors, neuropeptide FF/neuropeptide tors published by John Wiley & Sons (March 1998) and AF receptors, neuropeptide S receptors, neuropeptide W/neu Tatsuya Haga (Ed), G Protein-Coupled Receptors, published ropeptide B receptors, neuropeptide Y receptors, neurotensin by CRC Press (Sep. 24, 1999); and Steve Watson (Ed) G-Pro receptors, nicotinic acid receptor family, opioid receptors, US 2015/0376261 A1 Dec. 31, 2015 orexin receptors, P2Y receptors, peptide P518 receptor, plate ring “human muscarinic acetylcholine receptor M2” of Gen let-activating factor receptor, prokineticin receptors, prolac Bank accession number AAA51570.1. Or also, a “human mu tin-releasing peptide receptor, prostanoid receptors, protease opioid receptor has an amino acid sequence that is at least activating receptors, relaxin family peptide receptors, 95% identical to (e.g., at least 95% or at least 98% identical Somatostatin receptors, tachykinin receptors, thyrotropin-re to) the naturally occurring "human mu opioid receptor of leasing hormone receptor, trace amine receptor, urotensin GenBank accession number NP O00905. The term “non receptor, vasopressin and oxytocin receptors, class A naturally occurring in reference to a GPCR means a GPCR orphans, non-signaling 7TM chemokine-binding proteins, that is not naturally-occurring. Wild-type GPCRs that have calcitonin receptors, corticotropin-releasing factor receptors, been mutated and variants of naturally-occurring GPCRs are glucagon receptor family, parathyroid hormone receptors, examples of non-naturally occurring GPCRs. Non-naturally VIP and PACAP receptors, class B orphans, calcium-sensing occurring GPCR may have an amino acid sequence that is at receptors, GABAB receptors, GPRC5 receptors, metabotro least 80% identical to, at least 90% identical to, at least 95% pic glutamate receptors, class C orphans, Frizzled receptors, identical to or at least 99% identical to, a naturally-occurring the rhodopsins and other G-protein coupled seventransmem GPCR. In certain circumstances, it may be advantageous that brane segment receptors. GPCRs also include these GPCR the GPCR comprised in the chimeric polypeptide is a non receptors associated with each other as homomeric or hetero naturally occurring protein. For example, and for illustration meric dimers or as higher-order oligomers. The amino acid purposes only, to increase the probability of obtaining crys sequences (and the nucleotide sequences of the cDNAS which tals of the chimeric polypeptide comprising the GPCR stabi encode them) of GPCRs are readily available, for example, by lized in a particular conformation, it might be desired to reference to GenBank (on the World Wide Web at ncbi.nlm. perform some protein engineering without or only minimally nih.gov/entrez). HGNC standardized nomenclature to human affecting the conformation (e.g., active conformation with genes; accession numbers of different isoforms from different increased affinity for agonists). Or, alternatively or addition organisms are available from Uniprot (on the World Wide ally, to increase cellular expression levels of a GPCR, or to Web at uniprot.org). Moreover, a comprehensive overview of increase the stability, one might also consider introducing receptor nomenclature, pharmacological, functional and certain mutations in the GPCR of interest. Non-limiting pathophysiological information on GPCRs can be retrieved examples of non-naturally occurring GPCRs include, without from the IUPHAR database (on the World Wide Web at limitation, GPCRs that have been made constitutively active iuphar-db.org/). through mutation, GPCRs with a loop deletion, GPCRs with 01.06 According to a preferred embodiment, the GPCR an N- and/or C-terminal deletion, GPCRs with a substitution, that forms part of the chimeric polypeptide of the disclosure, an insertion or addition, or any combination thereof, in rela is chosen from the group comprising the adrenergic receptors, tion to their amino acid or nucleotide sequence, or other preferably the C. adrenergic receptors. Such as the aladrener variants of naturally-occurring GPCRs. Also comprised gic receptors and the O2 adrenergic receptors, and the B3 within the scope of the disclosure are target GPCRs compris adrenergic receptors, such as the B1 adrenergic receptors, the ing a chimeric or hybrid GPCR, for example, a chimeric B2 adrenergic receptors and the B3 adrenergic receptors; or GPCR with an N- and/or C-terminus from one GPCR and from the group comprising the muscarinic receptors, prefer loops of a second GPCR, or comprising a GPCR fused to a ably the M1 muscarinic receptors, the M2 muscarinic recep moiety, Such as T4 lysozyme, Flavodoxin, Xylanase, Rubre tors, the M3 muscarinic receptors, the M4 muscarinic recep doxin or cytochrome b as an utility in GPCR crystallization tors and the M5 muscarinic receptors; or from the group (Chun et al., 2012 and also described in patent applications comprising the opioid receptor family, preferably the Lopioid WO2012/158555, WO2012/030735, WO2012/148586). receptors (mu or MOP or Mor1), the 8 opioid receptors (delta 0108. According to specific embodiments within the or DOP), the K opioid receptors (kappa or KOP), the NOP Scope of the disclosure, a non-naturally occurring GPCR, as opioid receptors, all of which are well known in the art. comprised in the chimeric polypeptide, may have an amino 0107. It will be understood that, depending on the purpose acid sequence that is at least 80% identical to, at least 90% and application, the GPCR comprised in the fusion protein identical to, at least 95% identical to, at least 97% identical to, may be a naturally occurring or non-naturally occurring (i.e., or at least 99% identical to, a naturally-occurring GPCR. altered by man) receptor. The term “naturally-occurring in Further, it will be appreciated that the disclosure also envis reference to a GPCR means a GPCR that is naturally pro ages GPCRs with a loop deletion, or an N- and/or C-terminal duced. In particular, wild-type polymorphic variants and iso deletion, or a Substitution, or an insertion or addition in rela forms of GPCRs, as well as orthologs across different species tion to its amino acid or nucleotide sequence, or any combi are examples of naturally occurring proteins, and are found, nation thereof (as defined hereinbefore, and see also Example for example, and without limitation, in a mammal, more section). specifically in a human, or in a virus, or in a plant, or in an 0109 Binding Domain Moiety insect, amongst others). Such GPCRs are found in nature. In 0110. The chimeric polypeptide of the disclosure com addition, the term is intended to encompass wild-type poly prises at least two polypeptide moieties, one of which is a morphic variants and certain other variants of the B adrener GPCR, as described hereinbefore, and another one which is a gic receptor from a particular species, including mutants. For binding domain that is directed against and/or specifically example, a “human fB adrenergic receptor has an amino acid binds to the GPCR. sequence that is at least 95% identical to (e.g., at least 95% or 0111. The term “binding domain.” as used herein, means at least 98% identical to) the naturally occurring “human B the whole or part of a proteinaceous (protein, protein-like or adrenoreceptor of GenBank accession number NP 000015. protein containing) molecule that is capable of binding using Oralso, a “human muscarinic acetylcholine receptor M2 has specific intermolecular interactions to a GPCR. According to an amino acid sequence that is at least 95% identical to (e.g., a particular embodiment, the term “binding domain does not at least 95% or at least 98% identical to) the naturally occur include a naturally-occurring binding partner of a GPCR, US 2015/0376261 A1 Dec. 31, 2015 e.g., a G protein, an arrestin, an endogenous ligand; or vari binding antibody fragments that include, but are not limited ants or derivatives (including fragments) thereof. More spe to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single cifically, the term “binding domain refers to a polypeptide, chain antibodies, disulfide-linked FVs (dsFv) and fragments more particularly a protein domain. A protein binding domain comprising or consisting of either a VL or VH domain, and is an element of overall protein structure that is self-stabiliz any combination of those or any other functional portion of an ing and often folds independently of the rest of the protein immunoglobulin peptide capable of binding to the target anti chain. Binding domains vary in length from between about 25 gen. The term “antibodies’ is also meant to include heavy amino acids up to 500 amino acids and more. Many binding chain only antibodies, or fragments thereof, including immu domains can be classified into folds and are recognizable, noglobulin single variable domains, as defined further herein. identifiable, 3-D structures. Some folds are so common in 0114. The term “immunoglobulin single variable domain many different proteins that they are given special names. defines molecules wherein the antigenbinding site is present Non-limiting examples are binding domains selected from a on, and formed by, a single immunoglobulin domain (which 3- or 4-helix bundle, an armadillo repeat domain, a leucine is different from conventional immunoglobulins or their frag rich repeat domain, a PDZ domain, a SUMO or SUMO-like ments, wherein typically two immunoglobulin variable domain, a cadherin domain, an immunoglobulin-like domain, domains interact to form an antigen binding site). It should, phosphotyrosine-binding domain, pleckstrin homology however, be clear that the term “immunoglobulin single vari domain, Src homology 2 domain, amongst others. A binding able domain does comprise fragments of conventional domain can thus be derived from a naturally occurring mol immunoglobulins wherein the antigen binding site is formed ecule, e.g., from components of the innate or adaptive by a single variable domain. Preferably, the binding domain immune system, or it can be entirely artificially designed. moiety within the scope of the disclosure is an immunoglo 0112 In general, a binding domain can be immunoglobu bulin single variable domain. lin-based or it can be based on domains present in proteins 0115 Generally, an immunoglobulin single variable including, but not limited to, microbial proteins, protease domain will be an amino acid sequence comprising 4 frame inhibitors, toxins, fibronectin, lipocalins, single chain anti work regions (FR1 to FR4) and 3 complementary determin parallel coiled coil proteins or repeat motif proteins. Particu ing regions (CDR1 to CDR3), preferably according to the lar examples of binding domains which are known in the art following formula (1): FR1-CDR1-FR2-CDR2-FR3-CDR3 include, but are not limited to: antibodies, heavy chain anti FR4 (1), or any suitable fragment thereof (which will then bodies (hcAb), single domain antibodies (sdAb), minibodies, usually contain at least some of the amino acid residues that the variable domain derived from camelid heavy chain anti form at least one of the complementarity determining bodies (VHH or Nanobodies), the variable domain of the new regions). Immunoglobulin single variable domains compris antigen receptors derived from shark antibodies (VNAR). ing 4 FRs and 3 CDRs are known to the person skilled in the alphabodies, protein A, protein G, designed ankyrin-repeat art and have been described, as a non-limiting example, in domains (DARPins), fibronectin type III repeats, anticalins, Wesolowski et al., 2009. Typical, but non-limiting, examples knottins, engineered CH2 domains (nanoantibodies), engi of immunoglobulin single variable domains include light neered SH3 domains, affibodies, peptides and proteins, chain variable domain sequences (e.g., a VL domain lipopeptides (e.g., pepducins) (see, e.g., Gebauer & Skerra, sequence) or a suitable fragment thereof, or heavy chain 2009: Skerra, 2000; Starovasniket al., 1997: BinZetal., 2004; variable domain sequences (e.g., a VH domain sequence or Koide et al., 1998; Dimitrov, 2009; Nygren et al., 2008: VHH domain sequence) or a suitable fragment thereof, as WO2010066740). Frequently, when generating a particular long as it is capable of forming a single antigen binding unit. type of binding domain using selection methods, combinato Thus, according to a preferred embodiment, the binding rial libraries comprising a consensus or framework sequence domain moiety is an immunoglobulin single variable domain containing randomized potential interaction residues are used that is a light chain variable domain sequence (e.g., a VL to screen for binding to a molecule of interest, Such as a domain sequence) or a heavy chain variable domain sequence protein. (e.g., a VH domain sequence); more specifically, the immu 0113. According to a preferred embodiment, it is particu noglobulin single variable domain is a heavy chain variable larly envisaged that the binding domain that forms part of the domain sequence that is derived from a conventional four chimeric polypeptide of the disclosure is derived from an chain antibody or a heavy chain variable domain sequence innate or adaptive immune system. Preferably, the binding that is derived from a heavy chain antibody. The immunoglo domain is derived from an immunoglobulin. Preferably, the bulin single variable domain may be a domain antibody, or a binding domain, according to the disclosure, is derived from single domain antibody, or a “dAB or dAb, or a Single an antibody or an antibody fragment. The term “antibody' domain antibody (as defined herein), or another immunoglo (Ab) refers generally to a polypeptide encoded by an immu bulin single variable domain, or any suitable fragment of any noglobulin gene, or a functional fragment thereof, that spe one thereof. For a general description of single domain anti cifically binds and recognizes an antigen, and is known to the bodies, reference is made to the following book: “Single person skilled in the art. An antibody is meant to include a domain antibodies.” Methods in Molecular Biology, Eds. conventional four-chain immunoglobulin, comprising two Saerens and Muyldermans, 2012, Vol. 911. The immunoglo identical pairs of polypeptide chains, each pair having one bulin single variable domains generally comprise a single “light” (about 25kDa) and one “heavy chain (about 50kDa). amino acid chain that can be considered to comprise 4 Typically, in conventional immunoglobulins, a heavy chain “framework sequences” or FR’s and 3 “complementary variable domain (VH) and a light chain variable domain (VL) determining regions' or CDR's, as defined hereinbefore. It interact to form an antigen binding site. The term “antibody' should be clear that framework regions of immunoglobulin is meant to include whole antibodies, including single-chain single variable domains may also contribute to the binding of whole antibodies, and antigen-binding fragments. In some their antigens (Desmyter et al., 2002; Korotkov et al., 2009). embodiments, antigen-binding fragments may be antigen The delineation of the CDR sequences (and thus also the FR US 2015/0376261 A1 Dec. 31, 2015 sequences) can be based on the IMGT unique numbering 08/020079, on page 75, Table A-3, incorporated herein by system for V-domains and V-like domains (Lefranc et al., reference. It should be noted that the Nanobodies, of the 2003). Alternatively, the delineation of the FR and CDR disclosure in their broadest sense are not limited to a specific sequences can be done by using the Kabat numbering system biological source or to a specific method of preparation. For as applied to VHH domains from Camelids in the article of example, Nanobodies, can generally be obtained: (1) by iso Riechmann and Muyldermans (2000). lating the VHH domain of a naturally occurring heavy chain 0116. It should be noted that the immunoglobulin single only antibody; (2) by expression of a nucleotide sequence variable domains as binding domain moiety in their broadest encoding a naturally occurring VHH domain; (3) by “human sense are not limited to a specific biological source or to a ization of a naturally occurring VHH domain or by expres specific method of preparation. The term “immunoglobulin sion of a nucleic acid encoding a such humanized VHH single variable domain encompasses variable domains of domain; (4) by "camelization of a naturally occurring VH different origin, comprising mouse, rat, rabbit, donkey, domain from any animal species, and in particular from a human, shark, camelid variable domains. According to spe mammalian species, such as from a human being, or by cific embodiments, the immunoglobulin single variable expression of a nucleic acid encoding Such a camelized VH domains are derived from shark antibodies (the so-called domain; (5) by "camelization' of a “domain antibody” or immunoglobulin new antigen receptors or IgNARS), more “Dab,” as described in the art, or by expression of a nucleic specific from naturally occurring heavy chain shark antibod acid encoding Such a camelized VH domain; (6) by using ies, devoid of light chains, and are known as VNAR domain synthetic or semi-synthetic techniques for preparing proteins, sequences. Preferably, the immunoglobulin single variable polypeptides or otheramino acid sequences known perse; (7) domains are derived from camelid antibodies. More prefer by preparing a nucleic acid encoding a Single-domain anti ably, the immunoglobulin single variable domains are derived body using techniques for nucleic acid synthesis known per from naturally occurring camelid heavy chain only antibod se, followed by expression of the nucleic acid thus obtained; ies, devoid of light chains, and are known as VHH domain and/or (8) by any combination of one or more of the forego sequences or Nanobodies. ing. A further description of NANOBODIES(R), including humanization and/or camelization of NANOBODIESR, can 0117. According to a particularly preferred embodiment, be found, e.g., in WO08/101985 and WO08/142164, as well the binding domain moiety as comprised in the chimeric as further herein. A particular class of Nanobodies that inter polypeptide of the disclosure is an immunoglobulin single acts with conformational epitopes of native targets and that variable domain that is a NANOBODYR), as defined further stabilizes the target in a unique non-prominent conformation herein, and including, but not limited to, a VHH. The term (different than the basal conformation) are called Xaperones “NANOBODYR) or single domain antibody” (Nb), as used and are particularly envisaged here. Xaperones are unique herein, is a single domain antigen binding fragment. It par tools in structural biology. XAPERONETM is a trademark of VIB ticularly refers to a single variable domain derived from natu and VUB (Belgium). By rigidifying flexible regions and rally occurring heavy chain only antibodies and is known to obscuring aggregative Surfaces, XAPERONETM complexes war the person skilled in the art. NBs are usually derived from rant conformationally uniform samples that are key to protein heavy chain only antibodies (devoid of light chains) seen in structure determination by X-ray crystallography. Major camelids (Hamers-Casterman et al., 1993: Desmyter et al., advantages for the use of camelid antibody fragments as 1996) and consequently are often referred to as VHH anti crystallization aid are that Xaperones (1) bind cryptic body or VHH sequence. Camelids comprise old world cam epitopes and lock proteins in unique native conformations, elids (Camelus bactrianus and Camelus dromedarius) and (2) increase the stability of soluble proteins and solubilized new world camelids (for example, Lama paccos, Lama membrane proteins, (3) reduce the conformational complex glama, Lamaguanicoe and Lama vicugna). NANOBODYR ity of soluble proteins and solubilized membrane proteins, (4) and NANOBODIES(R) are registered trademarks of Ablynx increase the polar Surface enabling the growth of diffracting NV (Belgium). For a further description of VHHs or Nano crystals, (5) sequester aggregative or polymerizing Surfaces, bodies, reference is made to the book “Single domain anti bodies.” Methods in Molecular Biology, Eds. Saerens and (6) allow to affinity-trap active protein. Muyldermans, 2012, Vol 911, in particular to the Chapter by 0118 Within the scope of the disclosure, the term “immu Vincke and Muyldermans (2012), as well as to a non-limiting noglobulin single variable domain also encompasses vari list of patent applications, which are mentioned as general able domains that are “humanized' or “camelized in par background art, and include: WO 94/04678, WO95/04079, ticular Nanobodies that are “humanized' or “camelized.” For WO 96/34103 of the Vrije Universiteit Brussel; WO example, both “humanization' and “camelization' can be 94/25591, WO 99/37681, WO 00/40968, WO 00/43507, WO performed by providing a nucleotide sequence that encodes a 00/65057, WO 01/40310, WO 01/44301, EP 1134 231 and naturally occurring VH domain or VH domain, respectively, WO 02/48.193 of Unilever, WO 97/49805, WO 01/21817, and then changing, in a manner known per se, one or more WO 03/035694, WO 03/054016 and WO 03/055527 of the codons in the nucleotide sequence in Such a way that the new Vlaams Instituut voor Biotechnologie (VIB); WO nucleotide sequence encodes a “humanized' or “camelized 04/041867, WO 04/041862, WO 04/041865, WO 04/041863, immunoglobulin single variable domains of the disclosure, WO 04/062551, WO 05/044858, WO 06/40153, WO respectively. This nucleic acid can then be expressed in a 06/079372, WO 06/122786, WO 06/122787 and WO manner known perse, so as to provide the desired immuno 06/122825, by Ablynx N.V. and the further published patent globulin single variable domains of the disclosure. Alterna applications by Ablynx N. V. As will be known by the person tively, based on the amino acid sequence of a naturally occur skilled in the art, the Nanobodies are particularly character ring VH domain or VH domain, respectively, the amino acid ized by the presence of one or more Camelidae “hallmark sequence of the desired humanized or camelized immunoglo residues' in one or more of the framework sequences, accord bulin single variable domains of the disclosure, respectively, ing to Kabat numbering, as described, for example, in WO can be designed and then synthesized de novo using tech US 2015/0376261 A1 Dec. 31, 2015 niques for peptide synthesis known perse. Also, based on the mentarity regions are disregarded. Such variants of immuno amino acid sequence or nucleotide sequence of a naturally globulin single variable domains may be of particular advan occurring VHH domain or VH domain, respectively, a nucle tage since they may have improved potency/affinity. otide sequence encoding the desired humanized or camelized immunoglobulin single variable domains of the disclosure, 0.120. By means of non-limiting examples, a substitution respectively, can be designed and then synthesized de novo may, for example, be a conservative Substitution, as described using techniques for nucleic acid synthesis known per se, herein, and/or an amino acid residue may be replaced by after which the nucleic acid thus obtained can be expressed in another amino acid residue that naturally occurs at the same a manner known per se, so as to provide the desired immu position in another VHH domain. Thus, any one or more noglobulin single variable domains of the disclosure. Other Substitutions, deletions or insertions, or any combination Suitable methods and techniques for obtaining the immuno thereof, that either improve the properties of the immunoglo globulin single variable domains of the disclosure and/or bulin single variable domains or that do not detract from the nucleic acids encoding the same, starting from naturally desired properties or from the balance or combination of occurring VH sequences or preferably VHH sequences, will desired properties of the immunoglobulin single variable be clear from the skilled person, and may, for example, com domain (i.e., to the extent that the immunoglobulin single prise combining one or more parts of one or more naturally variable domains is no longer Suited for its intended use) are occurring VH sequences (such as one or more FR sequences included within the scope of the disclosure. A skilled person and/or CDR sequences), one or more parts of one or more will generally be able to determine and select suitable substi naturally occurring VHH sequences (such as one or more FR tutions, deletions or insertions, or Suitable combinations of sequences or CDR sequences), and/or one or more synthetic thereof, based on the disclosure herein and optionally after a or semi-synthetic sequences, in a Suitable manner, so as to limited degree of routine experimentation, which may, for provide a Single-domain antibody of the disclosure or a example, involve introducing a limited number of possible nucleotide sequence or nucleic acid encoding the same. Substitutions and determining their influence on the proper 0119) Also within the scope of the disclosure are natural or ties of the immunoglobulin single variable domains thus synthetic analogs, mutants, variants, alleles, parts or frag obtained. ments (herein collectively referred to as “variants') of the I0121. Also encompassed within the scope of the disclo immunoglobulin single variable domains, in particular the Sure are immunoglobulin single variable domains that are in Nanobodies, as defined herein, and in particular variants of a “multivalent form and are formed by bonding, chemically the immunoglobulin single variable domains of SEQIDNOs: or by recombinant DNA techniques, together two or more 13-20 (see Tables 1-2). Thus, according to one embodiment monovalent immunoglobulin single variable domains. Non of the disclosure, the term “immunoglobulin single variable limiting examples of multivalent constructs include “biva domain of the disclosure' or “Nanobody of the disclosure' in lent” constructs, “trivalent” constructs, “tetravalent” con its broadest sense also covers such variants. Generally, in Such structs, and so on. The immunoglobulin single variable variants, one or more amino acid residues may have been domains comprised within a multivalent construct may be replaced, deleted and/or added compared to the immunoglo identical or different. In another particular embodiment, the bulin single variable domains of the disclosure, as defined immunoglobulin single variable domains of the disclosure are herein. Such substitutions, insertions or deletions may be in a “multispecific' form and are formed by bonding together made in one or more of the FRs and/or in one or more of the two or more immunoglobulin single variable domains, of CDRs, and in particular variants of the FRs and CDRs of the which at least one with a different specificity. Non-limiting immunoglobulin single variable domains of SEQID NOs: 13 examples of multi-specific constructs include “bi-specific' 20 (see Tables 1-2). Variants, as used herein, are sequences constructs, “tri-specific' constructs, “tetra-specific’ con wherein each or any framework region and each or any structs, and so on. To illustrate this further, any multivalent or complementarity determining region shows at least 80% multispecific, as defined herein, immunoglobulin single vari identity, preferably at least 85% identity, more preferably able domain of the disclosure may be suitably directed 90% identity, even more preferably 95% identity or, still even against two or more different epitopes on the same antigen, more preferably 99% identity with the corresponding region for example, against two or more different epitopes of the in the reference sequence (i.e., FR1 variant versus FR1 GPCR; or may be directed against two or more different reference, CDR1 variant versus CDR1 reference, FR2 antigens, for example, against an epitope of the GPCR and an variant versus FR2 reference, CDR2 variant versus CDR2 epitope of a natural binding partner of the GPCR (e.g., G reference, FR3 variant versus FR3 reference, CDR3 protein, B-arrestin). In particular, a monovalent immunoglo variant versus CDR3 reference, FR4 variant versus FR4 bulin single variable domain of the disclosure is such that it reference), as can be measured electronically by making use will bind to the target GPCR with an affinity less than 500 nM, of algorithms such as PILEUP and BLAST. Software for preferably less than 200 nM, more preferably less than 10 nM, performing BLAST analyses is publicly available through the such as less than 500 pM. Multivalent or multispecific immu National Center for Biotechnology Information (on the World noglobulin single variable domains of the disclosure may also WideWeb at ncbi.nlm.nih.gov/). It will be understood that for have (or be engineered and/or selected for) increased avidity determining the degree of amino acid identity of the amino and/or improved selectivity for the desired GPCR, and/or for acid sequences of the CDRS of one or more sequences of the any other desired property or combination of desired proper immunoglobulin single variable domains, the amino acid ties that may be obtained by the use of such multivalent or residues that form the framework regions are disregarded. multispecific immunoglobulin single variable domains. In a Similarly, for determining the degree of amino acid identity particular embodiment, such multivalent or multispecific of the amino acid sequences of the FRs of one or more binding domains of the disclosure may also have (or be engi sequences of the immunoglobulin single variable domains of neered and/or selected for) improved efficacy in modulating the disclosure, the amino acid residues that form the comple signaling activity of a GPCR (see also further herein). US 2015/0376261 A1 Dec. 31, 2015
0122 Further, and depending on the host organism used to Likewise, methods for reconstituting an active GPCR in express the chimeric polypeptide of the disclosure, deletions phospholipid vesicles are known, and are described in: Luca and/or Substitutions within the binding domain moiety may et al., 2003, Mansoor et al., 2006, Niu et al., 2005, Shimada et be designed in Such a way that, e.g., one or more sites for al., 2002, and Eroglu et al., 2003, among others. In certain post-translational modification (such as one or more glyco cases, the GPCR and phospholipids may be reconstituted at sylation sites) are removed, as will be within the ability of the high phospholipid density (e.g., 1 mg receptor per mg of person skilled in the art. Alternatively, substitutions or inser phospholipid). In particular embodiments, the phospholipids tions may be designed so as to introduce one or more sites for vesicles may be tested to confirm that the GPCR is active. In attachment of functional groups, as described further herein. many cases, a GPCR may be present in the phospholipid 0123 Screening and Selection of Binding Domain Moi vesicle in both orientations (in the normal orientation, and in eties Suitable for the Disclosure the “inside-out' orientation in which the intracellular loops 0.124. A preferred class of binding domains, in particular are on the outside of the vesicle). Other immunization meth immunoglobulin single variable domains that form part of the ods with a GPCR include, without limitation, the use of chimeric polypeptide of the disclosure, is directed against complete cells expressing a GPCR or fractions thereof, vac and/or specifically binds to a functional conformational state cination with a nucleic acid sequence encoding a GPCR (e.g., of a GPCR, as described hereinbefore. Conformationally DNA vaccination), immunization with viruses or virus like selective binding domains, in particular immunoglobulin particles expressing a GPCR, amongst others (e.g., as single variable domains, can be identified in several ways, and described in WO2010070145, WO2011083141). will be illustrated hereafter in a non-limiting way for VHHs. 0.126 Any suitable animal, in particulara mammal Such as Preferably, conformation-selective binding domains can be a rabbit, mouse, rat, camel, sheep, cow, shark, pig, amongst selected after the step of immunization of a Camelidae with a others, or a bird Such as a chicken or turkey, may be immu GPCR in a functional conformational state, optionally bound nized using any of the techniques well known in the art to a receptor ligand, to expose the immune system of the Suitable for generating an immune response. animal with the conformational epitopes that are unique to the 0127. The selection for NANOBODIES(R), as a non-limit GPCR (for example, agonist-bound GPCR so as to raise ing example, specifically binding to a conformational epitope antibodies directed against a GPCR in its active conforma of a functional conformational state of the GPCR may, for tional state). Optionally, a particular ligand can be coupled to example, be performed by screening a set, collection or the GPCR of interest by chemical cross-linking. Thus, as library of cells that express heavy chain only antibodies on further described herein, such VHH sequences can preferably their surface (e.g., B-cells obtained from a suitably immu be generated or obtained by Suitably immunizing a species of nized Camelid), or bacteriophages that display a fusion of Camelid with a GPCR, preferably a GPCR in a functional genIII and Single-domain antibody at their Surface, or yeast conformational State (i.e., so as to raise an immune response cells that display a fusion of the mating factor protein Aga2p, and/or heavy chain only antibodies directed against the by screening of a (naive or immune) library of VHH GPCR), by obtaining a suitable biological sample from the sequences or Single-domain antibody sequences, or by Camelid (such as a blood sample, or any sample of B-cells), screening of a (naive or immune) library of nucleic acid and by generating VHH sequences directed against the sequences that encode VHH sequences or Single-domain GPCR, starting from the sample. Such techniques will be antibody sequences, which may all be performed in a manner clear to the skilled person. Yet another technique for obtaining known per se, and which method may optionally further the desired VHH sequences involves suitably immunizing a comprise one or more other Suitable steps. Such as, for transgenic mammal that is capable of expressing heavy chain example, and without limitation, a step of affinity maturation, only antibodies (i.e., so as to raise an immune response and/or a step of expressing the desired amino acid sequence, a step of heavy chain only antibodies directed against a GPCR in a screening for binding and/or for activity against the desired functional conformational state), obtaining a suitable biologi antigen (in this case, the GPCR), a step of determining the cal sample from the transgenic mammal (Such as a blood desired amino acid sequence or nucleotide sequence, a step of sample, or any sample of B-cells), and then generating VHH introducing one or more humanizing Substitutions, a step of sequences directed against the GPCR starting from the formatting in a Suitable multivalent and/or multispecific for sample, using any Suitable technique known per se. For mat, a step of Screening for the desired biological and/or example, for this purpose, the heavy chain antibody-express physiological properties (i.e., using a suitable assay known in ing mice and the further methods and techniques described in the art), and/or any combination of one or more of such steps, WOO2O85945 and in WOO40497.94 can be used. in any suitable order. 0125 For the immunization of an animal with a GPCR, the I0128 Various methods may be used to determine specific GPCR may be produced and purified using conventional binding, as defined hereinbefore, between the binding methods that may employ expressing a recombinant form of domain and a target GPCR, including, for example, enzyme the GPCR in a host cell, and purifying the GPCR using linked immunosorbent assays (ELISA), flow cytometry, affinity chromatography and/or antibody-based methods. In radioligand binding assays, Surface plasmon resonance particular embodiments, the baculovirus/Sf-9 system may be assays, phage display, and the like, which are common prac employed for expression, although other expression systems tice in the art, for example, in discussed in Sambrook et al., (e.g., bacterial, yeast or mammalian cell Systems) may also be 2001, Molecular Cloning, A Laboratory Manual. Third Edi used. Exemplary methods for expressing and purifying tion. Cold Spring Harbor Laboratory Press, Cold Spring Har GCPRs are described in, for example, Kobilka (1995), Eroglu bor, N.Y., and are further illustrated in the Example section. It et al., 2002, Chelikani et al., 2006, and the book “Identifica will be appreciated that for this purpose often a unique label tion and Expression of G Protein-Coupled Receptors' (Kevin or tag will be used, Such as a peptide label, a nucleic acid R. Lynch (Ed.), 1998), among many other references. A label, a chemical label, a fluorescent label, or a radio isotope GPCR may also be reconstituted in phospholipid vesicles. label, as described further herein. US 2015/0376261 A1 Dec. 31, 2015 20
0129. A particularly preferred way of selecting for confor particular sequence motifs. For example, a proteolytic cleav mation-selective binding agents is as described in, e.g. WO age site can be introduced into the linker molecule Such that 2012/007593. In an alternative preferred embodiment, selec GPCR moiety and binding domain moiety can be released. tion for conformation-selective binding agents can also be Useful cleavage sites are known in the art, and include a performed by using cell sorting to select, from a population of protease cleavage site Such as Factor Xa cleavage site having cells comprising a library of cell-surface tethered extracellu the sequence IEGR (SEQID NO:47), the thrombin cleavage lar binding agents, cells that are specifically bound to either site having the sequence LVPR (SEQ ID NO:48), the enter the GPCR in its active conformation or the GPCR in its okinase cleaving site having the sequence DDDDK (SEQID inactive conformation, but not both, for example, as described NO:49), or the PreScission (or 3C) cleavage site LEVLFQGP in Kruse et al., 2013. Without the purpose of being limitative, (SEQ ID NO:50). selection for conformation-selective binding agents is also 0.136. In case the binding domain moiety and the GPCR further illustrated in the Example section. moiety are linked using chemoenzymatic methods for protein 0130. It is also expected that the binding domain will modification, the linker moiety may exist of different chemi generally be capable of binding to all naturally occurring or cal entities, depending on the enzymes or the synthetic chem synthetic analogs, variants, mutants, alleles, parts, fragments, istry that is used to produce the covalent chimer in vivo or in and isoforms of a particular GPCR as comprised in the chi vitro (Rabuka 2010). meric polypeptide of the disclosure; or at least to those ana 0.137 Other Moieties and Modifications logs, variants, mutants, alleles, parts, fragments, and isoforms 0.138. The chimeric polypeptide of the disclosure may be of a particular GPCR that contain one or more antigenic further modified and/or may comprise (or can be further fused determinants or epitopes that are essentially the same as the to) other moieties, as described further herein. Examples of antigenic determinant(s) or epitope(s) to which the binding modifications, as well as examples of amino acid residues domains of the disclosure bind to a particular GPCR. within the chimeric polypeptide of the disclosure that can be 0131 Linker Moiety modified (i.e., either on the protein backbone but preferably 0.132. Within the context of the disclosure, the binding on a side chain), methods and techniques that can be used to domain moiety and the GPCR moiety (or eventually to still introduce Such modifications and the potential uses and other moieties, as described further herein) may be fused to advantages of such modifications will be clear to the skilled each other directly or indirectly, whereby indirect coupling person. For example, Such a modification may involve the usually occurs through the use of intervening amino acid introduction (e.g., by covalent linking or in another Suitable sequences or linker moieties. Preferred “linker molecules” or manner) of one or more functional groups, residues or moi “linkers' are peptides of 1 to 200 amino acids length, and are eties into or onto the chimeric polypeptide, in particular into typically, but not necessarily, chosen or designed to be or onto the binding domain moiety or into or onto the GPCR unstructured and flexible. For instance, one can choose amino moiety, and/or optionally into or onto the linker moiety. acids that form no particular secondary structure. Or, amino Examples of Such functional groups and of techniques for acids can be chosen so that they do not form a stable tertiary introducing them will be clear to the skilled person, and can structure. Or, the amino acid linkers may form a random coil. generally comprise all functional groups and techniques men Such linkers include, but are not limited to, synthetic peptides tioned in the art as well as the functional groups and tech rich in Gly, Ser. Thr, Gln, Glu or further amino acids that are niques known perse for the modification of pharmaceutical frequently associated with unstructured regions in natural proteins, and in particular for the modification of antibodies proteins (DoSztányi, Z. Csizmok, V., Tompa, P., & Simon, I. or antibody fragments (including ScPv's and single domain (2005). IUPred: web server for the prediction of intrinsically antibodies), for which reference is, for example, made to unstructured regions of proteins based on estimated energy Remington’s Pharmaceutical Sciences, 16th ed., Mack Pub content. Bioinformatics (Oxford, England), 21 (16), 3433-4). lishing Co., Easton, Pa. (1980). Such functional groups may, Non-limiting examples include (GS) or (GS). Other non for example, be linked directly (for example, covalently) to limiting examples of Suitable linker sequences are also the chimeric polypeptide, or optionally via a suitable linker or described in the Example section. spacer, as will again be clear to the skilled person. A usually 0133. In many cases, though not necessarily, the effective less preferred modification comprises N-linked or O-linked intramolecular concentration, as defined herein, will depend glycosylation, usually as part of co-translational and/or post on the linker length in a GPCR-binding domain fusion. translational modification, depending on the host cell used for Accordingly, an optimal linker length will be chosen so that expressing the chimeric polypeptide of the disclosure. Yet the effective intramolecular concentration reaches a maxi another modification may comprise the introduction of one or mum value. Preferably, the amino acid linker sequence has a more detectable labels or other signal-generating groups or low susceptibility to proteolytic cleavage and does not inter moieties, depending on the intended use of the labeled chi fere with the biological activity of chimeric polypeptide. meric polypeptide. Suitable labels and techniques for attach 0134. Thus, according to specific embodiments, the amino ing, using and detecting them will be clear to the skilled acid (AA) linker sequence is a peptide of between 0 and 200 person, and, for example, include, but are not limited to, AA, between 0 and 150AA, between 0 and 100 AA, between fluorescent labels (such as fluorescein, isothiocyanate, 0 and 90 AA, between 0 and 80 AA, between 0 and 70AA, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, between 0 and 60AA, between 0 and 50 AA, between 0 and o-phthaldehyde, and fluorescamine and fluorescent metals 40 AA, between 0 and 30 amino acids, between 0 and 20 AA, Such as Eu or others metals from the lanthanide series), phos between 0 and 10 amino acids, between 0 and 5 amino acids. phorescent labels, chemiluminescent labels or biolumines Examples of sequences of short linkers include, but are not cent labels (such as luminal, isoluminol, theromatic acri limited to, PPP, PP or G.S. dinium ester, imidazole, acridinium salts, oxalate ester, 0135 For certain applications, it may be advantageous dioxetane or GFP and its analogs), radio-isotopes, metals, that the linker molecule comprises or consists of one or more metals chelates or metallic cations or other metals or metallic US 2015/0376261 A1 Dec. 31, 2015
cations that are particularly Suited for use in in Vivo, in vitro from the organism, tissue, cell or cell line. Examples of mem or in situ detection and imaging, as well as chromophores and brane or liposomal compositions include, but are not limited enzymes (such as malate dehydrogenase, staphylococcal to, organelles, membrane preparations, viruses, virus like nuclease, delta-V-steroid isomerase, yeast alcohol dehydro lipoparticles (VLPs), and the like. It will be appreciated that genase, alpha-glycerophosphate dehydrogenase, triose phos a cellular composition, or a membrane or liposomal compo phate isomerase, biotinavidin peroxidase, horseradish per sition may comprise natural or synthetic lipids. In yet another oxidase, alkaline phosphatase, asparaginase, glucose preferred embodiment, the complex is crystalline. So, a crys oxidase, beta-galactosidase, ribonuclease, urease, catalase, tal of the complex is also provided, as well as methods of glucose-VI-phosphate dehydrogenase, glucoamylase and making the crystal, which are described in greater detail acetylcholine esterase). Other suitable labels will be clear to below. Preferably, a crystalline form of a complex comprising the skilled person, and, for example, include moieties that can a chimeric polypeptide, according to the disclosure, and a be detected using NMR or ESR spectroscopy. Such labeled receptor ligand is envisaged. chimeric polypeptides of the disclosure, may, for example, be 0.141. Accordingly, the disclosure also relates to a mem used for in vitro, in vivo or in situ assays (including immu brane or liposomal composition comprising a chimeric noassays known perse such as ELISA, RIA, EIA and other polypeptide or a complex, as described above. Membrane 'sandwich assays, etc.) as well as in vivo targeting and compositions may be derived from a tissue, cell or cell line imaging purposes, depending on the choice of the specific and include organelles, membrane extracts or fractions label. As will be clear to the skilled person, another modifi thereof, VLPs, viruses, and the like, as long as sufficient cation may involve the introduction of a chelating group, for functionality of the chimeric polypeptides is retained. example, to chelate one of the metals or metallic cations 0.142 Expression Systems referred to above. Suitable chelating groups, for example, 0143. In another aspect, the disclosure relates to a nucleic include, without limitation, diethyl-enetriaminepentaacetic acid molecule comprising a nucleic acid sequence encoding acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). Yet the chimeric polypeptide of the disclosure and as described another modification may comprise the introduction of a hereinbefore. According to a particular embodiment, the dis functional group that is one part of a specific binding pair, closure relates to a nucleic acid molecule comprising a Such as the biotin-(strept)avidin binding pair. Such a func nucleic acid sequence encoding the chimeric polypeptide of tional group may be used to link the chimeric polypeptide of the disclosure, wherein the nucleic acid encodes from 5' to 3': the disclosure to another protein, polypeptide or chemical 0144 a signal peptide, compound that is bound to the other half of the binding pair, 0145 an epitope tag, i.e., through formation of the binding pair. For example, a 0146 a protease cleavage site, chimeric polypeptide of the disclosure may be conjugated to 0147 a GPCR of interest, biotin, and linked to another protein, polypeptide, compound 0.148 a conformation-selective binding domain target or carrier conjugated to avidin or Streptavidin. For example, ing the GPCR of interest. Such a conjugated chimeric polypeptide may be used as a 0149. Alternatively, according to another particular reporter, for example, in a detection system where a detect embodiment, the disclosure relates to a nucleic acid molecule able signal-producing agent is conjugated to avidinor Strepta comprising a nucleic acid sequence encoding the chimeric vidin. Such binding pairs may, for example, also be used to polypeptide of the disclosure, wherein the nucleic acid bind the chimeric polypeptide of the disclosure to a carrier, encodes from 5' to 3': including carriers Suitable for pharmaceutical purposes. One 0.150 a signal peptide, non-limiting example are the liposomal formulations 0151 an epitope tag, described by Cao and Suresh, Journal of Drug Targeting, 8, 4. 0152 a protease cleavage site, 257 (2000). Such binding pairs may also be used to link a 0.153 a conformation-selective binding domain target therapeutically active agent to the chimeric polypeptide of the ing a GPCR of interest, disclosure. 0154 the GPCR of interest. 0139 Compositions Comprising a Chimeric Polypeptide 0155 Such nucleic acid molecules are exemplified further 0140. The chimeric polypeptide of the disclosure may also in the Example section. comprise (or can be further fused to) other molecules, in 0156 Further, the disclosure also envisages expression particular ligands, including a receptor ligand (such as a full vectors comprising nucleic acid sequences encoding any of agonist, partial agonist, antagonist, inverse agonist, biased chimeric polypeptides of the disclosure, as well as host cells agonist, natural binding partner, and the like). Thus, accord expressing Such expression vectors. Suitable expression sys ing to one aspect, the disclosure also envisages a complex tems include constitutive and inducible expression systems in comprising a chimeric polypeptide, as described hereinbe bacteria or yeasts, virus expression systems, such as bacu fore, and a receptor ligand. As a non-limiting example, a lovirus, Semliki forest virus and lentiviruses, or transient stable complex may be purified by size exclusion chromatog transfection in insector mammalian cells. The cloning and/or raphy. In a preferred embodiment, the complex, according to expression of the chimeric polypeptides of the disclosure can the disclosure, is in a solubilized form, such as in a detergent. be done according to techniques known by the skilled person In an alternative preferred embodiment, the complex, accord in the art. ing to the disclosure, is immobilized to a solid Support. Non 0157. The “host cell according to the disclosure, can be limiting examples of Solid Supports as well as methods and of any prokaryotic or eukaryotic organism. According to a techniques for immobilization are described further in the preferred embodiment, the host cell is a eukaryotic cell and detailed description. In still another embodiment, the com can be of any eukaryotic organism, but in particular embodi plex, according to the disclosure, is in a cellular composition, ments yeast, plant, mammalian and insect cells are envisaged. including an organism, a tissue, a cell, a cell line, or in a The nature of the cells used will typically depend on the ease membrane composition or liposomal composition derived and cost of producing the chimeric polypeptide, the desired US 2015/0376261 A1 Dec. 31, 2015 22 glycosylation properties, the origin of the chimeric polypep lipolytica), a Kluyveromyces species (e.g., Kluyveromyces tide, the intended application, or any combination thereof. lactic), a Pichia species (e.g., Pichia pastoris), or a Komaga Mammalian cells may, for instance, be used for achieving taella species (e.g., Komagataella pastoris). According to a complex glycosylation, but it may not be cost-effective to specific embodiment, the eukaryotic cells are Pichia cells, produce proteins in mammalian cell Systems. Plant and insect and in a most particular embodiment Pichia pastoris cells. cells, as well as yeast typically achieve high production levels 0160 Transfection of target cells (e.g., mammalian cells) and are more cost-effective, but additional modifications may can be carried out following principles outlined by Sambrook be needed to mimic the complex glycosylation patterns of and Russel (Molecular Cloning, A Laboratory Manual, 3" mammalian proteins. Yeast cells are often used for expression Edition, Volume 3, Chapter 16, Section 16.1-16.54). In addi of proteins because they can be economically cultured, give tion, viral transduction can also be performed using reagents high yields of (medium-secreted) protein, and when appro such as adenoviral vectors. Selection of the appropriate viral priately modified are capable of producing proteins having vector system, regulatory regions and host cell is common Suitable glycosylation patterns. Further, yeast offers estab knowledge within the level of ordinary skill in the art. The lished genetics allowing for rapid transformations, tested pro resulting transfected cells are maintained in culture or frozen tein localization strategies, and facile gene knock-out tech for later use according to standard practices. niques. Insect cells are also an attractive system to express 0.161 Accordingly, another aspect of the disclosure relates GPCRs because insect cells offer an expression system with to a method for producing a chimeric polypeptide, according out interfering with mammalian GPCR signaling. Eukaryotic to the disclosure, the method comprising at least the steps of cell or cell lines for protein production are well known in the 0162 a) Expressing in a suitable cellular expression sys art, including cell lines with modified glycosylation path tem (as defined hereinabove) a nucleic acid encoding a chi ways, and non-limiting examples Will be provided hereafter. meric polypeptide, according to the disclosure, and option 0158 Animal or mammalian host cells suitable for har ally. boring, expressing, and producing proteins for Subsequent 0163 b) Isolating and/or purifying the chimeric polypep isolation and/or purification include Chinese hamster ovary tide. cells (CHO), such as CHO-KI (ATCCCCL-61), DG44 (Cha 0164. The above-described conformationally constrained sin et al., 1986: Kolkekar et al., 1997), CHO-K1 Tet-On cell chimeric polypeptides can, thus, be considered as novel line (Clontech), CHO designated ECACC 85.050302 single-protein tools that are particularly useful for Screening (CAMR, Salisbury, Wiltshire, UK), CHO clone 13 (GEIMG, and drug discovery (in its broadest sense), all of which is now Genova, IT), CHO clone B (GEIMG, Genova, IT), CHO-K1/ detailed further herein. SF designated ECACC 93.061607 (CAMR, Salisbury, Wilt 0.165. Applications shire, UK), RR-CHOK1 designated ECACC 92052129 0166 The herein described chimeric polypeptides and (CAMR, Salisbury, Wiltshire, UK), dihydrofolate reductase nucleic acids encoding the same, complexes, cells, and cel negative CHO cells (CHO/-DHFR, Urlaub and Chasin, lular compositions derived thereof, can be used in a variety of 1980), and dp12.CHO cells (U.S. Pat. No. 5,721,121); mon contexts and applications, for example, and without limita key kidney CV1 cells transformed by SV40 (COS cells, COS tion, (1) for direct separation and/or purification of a chimeric 7, ATCC CRL-1651); human embryonic kidney cells (e.g., polypeptide as a single protein, wherein the GPCR of interest 293 cells, or 293T cells, or 293 cells subcloned for growth in is stabilized in a constitutive manner in a conformation of suspension culture, Graham et al., 1977, J. Gen. Virol. 36:59, interest; (2) for crystallization studies and high-resolution or GnTI KO HEK293S cells, Reeves et al., 2002); baby ham structural analysis of GPCRs by making use of a chimeric ster kidney cells (BHK, ATCCCCL-10); monkey kidney cells polypeptide of the disclosure; (3) for ligand screening and (CV1, ATCC CCL-70); African green monkey kidney cells (structure-based) drug discovery, (4) for stably and constitu (VERO-76, ATCC CRL-1587; VERO, ATCC CCL-81); tively expressing a GPCR as a single fusion protein in a mouse sertoli cells (TM4, Mather, 1980, Biol. Reprod. conformation of interest at a cellular Surface or in another 23:243-251); human cervical carcinoma cells (HELA, ATCC cellular membrane fraction, all of which will be described CCL-2); canine kidney cells (MDCK, ATCC CCL-34): into further detail below. human lung cells (W138, ATCCCCL-75); human hepatoma 0.167 Separation and Purification Methods cells (HEP-G2, HB 8065); mouse mammary tumor cells 0168 One key advantage of the disclosure is that a GPCR (MMT 060562, ATCCCCL-51); buffalo rat liver cells (BRL can be separated and purified in a conformation of interest in 3A, ATCC CRL-1442); TRI cells (Mather, 1982); MCR 5 a defined 1:1 stoichiometry of GPCR to binding domain. A cells: FS4 cells. According to a particular embodiment, the particular advantage of the disclosure is that the binding cells are mammaliancells selected from Hek293 cells or COS domain in the chimeric polypeptide can stabilize a particular cells. receptor conformation at a very high effective intramolecular 0159 Exemplary non-mammalian cell lines include, but concentration, even in the absence of any ligand. In addition, are not limited to, insect cells, such as Sf9 cells/baculovirus persons of ordinary skill in the art will recognize that binding expression systems (e.g., review Jarvis, Virology Volume domains that selectively bind a folded state of a GPCR will 310, Issue 1, 25 May 2003, Pages 1-7), plant cells such as protect this GPCR against chemical or thermal denaturation, tobacco cells, tomato cells, maize cells, algae cells, or yeasts thus increasing the conformational stability and/or thermo Such as Saccharomyces species, Schizosaccharomyces spe stability. Therefore, the chimeric polypeptide can be sepa cies, Hansenula species, Yarrowia species or Pichia species. rated from a mixture, and optionally purified as a single According to particular embodiments, the eukaryotic cells protein wherein the receptor adopts the conformation that is are yeast cells from a Saccharomyces species (e.g., Saccha stabilized by the binding domain. This separated or purified romyces cerevisiae), Schizosaccharomyces sp. (for example, chimeric polypeptide is a very useful and direct tool for Schizosaccharomyces pombe), a Hansenula species (e.g., Subsequent crystallization, ligand characterization and com Hansenula polymorpha), a Yarrowia species (e.g., Yarrowia pound Screening, immunizations, amongst others. US 2015/0376261 A1 Dec. 31, 2015
0169. Accordingly, the disclosure envisages a method of Related to the sparse matrix screening approach is to generate separating and/or purifying a chimeric polypeptide compris structural variation in the protein itself, for example, by add ing a GPCR fused to a binding domain that specifically binds ing ligands that bind the protein, or by making different to the GPCR, the method comprising the step of separating mutations, preferentially in Surface residues of the target pro and/or purifying the chimeric polypeptide by any Suitable tein or by trying to crystallize different species orthologues of CaS. the target protein. 0170 Alternatively, it may be desired to first generate a 0177 Because crystallization involves an unfavorable loss complex of a chimeric polypeptide, as described hereinbe of conformational entropy in the molecule to be assembled in fore, and a receptor ligand (e.g., an orthosteric ligand, an the crystal lattice, methods that reduce the conformational allosteric ligand, a natural binding protein such as a G protein, entropy of the target while still in solution should enhance the and the like), which can then Subsequently be separated and likelihood of crystallization by lowering the net entropic pen eventually purified. alty of lattice formation. The “surface entropy reduction' 0171 Thus, the disclosure also envisages a method of approach has proved to be highly effective (Derewenda separating and/or purifying a complex of a chimeric polypep 2004). Likewise, binding partners such as ions, Small mol tide and a receptor ligand, the method comprising the step of ecule ligands, and peptides can reduce the conformational separating and/or purifying the complex by any Suitable heterogeneity by binding to and Stabilizing a Subset of con CaS. formational states of a protein. Although Such binding part 0172. In essence, the same methods that are commonly ners are effective, not all proteins have a known binding used to produce and purify GPCRs (see above) can be equally partner, and even when a binding partner is known, its affinity, used for the production and purification of the chimeric solubility, and chemical stability may not be compatible with polypeptides of the disclosure. Methods for isolating/purify crystallization trials. ing chimeric polypeptides, as described above, include, with 0.178 Crystallization of GPCRs for high-resolution struc out limitation, affinity-based methods such as affinity chro tural studies is particularly difficult because of the amphip matography, affinity purification, immunoprecipitation, athic surface of these membrane proteins. Embedded in the protein detection, immunochemistry, Surface-display, size membrane bilayer, the contact sites of the protein with the exclusion chromatography, ion exchange chromatography, acyl chains of the phospholipids are hydrophobic, whereas amongst others, and are all well-known in the art. For the polar Surfaces are exposed to the polar head groups of the example, the chimeric polypeptide can be expressed in lipids and to the aqueous phases. To obtain well-ordered recombinant form in a host cell, and Subsequently purified three-dimensional crystals, a prerequisite to X-ray structural using affinity chromatography and/or antibody-based meth analysis at high resolution, GPCRs are solubilized with the ods. In particular embodiments, the baculovirus/Sf-9 system help of detergents and purified as protein-detergent com may be employed for expression, although other expression plexes. The detergent micelle covers the hydrophobic surface systems (e.g., bacterial, yeast or mammalian cell systems) of the membrane protein in a belt-like manner (Hunte and may also be used as described further herein. Michel 2002: Ostermeier et al., 1995). GPCR-detergent com 0173 Crystallography and Applications in Structure plexes form three-dimensional crystals in which contacts Based Drug Design between adjacent protein molecules are made by the polar 0.174. One aspect of the disclosure relates to the usefulness Surfaces of the protein protruding from the detergent micelle of the chimeric polypeptides of the disclosure in X-ray crys (Day et al., 2007). Obviously, the detergent micelle requires tallography of GPCRs and its applications in structure-based space in the crystal lattice. Although attractive interactions drug design. between the micelles might stabilize the crystal packing (Ras 0175 Crystallization of membrane proteins including mussen et al., 2007), these interactions do not lead to rigid GPCRs remains a challenge. Although expression and puri crystal contacts. Because many membrane proteins, includ fication methods are appearing that allow for the generation ing GPCRs contain relatively small or highly flexible hydro of milligram quantities, achieving stability with these mol philic domains, a strategy to increase the probability of get ecules is perhaps the most difficult hurdle to overcome, espe ting well-ordered crystals is to enlarge the polar Surface of the cially in view of the multiple conformations these proteins protein and/or to reduce their flexibility. The most physi can adopt. Increased receptor stability of detergent solubi ologic approach is to use a native signaling partner Such as a lized GPCRs protects them from proteolytic degradation and/ G protein or arrestin. Unfortunately, interactions of GPCRs or aggregation and facilitates the purification and concentra with G proteins or arrestins are highly lipid dependent, and it tion of homogenous samples of correctly folded proteins. has been difficult to form complexes of sufficient stability for Persons of ordinary skill in the art will recognize that such crystallography. samples are the preferred starting point for the generation of 0179. It is, thus, a particular advantage of the chimeric diffracting crystals. polypeptide of the disclosure that the binding domain binds a 0176 The crystallization process itself is another major conformational epitope on the GPCR at a very high effective bottleneck in the process of macromolecular structure deter intramolecular concentration, thus stabilizing the receptor, mination by X-ray crystallography. Successful crystallization reducing its conformational flexibility and increasing its requires the formation of nuclei and their Subsequent growth polar Surface, facilitating the crystallization of a rigid 1 to 1 to crystals of Suitable size. Crystal growth generally occurs receptor-binding domain fusion. It is a particular advantage spontaneously in a Supersaturated Solution as a result of that the chimeric polypeptide of the disclosure can be crys homogenous nucleation. Proteins may be crystallized in a tallized in the absence of any ligand. typical sparse matrix screening experiment, in which precipi 0180. It was surprisingly found that the chimeric polypep tants, additives and protein concentration are sampled exten tides of the disclosure can be used as tools to increase the sively, and Supersaturation conditions suitable for nucleation probability of obtaining well-ordered crystals by minimizing and crystal growth can be identified for a particular protein. the conformational heterogeneity in the GPCR of choice by US 2015/0376261 A1 Dec. 31, 2015 24 fusion to a conformationally-selective binding domain in a 0183. According to another embodiment, the disclosure defined 1:1 stoichiometry. Thus, according to one embodi relates to the use of a chimeric polypeptide, as described ment, it is envisaged to use the chimeric polypeptides of the herein, to solve a structure of a GPCR-binding domainfusion, disclosure for crystallization purposes. Advantageously, and optionally further comprising a receptor ligand. "Solving crystals can be formed of fusion proteins wherein the GPCR the structure.” as used herein, refers to determining the is trapped in a particular receptor conformation, more par arrangement of atoms or the atomic coordinates of a protein, ticularly a therapeutically relevant receptor conformation and is often done by a biophysical method, such as X-ray (e.g., an active conformation), as ensured by the choice of a crystallography. conformationally-selective binding domain that forms part of 0.184 In many cases, obtaining a diffraction-quality crys tal is the key barrier to solving its atomic-resolution structure. the fusion protein. The binding domain will also reduce the Thus, according to specific embodiments, the herein flexibility of extracellular regions upon binding the GPCR to described chimeric polypeptides can be used to improve the grow well-ordered crystals. Immunoglobulin single variable diffraction quality of the crystals so that the crystal structure domains, including Nanobodies, are especially Suited for this of the GPCR-binding domain fusion can be solved. purpose because they bind conformational epitopes and are 0185. Further, obtaining structural information of GPCR composed of one single rigid globular domain, devoid of targets, for example, to help guide GPCR drug discovery, is flexible linker regions unlike conventional antibodies or frag highly desired. Beyond the crystallization of more GPCRs, ments derived such as Fab’s. especially methods for acquiring structures of receptors 0181. Thus, according to a preferred embodiment, the dis bound to lead compounds that have pharmacological or bio closure provides for chimeric polypeptides comprising a logical activity and whose chemical structure is used as a GPCR fused to a binding domain useful as direct tools for starting point for chemical modifications in order to improve crystallizing a GPCR, and eventually to solve the structure. potency, selectivity, or pharmacokinetic parameters. Persons According to a specific embodiment, the disclosure also of ordinary skill in the art will recognize that the chimeric envisages to crystallize a complex of a chimeric polypeptide polypeptide of the disclosure is particularly suited for co and a receptor ligand, as defined hereinbefore. In a particu crystallization with lead compounds that are selective for a larly preferred embodiment of the above method, the GPCR non-prominent functional conformation (different from the comprised in the chimeric polypeptide or complex is in an basal conformation) induced by the binding domain because active state conformation revealing new structural features this binding domain is able to substantially increase the affin that are suitable for targeting with small molecules or bio ity for conformation-selective compounds. logicals and may enable the identification of compounds that 0186. According to another embodiment, the disclosure are selective for the active conformation. In particular, these allows to crystallize the chimeric polypeptide in the absence new structural features may occur at the orthosteric site or at of any ligand starting from a defined 1:1 stoichiometry an allosteric site, allowing the development of new confor between receptor and binding domain whereby the high mation-specific orthosteric or allosteric compounds or frag effective intramolecular concentration of the conformation ments thereof, respectively. In another embodiment the selective binding domain can stabilize the receptor in the GPCR comprised in the chimeric polypeptide or complex is desired conformation within the crystal lattice. Persons of in an inactive state conformation (characterized by an ordinary skill in the art will recognize that such preformed increased affinity for inverse agonists and/or by a decreased crystals of a free receptor, stabilized in a particular functional affinity for agonists as compared to the non-constrained conformation are an ideal starting point for soaking experi GPCR) or in a functional conformation that leads to 3-arrestin ments, aiming at Solving structures of the receptor in complex dependent signaling (characterized by an increased affinity with fragments or compounds that bind to the receptor in the for B-arrestin biased agonists as compared to the non-con conformation induced by the binding domain. strained GPCR). 0187. According to another embodiment, the disclosure 0182. Thus, the chimeric polypeptide of the disclosure, encompasses a method of determining the crystal structure of optionally in complex with a receptor ligand, may be crystal a chimeric polypeptide comprising a GPCR-binding domain lized using any of a variety of specialized crystallization fusion, the method comprising the steps of: methods for membrane proteins, many of which are reviewed 0188 a) Providing a chimeric polypeptide, according to in Caffrey (2003 & 2009). In general terms, the methods are the disclosure, and lipid-based methods that include adding lipid to the complex 0189 b) Allowing the chimeric polypeptide to crystallize. prior to crystallization. Such methods have previously been 0190. In particular embodiments of the above method of used to crystallize other membrane proteins. Many of these determining the crystal structure, the chimeric polypeptide methods, including the lipidic cubic phase crystallization comprising a GPCR-binding domain fusion further com method and the bicelle crystallization method, exploit the prises a receptor ligand, more specifically an agonist, an spontaneous self-assembling properties of lipids and deter inverse agonist, etc., bound to the GPCR. gent as vesicles (vesicle-fusion method), discoidal micelles 0191 The determining of the crystal structure may be (bicelle method), and liquid crystals or mesophases (in meso done by a biophysical method such as X-ray crystallography. or cubic-phase method). Lipidic cubic phases crystallization The method may further comprise a step for obtaining the methods are described in, for example: Landau et al., 1996; atomic coordinates of the crystal, as defined hereinbefore. Gouaux 1998: Rummel et al., 1998: Nollert et al., 2004, 0.192 Ligand Screening and Drug Discovery Rasmussen et al., 2011 a,b, which publications are incorpo 0193 Other applications are particularly envisaged by rated by reference for disclosure of those methods. Bicelle making use of the chimeric polypeptides of the disclosure, or crystallization methods are described in, for example: Faham advantageously, by making direct use of the host cells or cell et al., 2005; Faham et al., 2002, which publications are incor cultures comprising chimeric polypeptides, according to the porated by reference for disclosure of those methods. disclosure, or by using membrane preparations derived US 2015/0376261 A1 Dec. 31, 2015 thereof, including compound screening and immunizations, mation that leads to 3-arrestin dependent signaling or any which will be described further herein. other functional conformation of interest. 0194 In the process of compound screening, lead optimi 0203. In a preferred embodiment, the chimeric polypep Zation and drug discovery, including antibody discovery, tides as used in any of the screening methods described fur there is a requirement for faster, more effective, less expen ther herein, are provided as whole cells, or cell (organelle) sive and especially information-rich screening assays that extracts such as membrane extracts or fractions thereof, or provide simultaneous information on various compound may be incorporated in lipid layers or vesicles (comprising characteristics and their effects on various cellular pathways natural and/or synthetic lipids), high-density lipoparticles, or (i.e., efficacy, specificity, toxicity and drug metabolism). any nanoparticle. Such as nanodisks, or are provided as virus Thus, there is a need to quickly and inexpensively screenlarge or virus-like particles (VLPs), so that sufficient functionality numbers of compounds in order to identify new specific of the respective proteins is retained. Methods for prepara ligands of a protein of interest, preferably conformation-se tions of GPCR-containing chimeric polypeptides from mem lective ligands, which may be potential new drug candidates. brane fragments or membrane-detergent extracts are The disclosure solves this problem by providing GPCR drug reviewed in detail in Cooper (2004), incorporated herein by targets that are stabilized in a non-prominent druggable con reference. Alternatively, the chimeric polypeptides may also formation, due to the high effective intramolecular concen be solubilized in detergents. tration of the conformation-selective binding domain that is 0204 Screening assays for drug discovery can be solid covalently bound in a 1 to 1 stoichiometry. This allows to phase (e.g., beads, columns, slides, chips or plates) or solu quickly and reliably identify and differentiate between tion phase assays, e.g., a binding assay, Such as radioligand ligands of different functional profiles, including ligands with binding assays. In high-throughput assays, it is possible to an agonist profile, an inverse agonist profile, an antagonist screen up to several thousand different compounds in a single profile, a biased agonist profile, etc., in a single assay, so day in 96-, 384- or 1536-well formats. For example, each well increasing the speed and likelihood of identifying a ligand ofa microtiter plate can be used to run a separate assay against with the desired pharmacological properties. In particular, the a selected potential modulator, or, if concentration or incuba chimeric polypeptides and host cells comprising the same, as tion time effects are to be observed, every 5-10 wells can test well as host cell cultures or membrane preparations derived a single modulator. Thus, a single standard microtiter plate thereof are provided, for which specific preferences have can assay about 96 modulators. It is possible to assay many been described hereinbefore, are particularly suitable for this plates per day; assay screens for up to about 6,000, 20,000, purpose. Thus, these chimeric polypeptides, host cells, as 50,000 or more different compounds are possible today. well as host cell cultures or membrane preparations derived 0205 Various methods may be used to determine binding thereof, can then be used as immunogens or selection between the stabilized GPCR and a test compound, including, reagents for screening in a variety of contexts. for example, flow cytometry, radioligand binding assays, 0.195 Thus, according to a preferred embodiment, the dis enzyme linked immunosorbent assays (ELISA), Surface plas closure encompasses the use of the chimeric polypeptides, mon resonance assays, chip-based assays, immunocytofluo host cells, host cell cultures, or membrane preparations rescence, yeast two-hybrid technology and phage display, derived thereof, according to the disclosure and as described which are common practice in the art, for example, in Sam hereinbefore, in screening and/or identification programs for brook et al., 2001, Molecular Cloning, A Laboratory Manual. conformation-selective compounds of a GPCR, which ulti Third Edition. Cold Spring Harbor Laboratory Press, Cold mately might lead to potential new drug candidates. Spring Harbor, N.Y. Other methods of detecting binding 0196. According to one embodiment, the disclosure envis between a test compound and a membrane protein include ages a method of identifying conformation-selective com ultrafiltration with ion spray mass spectroscopy/HPLC meth pounds, the method comprising the steps of: ods or other (bio)physical and analytical methods. Fluores 0.197 (i) Providing a chimeric polypeptide, according to cence Energy Resonance Transfer (FRET) methods, for the disclosure, and example, well known to those skilled in the art, may also be (ii) Providing a test compound, and used. It will be appreciated that a bound test compound can be 0198 detected using a unique label or tag associated with the com 0199 (iii) Evaluating the selective binding of the test com pound, Such as a peptide label, a nucleic acid label, a chemical pound to the GPCR comprised in the chimeric polypeptide, label, a fluorescent label, or a radio isotope label, as described and further herein. 0200 (iv) Selecting a conformationally-selective com 0206. In one embodiment, it is determined whether the pound. compound alters the binding of the GPCR as comprised in the 0201 Specific preferences for the chimeric polypeptides, chimeric polypeptide to a receptor ligand, as defined herein. host cells, host cell cultures and membrane preparations Binding of a GPCR to its ligand can be assayed using standard thereofare as defined above with respect to earlier aspects of ligand binding methods known in the art, as described herein. the disclosure. For example, a ligand may be radiolabeled or fluorescently 0202 In a particular embodiment of the above method, the labeled. The assay may be carried out on whole cells or on conformation-selective compound is a compound selective membranes obtained from the cells or aqueous solubilized for an active conformation of the GPCR comprised in the receptor with a detergent. The compound will be character chimeric polypeptide. In another particular embodiment of ized by its ability to alter the binding of the labeled ligand (see the above method, the conformation-selective compound is a also Example section). The compound may decrease the compound selective for an inactive conformation of the binding between the GPCR and its ligand, or may increase the GPCR comprised in the chimeric polypeptide. In still another binding between the GPCR and its ligand, for example, by a embodiment of the above method, the conformation-selective factor of at least 2 fold, 3 fold, 4 fold, 5 fold, 10 fold, 20 fold, compound is a compound selective for a functional confor 30 fold, 50 fold, 100 fold. US 2015/0376261 A1 Dec. 31, 2015 26
0207. According to a particularly preferred embodiment, on a solid Surface of chimeric polypeptide, according to the the above-described method of identifying conformation-se disclosure, may occur via a surface coating with any of an lective compounds is performed by a ligand binding assay or antibody, or streptavidin oravidin, or a metalion, recognizing competition assay, even more preferably a radioligand bind a molecular tag attached to the chimeric polypeptide, accord ing or competition assay. Most preferably, the above-de ing to standard techniques known by the skilled person (e.g., scribed method of identifying conformation-selective com Strep tag. Histidine tag, etc.). pounds is performed in a comparative assay, more 0213. In particular, the chimeric polypeptide may be specifically, a comparative ligand competition assay, even attached to a solid Surface by covalent cross-linking using more specifically a comparative radioligand competition conventional coupling chemistries. A solid Surface may natu assay, which is illustrated further in the Example section. rally comprise cross-linkable residues suitable for covalent 0208. In case the above-described method is performed in attachment or it may be coated or derivatized to introduce a comparative assay, it will be understood that the method will Suitable cross-linkable groups, according to methods well comprise the step of comparing the binding of a test com known in the art. In one particular embodiment, Sufficient pound for a GPCR comprised in a chimeric polypeptide functionality of the immobilized protein is retained following wherein the GPCR is stabilized by a conformation-selective direct covalent coupling to the desired matrix via a reactive binding domain moiety in a functional conformation of inter moiety that does not contain a chemical spacer arm. Further est (e.g., an active conformation oran inactive conformation) examples and more detailed information on immobilization with the binding of the test compound to a control. Within the methods of antibody (fragments) on Solid Supports are dis Scope of the disclosure, the control can be the corresponding cussed in Jung et al., 2008; similarly, membrane receptor non-fused GPCR or a chimeric polypeptide of the corre immobilization methods are reviewed in Cooper, 2004; both sponding GPCR fused to a mock binding domain moiety herein incorporated by reference. (also referred to as control binding moiety or irrelevant bind 0214) Advances in molecular biology, particularly ing moiety) which is a binding domain moiety that is not through site-directed mutagenesis, enable the mutation of directed to and/or does not specifically bind to the corre specific amino acid residues in a protein sequence. The muta sponding GPCR. tion of a particular amino acid (in a protein with known or 0209. In a particular preferred embodiment, the step of inferred structure) to a lysine or cysteine (or other desired evaluating the selective binding of the test compound to the amino acid) can provide a specific site for covalent coupling, GPCR comprised in the chimeric polypeptide in any of the for example. It is also possible to reengineer a specific protein above-described methods, is done by measuring and/or cal to alter the distribution of Surface available amino acids culating the affinity, as defined herein, of the test compound involved in the chemical coupling (Kallwasset al., 1993), in for the chimeric polypeptide, as is also further illustrated in effect controlling the orientation of the coupled protein. A the Example section. similar approach can be applied to the chimeric polypeptides, 0210. Often high-throughput screening of GPCR targets according to the disclosure, so providing a means of oriented for conformation-selective compounds will be preferred. immobilization without the addition of other peptide tails or This will be facilitated by immobilization of a chimeric domains containing either natural or unnatural amino acids. It polypeptide, according to the disclosure, onto a suitable Solid will be understood that a mutation can be introduced in the Surface or Support that can be arrayed or otherwise multi GPCR moiety and/or the binding domain moiety of the chi plexed. Non-limiting examples of Suitable Solid Supports meric polypeptide and needs to be carefully chosen so not to include beads, columns, slides, chips or plates. interfere with structural conformations and/or biological 0211 More particularly, the solid supports may be par activity. For example, in case a mutation will be introduced in ticulate (e.g., beads or granules, generally used in extraction the binding domain moiety that is an antibody or an antibody columns) or in sheet form (e.g., membranes or filters, glass or fragment, Such as a Single-domain antibody, introduction of plastic slides, microtitre assay plates, dipstick, capillary fill mutations in the framework region is preferred, minimizing devices or such like) which can be flat, pleated, or hollow disruption to the antigen-binding activity of the antibody fibers or tubes. The following matrices are given as examples (fragment). and are not exhaustive, Such examples could include silica 0215 Conveniently, the immobilized proteins may be (porous amorphous silica), i.e., the FLASH series of car used in immunoadsorption processes Such as immunoassays, tridges containing 60A irregular silica (32-63 um or 35-70 for example, ELISA, or immunoaffinity purification pro um) Supplied by Biotage (a division of Dyax Corp.), agarose cesses by contacting the immobilized proteins, according to or polyacrylamide Supports, for example, the Sepharose the disclosure, with a test sample, according to standard range of products Supplied by Amersham Pharmacia Biotech, methods conventional in the art. Alternatively, and particu or the Affi-Gel supports supplied by Bio-Rad. In addition larly for high-throughput purposes, the immobilized proteins there are macroporous polymers, such as the pressure-stable can be arrayed or otherwise multiplexed. Preferably, the Affi-Prep supports as supplied by Bio-Rad. Other supports immobilized proteins, according to the disclosure are used for that could be utilized include; dextran, collagen, polystyrene, the screening and selection of compounds that selectively methacrylate, calcium alginate, controlled pore glass, alumi bind to a particular conformation of a GPCR. num, titanium and porous ceramics. Alternatively, the Solid 0216. It will be appreciated that either the binding domain Surface may comprise part of a mass dependent sensor, for moiety or the GPCR moiety that form part of the fusion may example, a Surface plasmon resonance detector. Further be immobilized, depending on the type of application or the examples of commercially available Supports are discussed type of screening that needs to be done. Also, the choice of the in, for example, Protein Immobilization, R. F. Taylor ed., GPCR-stabilizing binding domain (targeting a particular con Marcel Dekker, Inc., New York, (1991). formational epitope of the GPCR), will determine the orien 0212 Immobilization may be either non-covalent or cova tation of the GPCR and accordingly, the desired outcome of lent. In particular, non-covalent immobilization or adsorption the compound identification, e.g., compounds specifically US 2015/0376261 A1 Dec. 31, 2015 27 binding to extracellular parts, intramembranal parts or intra domain antibody (sdAb), a minibody, the variable domain cellular parts of the conformationally stabilized GPCR. derived from camelid heavy chain antibodies (VHH or 0217. In an alternative embodiment, the test compound (or Single-domain antibody), the variable domain of the new a library of test compounds) may be immobilized on a solid antigen receptors derived from shark antibodies (VNAR), a Surface. Such as a chip Surface, whereas the chimeric polypep protein scaffold including an alphabody, protein A, protein G, tide are provided, for example, in a detergent solution or in a designed ankyrin-repeat domains (DARPins), fibronectin membrane-like preparation. type III repeats, anticalins, knottins, engineered CH2 0218. Accordingly, in one specific embodiment, a solid domains (nanoantibodies), as defined hereinbefore. Support to which is immobilized a chimeric polypeptide, 0223) In one preferred embodiment, high throughput according to the disclosure, is provided for use in any of the screening methods involve providing a combinatorial chemi above Screening methods. cal or peptide library containing a large number of potential 0219 Most preferably, neither the chimeric polypeptide, therapeutic ligands. Such “combinatorial libraries' or “com nor the test compound is immobilized, for example, in phage pound libraries' are then screened in one or more assays, as display selection protocols in Solution, or radioligand binding described herein, to identify those library members (particu assayS. lar chemical species or subclasses) that display a desired 0220. The compounds to be tested can be any small chemi characteristic activity. A “compound library' is a collection cal compound, or a macromolecule. Such as a protein, a Sugar, of stored chemicals usually used ultimately in high-through nucleic acid or lipid. Typically, test compounds will be small put screening. A “combinatorial library” is a collection of chemical compounds, peptides, antibodies or fragments diverse chemical compounds generated by either chemical thereof. It will be appreciated that in some instances the test synthesis or biological synthesis, by combining a number of compound may be a library of test compounds. In particular, chemical “building blocks.” Preparation and screening of high-throughput screening assays for therapeutic compounds combinatorial libraries are well known to those of skill in the Such as agonists, antagonists or inverseagonists and/or modu art. The compounds thus identified can serve as conventional lators form part of the disclosure. For high-throughput pur “lead compounds” or can themselves be used as potential or poses, compound libraries or combinatorial libraries may be actual therapeutics. Thus, in one further embodiment, the used such as allosteric compound libraries, peptide libraries, screening methods, as described hereinabove, further com antibody libraries, fragment-based libraries, synthetic com prises modifying a test compound, which has been shown to pound libraries, natural compound libraries, phage-display selectively bind to a chimeric polypeptide comprising a chi libraries and the like. Methodologies for preparing and meric polypeptide comprising a GPCR in a particular confor screening Such libraries are known to those of skill in the art. mation, and determining whether the modified test compound 0221) The test compound may optionally be covalently or binds to the GPCR when residing in the particular conforma non-covalently linked to a detectable label. Suitable detect tion. able labels and techniques for attaching, using and detecting 0224 Thus, according to more specific embodiments, a them will be clear to the skilled person, and include, but are complex comprising a chimeric polypeptide of the disclosure not limited to, any composition detectable by spectroscopic, and a receptor ligand may be used in any of the above screen photochemical, biochemical, immunochemical, electrical, ing methods. Preferably, the receptor ligand is chosen from optical or chemical means. Useful labels include magnetic the group comprising a small molecule, a polypeptide, an beads (e.g., dynabeads), fluorescent dyes (e.g., all Alexa antibody or any fragment derived thereof, a natural product, Fluor dyes, fluorescein isothiocyanate, Texas red, rhodamine, and the like. More preferably, the receptor ligand is a full green fluorescent protein and the like), radiolabels (e.g., H. agonist, or a partial agonist, a biased agonist, an antagonist, or '*I, S, ''C, or 'P), enzymes (e.g., horse radishperoxidase, an inverse agonist, as described hereinbefore. alkaline phosphatase), and colorimetric labels such as colloi 0225. It may be desirable to identify and characterize natu dal gold or colored glass or plastic (e.g., polystyrene, ral or endogenous ligands of target GPCRs. In particular, polypropylene, latex, etc.) beads. Means of detecting Such there is a need to “de-orphanize GPCRs for which a natural labels are well known to those of skill in the art. Thus, for activating ligand has not been identified. Such ligands may be example, radiolabels may be detected using photographic recovered from biological samples such as blood or tissue film or Scintillation counters, fluorescent markers may be extract or from libraries of ligands. Thus, according to a detected using a photodetector to detect emitted illumination. particular embodiment, the test compound as used in any of Enzymatic labels are typically detected by providing the the above Screening methods is provided as a biological enzyme with a Substrate and detecting the reaction product sample. In particular, the sample can be any suitable sample produced by the action of the enzyme on the Substrate, and taken from an individual. For example, the sample may be a colorimetric labels are detected by simply visualizing the body fluid sample such as blood, serum, plasma, spinal fluid. colored label. Other suitable detectable labels were described 0226. Although the screening methods, as described earlier within the context of the first aspect of the disclosure above, are sufficient to determine the functional profile of relating to the chimeric polypeptide of the disclosure. compounds, the functional effect of a compound on down 0222. Thus, according to specific embodiments, the test stream signaling of the target GPCR may be additionally compound as used in any of the above Screening methods is evaluated in secondary assays. Therefore, the efficacy of the selected from the group comprising a polypeptide, a peptide, compounds and/or compositions comprising the same, can be a small molecule, a natural product, a peptidomimetic, a tested using any suitable in vitro assay, cell-based assay, in nucleic acid, a lipid, lipopeptide, a carbohydrate, an antibody Vivo assay and/or animal model known perse, or any combi or any fragment derived thereof, such as Fab, Fab' and F(ab') nation thereof, depending on the specific disease or disorder 2, Fd, single-chain FVS (ScPV), single-chain antibodies, dis involved. ulfide-linked Fvs (dsEv) and fragments comprising either a 0227. It will be appreciated that the chimeric polypep VL or VH domain, a heavy chain antibody (hcAb), a single tides, host cells and derivatives thereof, according to the dis US 2015/0376261 A1 Dec. 31, 2015 28 closure, may be further engineered and are, thus, particularly example, the kit may comprise (a library of) test compounds useful tools for the development or improvement of cell useful for compound screening applications. based assays. Cell-based assays are critical for assessing the 0232. The following examples are intended to promote a mechanism of action of new biological targets and biological further understanding of the disclosure. While the disclosure activity of chemical compounds. For example, without the is described herein with reference to illustrated embodiments, purpose of being limitative, current cell-based assays for it should be understood that the disclosure is not limited GPCRs include measures of pathway activation (Ca" hereto. Those having ordinary skill in the art and access to the release, cAMP generation or transcriptional activity); mea teachings herein will recognize additional modifications and Surements of protein trafficking by tagging GPCRs and embodiments within the scope thereof. Therefore, the disclo downstream elements with GFP, and direct measures of inter sure is limited only by the claims attached herein. actions between proteins using Fluorescence resonance energy transfer (FRET), bioluminescence resonance energy EXAMPLES transfer (BRET) or yeast two-hybrid approaches. 0228. Further, it may be particularly advantageous to Example 1 immunize an animal with a chimeric polypeptide of the dis closure, or a host cell or derivative thereof comprising the Generation of B2AR-Single-Domain Antibody same, in order to raise antibodies, preferably conformation Fusion Protein Constructs ally-selective antibodies against the target GPCR. Thus, such immunization methods are also envisaged here. Methods for 0233. The GPCR-Single-domain antibody fusions raising antibodies in vivo are known in the art, and are also described in this example are chimeric polypeptides that con described hereinbefore. Any Suitable animal, e.g., a mammal tain two different proteins connected with a peptide linker: Such as a rabbit, mouse, rat, camel, sheep, cow, pig, or a bird the GPCR B2AR, the linker GGGGSGGGS (SEQID NO:51) Such as a chicken or turkey, or a fish, Such as a shark, may be and a Single-domain antibody, all of which were fused in this immunized using any of the techniques well known in the art order from the amino to the carboxy terminus. Genes encod Suitable for generating an immune response. Following ing these proteins were fused, as described below (FIG.2) and immunization, expression libraries encoding immunoglobu cloned in the pFastEac1 vector (Invitrogen, cat. Nr 10359 lin genes, or portions thereof, expressed in bacteria, yeast, 016). filamentous phages, ribosomes or ribosomal Subunits or other 0234. The GPCR part was amplified from DNA encoding display systems, can be made according to well-known tech the cleavable hemagglutinin (HA) protein signal peptide (SP) niques in the art. Further to that, the antibody libraries that are derived from influenza virus (MKTIIALSYIFCLVFA: SEQ generated comprise a collection of Suitable test compounds IDNO:52) followed by the Flag epitope (DYKDDDDA: SEQ for use in any of the screening methods, as described herein ID NO:53) followed by a TEV cleavage site (ENLYFQGF: before. The antibodies that have been raised, as described SEQID NO:54) followed by the coding sequence of human hereinabove, may also be useful diagnostic tools to specifi B2 adrenergic receptor encompassing Gly2 to Gly365 (SEQ cally detect GPCRs in a particular conformational state, and ID NO:55). A point mutation of N187E was also introduced thus also form part of the disclosure. to the construct to disrupt this unwanted glycosylation site (B2AR365N; Rasmussen et al., 2011b). The B2 adrenergic 0229. In one embodiment, the immobilized chimeric receptor engineering to B2AR365N was performed to polypeptides, as described hereinbefore, may be used for the selection of binding domains including antibodies or anti increase the receptor's cellular expression levels in Sf9 cells. body fragments or peptides that bind the conformationally 0235 Single-domain antibody gene segments were ampli stabilized receptor. Persons of ordinary skill in the art will fied from phagemids encoding the respective Nanobodies. recognize that such binding domains, as a non-limiting Nb80 (SEQ ID NO:13) is a B2AR specific Single-domain example, can be selected by Screening a set, collection or antibody that stabilizes the active state of the B2AR bound to library of cells that express binding domains on their surface, full agonists such as BI-167107 (Rasmussen et al., 2011b). or bacteriophages that display a fusion of genIII and Single Nb71 (SEQ ID NO:14) is another B2AR specific Xaperone domain antibody at their Surface, or yeast cells that display a that stabilizes an active state (WO2012007593). Nb69 (SEQ fusion of the mating factor protein Aga2p, or by ribosome ID NO:15) is specific for the Muscarinic5 receptor and has no display amongst others. detectable affinity for B2AR. 0236. The GPCR and the Single-domain antibody were 0230. One particular embodiment relates to the use of such genetically fused in frame by an overlap extension PCR. immobilized chimeric polypeptides for the isolation of bind Therefore, 20 ng of plasmid containing the GPCR cloNA was ing domains that are selective for the conformation of the used as the template in a 50 lul PCR reaction (Pfu polymerase, receptor that is induced by the high effective intramolecular Fermentas, cat. Nir EP0501) containing 4% of DMSO to concentration of the conformation-selective binding domain amplify the B2AR encoding DNA using primer EP211 (5'- that is covalently bound to the receptor in a 1 to 1 stoichiom GCGGAATTCGAGCTCGCC-3'; SEQ ID NO:56) and etry primer EP207 (5'-CCTCCGCCGGATCCGCCACCTCCTC 0231. Still another aspect of the disclosure relates to a kit CACTCTGCTCCCCTGTG-3'; SEQ ID NO:57). Primer comprising a chimeric polypeptide of the disclosure, or a host EP211 harbors an EcoRI restriction site at the 5' end of the cell or a host cell culture or a membrane preparation, accord coding sequence. Primer EP207 incorporates part of the ing to the disclosure. The kit may further comprise a combi GGGGSGGGS (SEQID NO:51) linker at the C-terminus of nation of reagents such as buffers, molecular tags, vector the receptor. The amplification conditions for this reaction constructs, reference sample material, as well as a Suitable were 2 min 95°C., 35 cycles of 30 sec 94° C., 30 sec 50° C., solid supports, and the like. Such a kit may be useful for any 1 min30 sec 72°C. followed by 10minat 72° C. to amplify the of the applications of the disclosure, as described herein. For GPCR encoding part of the open reading frame of the fusion. US 2015/0376261 A1 Dec. 31, 2015 29
0237 Nb69, Nb71 and Nb80 all have identical N-terminal 0240 For each bacmid a transfection mix was prepared by and C-terminal sequences. Single-domain antibody DNA's mixing 1 ml Grace's unsupplemented insect cell culture were amplified with a Pfu polymerase in a PCR in 50 ul using medium (Sigma, cat. Nr G8142), 15ull of Cellfectin II (Invit 5ng of each construct with primer EP206 (GGCGGATCCG rogen, cat. Nr 10362-100) and 5uL of bacmid DNA (approxi GCGGAGGTTCGCAGGTGCAGCTGCAG mately 3 g). This transfection mix was preincubated for 20 GAGTCTGGGGGAGG: SEQID NO:58) to incorporate an minutes at RT. Next, 1x107 pelleted Sf9 cells were resus overlapping part of the GGGGSGGGS linker at the N-termi pended in the transfection mix and shaken at 27°C. After 4 nus of the Single-domain antibody and EP202 (TGGAAT hours 4 ml of protein free ESF 921 Sf9 medium (Expression TCTAGATTAGTGATGGTGATGGTGGTGT systems LLC, cat. Nr. 96-001) was added and cells were GAGGAGACGGTGACCTGGGT: SEQ ID NO:59) to add grown for 48 hrs at 27°C. and 130 rpm. An extra 5 ml of ESF the sequence of a His6-tag at the C-terminal end of the fusion 921 Sf9 medium was added and cells were incubated for protein incorporating an Xbal cloning site at the 3' end of the another 24 h to 40 h before harvesting the P1 recombinant gene. The following amplification conditions were used 2 baculovirus stock (P1) by centrifugation. A P2 recombinant min 95°C., 30 cycles of 30 sec94°C., 30 sec50°C., 1 min 72° baculovirus stock was made by diluting P1 100 times in a C. followed by 10 min at 72°C. to amplify the Single-domain fresh Sf9 culture at a density of 3x10° cells/ml and culturing antibody encoding part of the hybrids. at 27°C. and 130 rpm. P2 virus stocks were harvested by 0238 PCR fragments encoding the GPCR or a Single centrifugation 72 h after infection. Recombinant expression domain antibody were purified using the PCR purification kit of the different f82AR365N-Nb fusions was accomplished (Promega) and used as templates in a new 50 ul PCR reaction: through the infection of freshly grown Sf9 cells at a density of 20 ng of the EP211-B2AR-EP207 (EP211 and EP207 refers 4 million/ml (1:100 to 1:250) with the P2 baculovirus stocks. to the primers that have been used for PCR amplification) Infected cells were cultured for 48 h to 55 h at 27°C. (130 amplified PCR fragment was mixed with approximately 20 rpm) before harvesting. The expression of GPCR-Single ng of amplified EP206-Single-domain antibody-EP202 frag domain antibody hybrids was confirmed by fluorescence ment and fused with KapaTaq polymerase (Sopaghem, cat. microscopy on live cells (Example 3). Cells expressing the Nr BK1002) by overlap extension as follows. After melting recombinant protein were washed twice with ice cold PBS for 2 min at 95°C. and 5 cycles of 30 sec 95°C., 30 sec 55° (Life technologies, cat. Nr 10010-023) supplemented with C., 1 min 45 sec, the fused B2AR-Single-domain antibody 1.5 mM EDTA, pelleted and stored at -80° C. open reading frames were amplified using primers EP202 and EP211 in 28 cycles (30 sec 95°C., 30 sec 55° C., 1 min 45 sec Example 3 72°C.) followed by 10 minat 72° C. PCR fragments contain ing the different B2AR-Single-domain antibody open reading Confirming Expression of B2AR-Single-Domain frames were purified separately, cloned as an EcoRI-Xbal Antibody Fusion Proteins by Fluorescence fragment in pFastBac1 and transformed in E. coli Top 10. Microscopy Plasmid DNA was prepared from single colonies and the 0241. To monitor the expression of the different sequence of the open reading frames was confirmed by |B2AR365N-Nb fusions, non-infected Sf9 cells and Sf9 cells sequencing. Constructs were designated pFastBac infected with a P1 recombinant baculovirus stock (harvested |B2AR365N-Nb80 (Lab reference CA6836), pFastBac after 72 hrs of infection) were analyzed for receptor expres |B2AR365N-Nb69 (Lab reference CA6833), and pFastBac sion using fluorescence microscopy. For this purpose 15ul of |B2AR365N-Nb71 (Lab reference CA6835). The amino acid each cell culture was diluted in 8-well u-slides (Ibidi, cat. Nr sequences encoded by the different f82AR365N-Nb fusion 80821) into 200 W of PBS containing 1 g of a mouse anti constructs are given in FIG. 2 (SEQID NOs: 1-4). Flag (M2) monoclonal antibody (Sigma, cat. Nr F3165) and 1 ug of a rat anti mouse-IgG conjugated to FITC (ebioscience, Example 2 cat. Nr 11-4011) and incubated for 15 min in the dark. Once cells were Surface attached, excess of staining solution was Expression of B2AR-Single-Domain Antibody carefully removed. Images of infected cells and non-infected cells were taken with the Eclipse TE2000 (Nikon) inverted Fusions in Baculovirus-Infected Sf9 Cells microscope. Images were taken using transmission micros 0239. To produce bacmids encoding PAR-Single-domain copy, and using epifluorescence transmission microscopy antibody fusions, one ng of each pFastEac B2AR365N using the FITC filter. All fluorescence measurements were Single-domain antibody fusion was transformed into the performed using the same exposure settings. DH10BACTM cells using the BAC-TO-BAC(R) Baculovirus 0242 Comparing the fluorescence images of non-infected Expression system, according to the manufacturers instruc Sf9 cells with cells expressing B2AR365N-Nb80, tions (Invitrogen, cat. Nr 10359-016) and plated overnight on B2AR365N-Nb71, B2AR365N-Nb69 or non-fused a fresh LB agar plate with 50 lug/ml kanamycin, 7 ug/ml B2AR365N demonstrate that the chimeric polypeptides are gentamicin, 10 g/ml tetracycline, 100 ug/ml X-gal and 40 mainly expressed on the cell Surface of the insect cells, similar ug/ml IPTG. White colonies were picked, bacmids were puri to the non-fused receptor (data not shown). fied and the sequences of the B2AR-Single-domain antibody open reading frames confirmed. A plasmid encoding the Example 4 B2AR open reading frame, devoid of the linker and a Single Preparation of Membranes from Insect Cells domain antibody (pFastEac B2AR365N) was also trans Expressing the B2AR-Single-Domain Antibody formed into the DH 10BACTM cells to produce a bacmid encod ing non-fused receptor as a control. Recombinant baculovirus Fusions was produced by transfecting the 32AR-Single-domain anti 0243 Cell pellets obtained by centrifugation of fresh 50 body bacmids and the BAR365N bacmid in Sf9 cells. ml cultures of Sf9 cells expressing recombinant B2AR-Nb US 2015/0376261 A1 Dec. 31, 2015 30 fusions were resuspended in 8 ml lysis buffer containing prenolol was added (2 nM final concentration) to each dilu protease inhibitors (10 mM Tris/HCl pH7.4, 1 mM EDTA, 10 tion and samples were incubated for 2 hours at room tempera ug/ml leupeptin, 0.2 mM PMSF). Cells were lysed by thor ture on a shaking platform (total reaction Volume per assay oughly crushing the resuspended pellets using a small glass point was 250 ul). Receptor-bound radioligand was separated grinder and a teflon pestle. Membranes were recovered by from free radioligand by filtration over Whatman GF/C uni centrifugation at 26000 g. Membrane pellets were resus filters (PerkinElmer, cat. Nr 6005174) using a 96 well Filter pended in 1.5 ml of storage buffer (10 mM Tris/HCl pH7.4, 1 Mate harvester (Perkin Elmer). After filtration, membranes mM EDTA, 10% saccharose) and stored in aliquots at 80°C. retained on the filter plates were washed with ice-cold wash Total protein concentrations were measured with the BCA buffer (20 mM Tris-HCl pH 7.4), and filters were dried for 1 protein assay kit (Thermo Scientific Pierce, cat. Nr 23225), hour at 50° C. After adding 40 ul of scintillation fluid (MI according to the manufacturers instructions. The expression CROSCINTTM-O, Perkin Elmer, cat. Nr. 6013.611), radioactivity (cpm) of GPCR-Single-domain antibody hybrids in baculovirus retained on the filters was measured in a Wallac MICROBETAR) infected Sf9 cells was further confirmed by analyzing the Trillux scintillation counter. Data represent the meant SEM protein content of these Sf9 membranes by western blot (standard error of the mean) of each experiment performed in analysis (Example 5). The pharmacological properties of triplicate. The IC50 values were determined by nonlinear these GPCR-Single-domain antibody hybrids have been ana regression analysis using Prism (GraphPad Software, San lyzed by radioligand competition assays (Example 6). Diego, Calif.). 0247. In a first series of experiments, we compared the Example 5 pharmacological properties of the B2AR365N-Nb80 fusion with the properties of the B2AR365N-Nb69 chimer (FIG. 4). Expression of PAR-Single-Domain Antibody Fusion Nb80 is a Xaperone that selectively binds to agonist bound Proteins Confirmed by Western Blot B2AR and exhibits G protein-like behavior, thus stabilizing 0244 Membrane preparations (25 ug total protein) of the the active-state conformation of the receptor in the different baculovirus infected Sf9 cells were loaded on a agonist? 2AR-Nb 80 complex (Rasmussen et al., 2011b). 12.5% SDS-PAGE gel. After electrophoresis, proteins were Nb69 is a mock Single-domain antibody that specifically transferred to a nitrocellulose sheet and the membrane was binds to the rat muscarinic receptor M3 with no detectable blocked with 4% skimmed milk. Expression of the recombi affinity for B2AR. We found that the pharmacological prop nant proteins was detected using the anti-flag M2 (Sigma, cat. erties of the B2AR365N-Nb80 chimer are profoundly differ Nr F3165) as the primary antibody and an anti-mouse alka ent from the properties of the control Nb69-fused receptor. line phosphatase conjugate (Sigma, cat. Nir A3562) in com Compared to the Nb69 chimer, B2AR fused to the Single bination with NBT and BCIP to develop the blot (FIG.3). The domain antibody with G protein-like behavior (Nb80) exhib detection of bands with the appropriate molecular weight its increased affinities for agonists (epinephrine, isoproter (approximately 57 and 43 kDa for the Single-domain anti enol, salbutamol) and decreased affinities for inverse agonists body-fused and non-fused f2AR, respectively) confirms (ICI-118,551), exemplified by the modulated IC50s of the expression of the fusion protein for all constructs generated. tested ligands on the Nb50 and mock fusion (Table 3). This proves that the B2AR365N-Nb80 chimer but not the control Example 6 mock B2AR365N-Nb69 chimer-adopts an active-state con formation characterized by increased affinities for agonists Analysis of the Pharmacological Properties of the and decreased affinities for inverse agonists. B2AR-Single-Domain Antibody Fusions by 0248. The increased affinity of the B2AR365N-Nb80 Comparative Radioligand Competition Assays chimer, compared to control B2AR365N-Nb69 for the natural 0245. To analyze the pharmacological properties of the agonist epinephrine can be calculated from the ratio of the different B2AR365N-Single-domain antibody fusions we IC50 values from the competitive binding experiments performed comparative radioligand competition experiments depicted in FIG. 4A by dividing the IC50 of B2AR365N using the natural agonist epinephrine (Sigma cat. Nir E4250), Nb69 by the IC50'8' of B2AR365N-Nb80, resulting in an (-)-isoproterenol hydrochloride (full agonist, Sigma cat. Nr apparent potency shift of s2080. The increased affinity of the I6504), salbutamol (partial agonist, Sigma cat. Nr S8260), B2AR365N-Nb80 chimer for the synthetic agonist isoproten ICI-118,551 hydrochloride (inverse agonist, Sigma cat. Nr erol can be calculated from the ratio of the IC50 values from 1127) or alprenolol hydrochloride (neutral antagonist, Sigma the competitive binding experiments by dividing the IC50 of cat. Nir A8676) and carvedilol (antagonist, Sigma cat. Nr B2AR365N-Nb69 by the IC50s of B2AR365N-Nb80 (FIG. C3993) as the competitor and the neutral antagonist H 4B), resulting in an apparent potency shift of 670. The dihydroalprenolol as the radioligand. The pharmacological increased affinity of the B2AR365N-Nb80 chimer for the effect of the different ligands is according to Kahsai et al., synthetic partial agonist Salbutamol can be calculated from 2011. the ratio of the IC50 values from the competitive binding 0246 Radioligand competition binding experiments were experiments depicted in FIG. 4D by dividing the IC50 of performed on Sf9 insect cell membranes expressing either B2AR365N-Nb69 by the IC50's of B2AR365N-Nb80, B2AR365N (no Single-domain antibody fused), B2AR365N resulting in an apparent potency shift of s370. Nb80, B2AR365N-Nb71 or B2AR365N-Nb69. Membranes 0249 Similarly, the decreased affinity of the B2AR365N of Sf9 cells expressing the different recombinant proteins Nb80 chimer, compared to control B2AR365N-Nb69 for the (Examples 2 & 4, 5ug total protein) were mixed with either inverse agonist ICI-118,551 can be calculated from the ratio (-)-isoproterenol, epinephrine, salbutamol, ICI118,551 or of the IC50 values from the competitive binding experiments alprenolol at concentrations ranging from 10-'M to 10 M depicted in FIG. 4E by dividing the IC50 of B32AR365N in binding buffer (75 mM Tris pH7.5, 12.5 mMMgCl2, 1 mM Nb69 by the IC50 of B2AR365N-Nb80, resulting in an appar EDTA, 0.05% BSA). Next, the radioligand H-dihydroal ent potency shift of s().023. US 2015/0376261 A1 Dec. 31, 2015
(0250) Notably, the B2AR-Nb80 fusion has little effect on (0255. Similarly, the decreased affinity of the B2AR365N the affinity for the neutral antagonist alprenolol as compared Nb71 chimer, compared to control B2AR365N-Nb69 for the to the control B2AR365N-Nb69 chimer. The IC50's inverse agonist ICI-118,551 can be calculated from the ratio B2AR365N-Nb80 and B2AR365N-Nb69 for alprenolol of the IC50 values from the competitive binding experiments (FIG. 4C) are indeed very similar, consistent with the fact that depicted in FIG. 6E by dividing the IC50 of B2AR365N neutral antagonists are non-selective ligands that bind differ Nb69 by the IC50 of B2AR365N-Nb71, resulting in an appar ent functional conformations. ent potency shift of s().01. 0251 Remarkably, the B2AR-Nb80 fusion has little effect (0256 Notably, the B2AR-Nb71 fusion has little effect on on the affinity for the antagonist carvedilolas compared to the the affinity for the neutral antagonist alprenolol as compared control B2AR365N-Nb69 chimer. The IC50s of carvedilol to the control B2AR365N-Nb69 chimer. The IC50s detected on B2AR365N-Nb80 and B2AR365N-Nb69 (FIG. B2AR365N-Nb71 and B2AR365N-Nb69 for alprenolol 4F) are indeed very similar (difference less than a factor 2). (FIG. 6C) are indeed very similar, consistent with the fact that 0252. In a second series of experiments, we compared the neutral antagonists are non-selective ligands that bind differ pharmacological properties of the B2AR365N-Nb80 fusion ent functional conformations. with the properties of the non-fused B2AR365N receptor (0257 Remarkably, the B2AR-Nb71 fusion has little effect (FIG. 5). (32AR fused to the Single-domain antibody with G on the affinity for the antagonist carvedilolas compared to the protein-like behavior (Nb80) exhibits 3 orders of magnitude control B2AR365N-Nb69 chimer. The IC50’s B2AR365N higher affinities for the natural agonist epinephrine, indicat Nb71 and B2AR365N-Nb69 for carvedilol (FIG. 6F) are ing that the B2AR365N-Nb80 chimer but not the non-fused indeed very similar. control receptor—adopts an active-state conformation char acterized by increased affinities for agonists. The increased Example 7 affinity of the B2AR365N-Nb80 chimer, compared to control non-fused f2AR365N for the natural agonist epinephrine can Conformational Thermostability of the be calculated from the ratio of the IC50 values from the PAR-Single-Domain Antibody Fusion competitive binding experiments depicted in FIG. 5A by (0258. One of the strategies for the stabilization of GPCRs, dividing the IC50 of non-fused f2AR365N by the IC50's" of namely the thermostabilization of GPCRs is based on the B2AR365N-Nb80, resulting in an apparent potency shift of systematic mutagenesis coupled with thermostability assays 1370 (Table 3). in the presence of (radio)ligands to screen for mutants with 0253) Remarkably, the B2AR-Nb80 fusion has little effect improved thermostability (Tate 2012). Unfortunately, recep on the affinity for the antagonist carvedilolas compared to the tors that are thermostabilized in the presence of an agonist control non-fused B2AR365N. The IC50s of B2AR365N show no significant increase in the affinities for their respec Nb80 and non-fused B2AR365N-Nb69 for carvedilol (FIG. tive agonists (Serrano-Vegaetet al., 2008, Shibata et al., 2009, 5B and Table 3) are indeed very similar. Lebon et al., 2011), indicating that these thermostabilized 0254. In a third experiment, we compared the pharmaco receptors do not adopt the fully active conformation of the logical properties of the B2AR365N-Nb71 fusion with the receptor. properties of the B2AR365N-Nb69 chimer (FIG. 6 and Table (0259. To test if the B2AR365N-Nb80 fusion, a fusion pro 3). Nb11 is another Single-domain antibody that selectively tein with all properties of the active-state BB2AR receptor has binds the active conformation of B2AR (WO2012007594). an increased thermostability, we performed thermostability We found that the pharmacological properties of the assays on B2AR365N-Nb80 and B2AR365N-Nb69 to mea |B2AR365N-Nb71 chimer also exhibits increased affinities sure ifa Single-domain antibody with G protein-like behavior for agonists (isoproterenol, salbutamol) and decreased affini (Nb80) that stabilizes the active conformation of the receptor ties for the inverse agonist ICI-118,551, showing that the also increases its thermostability, leading to a genuine con |B2AR365N-Nb71 chimer but not the control B2AR365N formational thermostabilized receptor. Nb69 chimer—adopts an active-state conformation charac 0260 To solubilize the receptors, we incubated mem terized by increased affinities for agonists and decreased branes (approximately 1 mg of total membrane protein) from affinities for inverse agonists. The increased affinity of the Sf9 cells expressing either B2AR365N-Nb80 or B2AR365N |B2AR365N-Nb71 chimer, compared to control B2AR365N Nb69 for one hour on ice in 1% DDM (20 mM Tris HCl, Nb69 for the natural agonist epinephrine can be calculated pH7.4, 500 mM. NaCl, 1% n-Dodecyl B-D-maltoside, 10 from the ratio of the IC50 values from the competitive binding ug/ml leupeptine, 0.2 mM PMSF). Next insoluble material experiments depicted in FIG. 6A by dividing the IC50 of was removed by centrifugation for 5 min at 17000 g. Next, B2AR365N-Nb69 by the IC508 of B2AR365N-Nb71, solubilized receptors were diluted with buffer (20 mM Tris resulting in an apparent potency shift of s2030. The increased HCl, pH7.4, 500 mM. NaCl) to a DDM concentration of affinity of the B2AR365N-Nb71 chimer for the synthetic 0.08% DDM and insoluble material was removed again by agonist isoprotenerol can be calculated from the ratio of the centrifugation (20000 g for 20 min at 4°C.). 20 ul aliquots of IC50 values from the competitive binding experiments the solubilized receptor were diluted to 90 ul with assay depicted in FIG. 6B by dividing the IC50 of B2AR365N buffer (20 mM Tris HCl, pH7.4, 500 mM. NaCl, 1% n-Dode Nb69 by the IC50'8' of B2AR365N-Nb71, resulting in an cyl B-D-maltoside) and left on ice for 30 min. apparent potency shift of 80. The increased affinity of the 0261 Thermostability was assessed by incubating diluted B2AR365N-Nb71 chimer for the synthetic partial agonist aliquots in the absence of any ligand at a specified tempera salbutamol can be calculated from the ratio of the IC50 values ture for 30 min. After 30 minutes, excess radioligand (5 nM from the competitive binding experiments depicted in FIG. final concentration) was added to each sample and samples 6Dby dividing the IC50 of B2AR365N-Nb69 by the IC508 were left on ice for 45 min. off2AR365N-Nb71, resulting in an apparent potency shift of 0262 To quantify the remaining fraction of functional s450. receptor, receptor-bound radioligand was separated from free US 2015/0376261 A1 Dec. 31, 2015 32 radioligand by gel filtration on a 2 ml SEPHADEX(R) G50 depending on the concentration of Nb80, with increasing column equilibrated with ice cold assay buffer. The receptor apparent affinity concomitant with increasing concentrations bound radioligand was collected in a Volume of 1 ml and of exogenously added Nb80. The epinephrine potency shift of diluted in 6 ml of scintillation fluid (Optiphase Hisafe2, |B2AR365N in presence of 500 nM Nb80 is only 87-fold, PerkinElmer, cat. Nr 1200-436) to count the radioactivity while 534-fold for the B2AR365N-Nb80 fusion (calculated (cpm) in a liquid scintillation analyzer Tri-carb2810TR (Per by dividing the IC50 of the mock fusion by the respective kin Elmer). The nonspecific binding was estimated by mea IC50s of the non-fused B2AR365N in presence of exog Suring the radioactivity remaining in the protein fraction in enously added Nb80 and B2AR365N-Nb80). Only in the the presence of 1 uM of cold alprenolol. presence of 5 uM exogenous Nb80, the IC50 obtained with 0263. Data represent the meant-SEM (experiments per the non-fused B2AR365N is identical to the one obtained formed in triplicate) of the radioligand that specifically binds with the B2AR365N-Nb80 fusion. 5 uM of free Nb80 has to to the receptor at a given temperature, relative to the receptor be added to the non-fused receptor to measure a comparable bound ligand at 0°C. These experiments indicate that the affinity of non-fused B2AR365N and the B2AR365N-Nb80 solubilized B2AR365N-Nb80 chimer (Tm=33° C.) has a fusion for the natural agonist epinephrine. The effective higher thermostability than B2AR365N-Nb69 (Tm=29° C.) intramolecular concentration of Nb80 in the B2AR365N in 0.08% DDM (FIG. 7). Because Nb80 stabilizes the active Nb80 fusion thus appears to be higher than 500 nM. conformation of B2AR we conclude that the B2AR365N 0268. The amount of B2AR in the Sf9 membranes was Nb80 chimer represents a conformational thermostabilized determined to be approximately 20 pmol/mg total membrane receptor. protein for the B2AR365N-Nb80 fusion. Five ug of the B2AR365N-Nb80 Sf9 membranes thus contain approxi Example 8 mately 0.1 pmol of B2AR. Five uM of exogenously added Nb80 (in 250 ul of reaction volume) corresponds to approxi Comparison of the Pharmacological Properties of the mately 1.25 nmol of Nb80. A 12500 fold molar excess of B2AR-Single-Domain Antibody Fusion to the exogenously added Nb80 over B2AR is required to constrain Non-Fused PAR in Complex with Exogenously the receptor in its epinephrine bound active state with the Added Single-Domain Antibody same efficiency as compared to the 2AR-Nb80 fusion under 0264. To compare the efficiency of fused versus non-fused the conditions tested and assuming equal expression off32AR Nb80 to stabilize the active state of B2AR, the pharmacologi whether or not fused to Nb80. cal properties of the B2AR365N-Nb80 fusion was compared 0269. The results obtained via the comparative radioli to the non-fused f2AR365N in complex with exogenously gand competition assay on the active state constrained versus added Nb80. We performed similar comparative radioligand the non-constrained B2AR (Examples 6 and 8) allow to dis competition experiments as described in Example 6. The criminate (partial) agonists (IC50 ratioS >10) from antago natural agonist epinephrine (Sigma cat. Nir E4250) was used nists and inverse agonists (IC50 ratios <1) (Table 3). The as the competitor and H-dihydroalprenolol as the radioli ability to discriminate and predict the mode of action of tested gand. The B2AR365N-Nb69 fusion and B2AR365N in com compounds at nM-LM concentrations (agonist, partial ago plex with exogenously added Nb69 were assayed in parallel nist, antagonist, inverse agonist) without the need for a cel as controls. lular receptor signaling assay is an asset for compound 0265 Radioligand competition binding experiments were Screening. performed on Sf9 insect cell membranes (5ug total protein) expressing either B2AR365N (no Single-domain antibody Example 9 fused), B2AR365N-Nb80 or B2AR365N-Nb69. Membranes of Sf9 cells expressing the B2AR365N-Nb80 fusion or the Generation of M2R-Single-Domain Antibody Fusion |B2AR365N-Nb69 fusion were mixed with different concen Protein Constructs trations of epinephrine ranging from 10' M to 10M in binding buffer (75 mM Tris pH7.5, 12.5 mM MgCl2, 1 mM (0270. The GPCR-Single-domain antibody fusion EDTA, 0.05% BSA). In parallel, different concentrations of described in this example is a chimeric polypeptide that con purified Nb80 or Nb69, ranging from 50 pM to 500 nM, were tains two different proteins connected with a peptide linker: added to membranes of Sf9 cells expressing the non-fused the GPCRM2 muscarinic acetylcholine receptor (M2R), the B32AR365N before mixing them with the different concen linker GGGSGGGGSGGGGSGGGGSGGGS (SEQ ID trations of epinephrine ranging from 10" M to 10 M in NO:49) and a Single-domain antibody, all of which were binding buffer. Next, the radioligand H-dihydroalprenolol fused in this order from the amino to the carboxy terminus. was added (2 nM final concentration) to each condition and Genes encoding these proteins were fused as described below samples were incubated for 2 hours at room temperature on a (FIG.9) and cloned in the pFastEac1 vector. shaking platform (total reaction Volume per assay point was 0271 The GPCR part, synthetically synthesized, encodes 250 ul). Ligand bound membranes were harvested and radio the cleavable hemagglutinin (HA) protein signal peptide (SP) activity was measured as described in Example 6. Data rep derived from influenza virus (MKTIIALSYIFCLVFA: SEQ resent the meant-SEM of each data point performed in tripli ID NO:52) followed by the Flag epitope (DYKDDDD: SEQ Cate. ID NO:50) followed by a TEV cleavage site (ENLYFQG: 0266 Data represent the meant-SEM, of each experiment SEQID NO:51) followed by the coding sequence of human performed in triplicate. The IC50 values were determined by M2 muscarinic acetylcholine receptor encompassing Metl to nonlinear regression analysis using Prism (GraphPad Soft Arg466 with a deletion of the intracellular loop 3: replacing ware, San Diego, Calif.). the amino acids Pro233 till Lys374 with Thr and Arg. Point 0267 As can be observed in FIG. 8, the affinity of non mutations (N2D, N3D, N6D, N9D) were introduced to the fused f2AR365N for the natural agonist epinephrine is construct to disrupt glycosylation sites (M2Ai3R; SEQ ID US 2015/0376261 A1 Dec. 31, 2015
NO:5). This muscarinic receptor engineering was performed according to the manufacturers instructions. The pharmaco to increase the receptor's cellular expression levels in Sf9 logical properties of these GPCR-Single-domain antibody cells. hybrids were analyzed by radioligand competition assays (0272 Nb9-1 (SEQID NO:16) is a single domain antibody (Example 12). that selectively binds to agonist bound M2Ai3R and exhibits G protein-like behavior (also referred to as a G protein Example 12 mimetic), thus stabilizing the active-state conformation of the receptor in the agonist-M2Ai3R-Nb9-1 complex. The Analysis of the Pharmacological Properties of the M2Ai3R-Nb9-1 fusion was optimized for insect cell expres M2Ai3R-Single-Domain Antibody Fusion by sion and synthesized by Geneart (pMK-ROM2Ai3-Nb9-1; Comparative Radioligand Competition Assays Lab reference CA7908: Life technologies). The receptor 0276. To analyze the pharmacological properties of the Single-domain antibody fusion was cloned as a BglII-Xbal M2Ai3R-Single-domain antibody fusion we performed com fragment in the BamHI-Xbal opened pFastEac1 vector parative radioligand competition experiments using carba resulting in pFastEac1-M2Ai3R-Nb9-1 (Lab reference chol (full agonist, Sigma cat. Nr C4382) and oxotremorine M CA7911). A control construct encoding only the M2Ai3R (agonist, Sigma cat. Nr 0100) as the competitor and HI-N open reading frame without linker and a Single-domain anti methyl scopolamine (PerkinElmer cat. No. NET636001MC) body (pfastBac1-M2Ai3R; Lab reference CA7914) was con as the radioligand. structed by cloning the BglII-Xbal fragment from pMK 0277 Radioligand competition binding experiments were RQM2Ai3R (synthesized by Geneart, Lab reference 7909) in performed on Sf9 insect cell membranes expressing either the pFastBac1 vector. All constructs were transformed in E. M2Ai3R (no Single-domain antibody fused) or M2Ai3R coli Top10 cells. The amino acid sequences encoded by the Nb9-1. Membranes of Sf9 cells expressing the different M2Ai3R control construct and the M2Ai3R-Nb fusion con recombinant proteins (examples 10 & 11, 10ug total protein) struct are shown in FIGS. 9B and C (SEQ ID NOS:5 and 6). were mixed with either carbachol or oxotremorine Mat con The M2Ai3R-Nb9-8 fusion construct has been made in a centrations ranging from 10M to 10°M in binding buffer similar way. Nb9-8 (SEQID NO:17) is another example of a (75 mM Tris pH7.5, 12.5 mM MgCl2, 1 mM EDTA, 0.05% M2R specific Single-domain antibody with G protein-like BSA). Next, the radioligand HI-N methyl scopolamine was behavior (Kruse, 2013). added (0.5 nM final concentration) to each dilution and samples were incubated for 2 hours at room temperature on a Example 10 shaking platform (total reaction volume per assay point was 250 ul). Receptor-bound radioligand was separated from free Expression of M2Ai3R-Single-Domain Antibody radioligand by filtration over Whatman GEC unifilters (Per Fusion and of M2Ai3R in Baculovirus-Infected Sf9 kin Elmer, cat nr 6005174) using a 96 well FilterMate har Cells vester (PerkinElmer). After filtration, membranes retained on 0273 To produce bacmids encoding the M2Ai3R-Single the filter plates were washed with ice-cold wash buffer (20 domain antibody fusion, one ng of pFastEac1-M2Ai3R mM Tris-HCl pH7.4), and filters were dried for 1 hour at 50° Nb 9-1 was transformed into DH.10BACTM cells using the BAC C. After adding 35 ul of scintillation fluid (MICROSCINTTM-O, TO-BAC(R) Baculovirus Expression system according to the PerkinElmer, cat. Nr 6013.611), radioactivity (cpm) retained manufacturers instructions and plated overnight as described on the filters was measured in a Wallac MICROBETAR TriLux in Example 2. White colonies were picked, bacmids were Scintilation counter. purified and the sequences of the open reading frames recon 0278 We compared the pharmacological properties of the firmed. Recombinant baculovirus was produced in Sf9 cells M2Ai3R-Nb9-1 fusion with the properties of M2Ai3R (FIG. by transfecting the M2Ai3R-Single-domain antibody 9-1 10). We found that the pharmacological properties of the bacmid and the M2Ai3Rbacmid. M2Ai3R-Nb9-1 chimer is different from the properties of the 0274 P1 and P2 baculovirus stocks were prepared as control M2Ai3R, exemplified by the IC50s and IC50 ratio of described in Example 2. Recombinant expression of M2Ai3R the tested ligands on the M2Ai3R-Nb9-1 fusion and M2Ai3R or the M2Ai3R-Nb9-1 fusion was accomplished through the (Table 4). The increased affinity of the M2Ai3R-Nb9-1 infection of freshly grown Sf9 cells at a density of 4x10"/ml chimer, compared to control non-fused M2Ai3R for the syn with 100 fold diluted P2 baculovirus stocks. Infected cells thetic agonist carbachol is calculated as the ratio IC50A/ were cultured for 48 h to 60 h at 27°C. (130 rpm) before IC50's wo. (FIG. 10A), resulting in an apparent harvesting. The expression of GPCR-Single-domain anti potency shift of sG7. The ratio obtained for the synthetic body hybrids was confirmed by fluorescence microscopy on agonist oxotremorine M is 316, showing that the M2Ai3R live cells. Cells expressing the recombinant protein were Nb9-1 chimer adopts an active-state conformation (FIG. washed twice with ice cold PBS (pH 7.4, 1.5 mM EDTA), 10B). Similarly, the M2Ai3R-Nb9-8 fusion has a higheraffin pelleted and stored at -80° C. ity for the synthetic agonist carbachol as compared to non fused M2Ai3R (data not shown). Example 11 Example 13 Preparation of Membranes from Insect Cells Expressing the M2Ai3R or M2Ai3R-Nb Fusion Generation of B1AR-Single-Domain Antibody (0275 Cell pellets obtained by centrifugation of fresh 50 Fusion Protein Constructs ml cultures of Sf9 cells expressing recombinant M2Ai3R or (0279. The GPCR-Single-domain antibody fusion M2Ai3R-Nb fusion were processed into membrane extracts described in this example is a chimeric polypeptide that con and stored exactly as described in Example 4. Total protein tains two different proteins connected with a peptide linker: concentrations were measured with the BCA protein assay kit the B1 adrenergic receptor (B1AR), the linker US 2015/0376261 A1 Dec. 31, 2015 34
GGGGSGGGGSGGGGSGGGGSGGGS (SEQ IDNO:60) through the infection of freshly grown Sf9 cells at a density of and a Single-domain antibody, all of which were fused in this 4x10/ml with 100 fold diluted P2 baculovirus stocks. order from the amino to the carboxy terminus. Genes encod Infected cells were cultured for 48 h to 60 h at 27°C. (130 ing these proteins (FIG. FHA) were fused, as described rpm) before harvesting. Cells expressing the recombinant below. protein were washed twice with ice cold PBS (pH7.4, 1.5 mM 0280 A synthetic B1AR gene was synthesized by Geneart EDTA), pelleted and stored at -80° C. (pMK-RQ hbeta1 AR: Lab reference CA CA7910). It encodes the cleavable hemagglutinin (HA) protein signal Example 15 peptide (SP) derived from influenza virus (MKTIIALSYIF CLVFA: SEQ ID NO:52) followed by the Flag epitope Preparation of Membranes from Insect Cells (DYKDDDDA: SEQID NO:53) followed by a TEV cleavage Expressing the h(B1AR-Nb80 or h(B1AR-Nb69 site (ENLYFQG: SEQ ID NO:51) followed by the coding Fusion sequence of human B1 adrenergic receptor encompassing (0285 Cell pellets obtained by centrifugation of fresh 50 Pro50 to Arg401 (hi? 1AR, Uniprot P08588). The B1AR cod ml cultures of Sf9 cells expressing recombinant hf.1AR ing sequence contains a deletion of the intracellular loop 3 Nb80 or h1AR-Nb69 fusion were processed into membrane (Ser260 till Gly304) and two point mutations C392S, C393S extracts and stored exactly as described in Example 4. Total to improve the receptor's cellular expression levels in Sf9 protein concentrations were measured with the BCA protein cells. Alignments of the amino acid sequences off1 AR and assay kit, according to the manufacturers instructions. The B2AR indicate that the amino acid side-chains that constitute pharmacological properties of these GPCR-Single-domain the Nb80 epitope in the B2AR-Gs complex (Rasmussen et al., antibody hybrids were analyzed by radioligand competition 2011a) are identical amongst B1AR and B2AR except R318 assays (Example 16). (B1AR numbering; Uniprot P08588) that is replaced by lysine in B2AR. Based on this observation, one extra point Example 16 mutation R318K was introduced to create the full Nb80 epitope in the B1AR. Analysis of the Pharmacological Properties of the 0281 Single-domain antibody gene segments encoding h31AR-Single-Domain Antibody Fusion by the respective Nanobodies were cloned from the plasmids Comparative Radioligand Competition Assays described in Example 1. Nb80 (SEQ ID NO:13) is a B2AR 0286 To analyze the pharmacological properties of the Single-domain antibody that stabilizes the active state of the different hf.31AR-Single-domain antibody fusions, we per B2AR bound to full agonists such as BI-167107 (Rasmussen formed comparative radioligand competition experiments et al., 2011b). Nb69 (SEQ ID NO:15) is specific for the using the natural agonist epinephrine, then inverse agonist Muscarinic3 receptor and has no detectable affinity for ICI-118,551 hydrochloride or the neutral antagonist alpre |B2AR. nolol hydrochloride as the competitor and the neutral antago 0282. The B1AR receptor was cloned as a BglII-BamHI nist H-dihydroalprenolol as the radioligand. The pharma fragment from pMK-RQhbeta1AR (Lab reference CA7910) cological effect of the different ligands is according to Kahsai in the BamHI opened pFastBac B2AR365N-Nb80 (CA6836) et al., 2011. vector to replace the B2AR receptor resulting in pFastBac (0287 Membranes of Sf9 cells expressing the different hß1AR-Nb80 (Lab reference CA7923). A control construct recombinant proteins (Examples 14 & 15, 5ug total protein) pFastBac-h? 1AR-Nb69 (Lab reference CA7924) encoding were mixed with eitherepinephrine, ICI118,551 oralprenolol the B1AR open reading frame linked to Nb69 was constructed at concentrations ranging from 10-'M to 10M in binding by cloning the same BglII-BamHI fragment from pMK-RQ buffer (75 mM Tris pH7.5, 12.5 mM MgCl2, 1 mM EDTA, hbeta1AR in the pFastBac B2AR365N-Nb69 (CA6833) to 0.05% BSA). Next, the radioligand H-dihydroalprenolol replace the 2AR receptor. All constructs were transformed was added (2 nM final concentration) to each dilution and in E. coli Top 10 cells. The amino acid sequences encoded the samples were incubated for 2 hours at room temperature on a hbeta1AR-Nb fusion constructs are shown in FIGS. 11B and shaking platform (total reaction Volume per assay point was 11C (SEQID NOs:7 and 8). 250 ul). Receptor-bound radioligand was separated from free Example 14 radioligand as described in Example 6. Data represent the meant-SEM (standard error of the mean) of each experiment Expression of B1AR-Single-Domain Antibody performed in triplicate. The IC50 values were determined by Fusions in Baculovirus-Infected Sf9 Cells nonlinear regression analysis using Prism (GraphPad Soft ware, San Diego, Calif.). 0283 To produce bacmids encoding one of the B1AR 0288. In this series of experiments, we compared the phar Single-domain antibody fusions, one ng of pFastBac macological properties of the h? 1AR-Nb80 fusion with the hß1AR-Nb80 or pFastBac-B1AR-Nb69 was transformed properties of the h(B1AR-Nb69 fusion (FIG. 12A). We found into DH.10BACTM cells using the BAC-TO-BAC(R) Baculovirus that the pharmacological properties of the h? 1AR-Nb80 Expression system, according to the manufacturers instruc chimer are profoundly different from the properties of the tions, and plated overnight as described in Example 2. White control Nb69-fused receptor. Compared to the Nb69 chimer, colonies were picked, bacmids were purified and the h31 AR fused to the Single-domain antibody with G protein sequences of the open reading frames reconfirmed. Recom like behavior (Nb80) exhibits increased affinity for the ago binant baculovirus was produced in Sf9 cells by transfecting nist epinephrine and a decreased affinity for the inverse ago the B1 AR-Nb80 bacmid and the B1AR-Nb69 bacmid. nist (ICI-118,551), exemplified by the modulated IC50s of 0284 P1 and P2 baculovirus stocks were prepared as the tested ligands on the h? 1AR-Nb80 fusion and h? 1AR described in Example 2. Recombinant expression of the Nb69 fusion (Table 5). This proves that the hi?31AR-Nb80 |B1AR-Nb80 or the B1AR-Nb69 fusion was accomplished chimer, but not the control mock B2AR365N-Nb69 chimer, US 2015/0376261 A1 Dec. 31, 2015
adopts an active-state conformation characterized by GGGGSGGGS (SEQID NO:51) linker at the C-terminus of increased affinities for agonists and decreased affinities for the receptor. The amplification conditions for this reaction inverse agonists. were 30 sec 98°C., 25 cycles of 10 sec 98°C., 30 sec 64.5°C., 0289. The increased affinity of the hi? 1AR-Nb80 chimer, 30 sec 72° C. followed by 5 min at 72° C. to amplify the compared to control h? 1AR-Nb69 for the natural agonist GPCR encoding part of the open reading frame of the fusion. epinephrine can be calculated from the ratio of the IC50 0295 Nb60 has an identical N-terminal and C-terminal values from the competitive binding experiments depicted in sequence as the Nanobodies in Example 1. This Single-do FIG. 12A by dividing the IC50 of h(B1AR-Nb69 by the main antibody DNA was amplified as described in Example 1 IC50's" of hi?31AR-Nb80, resulting in an apparent potency using 2ng of template (CA2760) and Phusion polymerase in shift of s.68. The decreased affinity of the hi?B1AR-Nb80 a 50 ul reaction. The following amplification conditions were chimer, compared to control h? 1AR-Nb69 for the inverse used 30 min 98°C., 25 cycles of 10 sec 98° C. and 10 sec 72° agonist ICI-118,551 can be calculated from the ratio of the C. followed by 5 min at 72° C. to amplify the Single-domain IC50 values from the competitive binding experiments antibody encoding part of the hybrids. depicted in FIG. 12B by dividing the IC50 of hf.1AR-Nb69 0296 PCR fragments encoding the GPCR or a Single by the IC50" of h31AR-Nb80, resulting in an apparent domain antibody were purified using the PCR purification kit potency shift of s().077. (Promega) and used as templates in a new 50 ul PCR reaction: 0290. Notably, the h(B1AR-Nb80 fusion has little effect on 6 ng of the EP232-32AR-EP207 (EP232 and EP207 refers to the affinity for the neutral antagonist alprenolol as compared the primers that have been used for PCR amplification) ampli to the control hi?B1AR-Nb69 chimer. The IC50’s B2AR365N fied PCR fragment was mixed with approximately 2 ng of Nb80 and B2AR365N-Nb69 for alprenolol (FIG. 12C) are amplified EP206-Single-domain antibody-EP202 fragment indeed very similar, consistent with the fact that neutral and fused with Phusion polymerase by overlap extension as antagonists are non-selective ligands that bind different func follows. After melting for 30 sec at 98° C. and 5 cycles of 10 tional conformations. sec at 98°C., 30 sec at 72°C., the fused f2AR-Single-domain antibody open reading frames were amplified using primers Example 17 EP232 and EP202 in 25 cycles (10 sec 98° C., 30 sec 67°C., 40 sec 72° C.) followed by 5 min at 72°C. The PCR fragment Generation of B2AR-Nb60 Fusion Construct containing the B2AR-Nb60 open reading frame was purified, 0291. The GPCR-Single-domain antibody fusions cloned as an EcoRI-Xbal fragment in pFastEac1 and trans described in this Example is a chimeric polypeptides that formed in E. coli Top10. Plasmid DNA was prepared from a contain two different proteins connected with a peptide single colony and the sequence of the open reading frame was linker: the GPCR B2AR, the linker GGGGSGGGS (SEQ ID confirmed by sequencing. Constructs were designated pFast NO:51) and Nb60, all of which were fused in this order from Bac B2AR365N-Nb60 (Lab reference CA8235). The amino the amino to the carboxy terminus. The genes encoding this acid sequences encoded by the different B2AR365N-Nb protein were fused as described in Example 1 with minor fusion constructs are given in FIG. 2E (SEQID NO:4). adjustments. Example 18 0292. The GPCR part was amplified from DNA encoding the cleavable hemagglutinin (HA) protein signal peptide (SP) Expression of B2AR-Nb60 in Baculovirus-Infected derived from influenza virus (MKTIIALSYIFCLVFA: SEQ Sf9 Cells and Preparation of Membranes from Insect IDNO:52) followed by the Flag epitope (DYKDDDDA: SEQ Cells Expressing the B2AR-Nb60 Fusion ID NO:53) followed by a TEV cleavage site (ENLYFQGF: SEQID NO:54) followed by the coding sequence of human 0297. To express the B2AR365N-Nb60 fusion in Sf9 cells, B2 adrenergic receptor encompassing Gly2 to Gly365 (SEQ a bacmid encoding B2AR-Nb60 fusion was made and Sf9 ID NO:55). A point mutation of N187E was also introduced cells were infected as described in Example 2. Membranes to the construct to disrupt this unwanted glycosylation site from insect cells expressing the B2AR-Nb60 fusion were (B2AR365N; Rasmussen et al., 2011b). The B2 adrenergic prepared as described in Example 4. The pharmacological receptor engineering to B2AR365N was performed to properties of these GPCR-Single-domain antibody hybrids increase the receptor's cellular expression levels in SD cells. have been analyzed by radioligand competition assays (EX 0293. The Single-domain antibody gene segment was ample 19). amplified from a phagemids encoding the Nb60. Nb60 (SEQ ID NO:18) is a B2AR-specific Single-domain antibody that is Example 19 described to stabilize an inactive B2AR conformation and significantly inhibit G-protein activation and B-arrestin Analysis of the Pharmacological Properties of the recruitment (Staus et al., 2013). B2AR-Nb60 Fusion by Comparative Radioligand 0294 The GPCR and the Single-domain antibody were Competition Assays genetically fused in frame by an overlap extension PCR. 0298 To analyze the pharmacological properties of the Therefore, 2ng of plasmid containing the GPCR cDNA was B2AR365N-Nb60 fusion we performed comparative radioli used as the template in a 50 lul PCR reaction (Phusion poly gand competition experiments using the natural agonist epi merase, (Biolabs, cat. Nr MO530S) to amplify the B2AR nephrine, (-)-isoproterenol hydrochloride (full agonist), and encoding DNA (CA6817) using primer EP232 (5'-GCA ICI-118,551 hydrochloride (inverse agonist) as the competi GATCTCGGTCCGAAG-3'; SEQ ID NO:61) and primer tor and the neutral antagonist H-dihydroalprenolol as the EP2O7 (5'-CCTCCGCCGGATCCGCCACCTCCTC radioligand. The pharmacological effect of the different CACTCTGCTCCCCTGTG-3'; SEQ ID NO:57). Primer ligands is according to Kahsai et al., 2011. EP232 anneals 5' of the EcoRI restriction site at the 5' end of 0299 Radioligand competition binding experiments were the coding sequence. Primer EP207 incorporates part of the performed on Sf9 insect cell membranes expressing either US 2015/0376261 A1 Dec. 31, 2015 36
B2AR365N-Nb80, B2AR365N-Nb60 or B2AR365N-Nb69. cross species sequence homology for the predicted intracel Membranes of Sf9 cells expressing the different recombinant lular topological domains (ICLS+C-terminus) between proteins (Examples 2 & 4, 5ug total protein) were mixed with mouse, bovine, pig and human Mor1 is >90%. Knowing that either, epinephrine, (-)-isoproterenol or ICH 18.551 concen Nb33 interacts with intracellular epitopes of mouse Mor1, we trations ranging from 10-'M to 10°M in binding buffer (75 anticipated that Nb33 also stabilizes the active conformation mM Tris pH7.5, 12.5 mM MgCl2, 1 mM EDTA, 0.05% ofhMor1, as there is only one conserved substitution in ICL2 BSA). Next, the radioligand H-dihydroalprenolol was (indicated by :’ in FIG. 14) and one semi-conserved substi added (2nM final concentration) to each dilution and samples tution in the C-terminus (indicated by . in FIG. 14). were incubated for 2 hours at room temperature on a shaking platform (total reaction volume per assay point was 2500. (0303. The GPCR-Single-domain antibody fusions Receptor-bound radioligand was separated from free radioli described in this example encode chimeric polypeptides simi gand as described in Example 6. Data represent the lar to those described in Example 1. Here we describe the meantSEM (standard error of the mean) of each experiment human mu-opioid receptor (hMor1, NCBI reference performed in triplicate. The IC50 values were determined by sequence NM 000914.1) genetically fused to Single-do nonlinear regression analysis using Prism (GraphPad Soft main antibody Nb33 (Lab reference XA8633) and separated ware, San Diego, Calif.). by al 34 AA Gly-Ser linker 0300. In these experiments, we compared the pharmaco (GGGGSGGGGSGGGGSGGGGSGGGGSGGGGSGGGS: logical properties of the B2AR365N-Nb60 fusion with the SEQIDNO:62). An open reading frame encodinghMor1 was properties of the B2AR365N-Nb80 and the B2AR365N optimized for insect cell expression and was custom synthe Nb69 chimer (FIG. 13A). Nb60 is a Single-domain antibody sized as an EcoRI-HindIII fragment at GeneArt (Life Tech that is claimed to stabilize an inactive B2AR conformation nologies). A cartoon of the synthetic hybrid gene is repre (Staus et al., 2013), Nb80 is a Single-domain antibody that sented in FIG. 15. Compared to the B2AR fusions depicted in selectively binds to agonist bound (32AR and exhibits G FIG. 2A, for the opioid receptor fusions i) the TEV cleavage protein-like behavior, thus stabilizing the active-state confor site is omitted and ii) f2AR365N is replaced by the human mation of the receptor in the agonist B2AR-Nb 80 complex Mor1 nt sequence encoding for AA residues 1-360 with an (Rasmussen et al., 2011b). Nb69 is a mock Single-domain extra deletion of AA residues 2-5 (DSSA) and immediately antibody that specifically binds to the rat muscarinic receptor followed by a 3C cleavage site insertion (LEVLFQGP) M3 with no detectable affinity for B2AR. We found that the before the 34GS linker. Nb33 (Lab reference XA8633; SEQ pharmacological properties of the B2AR365N-Nb60 chimer ID NO:19) exhibitsG, protein-like behavior (also referred to are profoundly different from the properties of the control as G, protein mimetic), and selectively stabilizes the active Nb69-fused receptor. Compared to the Nb69 chimer, B2AR state conformation of Morl in the agonist Mor1:Nb33 com fused to Nb60 exhibits decreased affinities for agonists (epi plex. Similar to G, adding excess amounts of Nb33 increases nephrine, isoproterenol) and has little effect on the affinity for the affinity of mouseMor1 for agonist Dmt1-Dalda at least the inverse agonist ICI-118,551, exemplified by the modu 10-fold. In the fusion construct, the coding sequence of Nb33 lated IC50s of the tested ligands on the Nb60 and Nb69 fusion was engineered to introduce a unique PstI restriction site in (Table 6). This proves that the B2AR365N-Nb60 chimer, but FR1. The synthetic gene encoding hMOR1-34GS-Nb33 was not the control mock?52AR365N-Nb69 chimer, adopts a con cloned as an EcoRI-HindIII fragment in pFastEac1 and trans formation that differs from the agonist-bound active state formed to E. coli TG1, resulting in pFastEac1::hMOR1 conformation and differs from the basal conformation of the 34GS-Nb33 (Lab reference XA8901). The encoding AA receptor. This conformation is characterized by decreased sequence of the fusion is depicted in FIG. 15A. In parallel, affinities for agonists. Our results clearly show that different another fusion of hMOR1 with an irrelevant Single-domain Nanobodies are able to stabilize different conformational antibody was generated as the control construct expressing states of a receptor. the prominent conformation of Morl. Therefore, the Nb53 0301 The decreased affinity of the B2AR365N-Nb60 encoding sequence in pFastBac1::hMOR1-34GS-Nb33 was chimer (versus the increased affinity of the B2AR365N-Nb80 exchanged by a gene segment coding for Single-domain anti chimer), compared to control B2AR365N-Nb69 for the natu body Nb10 (Lab reference CA4910). Nb10 (SEQID NO:20) ral agonist epinephrine can be calculated from the ratio of the is a well characterized Single-domain antibody specific for IC50 values from the competitive binding experiments extracellular epitopes of a chemokine GPCR and has no depicted in FIG. 13A by dividing the IC50 of B2AR365N detectable affinity for Morl. To prepare the Nb10 coding gene Nb69 by the IC50 of B2AR365N-Nb60, resulting in an appar segment for the fusion, Nb10 was reamplified by PCR using ent potency shift of s().0046 (versus-855 for Nb80 fusion primers A6E (5'-GATGTGCAGCTGCAGGAGTCTGGRG compared to Nb69 fusion). The decreased affinity of the GAGG-3'; SEQ ID NO:63) introducing a PstI site in FR1 B2AR365N-Nb60 chimer for the syntheticagonist isoproten (changing V into Q) of the Single-domain antibody and GIII (5'-CCACAGACAGCCCTCATAG-3'; SEQID NO:64), the erol can be calculated from the ratio of the IC50 values from latter oligo hybridizing to gene III. As template, 5 ng of a the competitive binding experiments by dividing the IC50 of DNA prep of the phagemid pXAP100 expressing the Nb10 B2AR365N-Nb69 by the IC50 of B2AR365N-Nb60 (FIG. gene III fusion was used. The amplification conditions for this 13B), resulting in an apparent potency shift of s().012 (versus reaction were 3 min 94° C. and 25 cycles of 30 sec 94° C., 30 s155 for Nb80 fusion compared to Nb69 fusion). sec 55° C., 45 sec 72° C. followed by 10 min at 72° C. After Example 20 purification, the amplicon was double digested with Pstl (in troduced via oligo A6E) and BstEII (a naturally occurring Generation of Mu-Opioid Receptor-Single-Domain unique site in FR4), purified and ligated into the 6.2 kbp gel Antibody Fusion Constructs purified PstI-BstEII fragment derived of pFastBac1: 0302) The Morl AA sequence is highly conserved hMOR1-34GS-Nb33, resulting in pFastBac1:hMOR1 between different mammalian species. More specifically, the 34GS-Nb10. The encoding AA sequence of the fusion US 2015/0376261 A1 Dec. 31, 2015 37 hMOR1-34GS-Nb10 (SEQ ID NO:20) is depicted in FIG. confirmed in a radioligand assay by measuring total (TB) and 15C. Following cloning, plasmid DNA of both fusion con non-specific (NS) binding of 3H-Diprenorphine antagonist structs was prepared from single colonies and the sequence of radioligand (PerkinElmer, cat nr NET1121). the hybrid gene was confirmed by sequencing. 0307 The pharmacological properties of recombinant Mor1 is assessed in a radioligand competition assay (Manglik Example 21 et al., 2012) on hMOR1-34GS-Nb33 orhMOR1-34GS-Nb10 membranes (P2, 72 h expression). Fifteen ug of hMor1 Expression of Mu Opioid Receptor-Single-Domain 34GS-Nb33 or hMor1-34GS-Nb10 Sf9 membranes in TBB Antibody Fusions in Baculovirus-Infected Sf9 Cells (75 mM Tris-HCl pH7.4, 1 mM EDTA, 5 mM MgCl2, 100 0304) To produce bacmids encoding Mor1-Single-domain mM NaCl) containing 1% BSA as binding buffer are trans antibody fusions, five ng of pFastBac1:hMOR1-34GS-Nb33 ferred to a 96 well plate. Subsequently, a serial dilution of orpFastBac1:hMOR1-34GS-Nb10 was transformed into the cold agonist competitor (Dmt1-Dalda or KGOP01) or DH1 OBACTM cells. Recombinant baculovirus was produced antagonist (naloxone) is added. After adding one nM H by transfecting the Mor1-Single-domain antibody bacmids in diprenorphine (final concentration), the reaction mix (total Sf9 cells. Each bacmid was used for Cellfectin II mediated volume of 125ul) is incubated for 1 hr at room temperature. SD transfection as described in Example 2, except that the P1 Membrane bound 3H]-diprenorphine is separated from recombinant baculovirus was harvested 72 h after the trans unbound radioligandon 96 well FilterMate harvester by pass fection for the Nb10 fusion and 48 h for the Nb53 fusion. P1 ing over a Whatman GF/C filter presoaked in TBB with 1% virus stocks were stored at -80° C. as aliquots of snap frozen BSA and washed in ice cold TBB. Filters were dried for 1 culture Supernatant adding 5% (final concentration) fetal calf hour at 50° C. After adding 35 ml of scintillation fluid (MI serum (FCS). AP2 recombinant baculovirus stock was made CROSCINTTM-O), radioactivity (cpm) retained on the filters was by diluting P1 50 to 1000 fold in a fresh Sf9 culture at a measured in a Wallac MICROBETAR TriLux Scintillation density of 1x10° cells/mland culturing at 27°C. and 130 rpm. counter. The percentage of residual radioligand binding is P2 virus stocks were harvested by centrifugation 48 h and 72 calculated and the curves of a representative experiment are hafter infection and stored as described above at -80°C. until represented in FIG. 16. Each value in the graph represents the further use. The cell pellets were washed twice with ice cold average of 3 data points. The IC50 values were determined by PBS (Life Technologies, cat nr 10010-023), supplemented nonlinear regression analysis, with the one site: fit log IC50 with 1.5 mM EDTA), stored at -80° C. to prepare mem equation using Prism (GraphPad Software, San Diego, branes. Recombinant expression of the different MOR1-Nb Calif.). The IC50s obtained for all ligands tested are indicated fusions was accomplished through the infection of freshly in Table x. The IC50 of agonist Dmit-DALDA on hMor1 grown Sf9 cells at a density of 2eó cells/ml with 50, 200 and 34GS-Nb33 and hMor1-34GS-Nb10 Sf9 membranes are 655 1000 fold diluted P2 baculovirus stocks. As a negative control and 18, respectively. For each agonist ligand tested (Dmt1 expression, Sf9 cells were infected in parallel with P2 of Flag Dalda or KGOP01), the highest affinities (lowest IC50s) are tagged non-related M2R. Infected cells were cultured for 48 demonstrated on the hMor1-34GS-Nb33 membranes com hat 27°C. (130 rpm) before harvesting. The cell pellets were pared to those obtained on hMor1-34GS-Nb10 membranes. washed twice with ice cold PBS (pH 7.4, 1.5 mM EDTA) and For each agonist, an IC50 ratio -20 (Table 7) indicate their stored at -80° C. until membranes were prepared. Overex preference for the active state constrained Mor1 receptor. For pression of GPCR-Single-domain antibody chimers was con the antagonist naloxone, the IC50s do not significantly differ firmed via flow cytometry (data not shown). whether determined on hMor1-34GS-Nb33 or on hMor1 34GS-Nb10 membranes. This data supports that the Nb53 Example 22 fusion expresses Mor1 as the active conformer and has a higher affinity for agonists than for the antagonist naloxone. Analysis of the Pharmacological Properties of the hMOR1-Nb Fusion by Comparative Radioligand Example 23 Competition Assays Fragment Library Screening Using a Comparative 0305 Overexpression of hMOR1-34GS-Nb33 or Radioligand Displacement Assay on the 2AR-Nb hMOR1-34GS-Nb10 in Sf9 cells was assessed via a radioli Fusions gand assay on membranes (P2) to verify native Mor1 folding and stabilization of the active conformer by Nb33. To prepare 0308 Example 6 illustrates that the pharmacological membranes, aliquots of 1E7 hMor1 Sf9 cells were resus properties of the B2AR365N-Nb80 fusion is fundamentally pended in 1 ml of ice cold lysis buffer containing protease different compared to the B2AR365N-Nb69 fusion: the Nb80 inhibitors (Example 4). The cell Suspension was homog fusion preferentially binds natural and synthetic agonists, enized on ice applying 6 10-sec pulses with a small Volume whereas it shows lower affinity for inverse agonists. Ultraturrax cell mixer (IKA). The cell homogenate was cen Examples 12, 16, 19 further illustrate the modified pharma trifuged for 35 minat 15000xgina pre-cooled centrifuge. The cological properties of particular GPCR-Nb fusions. Build Supernatant was discarded and the membrane pellet was ing on this knowledge, we tested if these pharmacological resuspended in 75 mM Tris HCl pH7.4, 1 mM EDTA, 5 mM differences can be exploited for drug discovery. As an MgCl2, 10% sucrose and stored at -80° C. until further use. example, we Screened a fragment library to identify frag The total protein content of the membrane prep was deter ments that bind with different affinities to B2AR365N-Nb80 mined using the BCA protein assay kit, according to the versus B2AR365N-Nb69. manufacturers instructions. (0309 To identify fragments that bind with different affini 0306 The overexpression of recombinant Mor1 as a ties to B2AR365N-Nb80 versus B2AR365N-Nb69, we Single-domain antibody fusion (hMOR1-34GS-Nb33 and screened 1000 fragments of the Maybridge RO3 fragment hMOR1-34GS-Nb10 membranes; P2, 72 h incubation) was library containing fragments with a molecular weight in the US 2015/0376261 A1 Dec. 31, 2015
range of 80 to 300 Da, for conformation selective fragments. formations with the same affinity (antagonists profile). All fragments were dissolved in 100% DMSO at a concen Remarkably, only one fragment of the top 12 hits with agonist tration of 200 mM. The 1000 different Maybridge fragments profile has a catecholamine structure, characteristic for the were first diluted to 20 mM in 100% DMSO, next they were endogenous and several synthetic 132AR agonists. diluted 40 times in binding buffer (75 mM Tris pH7.5, 12.5 mM MgCl2, 1 mM EDTA, 0.05% BSA). In a comparative Example 24 radioligand competition binding experiment, membranes of Sf9 cells (5ug total protein in 100 ul binding buffer) express Analysis of the Activity Profiles of the Selected ing the B2AR365N-Nb80 fusion were mixed with 100 ul of Fragments by Comparative Radioligand Competition each of the 1000 diluted fragments in 1296-well plates. In Assays parallel, membranes of Sf9 cells (5ug total protein in 100 ul 0315. The profiles of the selected 18 fragment hits, 12 with binding buffer) expressing the B2AR365N-Nb69 fusion were the agonist activity profile, 3 with the antagonistic activity mixed with 100 ul of each of the same 1000 diluted fragments profile and the 3 with the inverse agonist activity profile were in separate series of 96-well plates. Next, radioligand H Subsequently confirmed by comparing the dose response dihydroalprenolol was added (50 ul, 2 nM final concentra curves on the B2AR365N-Nb80 fusion versus the tion) to each sample (2000 samples in total) and all were |B2AR365N-Nb69 fusion as described in Example 6. Briefly, incubated for 2 hours at room temperature on a shaking plat membranes of Sf9 cells expressing the different recombinant form (total reaction volume per assay point was 250 ul). The fusion proteins were mixed with each of the 18 fragment hits, final Screening concentration of each fragment was 200 uM. concentrations ranging from 4x107M to 4x10"Minbinding Each 96-well plate also included membranes incubated with buffer, the radioligand H-dihydroalprenolol was added to epinephrine (1E-7M) and alprenolol (1E-6M, 1 E-8M) as con each mixture and samples were incubated for 2 hours at room trols. Membranes were harvested and remaining H-dihy temperature on a shaking platform. Receptor-bound radioli droalprenolol radioactivity was measured as described in gand was separated from free radioligand as described in Example 6. Reasoning that most fragments would not dis Example 6. Data represent the meant-SD (standard deviation) place the radioligand, we calculated for each 96-well plate the of each experiment performed in triplicate. Graphs were gen average number of counts per well (excluding the controls) erated by nonlinear regression analysis using Prism (Graph and used this average value to normalize all data points on that Pad Software, San Diego, Calif.). The dose response curves plate (expressed in %). These normalized data were used to on the active state stabilized B2AR365N-Nb80 fusion versus compare the binding of each fragment for B2AR365N-Nb80 the B2AR365N-Nb69 fusion (the prominent conformation of versus B2AR365N-Nb69 by dividing the normalized value the receptor) confirms the activity profiles of the 18 fragments obtained on B2AR365N-Nb69 by the normalized value chosen in Example 23. Surprisingly, 11 out of the 12 identi obtained on B2AR365N-Nb80. Ratios higher than 1 indicate fied fragments belonging to the agonist profile have never that a fragment is selective (has a higher affinity) for been associated with B2AR ligands with agonist activity. (A B2AR365N-Nb80. Ratios lower than 1 indicate that a frag representative example of a dose response curve of 2 frag ment is selective for B2AR365N-Nb69. ments for each activity profile (agonist, antagonist, inverse 0310. To measure the reproducibility of this assay, the 44 agonist) is shown in FIG. 18). Fragments AC23506, CC56213 fragments most selective for B2AR365N-Nb80, the 44 frag clearly bind with a higher affinity the active state stabilized ments most selective for B2AR365N-Nb69 and the 44 frag |B2AR365N-Nb80 fusion then the B2AR365N-Nb69 fusion ments that displace the radioligand on B2AR365N-Nb80 and (FIG. 18A). For fragments KMO8985, AW00189 we see the B2AR365N-Nb69 to a similar extend were reassayed in opposite (FIG. 18C) while the fragments CC46746, CC44914 duplicate and ranked once more using the data of the three with an antagonistic profile bind both conformations with the independent assays. This comparative assay enables to triage same affinity (FIG. 18B). 132AR fragment hits into three separate functional profiles: 0311 Fragments that are more selective for Example 25 B2AR365N-Nb80 compared to B2AR365N-Nb69, similar to the natural and synthetic B2AR agonist epi Analysis of Pharmacological Properties of nephrine and isoproterenol, respectively (agonist pro Elaborated Fragments by Comparative Radioligand file). Assays 0312 Fragments that displace radioligand on 0316 To demonstrate that the comparative radioligand B2AR365N-Nb80 and B2AR365N-Nb69 to a similar assay can guide elaboration of fragments with an agonistic extend, similar to alprenolol (antagonist profile) profile, a fragment CC56213 was chosen on the basis of their 0313 Fragments that are more selective for dose response curves to elaborate. Multiple chemical variants B2AR365N-Nb69 compared to B2AR365N-Nb80, were Subsequently tested in the comparative radioligand similar to ICI118551 (inverse agonist profile). assay as (FIG. 19) as described in Example 6. Briefly, mem 0314. As a representative example, the %H]-dihydroal branes of Sf9 cells expressing the B2AR365N-Nb80 fusion or prenolol binding of 6 fragments is presented in FIG. 17 show the B2AR365N-Nb69 fusion proteins were mixed with each ing that we can profile the different fragments according to of the elaborated fragments (called compound 8, 9, 10) as their efficacy: 2 fragments, represented by AC23506, well as with the original fragment CC56213, concentrations CC56213, from the 12 highest ranked fragments having an ranging from 10M to 10M in binding buffer, the radioli agonist profile, preferentially bind the active conformation of gand H-dihydroalprenolol was added to each mixture and |B2AR, 2 fragments (KMO8985, AW00189) from the best samples were incubated for 2 hours at room temperature on a ranked fragments having an inverse agonist profile preferen shaking platform. Receptor-bound radioligand was separated tially bind the prominent conformation (inverse agonist pro from free radioligand as described in Example 6. Data repre file) and 2 fragments (CC46746, CC44914) bind both con sent the meant-SEM (standard error of Mean) of each experi US 2015/0376261 A1 Dec. 31, 2015 39
ment performed in triplicate. Graphs were generated by non TABL 1- Continued linear regression analysis using Prism (GraphPad Software, San Diego, Calif.). 0317 Compound 8 had a decreased affinity compared to List of Nanobodies the parent fragment (data not shown) while compound 9 and 10 had increased potency compared to the parent fragment Single CC56213. The improved affinity of the elaborated fragments at a domain (compounds 9, 10) versus the parent compounds were dem antibody antibody SEQ onstrated by calculating the IC50 values for each P2AR con- reference short ID former. The increase affinity of the B2AR365N-Nb80 chimer number notation NO Sequence for the elaborated compounds 9, 10 and the parent fragment CC56213 compared to the control B2AR365N-Nb69 can be calculated from the ratio of the IC50 values from the com- CA2771 No71 14 QVOLOESGGGLVOPGGSLRLSCAA petitive binding experiments depicted in FIG. 19 by dividing SGFAFSSYELRWYROAPGKOHELV the IC50 of B2AR365N-Nb69 by the IC50 of B2AR365N AGITTGGNTYYADSWKGRFTISRD Nb80, resulting in an apparent potency shift of s71,94, 22 for compound 9, 10, CC56213, respectively. Notably, compound NAKNTVYLOMSNLRPEDTAVYACN 10 is not only more potent than its parent fragment CC56213 ANWDLLSDYWGOGTOVTVSS and but is a fivefold more selective for the active state stabi lized B32AR. CA5669 No 69 15 QVOLOESGGGLVOAGGSLRLSCTA SGLTLSNYAMGWFROAPGKEREFV Example 26 AADTWNGNTYHODSVKGRFTISRD NAKNTVYLOMNYLKPEDTAVYYCA Profiling for Agonism with the ADRB2 cAMP ARGSRRSAYYSSSDYTYRCOGTOV Biosensor Assays (HitHunter-DiscoveRx) TVSS 0318. To test if the fragments with an “agonist profile’” (12 fragments described in Examples 23 and 24) are able to No.9 - 1 16 QVOLOESGGGLVOAGGSLRLSCAA induce B2AR signaling, the 18 fragments from Example 23 SGHTFSSARMYWVROAPGKEREFV were tested at the DiscoveRX facility at 2 concentrations (2 AAISRSGFTYSADSWKGRFTISRD mM and 100 uM) in a cellular assay, measuring G protein IANNTVYLOMNSLOPEDTAIYTCY mediated B2AR activation. The % of DMSO in the HitHunter assay was s1%, a concentration that was demonstrated not to AAYLDEFYNDYTHYWGLGTOVTVS be toxic for the B2AR cells used. As controls epinephrine (1 S uM & 50 nM) and alprenolol (0.1 uM & 5 nM) were included in the assay. The HITHUNTER(R) cAMP assay (DiscoveRx) No.9 - 8 17 QVOLOESGGGLVOAGDSLRLSCAA monitors the activation of a GPCR via secondary messenger SGFDFDNFDDYAIGWFROAPGOER cAMP accumulation. The maximal synthesis of cAMP EGWSCIDPSDGSTIYADSAKGRFT caused by the control agonist isoproterenol was set as 100% ISSDNAENTVYLOMNSLKPEDTAV and the agonistic behavior of the tested compounds was YWCSAWTLFHSDEYWGOGTOVTVS expressed relative to isoproterenolagonism (data not shown). S Remarkably, at the concentrations tested, the HITHUNTER(R) bio-assay only identifies three fragments, including CC56213, that cause a detectable and dose depending B2AR CA2760 No. 60 18 QVOLOESGGGLVOAGGSLRLSCAA signaling activity. It is a well-known feature of fragment SGSIFSLNDMGWYROAPGKLRELV libraries that many fragments are toxic for cells at mM con AAITSGGSTKYADSWKGRFTISRD centrations and will not be identified in cellular assays. It thus NAKNTVYLOMNSLKAEDTAVYYCN appears that we can identify multiple fragments with a par AKVAGTFSIYDYWGOGTOVTVSS ticular biological activity profile that cannot be identified in cellular assays, currently used for fragment screening and XA8633 No.33 19 QVOLOESGGGLVRPGGSRRLSCVD HTS. SERTSYPMGWFRRAPGKEREFWAS ITWSGIDPTYADSWADRFTISRDW TABLE 1. ANNTLYLOMNSLKHEDTAVYYCAA List of Nanobodies RAPWGOSSSPYDYDYWGOGTOVTV SS Single- Single domain domain antibody antibody SEQ CA4910 No.10 QVOLOESGGGLVOPGGSLRLSCAA reference short ID SGSFRSIWSMAWYROAPGKORELV number notation NO Sequence ASSNSGGSTNYADSWKGRFTISRD CA2780 No8O 13 QVOLOESGGGLVOAGGSLRLSCAA NAKNTVYLOMNSLKPEDTAVYWCN SGSIFSINTMGWYROAPGKORELV VONRLPGFDAFSGRSIAETYWGOG AAIHSGGSTNYANSWKGRFTISRD NAANTVYLOMNSLKPEDTAVYYCN TOVTVSS WKDYGAVLYEYDYWGOGTOVTVSS US 2015/0376261 A1 Dec. 31, 2015 40
TABLE 2
CDRS of listed Nanobodies Single- Single domain domain antibody antibody reference short number notation CDR1 CDR2 CDR3
CA2780 No8O GSIFSINT IHSGGST NWKDYGAWLYEYDY (SEQ ID NO: 21 (SEQ D NO : 29) (SEO ID NO : 37)
CA2771 No71 GFAFSSYE ITTGGNT NANWDLLSDY (SEQ ID NO: 22) (SEQ D NO: 3O) (SEQ ID NO: 38)
CA5669 No 69 GLTLSNYA DTWNGNT AARGSRRSAYYSSSD (SEQ ID NO: 23) (SEQ D NO : 31) YTY (SEO ID NO. 39)
No.9 - 1 GHTFSSAR ISRSGFT YAAYLDEFYNDYTHY (SEQ ID NO: 24) (SEQ D NO: 32) (SEQ ID NO: 40)
No.9 - 8 GFDFDNFDDYA IDPSDGST SAWTLFHSDEY (SEO ID NO: 25 (SEQ D NO : 33) (SEQ ID NO: 41)
No. 60 GSIFSLND ITSGGST NAKWAGTFSIYDY (SEQ ID NO: 26) (SEQ D NO: 34) (SEQ ID NO: 42)
XA8633 No.33 ERTSYP ITWSGIDP AARAPWGOSSSPYDY (SEO ID NO: 27 (SEQ D NO: 35) DY (SEQ ID NO : 43)
CA4910 No.10 GSFRSIWS SNSGGST NWONRLPGFDAFSGR (SEQ ID NO: 28 (SEQ D NO : 36) SIAETY (SEQ D NO : 44)
TABLE 3 TABLE 4
Ligand dependent potency shifts on active state constrained 2AR. IC50s of ligands for M2Ai3R-Nb9-1 compared to M2Ai3R Values represent the ratio of the IC50 of the indicated non-constrained B2AR (as a fusion to mock Nb69 or as non-fused receptor) to the IC50 Biolog- IC50 (M) ICSO ratio of the receptor constrained in the active state (Nb80 or Nb71 fusion). ical M2Ai3R- IC50,2A3Rf IC50 ratios Ligand activity Nb9-1 M2Ai3R IC50"parvo
B2AR365N- B2AR365N carbachol Full 7.17 482 67.22 Nb80 (vs Nb71 (vs agonist B2AR365N- B2AR365N- B2AR365N oxotremorine Full O.31 98.4 316 Biological Nb69 mock Nb80 (vs Nb69 mock M agonist Ligand activity fusion) B2AR365N) fusion) epinephrine Full agonist 2O72 1375 2032 (endogenous TABLE 5 igand) IC50s of ligands for his 1AR-Nb80 compared to B2AR-Nb69 isoproterenol Full agonist 670 ND 8O alprenolol Neutral 4 ND 1.5 IC50 (LIM ICSO ratio antagonist Biological hB1AR- h1AR- ICSAR-N-69/ Salbutamol Partial 373 ND 454 Ligand activity Nb8O Nb69 IC50', parviso agonist epinephrine Full agonist S.48 376 68.67 (endogenous ICI-118,551 Inverse O.O23 ND O.O1 ligand) agonist alprenolol Neutral 1461 14.44 O.988 carvedillol Antagonist 0.4 O.22 O6 antagonist ICI-118,551 Inverse 10450 805 0.077 agonist ND: not determined US 2015/0376261 A1 Dec. 31, 2015
TABLE 6 0330 Day P. W., Rasmussen S. G., Parnot C., Fung J.J., Masood A., Kobilka T. S.,Yao X.J., Choi H. J., Weis W.I. IC50s of ligands for h92AR-Nb60 compared to B2AR-Nb69 and Rohrer D. K. et al. A monoclonal antibody for G protein-coupled receptor crystallography, Nat Methods 4 IC50 (LIM ICSO ratio (2007), pp. 927-929. Biological B2AR- B2AR- IC50p2AR Nago/ 0331 Derewenda Z. S. Rational protein crystallization by Ligand activity Nb60 Nb69 IC50B2AR-60 mutational Surface engineering, Structure (Camb) 12 epinephrine Full agonist 284OOO 1310 O.OO46 (2004), pp. 529-535. (endogenous 0332 Desmyter A, Spinelli S. Payan F. Lauwereys M, ligand) Wyns L, Muyldermans S, Cambillau C. Three camelid isoprotenerol Full agonist 692OO 836 O.O12 VHH domains in complex with porcine pancreatic alpha ICI-118,551 Inverse 22.8 11.4 O.S agonist amylase. Inhibition and versatility of binding topology. J Biol Chem. 2002 Jun. 28:277(26):23645-50. 0333 Deveraux et al., 1984, Nucleic Acids Research 12, 387-395 TABLE 7 0334 Dimitrov D S. Engineered CH2 domains (nanoan IC50s and fold preference of ligands for prominent (hMor1-34GS-Nb10) tibodies). MAbs. 2009 January-February; 1(1):26-8. and active statestabilized (hMor1-34GS-Nb33) Mor1 conformers. 0335 Eroglu et al., EMBO 20023: 491.96 0336 Eroglu et al., Proc. Natl. Acad. Sci. 2003 100: IC50 (nM) IC50N,33/ 10219-10224 0337 Faham et al., Crystallization of bacteriorhodopsin Ligand hMor1-34GS-Nb33 hMor1-34GS-Nb10 IC50 from bicelle formulations at room temperature. Protein Dmt1-Dalda 18 655 36 Sci. 2005 14:836-40. 2005 (agonist) KGOPO1 3.8 76.7 2O 0338 Faham et al., Bicelle crystallization: a new method (agonist) for crystallizing membrane proteins yields a monomeric Naloxone 21 49 2 bacteriorhodopsin structure. J MoI Biol. 2002 Feb. 8; 316 (antagonist) (1): 1-6. 0339 Foord, S. M., T.I. Bonner, et al., 2005. “Interna tional Union of Pharmacology. XLVI. G protein-coupled REFERENCES receptor list.” Pharmacological reviews 57(2): 279-288. 0340 Fredriksson, R., M. C. Lagerstrom, et al., 2003. 0319 Binz et al., Nature Biotech., 22:575-582 (2004) “The G-protein-coupled receptors in the human genome 0320 Bokoch, M.P., Y. Zou, S. G. Rasmussen, C. W. Liu, form five main families. Phylogenetic analysis, paralogon R. Nygaard, D. M. Rosenbaum, J.J. Fung, H.J. Choi, F. S. groups, and fingerprints.” Molecular Pharmacology 63 (6): Thian, T. S. Kobilka, J. D. Puglisi, W. I. Weis, L. Pardo, R. 1256-1272. S. Prosser, L. Mueller and B. K. Kobilka (2010). “Ligand 0341 Frih V. Zhou Y. Chen D. Loch C, Ab E. GrinkovaY specific regulation of the extracellular Surface of a G-pro N, Verhei H, Sligar S G, Bushweller J H, tein-coupled receptor.” Nature 463(7277): 108-112. 0342 Siegal G. Application of fragment-based drug dis 0321 Caffrey (2003). Membrane protein crystallization. J covery to membrane proteins: identification of ligands of Struct. Biol. 2003 142:108-32. the integral membrane enzyme DsbB. Chem Biol. 2010 0322 Caffrey, M. & Cherezov, V. Crystallizing membrane Aug. 27: 17(8):881-91. proteins using lipidic mesophases. Nat Protoc 4, 706-731, 0343 Galandrin S. Oligny-Longpre G. Bouvier M. The (2009). evasive nature of drug efficacy: implications for drug dis 0323 Chasin et al., 1986, Som. Cell Molec. Genet., covery. Trends Pharmacol Sci. 2007 August; 28(8):423-30. 12:555-556. 0344) Gebauer M. Skerra A. Engineered protein scaffolds 0324 Chelikani et al., Protein Sci. 2006 15:1433-40 as next-generation antibody therapeutics. Curr Opin Chem 0325 Chen, I. and A. Y. Ting (2005). “Site-specific label Biol. 2009 June; 13(3):245-55. ing of proteins with small molecules in live cells. Curr (0345 George et al., 2002, Nat Rev Drug Discov 1:808. Opin Biotechnol 16(1): 35-40. 0346 Gouaux. It’s not just a phase: crystallization and 0326 Cherezov, V. et al., High-resolution crystal structure X-ray structure determination of bacteriorhodopsin in lip of an engineered human beta2-adrenergic G protein idic cubic phases. Structure. 1998 6:5-10; coupled receptor. Science 318, 1258-1265, doi:1150577 (0347 Granier S. Manglik A, Kruse A C, Kobilka T S, pil 10.1126/science. 1150577 (2007). Thian FS, Weis W I, Kobilka BK. Structure of the 8-opioid 0327 Christopoulos, A. (2002). ''Allosteric binding sites receptor bound to naltrindole. Nature. 2012 May 16; 485 on cell-Surface receptors: novel targets for drug discovery.” (7398):400-4. Nat Rev Drug Discov 1(3): 198-210. 0348 Haga K. Kruse AC, Asada H. Yurugi-Kobayashi T. 0328. Chun, E., A.A. Thompson, W. Liu, C. B. Roth, M.T. Shiroishi M., Zhang C, Weis W I, Okada T, Kobilka B K, Griffith, V. Katritch, J. Kunken, F. Xu, V. Cherezov, M.A. Haga T, Kobayashi T. Structure of the human M2 musca Hanson and R. C. Stevens (2012). “Fusion partner rinic acetylcholine receptor bound to an antagonist. toolchest for the stabilization and crystallization of G pro Nature. 2012 Jan. 25; 482(7386):547-51. tein-coupled receptors.” Structure 20(6): 967–976. 0349 Hamers-Casterman, C., T. Atarhouch, S. Muylder 0329 Danley, D. E. (2006). “Crystallization to obtain pro mans et al., Naturally occurring antibodies devoid of light tein-ligand complexes for structure-aided drug design.” chains. Nature 363, 446-448, doi:10.1038/363446a0 Acta Crystallogr D Biol Crystallogr 62(Pt. 6): 569-575. (1993). US 2015/0376261 A1 Dec. 31, 2015 42
0350 Hanson MA, Roth CB, Jo E. Griffith M T. Scott F 0369 Lee GM, Craik C S (2009). Trapping moving tar L. Reinhart G. Desale H, Clemons B, Cahalan S M, gets with small molecules. Science. April 10:324(5924): Schuerer SC, Sanna M G, Han G. W. Kuhn P. Rosen H, 213-5. Stevens R.C. Crystal structure of a lipid G protein-coupled 0370 Lefranc, M. P. C. Pommie, et al., 2003. “IMGT receptor. Science. 2012 Feb. 17:335(6070):851-5. unique numbering for immunoglobulin and T cell receptor 0351 Heilker et al., 2009. Drug Discovery Today 14:231 variable domains and Ig Superfamily V-like domains.” 240. Developmental and Comparative Immunology 27(1): 0352 Hunte C. and Michel H., Crystallisation of mem 55-77. brane proteins mediated by antibody fragments, Curr Opin 0371 Liu JJ, Horst R. Katritch V. Stevens RC, Wtithrich Struct Biol 12 (2002), pp. 503-508. K. Biased signaling pathways in B2-adrenergic receptor 0353 Kahsai, A. W. K. Xiao, S. Rajagopal, S. Aim, A. K. characterized by 19F-NMR. Science. 2012 Mar. 2: 335 Shukla, J. Sun, T. G. Oas and R. J. Lefkowitz (2011). (6072): 1106-10. “Multiple ligand-specific conformations of the beta2-adr 0372 Luca et al., Proc. Natl. Acad. Sci. 2003 100:10706-1 energic receptor.” Nat Chem Biol 7(10): 692-700. 1 0373) Manglik A, Kruse AC, Kobilka T S, Thian F S, 0354) Kallwass et al., Biotechnol. Lett., 15 (1), 29-34, MathiesenJM, Sunahara R K, Pardo L. Weis W I, Kobilka 1993 BK, Granier S. Crystal structure of the u-opioid receptor 0355 Kenakin 2002, Trends Pharmacol Sci 25:186. bound to a morphinan antagonist. Nature. 2012 Mar. 21; 0356. Kenakin TP (2009) Cellular assays as portals to 485(7398):321-6. seven-transmembrane receptor-based drug discovery. 0374. Mansoor et al., Proc. Natl. Acad. Sci. 2006 103: Nature reviews Drug discovery 8: 617-626 3060-3065 0357 Kobilka, B. K. Amino and carboxyl terminal modi 0375 Marchese et al., Genomics 23: 609-618, 1994 fications to facilitate the production and purification of a G 0376 Mary, S., M. Damian, M. Louet, N. Floquet, J. A. protein-coupled receptor. Anal Biochem 231, 269-271 Fehrentz, J. Marie, J. Martinez and J. L. Baneres (2012). (1995). "Ligands and signaling proteins govern the conformational 0358 Koide et al., J. MoI Biol, 284: 1141-1151 (1998) landscape explored by a G protein-coupled receptor.” Proc 0359 Kolakowski, L. F. (1994). “GCRDB A G-PRO Natl AcadSci USA 109(21): 8304-83.09. TEIN-COUPLED RECEPTOR DATABASE. Receptors 0377 Mather, 1982, Annals NY Acad. Sci., 383:44-68 & Channels 2(1): 1-7. 0378 Muralidharan, V. and T. W. Muir (2006). “Protein 0360) Kolkekar et al., 1997, Biochemistry, 36:10901 ligation: an enabling technology for the biophysical analy 10909. sis of proteins.” Nat Methods 3(6): 429-438. 0361 Korotkov K.V. Pardon E. Steyaert J. Hol W.G. Crys 0379 Niu et al., Biophys J. 2005 89:1833-1840 0380 Nollert et al., Lipidic cubic phases as matrices for tal structure of the N-terminal domain of the secretin GspD membrane protein crystallization Methods. 2004 34:348 from ETEC determined with the assistance of a nanobody. 53 Structure. 2009 Feb. 13; 17(2):255-65. 0381, Nygren, P-A. (2008) Alternative binding proteins: 0362 Kruse AC, Hu J, Pan AC, Arlow DH, Rosenbaum affibody binding proteins developed from a small three DM, Rosemond E, Green HF, Liu T, Chae PS, Dror RO, helix bundle scaffold. FEBS J. 275,2668-2676. Shaw DE, Weis W I, Wess J, Kobilka B K. Structure and 0382 Ostermeier C. Iwata S., Ludwig B. and Michel H., dynamics of the M3 muscarinic acetylcholine receptor. Fv fragment-mediated crystallization of the membrane Nature. 2012 Feb. 22:482(7386):552-6. protein bacterial cytochrome c oxidase, Nat Struct Biol 2 0363 Kruse AC, Ring AM, Manglik A, Hu J, Hu K, Eitel (1995), pp. 842-846. K, Hubner H, Pardon E, Valant C, Sexton PM, Christo 0383 Palczewski, K. et al., Crystal structure of rhodopsin: poulos A, Felder C C, Gmeiner P. Steyaert J. Weis W I, A G protein-coupled receptor. Science 289, 739-745 Garcia KC, Wess J. Kobilka B K. Activation and allosteric (2000). modulation of a muscarinic acetylcholine receptor. Nature. (0384 Popp, M. W., J. M. Antos, G. M. Grotenbreg, E. 2013 Dec. 5: 504(7478). Spooner and H. L. Ploegh (2007). "Sortagging: a versatile 0364 Lagerström, M.C. and H. B. Schioth (2008). “Struc method for protein labeling.” Nature chemical biology 3: tural diversity of G protein-coupled receptors and signifi 707-708. cance for drug discovery.” Nature reviews. Drug discovery 0385 Probstet al., 1992, DNA Cell Biol. 1992 11:1-20 7: 339-357. (0386 Rabuka, D. (2010). “Chemoenzymatic methods for 0365 Landau et al., Lipidic cubic phases: a novel concept site-specific protein modification.” Curr Opin Chem Biol for the crystallization of membrane proteins. Proc. Natl. 14(6): 790-796. Acad. Sci. 1996 93:14532-5 0387 Rajagopal, S. K. Rajagopal and R. J. Lefkowitz 0366 Lawson, A. D. (2012). ''Antibody-enabled small (2010). “Teaching old receptors new tricks: biasing seven molecule drug discovery.” Nat Rev Drug Discov 11(7): transmembrane receptors.” Nature reviews. Drug discov 519-525. ery 9:373-386. 0367 Lebon, G. K. Bennett, A. Jazayeri and C. G. Tate 0388 Rasmussen SG, DeVree BT, Zou Y. Kruse A C, (2011). “Thermostabilisation of an agonist-bound confor Chung KY, Kobilka TS, Thian FS, Chae PS, Pardon E, mation of the human adenosine A(2A) receptor.” J Mol Callinski D. Mathiesen J M. Shah ST, Lyons JA, Caffrey Biol 4.09(3): 298-310. M, Gellman SH, Steyaert J. Skiniotis G. Weis W I, Suna 0368 Lebon, G., T. Warne and C. G. Tate (2012). 'Ago hara R K, Kobilka B K. Crystal structure of the B2 adren nist-bound structures of G protein-coupled receptors.” ergic receptor-Gs protein complex. Nature. 2011 a Jul.19; Curr Opin Struct Biol 22(4): 482-490. 477(7366):549-55. US 2015/0376261 A1 Dec. 31, 2015 43
0389 Rasmussen, S. G. H. J. Choi, J. J. Fung, E. Pardon, (0403 Shoichet, B. K. and B. K. Kobilka (2012). “Struc P. Casarosa, P. S. Chae, B.T. DeVree, D. M. Rosenbaum, F. ture-based drug screening for G-protein-coupled recep S. Thian, T. S. Kobilka, A. Schnapp, I. Konetzki, R. K. tors.” Trends Pharmacol Sci 33(5): 268-272. Sunahara, S. H. Gellman, A. Pautsch, J. Steyaert, W.I. Weis 04.04 Skerra, J. Molecular Recognition, 13:167-187 and B. K. Kobilka (2011b). "Structure of a nanobody (2000). stabilized active state of the beta(2) adrenoceptor.” Nature 04.05 Starovasnik MA, Braisted AC, Wells J.A. Structural 469(7329): 175-180. mimicry of a native protein by a minimized binding domain. Proc Natl Acad Sci USA. 1997 Sep. 16: 94(19): 0390 Rasmussen, S.G. F., H.-J. Choi, D. M. Rosenbaum, 10O8O-5. T. S. Kobilka, F. S. Thian, P. C. Edwards, M. Burghammer, (0406 Staus DP Wingler LM, Strachan RT, RasmussenS V. R. P. Ratnala, R. Sanishvili, R. F. Fischetti, G. F. X. G F Pardon E, Ahn S. et al. Regulation of Beta-2-Adren Schertler, W. I. Weis and B. K. Kobilka (2007). “Crystal ergic Receptor Function by Conformationally Selective structure of the human beta2-adrenergic G-protein-coupled Single-domain Intrabodies. Mol Pharmacol. 2013 Dec. 6. receptor.” Nature 450: 383-387. (0407 Steyaert J. Kobilka B K (2011). Nanobody stabili 0391 Reeves et al., 2002, PNAS,99: 13419 Zation of G protein-coupled receptor conformational 0392 Rich R L. Errey J, Marshall F. Myszka D G. Biacore states. Curr Opin Struct Biol. August; 21(4):567-72. analysis with stabilized G-protein-coupled receptors. Anal (0408 Tate, C. G. (2012). “A crystal clear solution for Biochem. 2011 Feb. 15:409(2):267-72. determining G-protein-coupled receptor structures.” 0393 Riechmann and Muyldermans J. Immunol. Meth Trends Biochem Sci. ods 2000: 240: 185-195. 04.09 Urlaub and Chasin, 1980, Proc. Natl. Acad. Sci. 0394 Rios et al., 2001, Pharmacol Ther 92:71 USA, 77:4216 0395 Rosenbaum, D. M. V. Cherezov, M. A. Hanson, S. 0410 Warne, T., R. Moukhametzianov, J. G. Baker, R. G. Rasmussen, F. S. Thian, T. S. Kobilka, H. J. Choi, X. J. Nehme, P. C. Edwards, A. G. W. Leslie, G. F. X. Schertler Yao, W. I. Weis, R. C. Stevens and B. K. Kobilka (2007). and C. G. Tate (2011). “The structural basis for agonistand “GPCR engineering yields high-resolution structural partial agonist action on a 31-adrenergic receptor.' Nature insights into beta2-adrenergic receptor function. Science 469: 241-244. 318(5854): 1266-1273. 0411 Wesolowski et al., 2009, Med. Microbiol. Immunol. 0396 Rosenbaum, D. M. et al. Structure and function of 198: 157 an irreversible agonist-beta(2) adrenoceptor complex. 0412 White, J. F., N. Noinaj, Y. Shibata, J. Love, B. Kloss, Nature 469, 236-240 (2011). F. Xu, J. Gvozdenovic-Jeremic, P. Shah, J. Shiloach, C. G. 0397 Rosenbaum D. M., S. G. Rasmussen, and B. K. Tate and R. Grisshammer (2012). "Structure of the agonist Kobilka, Nature 459 (7245), 356 (2009). bound neurotensin receptor.” Nature 490(7421): 508-513. 0398 Rummel et al., Lipidic Cubic Phases: New Matrices 0413 Wu H. Wacker D. Mileni M. Katritch V. Han G. W. for the Three-Dimensional Crystallization of Membrane Vardy E. Liu W. Thompson AA, Huang X P. Carroll FI, Proteins. J. Struct. Biol. 1998 121:82–91; Mascarella SW, Westkaemper RB, Mosier PD, Roth BL, 0399. Serrano-Vega, M.J., F. Magnani, Y. Shibata and C. Cherezov V. Stevens R C. Structure of the human K-opioid G. Tate (2008). “Conformational thermostabilization of receptor in complex with JDTic. Nature. 2012 Mar. 21; the beta1-adrenergic receptor in a detergent-resistant 485(7398):327-32. foim.” Proceedings of the National Academy of Sciences 0414. Xu, F., et al., 2011. “Structure of an agonist-bound of the United States of America 105(3): 877-882. human A2A adenosine receptor.” Science 332(6027): 322 (0400 Shibata, Y., J. F. White, M.J. Serrano-Vega, F. Mag 327. nani, A. L. Aloia, R. Grisshammer and C. G. Tate (2009). 0415 Yao, X., C. Parnot, X. Deupi, V. R. P. Ratnala, G. “Thermostabilization of the neurotensin receptor NTS1.” Swaminath, D. Farrens and B. Kobilka (2006). “Coupling Journal of Molecular Biology 390(2): 262-277. ligand structure to specific conformational Switches in the 0401 Shimada et al., J. Biol. Chem. 2002 277:31774-80 beta2-adrenoceptor.” Nature chemical biology 2:417-422. 0402 Shimamura T. Shiroishi M, Weyand S. Tsujimoto H, 0416 Zhang C. Srinivasan Y. Arlow DH, Fung J.J. Palmer Winter G. Katritch V. Abagyan R. Cherezov V. Liu W. Han D, Zheng Y. Green H F Pandey A, Dror RO, Shaw DE, G. W. Kobayashi T. Stevens RC, Iwata S. Structure of the Weis W I, Coughlin S R. Kobilka B K. High-resolution human histamine H1 receptor complex with doxepin. crystal structure of human protease-activated receptor 1. Nature. 2011 Jun. 22:475(7354):65-70. Nature. 2012 Dec. 20: 492(7429):387-92.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 64
SEO ID NO 1 LENGTH: 531 TYPE PRT ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: GPCR-Nanobody fusion
<4 OOs SEQUENCE: 1 Met Lys Thr Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala US 2015/0376261 A1 Dec. 31, 2015 44
- Continued
1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Glu Asn Lieu. Tyr Phe Glin Gly Phe 2O 25 3O Gly Glin Pro Gly Asn Gly Ser Ala Phe Lieu. Lieu Ala Pro Asn Arg Ser 35 4 O 45 His Ala Pro Asp His Asp Val Thr Glin Glin Arg Asp Glu Val Trp Val SO 55 6 O Val Gly Met Gly Ile Val Met Ser Lieu. Ile Val Lieu Ala Ile Val Phe 65 70 7s 8O Gly Asn Val Lieu Val Ile Thr Ala Ile Ala Lys Phe Glu Arg Lieu. Glin 85 90 95 Thr Val Thr Asn Tyr Phe Ile Thr Ser Leu Ala Cys Ala Asp Leu Val 1OO 105 11 O Met Gly Lieu Ala Val Val Pro Phe Gly Ala Ala His Ile Lieu Met Lys 115 12 O 125 Met Trp Thr Phe Gly Asn Phe Trp Cys Glu Phe Trp Thr Ser Ile Asp 13 O 135 14 O Val Lieu. Cys Val Thr Ala Ser Ile Glu Thir Lieu. Cys Val Ile Ala Val 145 150 155 160 Asp Arg Tyr Phe Ala Ile Thir Ser Pro Phe Llys Tyr Glin Ser Lieu. Leu 1.65 17O 17s Thir Lys Asn Lys Ala Arg Val Ile Ile Lieu Met Val Trp Ile Val Ser 18O 185 19 O Gly Lieu. Thir Ser Phe Leu Pro Ile Gln Met His Trp Tyr Arg Ala Thr 195 2OO 2O5 His Glin Glu Ala Ile Asn. Cys Tyr Ala Glu Glu Thir Cys Cys Asp Phe 21 O 215 22O Phe Thr Asn Glin Ala Tyr Ala Ile Ala Ser Ser Ile Val Ser Phe Tyr 225 23 O 235 24 O Val Pro Leu Val Ile Met Val Phe Val Tyr Ser Arg Val Phe Glin Glu 245 250 255 Ala Lys Arg Glin Lieu Gln Lys Ile Asp Llys Ser Glu Gly Arg Phe His 26 O 265 27 O Val Glin Asn Lieu. Ser Glin Val Glu Glin Asp Gly Arg Thr Gly. His Gly 27s 28O 285 Lieu. Arg Arg Ser Ser Llys Phe Cys Lieu Lys Glu. His Lys Ala Lieu Lys 29 O 295 3 OO Thr Lieu. Gly Ile Ile Met Gly Thr Phe Thr Lieu. Cys Trp Leu Pro Phe 3. OS 310 315 32O Phe Ile Val Asn. Ile Val His Val Ile Glin Asp Asn Lieu. Ile Arg Llys 3.25 330 335
Glu Val Tyr Ile Leu Lleu. Asn Trp Ile Gly Tyr Val Asn Ser Gly Phe 34 O 345 35. O
Asn Pro Lieu. Ile Tyr Cys Arg Ser Pro Asp Phe Arg Ile Ala Phe Glin 355 360 365
Glu Lieu. Lieu. Cys Lieu. Arg Arg Ser Ser Lieu Lys Ala Tyr Gly Asn Gly 37 O 375 38O
Tyr Ser Ser Asn Gly Asn Thr Gly Glu Glin Ser Gly Gly Gly Gly Gly 385 390 395 4 OO
Ser Gly Gly Gly Ser Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu. 4 OS 41O 415 US 2015/0376261 A1 Dec. 31, 2015 45
- Continued
Val Glin Ala Gly Gly Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Ser 42O 425 43 O Ile Phe Ser Ile Asn Thr Met Gly Trp Tyr Arg Glin Ala Pro Gly Lys 435 44 O 445 Glin Arg Glu Lieu Val Ala Ala Ile His Ser Gly Gly Ser Thr Asn Tyr 450 45.5 460 Ala Asn. Ser Val Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Ala 465 470 47s 48O Asn Thr Val Tyr Lieu Gln Met Asn. Ser Lieu Lys Pro Glu Asp Thir Ala 485 490 495 Val Tyr Tyr Cys Asn. Wall Lys Asp Tyr Gly Ala Val Lieu. Tyr Glu Tyr SOO 505 51O Asp Tyr Trp Gly Glin Gly Thr Glin Val Thr Val Ser Ser His His His 515 52O 525
His His His 53 O
<210s, SEQ ID NO 2 &211s LENGTH: 527 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion < 4 OO SEQUENCE: 2 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Glu Asn Lieu. Tyr Phe Glin Gly Phe 2O 25 3O Gly Glin Pro Gly Asn Gly Ser Ala Phe Lieu. Lieu Ala Pro Asn Arg Ser 35 4 O 45 His Ala Pro Asp His Asp Val Thr Glin Glin Arg Asp Glu Val Trp Val SO 55 6 O Val Gly Met Gly Ile Val Met Ser Lieu. Ile Val Lieu Ala Ile Val Phe 65 70 7s 8O Gly Asn Val Lieu Val Ile Thr Ala Ile Ala Lys Phe Glu Arg Lieu. Glin 85 90 95 Thr Val Thr Asn Tyr Phe Ile Thr Ser Leu Ala Cys Ala Asp Leu Val 1OO 105 11 O Met Gly Lieu Ala Val Val Pro Phe Gly Ala Ala His Ile Lieu Met Lys 115 12 O 125 Met Trp Thr Phe Gly Asn Phe Trp Cys Glu Phe Trp Thr Ser Ile Asp 13 O 135 14 O
Val Lieu. Cys Val Thr Ala Ser Ile Glu Thir Lieu. Cys Val Ile Ala Val 145 150 155 160
Asp Arg Tyr Phe Ala Ile Thir Ser Pro Phe Llys Tyr Glin Ser Lieu. Leu 1.65 17O 17s
Thir Lys Asn Lys Ala Arg Val Ile Ile Lieu Met Val Trp Ile Val Ser 18O 185 19 O
Gly Lieu. Thir Ser Phe Leu Pro Ile Gln Met His Trp Tyr Arg Ala Thr 195 2OO 2O5 His Glin Glu Ala Ile Asn. Cys Tyr Ala Glu Glu Thir Cys Cys Asp Phe 21 O 215 22O US 2015/0376261 A1 Dec. 31, 2015 46
- Continued
Phe Thr Asn Glin Ala Tyr Ala Ile Ala Ser Ser Ile Val Ser Phe Tyr 225 23 O 235 24 O Val Pro Leu Val Ile Met Val Phe Val Tyr Ser Arg Val Phe Glin Glu 245 250 255 Ala Lys Arg Glin Lieu Gln Lys Ile Asp Llys Ser Glu Gly Arg Phe His 26 O 265 27 O Val Glin Asn Lieu. Ser Glin Val Glu Glin Asp Gly Arg Thr Gly. His Gly 27s 28O 285 Lieu. Arg Arg Ser Ser Llys Phe Cys Lieu Lys Glu. His Lys Ala Lieu Lys 29 O 295 3 OO Thr Lieu. Gly Ile Ile Met Gly Thr Phe Thr Lieu. Cys Trp Leu Pro Phe 3. OS 310 315 32O Phe Ile Val Asn. Ile Val His Val Ile Glin Asp Asn Lieu. Ile Arg Llys 3.25 330 335 Glu Val Tyr Ile Leu Lleu. Asn Trp Ile Gly Tyr Val Asn Ser Gly Phe 34 O 345 35. O Asn Pro Lieu. Ile Tyr Cys Arg Ser Pro Asp Phe Arg Ile Ala Phe Glin 355 360 365 Glu Lieu. Lieu. Cys Lieu. Arg Arg Ser Ser Lieu Lys Ala Tyr Gly Asn Gly 37 O 375 38O Tyr Ser Ser Asn Gly Asn Thr Gly Glu Glin Ser Gly Gly Gly Gly Gly 385 390 395 4 OO Ser Gly Gly Gly Ser Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu. 4 OS 41O 415 Val Glin Pro Gly Gly Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Phe 42O 425 43 O Ala Phe Ser Ser Tyr Glu Lieu. Arg Trp Tyr Arg Glin Ala Pro Gly Lys 435 44 O 445 Gln His Glu Lieu Val Ala Gly Ile Thr Thr Gly Gly Asn Thr Tyr Tyr 450 45.5 460 Ala Asp Ser Val Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Lys 465 470 47s 48O Asn Thr Val Tyr Lieu Gln Met Ser Asn Lieu. Arg Pro Glu Asp Thir Ala 485 490 495 Val Tyr Ala Cys Asn Ala Asn Trp Asp Lieu. Lieu. Ser Asp Tyr Trp Gly SOO 505 51O Gln Gly Thr Glin Val Thr Val Ser Ser His His His His His His 515 52O 525
<210s, SEQ ID NO 3 &211s LENGTH: 535 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion
<4 OOs, SEQUENCE: 3 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15
Asp Tyr Lys Asp Asp Asp Asp Ala Glu Asn Lieu. Tyr Phe Glin Gly Phe 2O 25 3O
Gly Glin Pro Gly Asn Gly Ser Ala Phe Lieu. Lieu Ala Pro Asn Arg Ser 35 4 O 45 US 2015/0376261 A1 Dec. 31, 2015 47
- Continued
His Ala Pro Asp His Asp Val Thr Glin Glin Arg Asp Glu Val Trp Val SO 55 6 O Val Gly Met Gly Ile Val Met Ser Lieu. Ile Val Lieu Ala Ile Val Phe 65 70 7s 8O Gly Asn Val Lieu Val Ile Thr Ala Ile Ala Lys Phe Glu Arg Lieu. Glin 85 90 95 Thr Val Thr Asn Tyr Phe Ile Thr Ser Leu Ala Cys Ala Asp Leu Val 1OO 105 11 O Met Gly Lieu Ala Val Val Pro Phe Gly Ala Ala His Ile Lieu Met Lys 115 12 O 125 Met Trp Thr Phe Gly Asn Phe Trp Cys Glu Phe Trp Thr Ser Ile Asp 13 O 135 14 O Val Lieu. Cys Val Thr Ala Ser Ile Glu Thir Lieu. Cys Val Ile Ala Val 145 150 155 160 Asp Arg Tyr Phe Ala Ile Thir Ser Pro Phe Llys Tyr Glin Ser Lieu. Leu 1.65 17O 17s Thir Lys Asn Lys Ala Arg Val Ile Ile Lieu Met Val Trp Ile Val Ser 18O 185 19 O Gly Lieu. Thir Ser Phe Leu Pro Ile Gln Met His Trp Tyr Arg Ala Thr 195 2OO 2O5 His Glin Glu Ala Ile Asn. Cys Tyr Ala Glu Glu Thir Cys Cys Asp Phe 21 O 215 22O Phe Thr Asn Glin Ala Tyr Ala Ile Ala Ser Ser Ile Val Ser Phe Tyr 225 23 O 235 24 O Val Pro Leu Val Ile Met Val Phe Val Tyr Ser Arg Val Phe Glin Glu 245 250 255 Ala Lys Arg Glin Lieu Gln Lys Ile Asp Llys Ser Glu Gly Arg Phe His 26 O 265 27 O Val Glin Asn Lieu. Ser Glin Val Glu Glin Asp Gly Arg Thr Gly. His Gly 27s 28O 285 Lieu. Arg Arg Ser Ser Llys Phe Cys Lieu Lys Glu. His Lys Ala Lieu Lys 29 O 295 3 OO Thr Lieu. Gly Ile Ile Met Gly Thr Phe Thr Lieu. Cys Trp Leu Pro Phe 3. OS 310 315 32O Phe Ile Val Asn. Ile Val His Val Ile Glin Asp Asn Lieu. Ile Arg Llys 3.25 330 335 Glu Val Tyr Ile Leu Lleu. Asn Trp Ile Gly Tyr Val Asn Ser Gly Phe 34 O 345 35. O Asn Pro Lieu. Ile Tyr Cys Arg Ser Pro Asp Phe Arg Ile Ala Phe Glin 355 360 365 Glu Lieu. Lieu. Cys Lieu. Arg Arg Ser Ser Lieu Lys Ala Tyr Gly Asn Gly 37 O 375 38O
Tyr Ser Ser Asn Gly Asn Thr Gly Glu Glin Ser Gly Gly Gly Gly Gly 385 390 395 4 OO
Ser Gly Gly Gly Ser Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu. 4 OS 41O 415
Val Glin Ala Gly Gly Ser Lieu. Arg Lieu. Ser Cys Thr Ala Ser Gly Lieu 42O 425 43 O
Thr Lieu Ser Asn Tyr Ala Met Gly Trp Phe Arg Glin Ala Pro Gly Lys 435 44 O 445 US 2015/0376261 A1 Dec. 31, 2015 48
- Continued Glu Arg Glu Phe Val Ala Ala Asp Thir Trp Asn Gly Asn. Thir Tyr His 450 45.5 460 Glin Asp Ser Val Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Lys 465 470 47s 48O Asn Thr Val Tyr Lieu Gln Met Asn Tyr Lieu Lys Pro Glu Asp Thr Ala 485 490 495 Val Tyr Tyr Cys Ala Ala Arg Gly Ser Arg Arg Ser Ala Tyr Tyr Ser SOO 505 51O Ser Ser Asp Tyr Thr Tyr Arg Gly Glin Gly Thr Glin Val Thr Val Ser 515 52O 525
Ser His His His His His His 53 O 535
<210s, SEQ ID NO 4 &211s LENGTH: 53 O 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion <4 OOs, SEQUENCE: 4 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Glu Asn Lieu. Tyr Phe Glin Gly Phe 2O 25 3O Gly Glin Pro Gly Asn Gly Ser Ala Phe Lieu. Lieu Ala Pro Asn Arg Ser 35 4 O 45 His Ala Pro Asp His Asp Val Thr Glin Glin Arg Asp Glu Val Trp Val SO 55 6 O Val Gly Met Gly Ile Val Met Ser Lieu. Ile Val Lieu Ala Ile Val Phe 65 70 7s 8O Gly Asn Val Lieu Val Ile Thr Ala Ile Ala Lys Phe Glu Arg Lieu. Glin 85 90 95 Thr Val Thr Asn Tyr Phe Ile Thr Ser Leu Ala Cys Ala Asp Leu Val 1OO 105 11 O Met Gly Lieu Ala Val Val Pro Phe Gly Ala Ala His Ile Lieu Met Lys 115 12 O 125 Met Trp Thr Phe Gly Asn Phe Trp Cys Glu Phe Trp Thr Ser Ile Asp 13 O 135 14 O Val Lieu. Cys Val Thr Ala Ser Ile Glu Thir Lieu. Cys Val Ile Ala Val 145 150 155 160 Asp Arg Tyr Phe Ala Ile Thir Ser Pro Phe Llys Tyr Glin Ser Lieu. Leu 1.65 17O 17s Thir Lys Asn Lys Ala Arg Val Ile Ile Lieu Met Val Trp Ile Val Ser 18O 185 19 O Gly Lieu. Thir Ser Phe Leu Pro Ile Gln Met His Trp Tyr Arg Ala Thr 195 2OO 2O5 His Glin Glu Ala Ile Asn. Cys Tyr Ala Glu Glu Thir Cys Cys Asp Phe 21 O 215 22O
Phe Thr Asn Glin Ala Tyr Ala Ile Ala Ser Ser Ile Val Ser Phe Tyr 225 23 O 235 24 O
Val Pro Leu Val Ile Met Val Phe Val Tyr Ser Arg Val Phe Glin Glu 245 250 255 US 2015/0376261 A1 Dec. 31, 2015 49
- Continued Ala Lys Arg Glin Lieu Gln Lys Ile Asp Llys Ser Glu Gly Arg Phe His 26 O 265 27 O Val Glin Asn Lieu. Ser Glin Val Glu Glin Asp Gly Arg Thr Gly. His Gly 27s 28O 285 Lieu. Arg Arg Ser Ser Llys Phe Cys Lieu Lys Glu. His Lys Ala Lieu Lys 29 O 295 3 OO Thr Lieu. Gly Ile Ile Met Gly Thr Phe Thr Lieu. Cys Trp Leu Pro Phe 3. OS 310 315 32O Phe Ile Val Asn. Ile Val His Val Ile Glin Asp Asn Lieu. Ile Arg Llys 3.25 330 335 Glu Val Tyr Ile Leu Lleu. Asn Trp Ile Gly Tyr Val Asn Ser Gly Phe 34 O 345 35. O Asn Pro Lieu. Ile Tyr Cys Arg Ser Pro Asp Phe Arg Ile Ala Phe Glin 355 360 365 Glu Lieu. Lieu. Cys Lieu. Arg Arg Ser Ser Lieu Lys Ala Tyr Gly Asn Gly 37 O 375 38O Tyr Ser Ser Asn Gly Asn Thr Gly Glu Glin Ser Gly Gly Gly Gly Gly 385 390 395 4 OO Ser Gly Gly Gly Ser Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu. 4 OS 41O 415 Val Glin Ala Gly Gly Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Ser 42O 425 43 O Ile Phe Ser Lieu. ASn Asp Met Gly Trp Tyr Arg Glin Ala Pro Gly Lys 435 44 O 445 Lieu. Arg Glu Lieu Val Ala Ala Ile Thir Ser Gly Gly Ser Thir Lys Tyr 450 45.5 460 Ala Asp Ser Val Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Lys 465 470 47s 48O Asn Thr Val Tyr Lieu Gln Met Asn. Ser Lieu Lys Ala Glu Asp Thir Ala 485 490 495 Val Tyr Tyr Cys Asn Ala Lys Val Ala Gly Thr Phe Ser Ile Tyr Asp SOO 505 51O Tyr Trp Gly Glin Gly Thr Glin Val Thr Val Ser Ser His His His His 515 52O 525
His His 53 O
<210s, SEQ ID NO 5 &211s LENGTH: 356 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion
<4 OOs, SEQUENCE: 5 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Glu Asn Lieu. Tyr Phe Glin Gly Met Asp 2O 25 3O
Asp Ser Thir Asp Ser Ser Asp Asn. Ser Lieu Ala Lieu. Thir Ser Pro Tyr 35 4 O 45
Lys Thr Phe Glu Val Val Phe Ile Val Lieu Val Ala Gly Ser Leu Ser SO 55 6 O US 2015/0376261 A1 Dec. 31, 2015 50
- Continued
Lell Wall Thir Ile Ile Gly Asn Ile Luell Wall Met Val Ser Ile Llys Val 65 70
Asn Arg His Luell Gn. Thir Wall Asn Asn Tyr Phe Lell Phe Ser Lieu Ala 85 90 95
Ala Asp Luell Ile Ile Gly Wall Phe Ser Met Asn Lell Tyr Thir Lieu. 105 11 O
Thir Wall Ile Gly Tyr Trp Pro Luell Gly Pro Wall Wall Asp Lieu. 115 12 O 125
Trp Luell Ala Luell Asp Wall Wall Ser Asn Ala Ser Wall Met Asn Luell 13 O 135 14 O
Lell Ile Ile Ser Phe Asp Arg Phe Wall Thir Pro Lieu. Thir 145 155 160
Pro Wall Arg Thr Thir Met Ala Gly Met Met Ile Ala Ala 1.65 17O 17s
Ala Trp Wall Luell Ser Phe Ile Luell Trp Ala Pro Ala Ile Luell Phe Trp 18O 185 19 O
Glin Phe Ile Wall Gly Val Arg Thir Wall Glu Asp Gly Glu Tyr Ile 195 2OO
Glin Phe Phe Ser Asn Ala Ala Wall Thir Phe Gly Thir Ala Ile Ala Ala 21 O 215 22O
Phe Luell Pro Wall Ile Ile Met Thir Wall Luell Tyr Trp His Ile Ser 225 23 O 235 24 O
Arg Ala Ser Ser Arg Ile Asp Glu Pro Wall Ala 245 250 255
Asn Glin Asp Pro Wall Ser Thir Arg Lys Pro Pro Pro Ser Arg Glu 26 O 265 27 O
Wall Thir Arg Thr Ile Luell Ala Ile Luell Lell Ala Phe Ile Ile 285
Thir Trp Ala Pro Tyr Asn Wall Met Wall Luell Ile Asn Thir Phe Cys Ala 29 O 295 3 OO
Pro Ile Pro Asn. Thir Wall Trp Thir Ile Gly Tyr Trp Luell 3. OS 310 315
Ile Asn Ser Thir Ile Asn Pro Ala Tyr Ala Lell Asn Ala Thr 3.25 330 335
Phe Thir Phe Lys His Luell Luell Met Cys His Lys ASn Ile 34 O 345 35. O
Gly Ala Thir Arg 355
SEQ ID NO 6 LENGTH: 506 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: GPCR-Nanobody fusion
SEQUENCE: 6
Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lell Wall Phe Ala 1. 5 15
Asp Tyr Lys Asp Asp Asp Asp Glu Asn Lieu. Tyr Phe Glin Gly Met Asp 25 3O
Asp Ser Thir Asp Ser Ser Asp Asn. Ser Lieu Ala Lieu. Thir Ser Pro Tyr 35 4 O 45 US 2015/0376261 A1 Dec. 31, 2015 51
- Continued
Lys Thr Phe Glu Val Val Phe Ile Val Lieu Val Ala Gly Ser Leu Ser SO 55 6 O Lieu Val Thir Ile Ile Gly Asn Ile Leu Val Met Val Ser Ile Llys Val 65 70 7s 8O Asn Arg His Lieu. Glin Thr Val Asn. Asn Tyr Phe Lieu. Phe Ser Lieu Ala 85 90 95 Cys Ala Asp Lieu. Ile Ile Gly Val Phe Ser Met Asn Lieu. Tyr Thr Lieu. 1OO 105 11 O Tyr Thr Val Ile Gly Tyr Trp Pro Leu Gly Pro Val Val Cys Asp Leu 115 12 O 125 Trp Lieu Ala Lieu. Asp Tyr Val Val Ser Asn Ala Ser Val Met Asn Lieu. 13 O 135 14 O Lieu. Ile Ile Ser Phe Asp Arg Tyr Phe Cys Val Thr Lys Pro Leu. Thr 145 SO 155 160 Tyr Pro Val Lys Arg Thr Thr Lys Met Ala Gly Met Met Ile Ala Ala 1.65 17O 17s Ala Trp Val Lieu. Ser Phe Ile Lieu. Trp Ala Pro Ala Ile Lieu. Phe Trp 18O 185 19 O Glin Phe Ile Val Gly Val Arg Thr Val Glu Asp Gly Glu. Cys Tyr Ile 195 2OO 2O5 Glin Phe Phe Ser Asn Ala Ala Val Thr Phe Gly Thr Ala Ile Ala Ala 21 O 215 22O Phe Tyr Lieu Pro Val Ile Ile Met Thr Val Lieu. Tyr Trp His Ile Ser 225 23 O 235 24 O Arg Ala Ser Lys Ser Arg Ile Llys Lys Asp Llys Lys Glu Pro Val Ala 245 250 255 Asn Glin Asp Pro Val Ser Thr Arg Llys Llys Pro Pro Pro Ser Arg Glu 26 O 265 27 O Llys Llys Val Thir Arg Thir Ile Lieu Ala Ile Lieu. Lieu Ala Phe Ile Ile 27s 28O 285 Thir Trp Ala Pro Tyr Asn Val Met Val Lieu. Ile Asn Thr Phe Cys Ala 29 O 295 3 OO Pro Cys Ile Pro Asn Thr Val Trp Thir Ile Gly Tyr Trp Lieu. Cys Tyr 3. OS 310 315 32O Ile Asin Ser Thir Ile ASn Pro Ala Cys Tyr Ala Lieu. Cys Asn Ala Thr 3.25 330 335 Phe Llys Llys Thr Phe Lys His Leu Lleu Met Cys His Tyr Lys Asn Ile 34 O 345 35. O Gly Ala Thr Arg Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 355 360 365 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Glin Val Glin Leu Gln 37 O 375 38O
Glu Ser Gly Gly Gly Lieu Val Glin Ala Gly Gly Ser Lieu. Arg Lieu. Ser 385 390 395 4 OO Cys Ala Ala Ser Gly His Thr Phe Ser Ser Ala Arg Met Tyr Trp Val 4 OS 41O 415
Arg Glin Ala Pro Gly Lys Glu Arg Glu Phe Val Ala Ala Ile Ser Arg 42O 425 43 O
Ser Gly Phe Thr Tyr Ser Ala Asp Ser Val Lys Gly Arg Phe Thir Ile 435 44 O 445
Ser Arg Asp Ile Ala Asn. Asn Thr Val Tyr Lieu. Glin Met Asn. Ser Lieu. US 2015/0376261 A1 Dec. 31, 2015 52
- Continued
450 45.5 460 Glin Pro Glu Asp Thr Ala Ile Tyr Thr Cys Tyr Ala Ala Tyr Lieu. Asp 465 470 47s 48O Glu Phe Tyr Asn Asp Tyr Thr His Tyr Trp Gly Lieu. Gly Thr Glin Val 485 490 495
Thir Wal Ser Ser His His His His His His SOO 505
<210s, SEQ ID NO 7 &211s LENGTH: 488 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion <4 OO > SEQUENCE: 7 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Glu Asn Lieu. Tyr Phe Glin Gly Pro 2O 25 3O Glu Pro Leu Ser Glin Glin Trp Thr Ala Gly Met Gly Lieu. Leu Met Ala 35 4 O 45 Lieu. Ile Val Lieu. Lieu. Ile Val Ala Gly Asn Val Lieu Val Ile Val Ala SO 55 6 O Ile Ala Lys Thr Pro Arg Lieu Gln Thr Lieu. Thir Asn Lieu Phe Ile Met 65 70 7s 8O Ser Lieu Ala Ser Ala Asp Lieu Val Met Gly Lieu. Lieu Val Val Pro Phe 85 90 95 Gly Ala Thir Ile Val Val Trp Gly Arg Trp Glu Tyr Gly Ser Phe Phe 1OO 105 11 O Cys Glu Lieu. Trp Thr Ser Val Asp Val Lieu. Cys Val Thr Ala Ser Ile 115 12 O 125 Glu Thir Lieu. CyS Val Ile Ala Lieu. Asp Arg Tyr Lieu Ala Ile Thir Ser 13 O 135 14 O Pro Phe Arg Tyr Glin Ser Lieu. Lieu. Thir Arg Ala Arg Ala Arg Gly Lieu. 145 150 155 160 Val Cys Thr Val Trp Ala Ile Ser Ala Leu Val Ser Phe Leu Pro Ile 1.65 17O 17s Lieu Met His Trp Trp Arg Ala Glu Ser Asp Glu Ala Arg Arg Cys Tyr 18O 185 19 O Asn Asp Pro Llys Cys Cys Asp Phe Val Thr Asn Arg Ala Tyr Ala Ile 195 2OO 2O5 Ala Ser Ser Val Val Ser Phe Tyr Val Pro Leu. Cys Ile Met Ala Phe 21 O 215 22O
Val Tyr Lieu. Arg Val Phe Arg Glu Ala Glin Lys Glin Val Lys Lys Ile 225 23 O 235 24 O
Asp Arg Ala Gly Lys Arg Arg Pro Ser Arg Lieu Val Ala Lieu Lys Glu 245 250 255
Glin Lys Ala Lieu Lys Thr Lieu. Gly Ile Ile Met Gly Val Phe Thr Lieu. 26 O 265 27 O
Cys Trp Lieu Pro Phe Phe Lieu Ala Asn Val Val Lys Ala Phe His Arg 27s 28O 285
Glu Lieu Val Pro Asp Arg Lieu Phe Val Phe Phe Asn Trp Leu Gly Tyr US 2015/0376261 A1 Dec. 31, 2015 53
- Continued
29 O 295 3 OO Ala Asn Ser Ala Phe Asn Pro Ile Ile Tyr Cys Arg Ser Pro Asp Phe 3. OS 310 315 32O Arg Lys Ala Phe Glin Arg Lieu. Lieu. Ser Ser Ala Arg Arg Ala Ala Arg 3.25 330 335 Arg Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 34 O 345 35. O Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Glin Val Glin Leu Gln Glu 355 360 365 Ser Gly Gly Gly Lieu Val Glin Ala Gly Gly Ser Lieu. Arg Lieu. Ser Cys 37 O 375 38O Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Thr Met Gly Trp Tyr Arg 385 390 395 4 OO Glin Ala Pro Gly Lys Glin Arg Glu Lieu Val Ala Ala Ile His Ser Gly 4 OS 41O 415 Gly Ser Thr Asn Tyr Ala Asn Ser Val Lys Gly Arg Phe Thr Ile Ser 42O 425 43 O Arg Asp Asn Ala Ala Asn Thr Val Tyr Lieu Gln Met Asn. Ser Lieu Lys 435 44 O 445 Pro Glu Asp Thir Ala Val Tyr Tyr Cys Asn. Wall Lys Asp Tyr Gly Ala 450 45.5 460 Val Lieu. Tyr Glu Tyr Asp Tyr Trp Gly Glin Gly Thr Glin Val Thr Val 465 470 475 48O
Ser Ser His His His His His His 485
<210s, SEQ ID NO 8 &211s LENGTH: 492 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion <4 OOs, SEQUENCE: 8 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Glu Asn Lieu. Tyr Phe Glin Gly Pro 2O 25 3O Glu Pro Leu Ser Glin Glin Trp Thr Ala Gly Met Gly Lieu. Leu Met Ala 35 4 O 45 Lieu. Ile Val Lieu. Lieu. Ile Val Ala Gly Asn Val Lieu Val Ile Val Ala SO 55 6 O Ile Ala Lys Thr Pro Arg Lieu Gln Thr Lieu. Thr Asn Lieu. Phe Ile Met 65 70 7s 8O
Ser Lieu Ala Ser Ala Asp Lieu Val Met Gly Lieu. Lieu Val Val Pro Phe 85 90 95
Gly Ala Thir Ile Val Val Trp Gly Arg Trp Glu Tyr Gly Ser Phe Phe 1OO 105 11 O
Cys Glu Lieu. Trp Thr Ser Val Asp Val Lieu. Cys Val Thr Ala Ser Ile 115 12 O 125
Glu Thir Lieu. CyS Val Ile Ala Lieu. Asp Arg Tyr Lieu Ala Ile Thir Ser 13 O 135 14 O
Pro Phe Arg Tyr Glin Ser Lieu. Lieu. Thir Arg Ala Arg Ala Arg Gly Lieu. US 2015/0376261 A1 Dec. 31, 2015 54
- Continued
145 150 155 160 Val Cys Thr Val Trp Ala Ile Ser Ala Leu Val Ser Phe Leu Pro Ile 1.65 17O 17s Lieu Met His Trp Trp Arg Ala Glu Ser Asp Glu Ala Arg Arg Cys Tyr 18O 185 19 O Asn Asp Pro Llys Cys Cys Asp Phe Val Thr Asn Arg Ala Tyr Ala Ile 195 2OO 2O5 Ala Ser Ser Val Val Ser Phe Tyr Val Pro Leu. Cys Ile Met Ala Phe 21 O 215 22O Val Tyr Lieu. Arg Val Phe Arg Glu Ala Glin Lys Glin Val Lys Lys Ile 225 23 O 235 24 O Asp Arg Ala Gly Lys Arg Arg Pro Ser Arg Lieu Val Ala Lieu Lys Glu 245 250 255 Glin Lys Ala Lieu Lys Thr Lieu. Gly Ile Ile Met Gly Val Phe Thr Lieu. 26 O 265 27 O Cys Trp Lieu Pro Phe Phe Lieu Ala Asn Val Val Lys Ala Phe His Arg 27s 28O 285 Glu Lieu Val Pro Asp Arg Lieu Phe Val Phe Phe Asn Trp Leu Gly Tyr 29 O 295 3 OO Ala Asn Ser Ala Phe Asn Pro Ile Ile Tyr Cys Arg Ser Pro Asp Phe 3. OS 310 315 32O Arg Lys Ala Phe Glin Arg Lieu. Lieu. Ser Ser Ala Arg Arg Ala Ala Arg 325 330 335 Arg Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 34 O 345 35. O Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Glin Val Glin Leu Gln Glu 355 360 365 Ser Gly Gly Gly Lieu Val Glin Ala Gly Gly Ser Lieu. Arg Lieu. Ser Cys 37 O 375 38O Thr Ala Ser Gly Lieu. Thir Lieu Ser Asn Tyr Ala Met Gly Trp Phe Arg 385 390 395 4 OO Glin Ala Pro Gly Lys Glu Arg Glu Phe Val Ala Ala Asp Thir Trp Asn 4 OS 41O 415 Gly Asn Thr Tyr His Glin Asp Ser Val Lys Gly Arg Phe Thr Ile Ser 42O 425 43 O Arg Asp Asn Ala Lys Asn Thr Val Tyr Lieu Gln Met Asn Tyr Lieu Lys 435 44 O 445 Pro Glu Asp Thir Ala Val Tyr Tyr Cys Ala Ala Arg Gly Ser Arg Arg 450 45.5 460 Ser Ala Tyr Tyr Ser Ser Ser Asp Tyr Thr Tyr Arg Gly Glin Gly Thr 465 470 47s 48O
Glin Wall Thir Wal Ser Ser His His His His His His 485 490
<210s, SEQ ID NO 9 &211s LENGTH: 550 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion
<4 OOs, SEQUENCE: 9 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala US 2015/0376261 A1 Dec. 31, 2015 55
- Continued
1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Met Ala Pro Thr Asn Ala Ser Asn 2O 25 3O Cys Thr Asp Ala Lieu Ala Tyr Ser Ser Cys Ser Pro Ala Pro Ser Pro 35 4 O 45 Gly Ser Trp Val Asn Lieu. Ser His Lieu. Asp Gly Asn Lieu. Ser Asp Pro SO 55 6 O Cys Gly Pro Asn Arg Thr Asp Lieu. Gly Gly Arg Asp Ser Lieu. Cys Pro 65 70 7s 8O Pro Thr Gly Ser Pro Ser Met Ile Thr Ala Ile Thr Ile Met Ala Leu 85 90 95 Tyr Ser Ile Val Cys Val Val Gly Lieu Phe Gly Asn Phe Leu Val Met 1OO 105 11 O Tyr Val Ile Val Arg Tyr Thr Lys Met Lys Thr Ala Thr Asn Ile Tyr 115 12 O 125 Ile Phe Asn Lieu Ala Lieu Ala Asp Ala Lieu Ala Thir Ser Thr Lieu Pro 13 O 135 14 O Phe Glin Ser Val Asn Tyr Lieu Met Gly. Thir Trp Pro Phe Gly. Thir Ile 145 150 155 160 Lieu. Cys Lys Ile Val Ile Ser Ile Asp Tyr Tyr Asn Met Phe Thir Ser 1.65 17O 17s Ile Phe Thr Lieu. Cys Thr Met Ser Val Asp Arg Tyr Ile Ala Val Cys 18O 185 19 O His Pro Wall Lys Ala Lieu. Asp Phe Arg Thr Pro Arg Asn Ala Lys Ile 195 2OO 2O5 Ile Asin Val Cys Asn Trp Ile Lieu. Ser Ser Ala Ile Gly Lieu Pro Val 21 O 215 22O Met Phe Met Ala Thr Thr Lys Tyr Arg Glin Gly Ser Ile Asp Cys Thr 225 23 O 235 24 O Lieu. Thir Phe Ser His Pro Thr Trp Tyr Trp Glu Asn Lieu. Leu Lys Ile 245 250 255 Cys Val Phe Ile Phe Ala Phe Ile Met Pro Val Lieu. Ile Ile Thr Val 26 O 265 27 O Cys Tyr Gly Lieu Met Ile Lieu. Arg Lieu Lys Ser Val Arg Met Lieu. Ser 27s 28O 285 Gly Ser Lys Glu Lys Asp Arg Asn Lieu. Arg Arg Ile Thr Arg Met Val 29 O 295 3 OO Lieu Val Val Val Ala Val Phe Ile Val Cys Trp Thr Pro Ile His Ile 3. OS 310 315 32O Tyr Val Ile Ile Lys Ala Leu Val Thir Ile Pro Glu Thir Thr Phe Glin 3.25 330 335 Thr Val Ser Trp His Phe Cys Ile Ala Leu Gly Tyr Thr Asn Ser Cys 34 O 345 35. O
Lieu. Asn Pro Val Lieu. Tyr Ala Phe Lieu. Asp Glu Asn. Phe Lys Arg Cys 355 360 365
Phe Arg Glu Phe Cys Ile Pro Thr Ser Ser Asn Ile Lieu. Glu Val Lieu. 37 O 375 38O
Phe Glin Gly Pro Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 385 390 395 4 OO Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 4 OS 41O 415 US 2015/0376261 A1 Dec. 31, 2015 56
- Continued
Gly Ser Gly Gly Gly Ser Glin Val Glin Leu Gln Glu Ser Gly Gly Gly 42O 425 43 O Lieu Val Arg Pro Gly Gly Ser Arg Arg Lieu. Ser Cys Val Asp Ser Glu 435 44 O 445 Arg Thr Ser Tyr Pro Met Gly Trp Phe Arg Arg Ala Pro Gly Lys Glu 450 45.5 460 Arg Glu Phe Val Ala Ser Ile Thr Trp Ser Gly Ile Asp Pro Thr Tyr 465 470 47s 48O Ala Asp Ser Val Ala Asp Arg Phe Thir Ile Ser Arg Asp Val Ala Asn 485 490 495 Asn. Thir Lieu. Tyr Lieu Gln Met Asn. Ser Lieu Lys His Glu Asp Thir Ala SOO 505 51O Val Tyr Tyr Cys Ala Ala Arg Ala Pro Val Gly Glin Ser Ser Ser Pro 515 52O 525 Tyr Asp Tyr Asp Tyr Trp Gly Glin Gly Thr Glin Val Thr Val Ser Ser 53 O 535 54 O
His His His His His His 5.45 550
<210s, SEQ ID NO 10 &211s LENGTH: 555 212. TYPE: PRT <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: GPCR-Nanobody fusion
<4 OOs, SEQUENCE: 10 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Met Ala Pro Thr Asn Ala Ser Asn 2O 25 3O Cys Thr Asp Ala Lieu Ala Tyr Ser Ser Cys Ser Pro Ala Pro Ser Pro 35 4 O 45 Gly Ser Trp Val Asn Lieu. Ser His Lieu. Asp Gly Asn Lieu. Ser Asp Pro SO 55 6 O Cys Gly Pro Asn Arg Thr Asp Lieu. Gly Gly Arg Asp Ser Lieu. Cys Pro 65 70 7s 8O Pro Thr Gly Ser Pro Ser Met Ile Thr Ala Ile Thr Ile Met Ala Leu 85 90 95 Tyr Ser Ile Val Cys Val Val Gly Lieu Phe Gly Asn Phe Leu Val Met 1OO 105 11 O Tyr Val Ile Val Arg Tyr Thr Lys Met Lys Thr Ala Thr Asn Ile Tyr 115 12 O 125
Ile Phe Asn Lieu Ala Lieu Ala Asp Ala Lieu Ala Thir Ser Thr Lieu Pro 13 O 135 14 O
Phe Glin Ser Val Asn Tyr Lieu Met Gly. Thir Trp Pro Phe Gly. Thir Ile 145 150 155 160
Lieu. Cys Lys Ile Val Ile Ser Ile Asp Tyr Tyr Asn Met Phe Thir Ser 1.65 17O 17s
Ile Phe Thr Lieu. Cys Thr Met Ser Val Asp Arg Tyr Ile Ala Val Cys 18O 185 19 O His Pro Wall Lys Ala Lieu. Asp Phe Arg Thr Pro Arg Asn Ala Lys Ile 195 2OO 2O5 US 2015/0376261 A1 Dec. 31, 2015 57
- Continued
Ile Asn Wall Cys Asn Trp Ile Luell Ser Ser Ala Ile Gly Luell Pro Wall 21 O 215
Met Phe Met Ala Thir Thir Arg Glin Gly Ser Ile Asp Thir 225 23 O 235 24 O
Lell Thir Phe Ser His Pro Thir Trp Trp Glu Asn Lell Luell Lys Ile 245 250 255
Wall Phe Ile Phe Ala Phe Ile Met Pro Wall Lell Ile Ile Thir Wall 26 O 265 27 O
Gly Luell Met Ile Lell Arg Luell Ser Wall Arg Met Luell Ser 285
Gly Ser Glu Asp Arg Asn Luell Arg Arg Ile Thir Arg Met Wall 29 O 295 3 OO
Lell Wall Wall Wall Ala Wall Phe Ile Wall Cys Trp Thir Pro Ile His Ile 3. OS 310 315
Wall Ile Ile Lys Ala Lell Wall Thir Ile Pro Glu Thir Thir Phe Glin 3.25 330 335
Thir Wall Ser Trp His Phe Ile Ala Luell Gly Tyr Thir Asn Ser 34 O 345 35. O
Lell Asn Pro Wall Lell Tyr Ala Phe Luell Asp Glu Asn Phe Arg 355 360 365
Phe Arg Glu Phe Ile Pro Thir Ser Ser ASn Ile Lell Glu Wall Luell 37 O 375
Phe Glin Gly Pro Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 385 390 395 4 OO
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 4 OS 415
Gly Ser Gly Gly Gly Ser Glin Wall Glin Luell Glin Glu Ser Gly Gly Gly 425 43 O
Lell Wall Glin Pro Gly Gly Ser Luell Arg Luell Ser Ala Ala Ser Gly 435 44 O 445
Ser Phe Arg Ser Ile Wall Ser Met Ala Trp Arg Glin Ala Pro Gly 450 45.5 460
Lys Glin Arg Glu Lell Wall Ala Ser Ser Asn Ser Gly Gly Ser Thir Asn 465 470
Ala Asp Ser Wall Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala 485 490 495
Asn Thir Wall Tyr Lell Glin Met Asn Ser Luell Pro Glu Asp Thir SOO 505
Ala Wall Tyr Trp Asn Wall Glin Asn Arg Luell Pro Gly Phe Asp Ala 515 525
Phe Ser Gly Arg Ser Ile Ala Glu Thir Tyr Trp Gly Glin Gly Thir Glin 53 O 535 54 O
Wall Thir Wall Ser Ser His His His His His His 5.45 550 555
SEQ ID NO 11 LENGTH: 548 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: GPCR-Nanobody fusion
SEQUENCE: 11 US 2015/0376261 A1 Dec. 31, 2015 58
- Continued
Met Thir Ile Ile Ala Lell Ser Ile Phe Cys Lell Wall Phe Ala 1O 15
Asp Asp Asp Asp Ala Met Gly Pro Gly Asn Ile Ser Asp 25
Ser Asp Pro Lell Ala Pro Ala Ser Ser Pro Ala Pro Gly Ser 35 4 O 45
Trp Luell Asn Luell Ser His Wall Asp Gly Asn Glin Ser Asp Pro Gly SO 55 6 O
Pro Asn Arg Thir Gly Lell Gly Gly Ser His Ser Lell Pro Glin Thir 65 70
Gly Ser Pro Ser Met Wall Thir Ala Ile Thir Ile Met Ala Luell Tyr Ser 85 90 95
Ile Wall Wall Wall Gly Lell Phe Gly Asn Phe Lell Wall Met Wall 105 11 O
Ile Wall Arg Thir Met Lys Thir Ala Thir Asn Ile Ile Phe 115 12 O 125
Asn Luell Ala Luell Ala Asp Ala Luell Ala Thir Ser Thir Lell Pro Phe Glin 13 O 135 14 O
Ser Wall Asn Tyr Lell Met Gly Thir Trp Pro Phe Gly Asn Ile Luell Cys 145 150 155 160
Ile Wall Ile Ser Ile Asp Asn Met Phe Thir Ser Ile Phe 1.65 17O 17s
Thir Luell Thir Met Ser Wall Asp Arg Ile Ala Wall Cys His Pro 18O 185 19 O
Wall Ala Luell Asp Phe Arg Thir Pro Arg ASn Ala Lys Ile Wall Asn 195
Wall Cys Asn Trp Ile Lell Ser Ser Ala Ile Gly Lell Pro Wall Met Phe 21 O 215
Met Ala Thir Thir Tyr Arg Glin Gly Ser Ile Asp Thir Luell Thir 225 23 O 235 24 O
Phe Ser His Pro Thir Trp Trp Glu Asn Luell Lell Ile Cys Wall 245 250 255
Phe Ile Phe Ala Phe Ile Met Pro Wall Luell Ile Ile Thir Wall Tyr 26 O 265 27 O
Gly Luell Met Ile Lell Arg Lell Lys Ser Wall Arg Met Lell Ser Gly Ser 285
Glu Asp Arg Asn Lell Arg Arg Ile Thir Arg Met Wall Luell Wall 29 O 295 3 OO
Wall Wall Ala Wall Phe Ile Wall Trp Thir Pro Ile His Ile Wall 3. OS 310 315
Ile Ile Ala Lell Ile Thir Ile Pro Glu Thir Thir Phe Glin Thir Wall 3.25 330 335
Ser Trp His Phe Ile Ala Luell Gly Tyr Thir Asn Ser Cys Luell Asn 34 O 345 35. O
Pro Wall Luell Tyr Ala Phe Lell Asp Glu Asn Phe Arg Phe Arg 355 360 365
Glu Phe Ile Pro Thir Ser Ser Thir Ile Luell Glu Wall Luell Phe Glin 37 O 375 38O
Gly Pro Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 385 390 395 4 OO US 2015/0376261 A1 Dec. 31, 2015 59
- Continued Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 4 OS 41O 415 Gly Gly Gly Ser Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val 42O 425 43 O Arg Pro Gly Gly Ser Arg Arg Lieu. Ser Cys Val Asp Ser Glu Arg Thr 435 44 O 445 Ser Tyr Pro Met Gly Trp Phe Arg Arg Ala Pro Gly Lys Glu Arg Glu 450 45.5 460 Phe Val Ala Ser Ile Thir Trp Ser Gly Ile Asp Pro Thr Tyr Ala Asp 465 470 47s 48O Ser Val Ala Asp Arg Phe Thir Ile Ser Arg Asp Val Ala Asn. Asn Thr 485 490 495 Lieu. Tyr Lieu Gln Met Asn. Ser Lieu Lys His Glu Asp Thr Ala Val Tyr SOO 505 51O Tyr Cys Ala Ala Arg Ala Pro Val Gly Glin Ser Ser Ser Pro Tyr Asp 515 52O 525 Tyr Asp Tyr Trp Gly Glin Gly Thr Glin Val Thr Val Ser Ser His His 53 O 535 54 O
His His His His 5.45
<210s, SEQ ID NO 12 &211s LENGTH: 553 212. TYPE PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GPCR-Nanobody fusion <4 OOs, SEQUENCE: 12 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15 Asp Tyr Lys Asp Asp Asp Asp Ala Met Gly Pro Gly Asn. Ile Ser Asp 2O 25 3O Cys Ser Asp Pro Leu Ala Pro Ala Ser Cys Ser Pro Ala Pro Gly Ser 35 4 O 45 Trp Lieu. Asn Lieu. Ser His Val Asp Gly Asn Glin Ser Asp Pro Cys Gly SO 55 6 O Pro Asn Arg Thr Gly Lieu. Gly Gly Ser His Ser Lieu. Cys Pro Gln Thr 65 70 7s 8O Gly Ser Pro Ser Met Val Thr Ala Ile Thr Ile Met Ala Lieu. Tyr Ser 85 90 95 Ile Val Cys Val Val Gly Lieu Phe Gly Asn Phe Leu Val Met Tyr Val 1OO 105 11 O Ile Val Arg Tyr Thr Lys Met Lys Thr Ala Thr Asn Ile Tyr Ile Phe 115 12 O 125
Asn Lieu Ala Lieu Ala Asp Ala Lieu Ala Thir Ser Thr Lieu Pro Phe Glin 13 O 135 14 O
Ser Val Asn Tyr Lieu Met Gly. Thir Trp Pro Phe Gly Asn Ile Lieu. Cys 145 150 155 160
Lys Ile Val Ile Ser Ile Asp Tyr Tyr Asn Met Phe Thr Ser Ile Phe 1.65 17O 17s Thr Lieu. Cys Thr Met Ser Val Asp Arg Tyr Ile Ala Val Cys His Pro 18O 185 19 O US 2015/0376261 A1 Dec. 31, 2015 60
- Continued Val Lys Ala Lieu. Asp Phe Arg Thr Pro Arg Asn Ala Lys Ile Val Asn 195 2OO 2O5 Val Cys Asn Trp Ile Leu Ser Ser Ala Ile Gly Lieu Pro Val Met Phe 21 O 215 22O Met Ala Thir Thr Lys Tyr Arg Glin Gly Ser Ile Asp Cys Thr Lieu. Thr 225 23 O 235 24 O Phe Ser His Pro Thr Trp Tyr Trp Glu Asn Lieu Lleu Lys Ile Cys Val 245 250 255 Phe Ile Phe Ala Phe Ile Met Pro Val Lieu. Ile Ile Thr Val Cys Tyr 26 O 265 27 O Gly Lieu Met Ile Lieu. Arg Lieu Lys Ser Val Arg Met Lieu. Ser Gly Ser 27s 28O 285 Lys Glu Lys Asp Arg Asn Lieu. Arg Arg Ile Thr Arg Met Val Lieu Val 29 O 295 3 OO Val Val Ala Val Phe Ile Val Cys Trp Thr Pro Ile His Ile Tyr Val 3. OS 310 315 32O Ile Ile Lys Ala Lieu. Ile Thr Ile Pro Glu Thir Thr Phe Glin Thr Val 3.25 330 335 Ser Trp His Phe Cys Ile Ala Leu Gly Tyr Thr Asn Ser Cys Lieu. Asn 34 O 345 35. O Pro Val Lieu. Tyr Ala Phe Lieu. Asp Glu Asn. Phe Lys Arg Cys Phe Arg 355 360 365 Glu Phe Cys Ile Pro Thr Ser Ser Thr Ile Lieu. Glu Val Lieu Phe Glin 37 O 375 38O Gly Pro Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 385 390 395 4 OO Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 4 OS 41O 415 Gly Gly Gly Ser Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val 42O 425 43 O Glin Pro Gly Gly Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Ser Phe 435 44 O 445 Arg Ser Ile Val Ser Met Ala Trp Tyr Arg Glin Ala Pro Gly Lys Glin 450 45.5 460 Arg Glu Lieu Val Ala Ser Ser Asn. Ser Gly Gly Ser Thr Asn Tyr Ala 465 470 47s 48O Asp Ser Val Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Lys Asn 485 490 495 Thr Val Tyr Lieu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val SOO 505 51O Tyr Trp Cys Asn Val Glin Asn Arg Lieu Pro Gly Phe Asp Ala Phe Ser 515 52O 525
Gly Arg Ser Ile Ala Glu Thir Tyr Trp Gly Glin Gly Thr Glin Val Thr 53 O 535 54 O
Wal Ser Ser His His His His His His 5.45 550
<210s, SEQ ID NO 13 &211s LENGTH: 120 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No.8O US 2015/0376261 A1 Dec. 31, 2015 61
- Continued
<4 OOs, SEQUENCE: 13 Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Glin Ala Gly Gly 1. 5 1O 15 Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn 2O 25 3O Thir Met Gly Trp Tyr Arg Glin Ala Pro Gly Lys Glin Arg Glu Lieu Val 35 4 O 45 Ala Ala Ile His Ser Gly Gly Ser Thr Asn Tyr Ala Asn. Ser Val Lys SO 55 6 O Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Ala Asn Thr Val Tyr Lieu. 65 70 7s 8O Gln Met Asn Ser Lieu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Val Lys Asp Tyr Gly Ala Val Lieu. Tyr Glu Tyr Asp Tyr Trp Gly Glin 1OO 105 11 O Gly Thr Glin Val Thr Val Ser Ser 115 12 O
<210s, SEQ ID NO 14 &211s LENGTH: 116 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No f1
<4 OOs, SEQUENCE: 14 Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Glin Pro Gly Gly 1. 5 1O 15 Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr 2O 25 3O Glu Lieu. Arg Trip Tyr Arg Glin Ala Pro Gly Lys Glin His Glu Lieu Val 35 4 O 45 Ala Gly Ile Thr Thr Gly Gly Asn Thr Tyr Tyr Ala Asp Ser Val Lys SO 55 6 O Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Lieu. 65 70 7s 8O Glin Met Ser Asn Lieu. Arg Pro Glu Asp Thir Ala Val Tyr Ala Cys Asn 85 90 95 Ala Asn Trp Asp Lieu Lleu Ser Asp Tyr Trp Gly Glin Gly Thr Glin Val 1OO 105 11 O
Thir Wal Ser Ser 115
<210s, SEQ ID NO 15 &211s LENGTH: 124 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No 69
<4 OOs, SEQUENCE: 15 Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Glin Ala Gly Gly 1. 5 1O 15
Ser Lieu. Arg Lieu. Ser Cys Thr Ala Ser Gly Lieu. Thir Lieu. Ser Asn Tyr 2O 25 3O US 2015/0376261 A1 Dec. 31, 2015 62
- Continued
Ala Met Gly Trp Phe Arg Glin Ala Pro Gly Lys Glu Arg Glu Phe Val 35 4 O 45 Ala Ala Asp Thir Trp Asn Gly Asn. Thir Tyr His Glin Asp Ser Val Lys SO 55 6 O Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Lieu. 65 70 7s 8O Gln Met Asn Tyr Lieu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Arg Gly Ser Arg Arg Ser Ala Tyr Tyr Ser Ser Ser Asp Tyr Thr 1OO 105 11 O Tyr Arg Gly Glin Gly Thr Glin Val Thr Val Ser Ser 115 12 O
<210s, SEQ ID NO 16 &211s LENGTH: 121 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No.9 - 1
<4 OOs, SEQUENCE: 16 Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Glin Ala Gly Gly 1. 5 1O 15 Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly His Thr Phe Ser Ser Ala 2O 25 30 Arg Met Tyr Trp Val Arg Glin Ala Pro Gly Lys Glu Arg Glu Phe Val 35 4 O 45 Ala Ala Ile Ser Arg Ser Gly Phe Thr Tyr Ser Ala Asp Ser Val Lys SO 55 6 O Gly Arg Phe Thir Ile Ser Arg Asp Ile Ala Asn. Asn Thr Val Tyr Lieu. 65 70 7s 8O Gln Met Asn Ser Lieu. Glin Pro Glu Asp Thr Ala Ile Tyr Thr Cys Tyr 85 90 95 Ala Ala Tyr Lieu. Asp Glu Phe Tyr Asn Asp Tyr Thr His Tyr Trp Gly 1OO 105 11 O Lieu. Gly Thr Glin Val Thr Val Ser Ser 115 12 O
<210s, SEQ ID NO 17 &211s LENGTH: 121 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No.9 - 8
<4 OOs, SEQUENCE: 17 Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Glin Ala Gly Asp 1. 5 1O 15
Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Phe Asp Phe Asp Asn. Phe 2O 25 3O
Asp Asp Tyr Ala Ile Gly Trp Phe Arg Glin Ala Pro Gly Glin Glu Arg 35 4 O 45
Glu Gly Val Ser Cys Ile Asp Pro Ser Asp Gly Ser Thr Ile Tyr Ala SO 55 6 O
Asp Ser Ala Lys Gly Arg Phe Thir Ile Ser Ser Asp Asn Ala Glu Asn US 2015/0376261 A1 Dec. 31, 2015 63
- Continued
Thr Val Tyr Lieu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val 85 90 95 Tyr Val Cys Ser Ala Trp Thr Lieu Phe His Ser Asp Glu Tyr Trp Gly 1OO 105 11 O Gln Gly Thr Glin Val Thr Val Ser Ser 115 12 O
<210s, SEQ ID NO 18 &211s LENGTH: 119 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No 60
<4 OOs, SEQUENCE: 18 Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Glin Ala Gly Gly 1. 5 1O 15 Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Lieu. Asn 2O 25 3O Asp Met Gly Trp Tyr Arg Glin Ala Pro Gly Lys Lieu. Arg Glu Lieu Val 35 4 O 45 Ala Ala Ile Thir Ser Gly Gly Ser Thir Lys Tyr Ala Asp Ser Val Lys SO 55 6 O Gly Arg Phe Thir Ile Ser Arg Asp ASn Ala Lys Asn Thr Val Tyr Lieu 65 70 7s 8O Glin Met Asn. Ser Lieu Lys Ala Glu Asp Thir Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Lys Val Ala Gly Thr Phe Ser Ile Tyr Asp Tyr Trp Gly Glin Gly 1OO 105 11 O
Thir Glin Wall. Thir Wal Ser Ser 115
<210s, SEQ ID NO 19 &211s LENGTH: 122 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No.33
<4 OOs, SEQUENCE: 19 Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Arg Pro Gly Gly 1. 5 1O 15 Ser Arg Arg Lieu Ser Cys Val Asp Ser Glu Arg Thr Ser Tyr Pro Met 2O 25 3O Gly Trp Phe Arg Arg Ala Pro Gly Lys Glu Arg Glu Phe Val Ala Ser 35 4 O 45
Ile Thir Trp Ser Gly Ile Asp Pro Thr Tyr Ala Asp Ser Val Ala Asp SO 55 6 O
Arg Phe Thir Ile Ser Arg Asp Val Ala Asn. Asn. Thir Lieu. Tyr Lieu. Glin 65 70 7s 8O Met Asn. Ser Lieu Lys His Glu Asp Thir Ala Val Tyr Tyr Cys Ala Ala 85 90 95
Arg Ala Pro Val Gly Glin Ser Ser Ser Pro Tyr Asp Tyr Asp Tyr Trp 1OO 105 11 O US 2015/0376261 A1 Dec. 31, 2015 64
- Continued
Gly Glin Gly Thr Glin Val Thr Val Ser Ser 115 12 O
<210s, SEQ ID NO 2 O &211s LENGTH: 127 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: No.10
<4 OOs, SEQUENCE: 2O Glin Val Glin Lieu. Glin Glu Ser Gly Gly Gly Lieu Val Glin Pro Gly Gly 1. 5 1O 15 Ser Lieu. Arg Lieu. Ser Cys Ala Ala Ser Gly Ser Phe Arg Ser Ile Val 2O 25 3O Ser Met Ala Trp Tyr Arg Glin Ala Pro Gly Lys Glin Arg Glu Lieu Val 35 4 O 45 Ala Ser Ser Asn. Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys SO 55 6 O Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Lieu. 65 70 7s 8O Glin Met Asn. Ser Lieu Lys Pro Glu Asp Thir Ala Val Tyr Trp Cys Asn 85 90 95 Val Glin Asn Arg Lieu Pro Gly Phe Asp Ala Phe Ser Gly Arg Ser Ile 1OO 105 11 O Ala Glu Thir Tyr Trp Gly Glin Gly Thr Glin Val Thr Val Ser Ser 115 12 O 125
<210s, SEQ ID NO 21 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1 No8O
<4 OOs, SEQUENCE: 21 Gly Ser Ile Phe Ser Ile Asn Thr 1. 5
<210s, SEQ ID NO 22 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1 No71
<4 OOs, SEQUENCE: 22 Gly Phe Ala Phe Ser Ser Tyr Glu 1. 5
<210s, SEQ ID NO 23 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1. No 69
<4 OOs, SEQUENCE: 23 Gly Lieu. Thir Lieu. Ser Asn Tyr Ala 1. 5 US 2015/0376261 A1 Dec. 31, 2015 65
- Continued
<210s, SEQ ID NO 24 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1 No-1
<4 OOs, SEQUENCE: 24 Gly His Thr Phe Ser Ser Ala Arg 1. 5
<210s, SEQ ID NO 25 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1 NS-8
<4 OOs, SEQUENCE: 25 Gly Phe Asp Phe Asp Asn. Phe Asp Asp Tyr Ala 1. 5 1O
<210s, SEQ ID NO 26 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1. No 60
<4 OOs, SEQUENCE: 26 Gly Ser Ile Phe Ser Lieu. Asn Asp 1. 5
<210s, SEQ ID NO 27 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1 No.33
<4 OOs, SEQUENCE: 27 Glu Arg Thr Ser Tyr Pro 1. 5
<210s, SEQ ID NO 28 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR1 N10
<4 OOs, SEQUENCE: 28 Gly Ser Phe Arg Ser Ile Val Ser 1. 5
<210s, SEQ ID NO 29 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR2 No8O
<4 OOs, SEQUENCE: 29 Ile His Ser Gly Gly Ser Thr US 2015/0376261 A1 Dec. 31, 2015 66
- Continued
<210s, SEQ ID NO 3 O &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR2 No71
<4 OOs, SEQUENCE: 30 Ile Thir Thr Gly Gly Asn Thr 1. 5
<210s, SEQ ID NO 31 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR2 No 69
<4 OOs, SEQUENCE: 31 Asp Thir Trp Asn Gly Asn Thr 1. 5
<210s, SEQ ID NO 32 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence & 22 O FEATURE; 223 OTHER INFORMATION: CDR2 No-1
<4 OOs, SEQUENCE: 32 Ile Ser Arg Ser Gly Phe Thr 1. 5
<210s, SEQ ID NO 33 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR2 NoC-8
<4 OOs, SEQUENCE: 33 Ile Asp Pro Ser Asp Gly Ser Thr 1. 5
<210s, SEQ ID NO 34 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR2 No. 60
<4 OOs, SEQUENCE: 34 Ile Thr Ser Gly Gly Ser Thr 1. 5
<210s, SEQ ID NO 35 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR2 No33
<4 OOs, SEQUENCE: 35 US 2015/0376261 A1 Dec. 31, 2015 67
- Continued
Ile Thir Trp Ser Gly Ile Asp Pro 1. 5
<210s, SEQ ID NO 36 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR2 N10
<4 OOs, SEQUENCE: 36 Ser Asn Ser Gly Gly Ser Thr 1. 5
<210s, SEQ ID NO 37 &211s LENGTH: 14 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 No8O
<4 OO > SEQUENCE: 37 Asn. Wall Lys Asp Tyr Gly Ala Val Lieu. Tyr Glu Tyr Asp Tyr 1. 5
<210s, SEQ ID NO 38 &211s LENGTH: 10 212. TYPE PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 No71
<4 OOs, SEQUENCE: 38 Asn Ala Asn Trp Asp Lieu Lleu Ser Asp Tyr 1. 5 1O
<210s, SEQ ID NO 39 &211s LENGTH: 18 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 No 69
<4 OOs, SEQUENCE: 39 Ala Ala Arg Gly Ser Arg Arg Ser Ala Tyr Tyr Ser Ser Ser Asp Tyr 1. 5 15 Thr Tyr
<210s, SEQ ID NO 4 O &211s LENGTH: 15 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 NC-1
<4 OOs, SEQUENCE: 4 O Tyr Ala Ala Tyr Lieu. Asp Glu Phe Tyr Asn Asp Tyr Thr His Tyr 1. 5 15
<210s, SEQ ID NO 41 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Artificial Sequence US 2015/0376261 A1 Dec. 31, 2015 68
- Continued
22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 NS-8
<4 OOs, SEQUENCE: 41 Ser Ala Trp Thr Lieu. Phe His Ser Asp Glu Tyr 1. 5 1O
<210s, SEQ ID NO 42 &211s LENGTH: 13 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 No 60
<4 OOs, SEQUENCE: 42 Asn Ala Lys Val Ala Gly Thr Phe Ser Ile Tyr Asp Tyr 1. 5 1O
<210s, SEQ ID NO 43 &211s LENGTH: 17 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 No33
<4 OOs, SEQUENCE: 43 Ala Ala Arg Ala Pro Val Gly Glin Ser Ser Ser Pro Tyr Asp Tyr Asp 1. 5 1O 15 Tyr
<210s, SEQ ID NO 44 &211s LENGTH: 21 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: CDR3 N10
<4 OOs, SEQUENCE: 44 Asn Val Glin Asn Arg Lieu Pro Gly Phe Asp Ala Phe Ser Gly Arg Ser 1. 5 1O 15 Ile Ala Glu Thr Tyr 2O
<210s, SEQ ID NO 45 &211s LENGTH: 398 212. TYPE: PRT <213s ORGANISM: Mus musculus
<4 OOs, SEQUENCE: 45 Met Asp Ser Ser Ala Gly Pro Gly Asn. Ile Ser Asp Cys Ser Asp Pro 1. 5 1O 15
Lieu Ala Pro Ala Ser Cys Ser Pro Ala Pro Gly Ser Trp Lieu. Asn Lieu. 2O 25 3O Ser His Val Asp Gly Asn Glin Ser Asp Pro Cys Gly Pro Asn Arg Thr 35 4 O 45 Gly Lieu. Gly Gly Ser His Ser Lieu. Cys Pro Gln Thr Gly Ser Pro Ser SO 55 6 O
Met Val Thr Ala Ile Thr Ile Met Ala Leu Tyr Ser Ile Val Cys Val 65 70 7s 8O
Val Gly Lieu Phe Gly Asn Phe Leu Val Met Tyr Val Ile Val Arg Tyr US 2015/0376261 A1 Dec. 31, 2015 69
- Continued
85 90 95 Thr Lys Met Lys Thr Ala Thr Asn Ile Tyr Ile Phe Asn Lieu. Ala Leu 1OO 105 11 O Ala Asp Ala Leu Ala Thr Ser Thr Lieu Pro Phe Glin Ser Val Asn Tyr 115 12 O 125 Lieu Met Gly. Thir Trp Pro Phe Gly Asn Ile Lieu. Cys Lys Ile Val Ile 13 O 135 14 O Ser Ile Asp Tyr Tyr Asn Met Phe Thr Ser Ile Phe Thr Lieu. Cys Thr 145 150 155 160 Met Ser Val Asp Arg Tyr Ile Ala Val Cys His Pro Wall Lys Ala Lieu. 1.65 17O 17s Asp Phe Arg Thr Pro Arg Asn Ala Lys Ile Val Asn Val Cys Asn Trp 18O 185 19 O Ile Leu Ser Ser Ala Ile Gly Lieu Pro Val Met Phe Met Ala Thir Thr 195 2OO 2O5 Lys Tyr Arg Glin Gly Ser Ile Asp Cys Thr Lieu. Thr Phe Ser His Pro 21 O 215 22O Thir Trp Tyr Trp Glu Asn Lieu. Leu Lys Ile Cys Val Phe Ile Phe Ala 225 23 O 235 24 O Phe Ile Met Pro Val Lieu. Ile Ile Thr Val Cys Tyr Gly Leu Met Ile 245 250 255 Lieu. Arg Lieu Lys Ser Val Arg Met Lieu. Ser Gly Ser Lys Glu Lys Asp 26 O 265 27 O Arg Asn Lieu. Arg Arg Ile Thr Arg Met Val Lieu Val Val Val Ala Val 27s 28O 285 Phe Ile Val Cys Trp Thr Pro Ile His Ile Tyr Val Ile Ile Lys Ala 29 O 295 3 OO Lieu. Ile Thr Ile Pro Glu Thir Thr Phe Glin Thr Val Ser Trp His Phe 3. OS 310 315 32O Cys Ile Ala Lieu. Gly Tyr Thr Asn. Ser Cys Lieu. Asn Pro Val Lieu. Tyr 3.25 330 335 Ala Phe Lieu. Asp Glu Asn. Phe Lys Arg Cys Phe Arg Glu Phe Cys Ile 34 O 345 35. O Pro Thir Ser Ser Thr Ile Glu Gln Glin Asn Ser Ala Arg Ile Arg Glin 355 360 365 Asn Thr Arg Glu. His Pro Ser Thr Ala Asn Thr Val Asp Arg Thr Asn 37 O 375 38O
His Glin Lieu. Glu Asn Lieu. Glu Ala Glu Thir Ala Pro Lieu Pro 385 390 395
<210s, SEQ ID NO 46 &211s LENGTH: 4 OO 212. TYPE: PRT <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 46 Met Asp Ser Ser Ala Ala Pro Thr Asn Ala Ser Asn. Cys Thr Asp Ala 1. 5 1O 15
Lieu Ala Tyr Ser Ser Cys Ser Pro Ala Pro Ser Pro Gly Ser Trp Val 2O 25 3O Asn Lieu. Ser His Lieu. Asp Gly Asn Lieu. Ser Asp Pro Cys Gly Pro Asn 35 4 O 45 US 2015/0376261 A1 Dec. 31, 2015 70
- Continued Arg Thr Asp Lieu. Gly Gly Arg Asp Ser Lieu. Cys Pro Pro Thr Gly Ser SO 55 6 O Pro Ser Met Ile Thr Ala Ile Thr Ile Met Ala Lieu. Tyr Ser Ile Val 65 70 7s 8O Cys Val Val Gly Lieu. Phe Gly Asn Phe Leu Val Met Tyr Val Ile Val 85 90 95 Arg Tyr Thr Lys Met Lys Thr Ala Thr Asn Ile Tyr Ile Phe Asn Lieu. 1OO 105 11 O Ala Lieu Ala Asp Ala Lieu Ala Thir Ser Thr Lieu Pro Phe Glin Ser Val 115 12 O 125 Asn Tyr Lieu Met Gly. Thir Trp Pro Phe Gly. Thir Ile Lieu. Cys Lys Ile 13 O 135 14 O Val Ile Ser Ile Asp Tyr Tyr Asn Met Phe Thir Ser Ile Phe Thr Lieu. 145 150 155 160 Cys Thr Met Ser Val Asp Arg Tyr Ile Ala Val Cys His Pro Val Lys 1.65 17O 17s Ala Lieu. Asp Phe Arg Thr Pro Arg Asn Ala Lys Ile Ile Asin Val Cys 18O 185 19 O Asn Trp Ile Leu Ser Ser Ala Ile Gly Lieu Pro Val Met Phe Met Ala 195 2OO 2O5 Thir Thr Lys Tyr Arg Glin Gly Ser Ile Asp Cys Thr Lieu. Thr Phe Ser 21 O 215 22O His Pro Thir Trp Tyr Trp Glu ASn Lieu Lieu Lys Ile CyS Val Phe Ile 225 23 O 235 24 O Phe Ala Phe Ile Met Pro Val Lieu. Ile Ile Thr Val Cys Tyr Gly Lieu. 245 250 255 Met Ile Lieu. Arg Lieu Lys Ser Val Arg Met Lieu. Ser Gly Ser Lys Glu 26 O 265 27 O Lys Asp Arg Asn Lieu. Arg Arg Ile Thr Arg Met Val Lieu Val Val Val 27s 28O 285 Ala Val Phe Ile Val Cys Trp Thr Pro Ile His Ile Tyr Val Ile Ile 29 O 295 3 OO Lys Ala Leu Val Thr Ile Pro Glu Thir Thr Phe Glin Thr Val Ser Trp 3. OS 310 315 32O His Phe Cys Ile Ala Lieu. Gly Tyr Thr Asn Ser Cys Lieu. Asn Pro Val 3.25 330 335 Lieu. Tyr Ala Phe Lieu. Asp Glu Asn. Phe Lys Arg Cys Phe Arg Glu Phe 34 O 345 35. O Cys Ile Pro Thr Ser Ser Asn Ile Glu Glin Glin Asn Ser Thr Arg Ile 355 360 365 Arg Glin Asn. Thir Arg Asp His Pro Ser Thr Ala Asn Thr Val Asp Arg 37 O 375 38O
Thir Asn His Glin Lieu. Glu Asn Lieu. Glu Ala Glu Thir Ala Pro Lieu Pro 385 390 395 4 OO
<210s, SEQ ID NO 47 &211s LENGTH: 4 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Factor Xa cleavage site
<4 OOs, SEQUENCE: 47 US 2015/0376261 A1 Dec. 31, 2015 71
- Continued Ile Glu Gly Arg 1.
<210s, SEQ ID NO 48 &211s LENGTH: 4 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: thrombin cleavage site <4 OOs, SEQUENCE: 48 Lieu Val Pro Arg 1.
<210s, SEQ ID NO 49 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: enterokinase cleaving site <4 OOs, SEQUENCE: 49 Asp Asp Asp Asp Llys 1. 5
<210s, SEQ ID NO 50 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PreScission (or 3C) cleavage site <4 OOs, SEQUENCE: 50 Lieu. Glu Val Lieu Phe Glin Gly Pro 1. 5
<210s, SEQ ID NO 51 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Linker
<4 OOs, SEQUENCE: 51 Gly Gly Gly Gly Ser Gly Gly Gly Ser 1. 5
<210s, SEQ ID NO 52 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Influenza A virus
<4 OOs, SEQUENCE: 52 Met Lys Thir Ile Ile Ala Leu Ser Tyr Ile Phe Cys Lieu Val Phe Ala 1. 5 1O 15
<210s, SEQ ID NO 53 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Flag epitope
<4 OOs, SEQUENCE: 53 US 2015/0376261 A1 Dec. 31, 2015 72
- Continued Asp Tyr Lys Asp Asp Asp Asp Ala 1. 5
<210s, SEQ ID NO 54 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TEV cleavage site <4 OOs, SEQUENCE: 54 Glu Asn Lieu. Tyr Phe Glin Gly Phe 1. 5
<210s, SEQ ID NO 55 &211s LENGTH: 413 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OO > SEQUENCE: 55 Met Gly Glin Pro Gly Asn Gly Ser Ala Phe Lieu. Lieu Ala Pro Asn Arg 1. 5 1O 15 Ser His Ala Pro Asp His Asp Val Thr Glin Glin Arg Asp Glu Val Trp 2O 25 3O Val Met Gly Met Gly Ile Val Met Ser Lieu. Ile Val Lieu Ala Ile Val 35 4 O 45 Phe Gly ASn Val Lieu Val Ile Thr Ala Ile Ala Llys Phe Glu Arg Lieu SO 55 6 O Gln Thr Val Thr Asn Tyr Phe Ile Thr Ser Leu Ala Cys Ala Asp Leu 65 70 7s 8O Val Met Gly Lieu Ala Val Val Pro Phe Gly Ala Ala His Ile Leu Met 85 90 95 Lys Met Trp Thr Phe Gly Asn Phe Trp Cys Glu Phe Trp Thr Ser Ile 1OO 105 11 O Asp Val Lieu. Cys Val Thr Ala Ser Ile Glu Thir Lieu. Cys Val Ile Ala 115 12 O 125 Val Asp Arg Tyr Phe Ala Ile Thr Ser Pro Phe Lys Tyr Glin Ser Leu 13 O 135 14 O Lieu. Thir Lys Asn Lys Ala Arg Val Ile Ile Lieu Met Val Trp Ile Val 145 150 155 160 Ser Gly Lieu. Thir Ser Phe Leu Pro Ile Glin Met His Trp Tyr Arg Ala 1.65 17O 17s Thir His Glin Glu Ala Ile Asn. Cys Tyr Ala Asn. Glu Thir Cys Cys Asp 18O 185 19 O Phe Phe Thr Asn Glin Ala Tyr Ala Ile Ala Ser Ser Ile Val Ser Phe 195 2OO 2O5
Tyr Val Pro Leu Val Ile Met Val Phe Val Tyr Ser Arg Val Phe Glin 21 O 215 22O
Glu Ala Lys Arg Glin Lieu Gln Lys Ile Asp Llys Ser Glu Gly Arg Phe 225 23 O 235 24 O
His Val Glin Asn Lieu. Ser Glin Val Glu Glin Asp Gly Arg Thr Gly. His 245 250 255 Gly Lieu. Arg Arg Ser Ser Llys Phe Cys Lieu Lys Glu. His Lys Ala Lieu. 26 O 265 27 O
Lys Thr Lieu. Gly Ile Ile Met Gly Thr Phe Thr Lieu. Cys Trp Leu Pro US 2015/0376261 A1 Dec. 31, 2015 73
- Continued
27s 28O 285 Phe Phe Ile Val Asn. Ile Val His Val Ile Glin Asp Asn Lieu. Ile Arg 29 O 295 3 OO Lys Glu Val Tyr Ile Lieu. Lieu. Asn Trp Ile Gly Tyr Val Asn. Ser Gly 3. OS 310 315 32O Phe Asin Pro Leu. Ile Tyr Cys Arg Ser Pro Asp Phe Arg Ile Ala Phe 3.25 330 335 Glin Glu Lieu. Lieu. Cys Lieu. Arg Arg Ser Ser Lieu Lys Ala Tyr Gly Asn 34 O 345 35. O Gly Tyr Ser Ser Asn Gly Asn Thr Gly Glu Gln Ser Gly Tyr His Val 355 360 365 Glu Glin Glu Lys Glu Asn Llys Lieu. Lieu. Cys Glu Asp Lieu Pro Gly. Thir 37 O 375 38O Glu Asp Phe Val Gly His Glin Gly Thr Val Pro Ser Asp Asn. Ile Asp 385 390 395 4 OO Ser Glin Gly Arg Asn. Cys Ser Thr Asn Asp Ser Lieu. Lieu. 4 OS 41O
<210s, SEQ ID NO 56 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer
<4 OOs, SEQUENCE: 56 gcggaatt.cg agct cqcc 18
<210s, SEQ ID NO 57 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer
<4 OO > SEQUENCE: 57 cctic cqc.cgg atcc.gc.cacc ticctic cactic togctic cc ctd to 42
<210s, SEQ ID NO 58 &211s LENGTH: 50 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer
<4 OOs, SEQUENCE: 58 ggcggat.ccg gC9gaggttc gCaggtgcag Ctgcaggagt Ctgggggagg SO
<210s, SEQ ID NO 59 &211s LENGTH: 54 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer
<4 OO > SEQUENCE: 59 tggaatticta gattagtgat ggtgatggtg gtgtgaggag acggtgacct gggit 54
<210s, SEQ ID NO 60 US 2015/0376261 A1 Dec. 31, 2015 74
- Continued
&211s LENGTH: 24 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Linker
<4 OOs, SEQUENCE: 60 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1. 5 1O 15 Gly Gly Gly Ser Gly Gly Gly Ser 2O
<210s, SEQ ID NO 61 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer
<4 OOs, SEQUENCE: 61 gCagat Ct c gtc.cgaag 18
<210s, SEQ ID NO 62 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Linker
<4 OOs, SEQUENCE: 62 ggggsggggs ggggsggggs ggggsggggs gggs 34
<210s, SEQ ID NO 63 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer
<4 OOs, SEQUENCE: 63 gatgttgcagc tigCaggagtic tigrggagg 29
<210s, SEQ ID NO 64 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer
<4 OOs, SEQUENCE: 64 ccacagacag ccct catag 19
1. A chimeric polypeptide comprising: 4. The chimeric polypeptide of claim 1, wherein the bind a G protein-coupled receptor (GPCR) fused to a binding ing domain is a conformation-selective binding domain. domain, 5. The chimeric polypeptide of claim 1, wherein the GPCR is stabilized in an active conformation upon binding of the wherein said binding domain is directed against and/or binding domain. able to specifically bind to the GPCR. 6. The chimeric polypeptide of claim 5, wherein the active 2. The chimeric polypeptide of claim 1, wherein the bind conformation is an agonist conformation, a partial agonist ing domain is not a naturally-occurring binding partner. conformation, or a biased agonist conformation. 3. The chimeric polypeptide of claim 2, wherein the bind 7. The chimeric polypeptide of claim 1, wherein the GPCR ing domain is fused to the GPCR either directly or through a is stabilized in an inactive conformation upon binding of the linker. binding domain. US 2015/0376261 A1 Dec. 31, 2015
8. The chimeric polypeptide of claim 7, wherein the inac 25. A membrane composition comprising the chimeric tive conformation is an inverse agonist conformation. polypeptide of claim 1. 9. The chimeric polypeptide of claim 1, wherein the GPCR 26. A method to produce a chimeric polypeptide compris has an increased affinity for a conformation-selective ligand ing a G protein-coupled receptor (GPCR) fused to a binding as compared to the corresponding non-fused GPCR. domain, the method comprising: 10. The chimeric polypeptide of claim 1, wherein the bind culturing the host cell of claim 23 under suitable condi ing domain binds to an intracellular epitope of the GPCR. tions. 11. The chimeric polypeptide of claim 10, wherein said 27. A method to display a G protein-coupled receptor intracellularenitnne is comnrised in a binding site for a down (GPCR) in an active or inactive conformation at the cellular stream signaling nrotein. Surface or in a particular cellular membrane fraction of a host 12. The chimeric polypeptide of claim 10, wherein said cell, the method comprising: intracellular epitope is comprised in the G protein binding culturing the host cell of claim 23 under suitable conditions site. to express the chimeric polypeptide. 13. The chimeric polypeptide of claim 1, wherein said 28. A method of identifying a conformation-selective com binding domain comprises: pound, the method comprising: a peptide that comprises four framework regions (FR1 to (i) providing the chimeric polypeptide of claim 1, and FR4) and three complementary determining regions (ii) providing a test compound, and (CDR1 to CDR3), or any suitable fragment thereof. (iii) evaluating selective binding of the test compound to 14. The chimeric polypeptide of claim 1, wherein the bind the GPCR comprised in the chimeric polypeptide. ing domain is an immunoglobulin single variable domain. 29. The method of claim 28, wherein the conformation 15. The chimeric polypeptide of claim 14, wherein the selective compound that is identified is an agonistic com immunoglobulin single variable domain is derived from a pound. heavy chain antibody. 30. A method of crystallizing and/or to solving the struc 16. The chimeric polypeptide of claim 14, wherein the ture of a G protein-coupled receptor (GPCR), the method immunoglobulin single variable domain comprises a VHH comprising: sequence or a NANOBODYR sequence. 17. The chimeric polypeptide of claim 1, wherein the utilizing the chimeric polypeptide of claim 1 to crystallize GPCR is a naturally occurring GPCR. and/or to solve the structure of the GPCR. 18. The chimeric polypeptide of claim 1, wherein the 31. A method of capturing a G protein-coupled receptor GPCR is a variant of a naturally occurring GPCR or a trun (GPCR) in a functional conformational state, the method cated form of a naturally occurring GPCR. comprising: 19. The chimeric polypeptide of claim 1, wherein the utilizing the chimeric polypeptide of claim 1 to capture the GPCR is selected from the group consisting of a GPCR of the GPCR in a functional conformational state. Glutamate family of GPCRs, a GPCR of the Rhodopsin fam 32. A kit comprising the chimeric polypeptide of claim 1. ily of GPCRs, a GPCR of the Adhesion family of GPCRs, a 33. A conformation-selective compound identified by the GPCR of the Frizzled/Taste2 family of GPCRs, and a GPCR method of claim 28. of the Secretin family of GPCRs. 34. The method according to claim 26, further comprising: 20. A complex comprising: isolating the chimeric polypeptide. the chimeric polypeptide of claim 1, and 35. A chimeric polypeptide comprising: a receptor ligand. a G protein-coupled receptor (GPCR) fused to 21. The chimeric polypeptide of claim 1, which is crystal line. a conformation-selective binding domain directed against 22. A nucleic acid molecule comprising: and/or able to specifically bind to the GPCR, a polynucleotide encoding the chimeric polypeptide of wherein the conformation-selective binding domain is not claim 1. a naturally-occurring binding partner of the GPCR and 23. A host cell comprising the nucleic acid molecule of wherein the GPCR is stabilized in an active conforma claim 22. tion upon binding to the conformation-selective binding 24. The host cell according to claim 23, which is a bacterial domain. cell, a yeast cell, a mammalian cell, or an insect cell.