DOCSLIB.ORG

WO 2017/205751 Al 30 November 2017 (30.11.2017) W !P O PCT

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2017/205751 Al 30 November 2017 (30.11.2017) W !P O PCT (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/205751 Al 30 November 2017 (30.11.2017) W !P O PCT (51) International Patent Classification: WHEELER, Christopher; c/o Provivi, Inc., 1701 Col A01M 29/12 (201 1.01) C12N 15/82 (2006.01) orado Avenue, Santa Monica, California 90404 (US). A I 27/00 (2006.01) C12P 19/34 (2006.01) (74) Agent: VEITENHEIMER, Erich et al. ; Cooley LLP, 1299 (21) International Application Number: Pennsylvania Avenue, N.W., Suite 700, Washington, Dis PCT/US20 17/034697 trict of Columbia 20004-2400 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 26 May 2017 (26.05.2017) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, (25) Filing Language: English CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (26) Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KH, KN, KP, KR, (30) Priority Data: KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, 62/342,807 27 May 2016 (27.05.2016) US MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (71) Applicant: PROVIVI, INC. [US/US]; 1701 Colorado Av PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, enue, Santa Monica, California 90404 (US). SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (72) Inventors: COELHO, Pedro; c/o Provivi, Inc., 1701 Colorado Avenue, Santa Monica, California 90404 (US). (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (54) Title: IMPROVED INSECT CONTROL STRATEGIES UTILIZING PHEROMONES AND RNAI CTAATACGACTCACTATAGGGCAAGCAGTGGTAACAACGCAGAGTACGCGG 1 GGTCATTTGCTTTCAAAAACCTTCGAGGGAGACCACGGAAGCACCAACTAC 102 AACCTTCCGTAGTTACTAGTAAAAGTGATCCGTACTTTATTTCACGTAAAC 153 GAAPiCTCAGTTAGCTGCTGAATTTATTTCGACGTGCAGATTTATAAAGTTC 2 0 4 GAAGGATC7iCAATGAA ?iCGAGCGCGTACAACGTGTACCTGGGAGTCGTGG 2 5 6 M K T S A Y N Y L G V V 1 3 CCGCCATGTTGGCTCTACTGTTCX?TCACAATTAATGCTGCGCCAATGGAGG 3 0 7 A A M L A L L F V T I N l M E 3 0 CGGACGATGACACGGCTGAGAACACCCTCGTGCCGCATCCCGATCGTGACA 3 5 8 A D D E T A E N T L V A H P D G D TGGAGCTCTCAGGCCCCTGGGATGCTATCAJiCACTGCCGCTCTAGGCAAAC 4 0 9 M E L 3 G P D A I N T A A L K _ 6 4 TGCTGCTGCAACTTGATGCAGAGGACAGGATGGGCGGGGTGACCCGCTCGT 4 6 0 L L L Q L D A E D R M G G V T R S 8 1 GGCCCCAAGCTGAGCCCCGCGGTTGGGGTCTGCGGGCGTTGGACAGCCGTC 5 1 1 W P Q A E P R G W G L R A L D S R 9 8 TGGCGCGGCAGTGGAGGGCAGACAAGCGGCAGGTGCGATTCCGCCAGTGCT 562 115 ACTTCAACCCAATTTCCTGCTTC CGCAAGTGAAAACAGCACCAACTCAtACG 6 1 3 1 2 5 ACGCATCGACCGTTTGACCTAGGGTAGCAAGAACG AATAAAACGTCGCCAT 6 6 4 AATCTCCCGAJXAAAAAAAAAAAAAAAAAAAAAAAAA' 3 6 9 9 FIG. 1 (57) Abstract: Systems and methods of preventing or reducing crop damage from pests are provided. In one embodiment, the method comprises: a) applying a mating disruption tactic to a field plot; and b) disrupting expression of one or more target genes in one or o more pests, wherein crop damage is reduced in the field plot. In another embodiment, the method comprises applying an attract-and-kill tactic to a field plot, wherein said attract-and-kill tactic comprises: a) applying one or more semiochemicals or factors; and b) disrupting expression of one or more target genes in one or more pests, wherein said disruption is capable of killing the one or more pests, wherein o crop damage is reduced in the field plot. o [Continued on nextpage] WO 2017/205751 Al Illlll II i ll lllll i ll llll III III i ll Hill lllll lllll lllll llll llll llll llll GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). Declarations under Rule 4.17: — as to applicant's entitlement to apply for and be granted a patent (Rule 4.1 7( )) Published: — with international search report (Art. 21(3)) — with sequence listing part of description (Rule 5.2(a)) IMPROVED INSECT CONTROL STRATEGIES UTILIZING PHEROMONES AND RNAI CROSS-REFERENCE T RELATED APPLICATIONS [0001] This application claims the benefit of priority to U.S. Provisional Application No. 62/342,807, filed May 27, 2016, which is herein incorporated by reference in its entirety. STATEMENT REGARDING SEQUENCE LISTING [0002] The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is PRVI-015_01WO_SeqList_ST25.txt. The text file is about 3.5 KB, was created on May 25, 2017, and is being submitted electronically via EFS-Web. FIELD OF THE INVENTION [0003] The present disclosure relates to improved systems and methods for controlling pests. n one embodiment, the method comprises: a) applying a mating disruption tactic to a field plot; and b) disrupting expression of one or more target genes in one or more pests, wherein crop damage is reduced in the field plot. In another embodiment, the method comprises applying an attract-and-kill tactic to a field plot, wherein said attract-and-kill tactic comprises: a) applying one or more semiochemicals or factors; and b) disrupting expression of one or more target genes in one or more pests, wherein said disruption is capable of killing the one or more pests, wherein crop damage is reduced in the field plot. BACKGROUND OF THE INVENTION [0004] About - 6 percent of global crop production is lost to pests such as fungi, bacteria, viruses, insects, nematodes, viroids and oomycetes. About 67,000 different crop pest species—including plant pathogens, weeds, invertebrates and some vertebrate species— together cause about a 40 percent reduction in the world's crop yield. For example, the cotton bollworm, Helicoverpa zea, infests roughly 70% of the 3,800,000 acres of cotton grown in the US each year. Helicoverpa zea, also known as the corn earworm, is the second most important economic pest species in North America. H . zea migrates seasonally, mostly at night, and can be carried downwind up to 400 km. Furthermore, a strong relationship exists between increased global temperatures over the past 50 years and the expansion of crop pests. [0005] Chemical pesticides have traditionally been used to control pests, but resistance of the pests to these chemicals has been increasing. More than 90 percent of the arthropod species with resistant populations are Diptera (35 percent), Lepidoptera (15 percent), Coleoptera (14 percent), Hemiptera (14 percent), or mites (14 percent). The heavy use of insecticides against disease-carrying mosquitoes has led to the disproportionately high number of resistant Diptera. Agricultural pests account for 59 percent of harmful resistant species, while medical and veterinary pests account for 4 1 percent. Statistical analyses suggest that for crop pests, resistance evolves most readily in those with an intermediate number of generations (four to ten) per year that feed either by chewing or by sucking on plant cell contents (Karaagac SU: Insecticide resistance. In: Insecticides - Advances in integrated Pest Management. Edited by Perveen F : In Tech; 2012:469-478). Additionally, broad-spectrum pesticides can adversely affect human health and the environment. T ey are often non-selective, harming beneficial organisms as well as pests. Thus there is a desire to employ safer and more environmentally friendly pest control techniques and lim iting the amount of chemical pesticides. [0006] Integrated pest management (IPM) considers all available pest control tactics and how these tactics fit with other agricultural practices to grow healthy crops and minimize the use of pesticides. The goal of IPM is to prevent pests from inflicting economic or aesthetic damage with the least risk to the environment. IPM involves the identification of pests, accurate measurement of pest populations, assessment of damage levels and knowledge of available pest management strategies or tactics that enable the specialist to make intelligent decisions about pest control . Pest control strategies can include chemical control; physical, mechanical and cultural controls; genetic control; and biological control. [0007] Synthetic chemical pesticides can include inorganic substances like arsenic- containing salts or synthetic organic compounds like organophosphates, carbamates, and triazines. Pesticides such as insecticides can be classified according to shared chemical structures and modes of action (MoA). MoA is the specific process by which an insecticide kills an insect, or inhibits its growth. A good cultural practice is to use insecticides having different MoAs to slow the rate at which insects develop resistance to any one class of chemical insecticides. [0008] Physical, mechanical and cultural controls include ecological landscaping to reduce field size and distance to habitats of natural enemies, erection of barriers, crop rotation, cover cropping, mechanical removal of pests (e.g., by hand or vacuums), improved crop residue management, better water management, and improved pest monitoring. [0009] Genetic control strategies take advantage of naturally resistant plant or crop varieties, new plant or crop varieties bred for resistance, or transgenic plant or crop varieties. Genetic control strategies can also encompass production and release of sterile pests to prevent reproduction.
Load more

Recommended publications
  • CHESTNUT (CASTANEA Spp.) CULTIVAR EVALUATION for COMMERCIAL CHESTNUT PRODUCTION
    CHESTNUT (CASTANEA spp.) CULTIVAR EVALUATION FOR COMMERCIAL CHESTNUT PRODUCTION IN HAMILTON COUNTY, TENNESSEE By Ana Maria Metaxas Approved: James Hill Craddock Jennifer Boyd Professor of Biological Sciences Assistant Professor of Biological and Environmental Sciences (Director of Thesis) (Committee Member) Gregory Reighard Jeffery Elwell Professor of Horticulture Dean, College of Arts and Sciences (Committee Member) A. Jerald Ainsworth Dean of the Graduate School CHESTNUT (CASTANEA spp.) CULTIVAR EVALUATION FOR COMMERCIAL CHESTNUT PRODUCTION IN HAMILTON COUNTY, TENNESSEE by Ana Maria Metaxas A Thesis Submitted to the Faculty of the University of Tennessee at Chattanooga in Partial Fulfillment of the Requirements for the Degree of Master of Science in Environmental Science May 2013 ii ABSTRACT Chestnut cultivars were evaluated for their commercial applicability under the environmental conditions in Hamilton County, TN at 35°13ꞌ 45ꞌꞌ N 85° 00ꞌ 03.97ꞌꞌ W elevation 230 meters. In 2003 and 2004, 534 trees were planted, representing 64 different cultivars, varieties, and species. Twenty trees from each of 20 different cultivars were planted as five-tree plots in a randomized complete block design in four blocks of 100 trees each, amounting to 400 trees. The remaining 44 chestnut cultivars, varieties, and species served as a germplasm collection. These were planted in guard rows surrounding the four blocks in completely randomized, single-tree plots. In the analysis, we investigated our collection predominantly with the aim to: 1) discover the degree of acclimation of grower- recommended cultivars to southeastern Tennessee climatic conditions and 2) ascertain the cultivars’ ability to survive in the area with Cryphonectria parasitica and other chestnut diseases and pests present.
    [Show full text]
  • 1 1 DNA Barcodes Reveal Deeply Neglected Diversity and Numerous
    Page 1 of 57 1 DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in 2 Madagascar 3 4 5 Carlos Lopez-Vaamonde1,2, Lucas Sire2, Bruno Rasmussen2, Rodolphe Rougerie3, 6 Christian Wieser4, Allaoui Ahamadi Allaoui 5, Joël Minet3, Jeremy R. deWaard6, Thibaud 7 Decaëns7, David C. Lees8 8 9 1 INRA, UR633, Zoologie Forestière, F- 45075 Orléans, France. 10 2 Institut de Recherche sur la Biologie de l’Insecte, UMR 7261 CNRS Université de Tours, UFR 11 Sciences et Techniques, Tours, France. 12 3Institut de Systématique Evolution Biodiversité (ISYEB), Muséum national d'Histoire naturelle, 13 CNRS, Sorbonne Université, EPHE, 57 rue Cuvier, CP 50, 75005 Paris, France. 14 4 Landesmuseum für Kärnten, Abteilung Zoologie, Museumgasse 2, 9020 Klagenfurt, Austria 15 5 Department of Entomology, University of Antananarivo, Antananarivo 101, Madagascar 16 6 Centre for Biodiversity Genomics, University of Guelph, 50 Stone Road E., Guelph, ON 17 N1G2W1, Canada 18 7Centre d'Ecologie Fonctionnelle et Evolutive (CEFE UMR 5175, CNRS–Université de Genome Downloaded from www.nrcresearchpress.com by UNIV GUELPH on 10/03/18 19 Montpellier–Université Paul-Valéry Montpellier–EPHE), 1919 Route de Mende, F-34293 20 Montpellier, France. 21 8Department of Life Sciences, Natural History Museum, Cromwell Road, SW7 5BD, UK. 22 23 24 Email for correspondence: [email protected] For personal use only. This Just-IN manuscript is the accepted prior to copy editing and page composition. It may differ from final official version of record. 1 Page 2 of 57 25 26 Abstract 27 Madagascar is a prime evolutionary hotspot globally, but its unique biodiversity is under threat, 28 essentially from anthropogenic disturbance.
    [Show full text]
  • DNA Barcodes Reveal Deeply Neglected Diversity and Numerous Invasions of Micromoths in Madagascar
    Genome DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in Madagascar Journal: Genome Manuscript ID gen-2018-0065.R2 Manuscript Type: Article Date Submitted by the 17-Jul-2018 Author: Complete List of Authors: Lopez-Vaamonde, Carlos; Institut National de la Recherche Agronomique (INRA), ; Institut de Recherche sur la Biologie de l’Insecte (IRBI), Sire, Lucas; Institut de Recherche sur la Biologie de l’Insecte Rasmussen,Draft Bruno; Institut de Recherche sur la Biologie de l’Insecte Rougerie, Rodolphe; Institut Systématique, Evolution, Biodiversité (ISYEB), Wieser, Christian; Landesmuseum für Kärnten Ahamadi, Allaoui; University of Antananarivo, Department Entomology Minet, Joël; Institut de Systematique Evolution Biodiversite deWaard, Jeremy; Biodiversity Institute of Ontario, University of Guelph, Decaëns, Thibaud; Centre d'Ecologie Fonctionnelle et Evolutive (CEFE UMR 5175, CNRS–Université de Montpellier–Université Paul-Valéry Montpellier–EPHE), , CEFE UMR 5175 CNRS Lees, David; Natural History Museum London Keyword: Africa, invasive alien species, Lepidoptera, Malaise trap, plant pests Is the invited manuscript for consideration in a Special 7th International Barcode of Life Issue? : https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 57 Genome 1 DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in 2 Madagascar 3 4 5 Carlos Lopez-Vaamonde1,2, Lucas Sire2, Bruno Rasmussen2, Rodolphe Rougerie3, 6 Christian Wieser4, Allaoui Ahamadi Allaoui 5, Joël Minet3, Jeremy R. deWaard6, Thibaud 7 Decaëns7, David C. Lees8 8 9 1 INRA, UR633, Zoologie Forestière, F- 45075 Orléans, France. 10 2 Institut de Recherche sur la Biologie de l’Insecte, UMR 7261 CNRS Université de Tours, UFR 11 Sciences et Techniques, Tours, France.
    [Show full text]
  • ON CRYPTOBLABES GNIDIELLA and ALIENA1 (Lepidoptera : Pyralidae : Phycitinae)
    Pacific Insects 14 (2) : 433 20 August 1972 ON CRYPTOBLABES GNIDIELLA AND ALIENA1 (Lepidoptera : Pyralidae : Phycitinae) By Elwood C. Zimmerman2 In Insects of Hawaii 8 : 363, 1958, I wrote that Cryptoblabes aliena Swezey is an "Im­ migrant, but source not determined. First noticed in Hawaii by Swezey in 1905." The problem of the source of the moth in Hawaii is solved by the following synonymy and details : Cryptoblabes gnidiella (Milliere). Ephestia Gnidiella Milliere, Iconographie et Description de chenilles et LSpidopteres inSdits 2: 308, pl. 83, figs. 4-9, 1867 (sometimes wrongly cited as 1864, which is the date on the title page but which applies only to part of the work). Cryptoblabes gnidiella (Milliere) Ragonot, Monographie des Phycitinae et des Galleriinae. In: N. M. Romanoff's Memoires sur les LSpidopteres 7 : 16, 1893. Heinrich, Proc. U. S. Nat. Mus. 207: 10, figs. 1, 132, 639, 1956. Cryptoblabes aliena Swezey, Hawaiian Sugar Planters' Assoc. Exp. Sta., Ent. Bull. 6: 24, pl. 4, figs. 4-7, 1909. Zimmerman, Insects of Hawaii 8: 360, figs. 298-300, 1958. New synonym. Cryptoblabes gnidiella was described from France, and it is now widely dispersed about the warmer parts of the world. It has been reported from Eurasia, Africa, Malaysia and America, whence it was first recorded by Dyar in 1915 (Insecutor Inscitiae Menstruus 3 : 88) from specimens collected in Bermuda. My manuscript for the pyralid volume of Insects of Hawaii was mostly written before the appearance of Heinrich's 1956 monograph, and although I added various details from his publication before my book was published, the fact that Heinrich (p.
    [Show full text]
  • Lepidoptera of North America 5
    Lepidoptera of North America 5. Contributions to the Knowledge of Southern West Virginia Lepidoptera Contributions of the C.P. Gillette Museum of Arthropod Diversity Colorado State University Lepidoptera of North America 5. Contributions to the Knowledge of Southern West Virginia Lepidoptera by Valerio Albu, 1411 E. Sweetbriar Drive Fresno, CA 93720 and Eric Metzler, 1241 Kildale Square North Columbus, OH 43229 April 30, 2004 Contributions of the C.P. Gillette Museum of Arthropod Diversity Colorado State University Cover illustration: Blueberry Sphinx (Paonias astylus (Drury)], an eastern endemic. Photo by Valeriu Albu. ISBN 1084-8819 This publication and others in the series may be ordered from the C.P. Gillette Museum of Arthropod Diversity, Department of Bioagricultural Sciences and Pest Management Colorado State University, Fort Collins, CO 80523 Abstract A list of 1531 species ofLepidoptera is presented, collected over 15 years (1988 to 2002), in eleven southern West Virginia counties. A variety of collecting methods was used, including netting, light attracting, light trapping and pheromone trapping. The specimens were identified by the currently available pictorial sources and determination keys. Many were also sent to specialists for confirmation or identification. The majority of the data was from Kanawha County, reflecting the area of more intensive sampling effort by the senior author. This imbalance of data between Kanawha County and other counties should even out with further sampling of the area. Key Words: Appalachian Mountains,
    [Show full text]
  • Historical Perspectives on Apple Production: Fruit Tree Pest Management, Regulation and New Insecticidal Chemistries
    Historical Perspectives on Apple Production: Fruit Tree Pest Management, Regulation and New Insecticidal Chemistries. Peter Jentsch Extension Associate Department of Entomology Cornell University's Hudson Valley Lab 3357 Rt. 9W; PO box 727 Highland, NY 12528 email: [email protected] Phone 845-691-7151 Mobile: 845-417-7465 http://www.nysaes.cornell.edu/ent/faculty/jentsch/ 2 Historical Perspectives on Fruit Production: Fruit Tree Pest Management, Regulation and New Chemistries. by Peter Jentsch I. Historical Use of Pesticides in Apple Production Overview of Apple Production and Pest Management Prior to 1940 Synthetic Pesticide Development and Use II. Influences Changing the Pest Management Profile in Apple Production Chemical Residues in Early Insect Management Historical Chemical Regulation Recent Regulation Developments Changing Pest Management Food Quality Protection Act of 1996 The Science Behind The Methodology Pesticide Revisions – Requirements For New Registrations III. Resistance of Insect Pests to Insecticides Resistance Pest Management Strategies IV. Reduced Risk Chemistries: New Modes of Action and the Insecticide Treadmill Fermentation Microbial Products Bt’s, Abamectins, Spinosads Juvenile Hormone Analogs Formamidines, Juvenile Hormone Analogs And Mimics Insect Growth Regulators Azadirachtin, Thiadiazine Neonicotinyls Major Reduced Risk Materials: Carboxamides, Carboxylic Acid Esters, Granulosis Viruses, Diphenyloxazolines, Insecticidal Soaps, Benzoyl Urea Growth Regulators, Tetronic Acids, Oxadiazenes , Particle Films, Phenoxypyrazoles, Pyridazinones, Spinosads, Tetrazines , Organotins, Quinolines. 3 I Historical Use of Pesticides in Apple Production Overview of Apple Production and Pest Management Prior to 1940 The apple has a rather ominous origin. Its inception is framed in the biblical text regarding the genesis of mankind. The backdrop appears to be the turbulent setting of what many scholars believe to be present day Iraq.
    [Show full text]
  • GIS Handbook Appendices
    Aerial Survey GIS Handbook Appendix D Revised 11/19/2007 Appendix D Cooperating Agency Codes The following table lists the aerial survey cooperating agencies and codes to be used in the agency1, agency2, agency3 fields of the flown/not flown coverages. The contents of this list is available in digital form (.dbf) at the following website: http://www.fs.fed.us/foresthealth/publications/id/id_guidelines.html 28 Aerial Survey GIS Handbook Appendix D Revised 11/19/2007 Code Agency Name AFC Alabama Forestry Commission ADNR Alaska Department of Natural Resources AZFH Arizona Forest Health Program, University of Arizona AZS Arizona State Land Department ARFC Arkansas Forestry Commission CDF California Department of Forestry CSFS Colorado State Forest Service CTAES Connecticut Agricultural Experiment Station DEDA Delaware Department of Agriculture FDOF Florida Division of Forestry FTA Fort Apache Indian Reservation GFC Georgia Forestry Commission HOA Hopi Indian Reservation IDL Idaho Department of Lands INDNR Indiana Department of Natural Resources IADNR Iowa Department of Natural Resources KDF Kentucky Division of Forestry LDAF Louisiana Department of Agriculture and Forestry MEFS Maine Forest Service MDDA Maryland Department of Agriculture MADCR Massachusetts Department of Conservation and Recreation MIDNR Michigan Department of Natural Resources MNDNR Minnesota Department of Natural Resources MFC Mississippi Forestry Commission MODC Missouri Department of Conservation NAO Navajo Area Indian Reservation NDCNR Nevada Department of Conservation
    [Show full text]
  • Jordan Beans RA RMO Dir
    Importation of Fresh Beans (Phaseolus vulgaris L.), Shelled or in Pods, from Jordan into the Continental United States A Qualitative, Pathway-Initiated Risk Assessment February 14, 2011 Version 2 Agency Contact: Plant Epidemiology and Risk Analysis Laboratory Center for Plant Health Science and Technology United States Department of Agriculture Animal and Plant Health Inspection Service Plant Protection and Quarantine 1730 Varsity Drive, Suite 300 Raleigh, NC 27606 Pest Risk Assessment for Beans from Jordan Executive Summary In this risk assessment we examined the risks associated with the importation of fresh beans (Phaseolus vulgaris L.), in pods (French, green, snap, and string beans) or shelled, from the Kingdom of Jordan into the continental United States. We developed a list of pests associated with beans (in any country) that occur in Jordan on any host based on scientific literature, previous commodity risk assessments, records of intercepted pests at ports-of-entry, and information from experts on bean production. This is a qualitative risk assessment, as we express estimates of risk in descriptive terms (High, Medium, and Low) rather than numerically in probabilities or frequencies. We identified seven quarantine pests likely to follow the pathway of introduction. We estimated Consequences of Introduction by assessing five elements that reflect the biology and ecology of the pests: climate-host interaction, host range, dispersal potential, economic impact, and environmental impact. We estimated Likelihood of Introduction values by considering both the quantity of the commodity imported annually and the potential for pest introduction and establishment. We summed the Consequences of Introduction and Likelihood of Introduction values to estimate overall Pest Risk Potentials, which describe risk in the absence of mitigation.
    [Show full text]
  • Bionomics of Bagworms (Lepidoptera: Psychidae)
    ANRV363-EN54-11 ARI 27 August 2008 20:44 V I E E W R S I E N C N A D V A Bionomics of Bagworms ∗ (Lepidoptera: Psychidae) Marc Rhainds,1 Donald R. Davis,2 and Peter W. Price3 1Department of Entomology, Purdue University, West Lafayette, Indiana, 47901; email: [email protected] 2Department of Entomology, Smithsonian Institution, Washington D.C., 20013-7012; email: [email protected] 3Department of Biological Sciences, Northern Arizona University, Flagstaff, Arizona, 86011-5640; email: [email protected] Annu. Rev. Entomol. 2009. 54:209–26 Key Words The Annual Review of Entomology is online at bottom-up effects, flightlessness, mating failure, parthenogeny, ento.annualreviews.org phylogenetic constraint hypothesis, protogyny This article’s doi: 10.1146/annurev.ento.54.110807.090448 Abstract Copyright c 2009 by Annual Reviews. The bagworm family (Lepidoptera: Psychidae) includes approximately All rights reserved 1000 species, all of which complete larval development within a self- 0066-4170/09/0107-0209$20.00 enclosing bag. The family is remarkable in that female aptery occurs in ∗The U.S. Government has the right to retain a over half of the known species and within 9 of the 10 currently recog- nonexclusive, royalty-free license in and to any nized subfamilies. In the more derived subfamilies, several life-history copyright covering this paper. traits are associated with eruptive population dynamics, e.g., neoteny of females, high fecundity, dispersal on silken threads, and high level of polyphagy. Other salient features shared by many species include a short embryonic period, developmental synchrony, sexual segrega- tion of pupation sites, short longevity of adults, male-biased sex ratio, sexual dimorphism, protogyny, parthenogenesis, and oviposition in the pupal case.
    [Show full text]
  • British Lepidoptera (/)
    British Lepidoptera (/) Home (/) Anatomy (/anatomy.html) FAMILIES 1 (/families-1.html) GELECHIOIDEA (/gelechioidea.html) FAMILIES 3 (/families-3.html) FAMILIES 4 (/families-4.html) NOCTUOIDEA (/noctuoidea.html) BLOG (/blog.html) Glossary (/glossary.html) FAMILY: YPONOMEUTIDAE (8G +1EX 22S +2EX) Suborder:Glossata Infraorder:Heteroneura, Superfamily:Yponomeutoidea MBGBI3 includes families Ypsolophidae, Plutellidae, Argyresthiidae, Praydidae and Scythropiidae as subfmailies (Ypsolophinae, Plutellinae, Argyresthiinae, Praydinae and Scythropiinae) of Yponomeutidae. MBGBI3 also lists Acrolepiinae a subfamily of Yponomeutidae, it is now considered a subfamily of Glyphipterigidae. The remaining Family: Yponomeutidae is equivalent to Subfamily: Yponomeutinae as considered in MBGBI3. Abdominal tergites spined Uncus present, with a pair of prongs Aedeagus usually with a sheath Larvae are mostly web-spinners Yponomeuta (8S) Head smooth or rough-scaled, frons smooth Proboscis developed Antenna ¾ length of forewing; simple at base, weakly serrate beyond basal quarter, minutely ciliate; scape with or without pecten Labial palp moderate, curved, ascending; S2 somewhat rough ventrally; S3 =/> S2 Forewing broad, discal cell long, almost reaching 5/6; white or whitish with longitudinal rows of black spots Hindwing as long as forewing, elongate-ovate; hyaline space between cell and base (/001-yponomeuta-evonymella-bird-cherry-ermine.html) (/002-yponomeuta-padella-orchard-ermine.html) (/003-yponomeuta-malinellus-apple-ermine.html) (/004-yponomeuta-cagnagella-spindle-ermine.html)
    [Show full text]
  • Bioblitz! OK 2019 - Cherokee County Moth List
    BioBlitz! OK 2019 - Cherokee County Moth List Sort Family Species 00366 Tineidae Acrolophus mortipennella 00372 Tineidae Acrolophus plumifrontella Eastern Grass Tubeworm Moth 00373 Tineidae Acrolophus popeanella 00383 Tineidae Acrolophus texanella 00457 Psychidae Thyridopteryx ephemeraeformis Evergreen Bagworm Moth 01011 Oecophoridae Antaeotricha schlaegeri Schlaeger's Fruitworm 01014 Oecophoridae Antaeotricha leucillana 02047 Gelechiidae Keiferia lycopersicella Tomato Pinworm 02204 Gelechiidae Fascista cercerisella 02301.2 Gelechiidae Dichomeris isa 02401 Yponomeutidae Atteva aurea 02401 Yponomeutidae Atteva aurea Ailanthus Webworm Moth 02583 Sesiidae Synanthedon exitiosa 02691 Cossidae Fania nanus 02694 Cossidae Prionoxystus macmurtrei Little Carpenterworm Moth 02837 Tortricidae Olethreutes astrologana The Astrologer 03172 Tortricidae Epiblema strenuana 03202 Tortricidae Epiblema otiosana 03494 Tortricidae Cydia latiferreanus Filbert Worm 03573 Tortricidae Decodes basiplaganus 03632 Tortricidae Choristoneura fractittana 03635 Tortricidae Choristoneura rosaceana Oblique-banded Leafroller moth 03688 Tortricidae Clepsis peritana 03695 Tortricidae Sparganothis sulfureana Sparganothis Fruitworm Moth 03732 Tortricidae Platynota flavedana 03768.99 Tortricidae Cochylis ringsi 04639 Zygaenidae Pyromorpha dimidiata Orange-patched Smoky Moth 04644 Megalopygidae Lagoa crispata Black Waved Flannel Moth 04647 Megalopygidae Megalopyge opercularis 04665 Limacodidae Lithacodes fasciola 04677 Limacodidae Phobetron pithecium Hag Moth 04691 Limacodidae
    [Show full text]
  • FURY 10 EW Active Substance: Zeta-Cypermethrin 100 G/L COUNTRY
    Part A Product name Registration Report –Central Zone National Assessment - FURY 10 EW Page 1 of 27 Federal Republic of Germany 024222-00/01 REGISTRATION REPORT Part A Risk Management Product name: FURY 10 EW Active Substance: zeta-cypermethrin 100 g/L COUNTRY: Germany Central Zone Zonal Rapporteur Member State: Germany NATIONAL ASSESSMENT Applicant: Cheminova Deutschland GmbH & Co. KG Submission Date: 02/01/2014 Date: 17/08/2018 Applicant (Cheminova Deutschland GmbH) Evaluator BVL / DE Date: 17/09/ 2018 Part A Product name Registration Report –Central Zone National Assessment - FURY 10 EW Page 2 of 27 Federal Republic of Germany 024222-00/01 Table of Contents PART A – Risk Management 4 1 Details of the application 4 1.1 Application background 4 1.2 Annex I inclusion 4 1.3 Regulatory approach 5 2 Details of the authorisation 6 2.1 Product identity 6 2.2 Classification and labelling 6 2.3.2.2 Specific restrictions linked to the intended uses 9 2.3 Product uses 10 3 Risk management 12 3.1 Reasoned statement of the overall conclusions taken in accordance with the Uniform Principles 12 3.1.1 Physical and chemical properties (Part B, Section 1, Points 2 and 4) 12 3.1.2 Methods of analysis (Part B, Section 2, Point 5) 12 3.1.2.1 Analytical method for the formulation (Part B, Section 2, Point 5.2) 12 3.1.2.2 Analytical methods for residues (Part B, Section 2, Points 5.3 – 5.8) 12 3.1.3 Mammalian Toxicology (Part B, Section 3, Point 7) 12 The PPP is already registered in Germany according to Regulation (EU) No 1107/2009.
    [Show full text]